Proc. Natl. Acad. Sci. USAVol. 86, pp. 938-942, February 1989Developmental Biology

Growing and developing Dictyostelium cells express differentras genes

(conserved proteins/dIfferential nucleic acid hybridization/gene families)

STEPHEN M. ROBBINS*, JEFFREY G. WILLIAMSt, KEITH A. JERMYNt, GEORGE B. SPIEGELMAN*t,AND GERALD WEEKS*t§Departments of *Microbiology and tMedical Genetics, University of British Columbia, Vancouver, BC, Canada V6T 1W5; and tThe Imperial Cancer ResearchFund, Clare Hall Laboratories, South Mimms, Potter's Bar, Hertfordshire, England EN6 3LD

Communicated by J. T. Bonner, September 26, 1988

ABSTRACT The expression of ras-related protein in thecellular slime mold Dictyostelium discoideum is developmen-tally regulated. It was previously reported that Dictyosteliumpossesses a single ras gene (Ddras) that is maximally expressedduring the pseudoplasmodial stage of development. We haveisolated a series ofcDNA clones derived from a second ras gene,DdrasG. It encodes a protein that is very similar to the proteinencoded by Ddras, but In contrast to Ddras, DdrasG is onlyexpressed during growth and early development. Althoughother eukaryotic organisms possess more than one ras gene,Dictyostelium is thus far unique in expressing different ras genesat different stages of development. In Dictyostelium the two rasproteins may fulfill different functions, with the DdrasGprotein playing a role during cell growth and the Ddras proteinplaying a role in signal transduction during multicellulardevelopment.

ras genes and their encoded products have widespreadoccurrence in eukaryotic organisms (1). The ras proteins bindguanine nucleotides (2), exhibit GTPase activity (3), and thusresemble the G proteins, which are involved in mediatingsignal transduction in a variety of systems (4). In yeast, rasproteins act as regulators of adenylate cyclase (5), while inmammalian cells and in Dictyostelium discoideum theypossibly act as regulators of inositol phospholipid breakdown(6-9). ras genes are expressed in both proliferative as well asdifferentiated mammalian cell types (10-12).Development in Dictyostelium is unusual in t14t growth

and cellular differentiation are clearly separated processes.Dictyostelium was previously shown to contain a single rasgene (Ddras) that was maximally expressed during develop-ment after formation of the multicellular aggregate (13) and amissense mutation at residue Gly-12 disrupted normal devel-opment (14, 15). However, maximum rates of ras-relatedprotein synthesis were detected in vegetative and earlydeveloping cells when the ras-specific monoclonal antibodyY13-259 was used to immunoprecipitate ras protein (16-18).

In this report, we show that contrary to previous studies D.discoideum possesses at least one additional ras gene,DdrasG.t It is highly conserved relative to Ddras but is onlyexpressed during growth and early development. The possi-bility that the two proteins may fulfill different functionsduring growth and differentiation is discussed.

MATERIALS AND METHODS

Isolation and Sequencing of the DdrasG cDNA Clones. Avegetative AgtlO cDNA library prepared from mRNA iso-lated from growing cells ofD. discoideum, kindly donated by

S. Rosejohn and W. Rowekamp Deutsches Krebsforschung/Zentrum Institut fur Zellforschung, Heidelberg, was platedand blotted onto nitrocellulose filters as described by Mani-atis et al. (19). The filters were prehybridized at 370C in 30%formamide/5 x Denhardt's solution (1lx Denhardt's solutionis 0.02% Ficoll/0.02% bovine serum albumin/0.02% poly-vinylpyrrolidone)/5x SSC (lx SSC is 0.15 M NaCI/0.015 Msodium citrate)/20 mM sodium phosphate buffer; pJ6.5/sonicated salmon sperm DNA (250 gg/ml)/0.5% 9Sand then probed by the addition of Ddrascl that had beenlabeled by the mixed oligonucleotide method (20). Filterswere washed twice (30% formamide/3 x SSC/0.1% SDS at37°C) and then exposed against x-ray film for 24 hr. The filterswere then washed under higher-stringency conditions (40%formamide/2 x SSC/0.1% SDS at 37°C) and reexposed tox-ray film. Plaques that hybridized after the initial wash butshowed reduced hybridization following the second higher-stringency wash were selected and plaque purified. ThreecDNA clones (DdrasG-c3, DdrasG-cll, DdrasG-c23) wereselected for further study.DNA was isolated from liquid lysates (21) of the three

recombinant phages, subcloned into M13mp18 and M13mp19(22), and single-stranded DNA was sequenced by the chain-termination method (23). The sequencing strategy for DdrasGis depicted in Fig. 1. Some sequences were confirmed byusing a synthetic primer complementary to a 20-nucleotideoverlapping region of DdrasG-c3 and DdrasG-c11.

Isolation of DNA and RNA. The Ax-2 strain of D. discoi-deum was grown in rich nutrient medium to stationary phaseand then harvested by centrifugation at 700 x g as described(24). The nuclei were isolated as described by Cocucci andSussman (25) and the genomic DNA was extracted (19).D. discoideum strain V12-M2 was grown on nutrient agar

plates in association with Enterobacter aerogenes (26).Differentiation was induced by separating the vegetativeamebae from the bacteria by four low-speed centrifugations(700 x g for 2 min) and plating 108 cells on Millipore filtersresting on support pads saturated with phosphate buffer (26).Total cytoplasmic RNA from various stages of developmentwas isolated (27) and subsequent isolation of polyadenylyl-ated RNA was performed by oligo[d(T)]-cellulose chroma-tography (28).

Southern and Northern Blot Analyses. For Southern blotW,genomic DNA was digested with various restriction enzymes(Bethesda Research Laboratories), size fractionated on aga-rose gels, and then transferred to nitrocellulose. The filterswere prehybridized for 2-4 hr by diing the ptehybridiza ionbuffer conditions described under clone isolation and thenthey were hybridized in a solution cdntaining 30% forniali-

§To whom reprint requests should be addressed.$The sequence reported in this pdper is being deposited in theEMBL/GenBank data base (accession no. J04160).

938

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Mar

ch 2

9, 2

021

Proc. Natl. Acad. Sci. USA 86 (1989) 939

DdrasG-c3a

- . DdrasG

DdrasG

100 bps

FIG. 1. Sequencing strategy. DdrasG was sequenindependent cDNA clones, DdrasG-c3, DdrasG-cllc23. DdrasG-c3a is a subcjoned fragment of DdrasCi-c:cleavage at a HindIII restriction site. Arrowed fin(direction and length ofthe portions ofeach clone that XHatched bar represents the entire coding sequence oregion complementary to the synthetic oligonucleotidwas used for confirmation of the nucleotide sequencean asterisk.

ide/Sx SSC/1 x Denhardt's solution/20 mM pifer, pH 6.5/0.5% SDS/salmon sperm DNA 4randomly primed DNA insert (10 cpm/ml) (20were incubated at 370C for 16 hr and then wash

(30 min per wash) in 2x SSC/0.1% SDS at 500C to providelow-stringency conditions. After the filters were exposed to

DdrasG-c3 x-ray film, they were washed twice in O.lx SSC/0.1% SDSat 650C to provide high-stringency conditions and were thenreexposed to x-ray film.RNA samples for Northern blot analysis were adjusted to

50% formamide/40 mM 3-(N-morpholino)propanesulfonicacid, pH 7.0/10 mM sodium acetate/1 mM EDTA/6%

c11 formaldehyde, heat denatured for 10 min at 650C, and thensize fractionated on 1.25% formaldehyde-agarose gels (29).

a-c23 The gels were partially hydrolyzed (19) and then transferredto nitrocellulose. The filters were prehybridized and hybrid-ized as for the Southern blots, except that the buffers alsocontained polyAdeny!ic acid (30 gg/ml). The filters were thenwashed under the same conditions used for the high-

lced. using three stringency Southern blots.L and DdrasG-3 obtained afteres indicate the RESULTS AND DISCUSSIONwas sequenced.of qdrasG. The Three DdrasG cDNA clones were isolated from a cDNAle (3fmer) that clone bank prepared with mRNA isolated from growing cellsis miarked with and screened wftf- the insert from the Ddrascl cDNA clone

as a probe (13). Sequence analysis revealed that all threeclones were derived from the same gene and the strategy used

hosphate buf- to derive the sequence of the entire gene is shown in Fig. 1.(100 Zg/ml)/ Clone DdrasG-c3 contains the entire coding region (Fig. 1).)). Ttie filters The nucleotide sequence of the coding region of DdrasG isled two times shown in Fig. 2, along with the previously published com-

DdrasG ATGACAGAATACAAATTAGTTATTGTTGGTGGTGGTGGTGTCGGTAAAAGTGCCTTAACC 60* * * * *

Ddras ATGACAGAATATAAATTAGTTATTGTAGGTGGTGGTGGTGTTGGTAAAAGTGCATTAACA 60

DdrasG ATTCAATTAATCCAAAACCATTTCATTGATGAATACGATCCAACTATCGAAGATTCATAC 120* * * * * * *** *

Ddras ATTCAATTAATTCAAAATCATTTTATTGATGAATATGATCCAACAATTGAAGATAGTTAT 120

DdrasG AGAAAACAAGTTACCATTGATGAAGAAACTTGTTTATTAGATATTTTAGATACTGCTGGT 180*D **C* * *

Ddras CGTAAACAAGTTTCAATPGATGATGAAACTTGTTTATTAGATATTTTAGATACTGCAGGT 180

DdrasG CAAGAGGAATACTCTGCAATGAGAGACCAAATATGA1GAACGGlTLAAGlGTTTCCT-UGlT***asCA* * ** *

Ddras CAAGAGGAATATAGTGCAATGAGAGATCAATATATGAGAACTGGTCAAGGATTTTTATGT

240

240

DdrasG GTCTACTCTATCACTTCAAGATCATCATTTGATGAAATTGCATCATTCCGTGAACAAATT 300* * * * * * *

Ddras GTTTATTCAATTACATCAAGATCATCATATGATGAAATTGCATCATTTAGAGAACAAATT 300

DdrasG CTTAGAGTTAAGGATAAGGATAGAGTACCAATGATTGTCGTTGGTAACAAATGCGATTTG 360* * * * * * * * ***

Ddras CTAAGAGTTAAAGACAAAGATAGAGTACCATTGATTTTGGTTGGTAATAAAGCAGATTTG 360

Ddra.sG GAATCTGATCGTCAAGTCACAACTGGTGAAGGTCAAGATTTAGCAAAATCCTTCGGTAGT 420*** * * ******* ** * **** ********

Ddras GATCATGAACGTCAAGTTAGTGTAAATGAAGGTCAAGAACTTGCAAAGGATTCATTGTCC 420

DdrasG

Ddras

CCATTCCTTGAAACCTCTGCCAAGATTCGTGTCAACGTTGAGGAAGCTTTCTATTCACTC 480* ***T* * * **A*** * * * * * * **4*

---TTTCATGAGTCATCTGCTAAAAGTAGAATTAATGTTGAAGAGGCATTTTACTCTTTA 477

DdragG GTACGTGAAATCAGAAAAGACCTCAAGGGTGACTCTAAACCAGAAAAAGGCAAGAAGAAG 540* * * * * ***** *** ** *** * *

Ddras GTTCGTGAAATTAGAAAAGAACTAAAAGGTGATCAATCAAGTGGCAAAGCTCAAAAAAAG 537

DdrasG AGACCATTAAAAGCTTGTACTCTTTTATAA* ** ** ****

Ddras AAAAAACAA----TGTTTAATmTTATAA

570

561

Fi. 2. Nucleotide sequence of the coding region ofDdrasG and comparison with that previously published for Ddras (13). The nucleotidesare n4mbered relative to the start ofthe coding sequence. Differences in nucleotides between the two genes are denoted with an asterisk. Spaceshave beer} introduced into the Ddras sequence to maximize alignment.

,____,____rswrzrzrs

Developmental Biology: Robbins et al.

Dow

nloa

ded

by g

uest

on

Mar

ch 2

9, 2

021

940 Developmental Biology: Robbihs et al.

parable sequence for Ddras (13). There are numerous nucle-otide differences along the entire length of the gene, qsuggest-ing ihat the two cDNAs are not derived from the differentialsplicing of a single ras gene. The predicted sequence of thecognate protein is presented in Fig. 3 and compared to thatof other ras proteins. The protein encoded by DdrasG is 82%

DdG M T E Y K L VDdx - - - - - - -c-ki-=2 -c-Ha-ZAA-----c-N-xia ___

Yel ...IR---I-YetaL2 ...IR - - -

40.S Y R K Q V T

DdA - - - - - - Sc-Ki-§&------Vc-Ha-=l - - - - - - Vc-N-=i - - - - - - VD=aYeXl - - VYe=2 - V

DdXaqDdxii.c-Kti-a2c-Ha-=-l1c-N-za:ADXYexl

VDxaaG

c-Ki-ZL2c-Ha-ZA&c-N-i~DxaYei=2Ye2

10I G G G GV

V --A - - -V --A - - -

V - - -_ _V---_

50I D E E T C L

--D K V S I--D - V S I

801G F L C V Y S I T S

-----F A -N N- -- -- FA -N N-----F 1-NN---L -F A N----L ---V-----L ---V--

120G 1d K (; D L E: S D R---A --D H E-

- -- -- ^ A A-P T-A S W

-- t -- -N E -- -- - -N E X

Proc. Natl. Acad. Sci. USA 86 (1989)

conserved relative, to the Ddras-encoded protein, but itcontains three additional amino acids. The DdrasG-ehcodedprotein is 69% conserved relative to the human HRAS1protein and 62% conserved relative to the yeast RAS-2protein. The N-terminal regions of the ras proteins containpart of the guanine-nucleotide binding site (35, 36) and are

G K S A L_ - - - -

_ _ _

-_ - _ _ _

- - - - -

- - - - -

-_ - _ _ _

- - - - -

20t

-_ - F

I Q NI

- - S

30H F I D E Y D P T I E D

V- - - -

V-

- - -

- - - -

V - -- - -V - - - -

- - - -

Y - V - G - - - - - - -V - - - - - - - - -

B~~607L D I L D T A G Q E F Y S A 14 R D 70 y MRTG

__; -_ - - - - - - - - - - - - - -E-

- - - - - - - - - - - - - - E- - - - - - - - - - - - - - - -

-

- - - - - - E- - - - - - - - - - - - - - - - E - - - -

-

-E- - - - - - - -

90R S S F D E I A S F

TK- - ED- H H YtIT K --E D -H Q YIT K --A D -N L YA K --E D -G T Y-N- - - -L L -Y-N ----L L-Y

Q V T T G- $ VN

T - D -: X

T - D - KI f4 - N N E

130E G Q D_ - - EQ A - -Q A - -QAH EQ A R E

- - S Y E D - L R- - S Y Q A - L N

100R E Q I L R V

- - - - K - -- - - - K - -

K D KC D

- - S EK D K

- - K - - - - S -- - X H - - - A E_ _ 0 - - - - S

_ _ o - - - - SY QY Q

* * *@0L A X S F G S P F L-- -D S L- - H-- R- Y -I -- I-- R- Y -I -Y I- - - - Y - I - - I

V- -Q Y-I -Y I-- -Q L NA -- -M- -Q M NA -- -

E

110R V P M I V V- - - L - L -D - - - V L -D - - - V f -D - - - V L -E - - - V L AY I - V V - -Y I - V V - -

* 15iT S A K I R VS - - - S- I- - - T - Q- _ - -T - Q- - - - T - Q_ - - - T - m- - - -Q A I N- - - - Q A I N

NV E E A f Y S L V R E I

R - D-

- - - - - - - -

Gr- D ---T-----G --D ---T------D D - - - T-------D ------I -L V*R-DD-_ _--T

CT-IL-V-v

-v

- K-I-I

R K D L- E-

- - H K- Q H K_ Q Y R_ _

- K~

170K G D

E K ML R KM K KD N K

S K PQ S S

L N -L N SG R R

180E K G K K X R P L K AG - A Q - - K K QG - K - - - K S - T KP D E S G P G C M S C KS D D G T N G C M G L PG R X M N - P N C R F K

- D - G G K Y N S M N R Q L D N T N E I R D...- Q Y R L K K I S K - E K T P G C V K I K K...

189LLI-I s

-s

V MM-ICIS

FIG; 3. Comparison of the derived amino acid sequence of the DdrasG protein with the sequences of the other Dictyostelium ras protein(Ddras), the three human RAS proteins (KRAS2, HRAS1, and. NRAS), the Drosophila ras protein (Dras), and the yeast RAS proteins (Yeraslahd .'eras2). The DdrasG protein sequence is numbered. The other ras protein sequences are aligned relative to it, with gaps inserted to maximizehomology. A dash indicates homology with the DdrasG protein and only amino acids that differ are indicated. The two series of dots representthe positions of additiohal residues present in the yeast RAS proteins. The triangle indicates the conserved cysteine residue, which is acylated(30). The circles in the region 137-145 indicate amino acids conserved between DdrasG and human RAS genes and diverged in Ddras. Solidsymbols indicate identity, while the open circle indicates chemical similarity. The sequences of the ras gene products have been taken from thefollowing publications (13, 31-34). Amino acids are identified by the single-letter code.

DdXALG

c-Xti-xL12c-Ha-xaAlC-N-=

Yez~alYeraI2

DdcGDdXLIc-Ki-1=2C-Ha-xaa2

Dr LYemlYeLL2

- - - - T - S

I

Dow

nloa

ded

by g

uest

on

Mar

ch 2

9, 2

021

Proc. Natl. Acad. Sci. USA 86 (1989) 941

a

1 2 3

< 21.2 D:,o: _0tt

q 5.0 ,

4 4.3 b-

< 2.0 b

'N

FIG. 4. Southern blot analysis of Dictyostelium ras genes. Genomic DNA (5 ,g) from the Dictyostelium strain Ax-2 was digested with BgIII (lanes 1), EcoRI (lanes 2), and EcoRI/Bgl II (lanes 3), electrophoresed on a 0.8% agarose gel, and then transferred to nitrocellulose. The filterwas probed with labeled DdrasG-c3 (a) or Ddrascl (b) and the filters were washed under low-stringency conditions (A) and then underhigh-stringency conditions (B). The filters were exposed to x-ray film for 12 hr. Molecular sizes (kilobases) are shown in the middle.

extremely conserved. The DdrasG protein conforms to thispattern and, of the first 81 amino acids, DdrasG differs fromDdras, human HRAS1, and yeast RAS-2 by only 2, 6, and 16amino acids, respectively. This unambiguously establishesthat the DdrasG gene encodes a ras protein. The C-terminalportions of all ras proteins are more highly diverged and theDdrasG protein is only 59% conserved relative to the Ddrasprotein in this region. As might be expected, this is asignificantly higher degree of conservation than is observedwhen the sequence of either protein is compared to that of rasproteins from other organisms. There is an acylated cysteineresidue close to the C terminus of the mammalian ras proteinthat is involved in anchoring the protein to the inner surfaceof the plasma membrane (30). The Dictyostelium protein is

A 0 4 8 12 16

B

1.2

FIG. 5. Northern blot analysis of Ddras and DdrasG geneexpression during growth and development. Poly(A)+RNA (5 lg)from each of the indicated times after the onset of differentiation(hours) was separated on a 1.25% formaldehyde-agarose gel, trans-ferred to nitrocellulose, and probed with Ddras-cl (A) or DdrasG-c3(B). The filters were washed under high-stringency conditions andexposed to x-ray film for 16 hr. The approximate sizes (kilobases) ofthe mRNA are indicated by arrowheads.

acylated (37) and both the Ddras and DdrasG proteins havea cysteine residue in an analogous position (Fig. 3) thatpresumably performs this function.To establish the number of ras genes in Dictyostelium,

cDNA inserts from Ddras and DdrasG were used as probesin Southern transfer analysis of genomic DNA. At highstringency, there is only slight cross-hybridization betweenthe Ddras and DdrasG sequences, and the different sizes ofthe fragments detected show that the two cDNAs are derivedfrom different genes (Fig. 4B). When hybridized underlow-stringency conditions, the Ddras and DdrasG cDNAprobes hybridize to their cognate genes, cross-hybridize toone another, and also hybridize very weakly to a number ofother fragments (Fig. 4A). Reymond et al. (13) also reportedweakly hybridizing bands, using a genomic clone containingthe entire coding region ofDdras as a probe at low stringency,but these were interpreted as hybridization artefacts due tothe presence of simple sequence repeats within the probe.Our isolation of the DdrasG cDNA clones and the genomicanalysis suggest that the weakly hybridizing bands representother ras genes and/or Dictyostelium homologues of theextended ras gene family such as rho (38) or ral (39).We have used the selective hybridization conditions to

determine the patterns of developmental expression of thetwo genes. Two transcripts, of approximately 1.2 and 0.9kilobases, which start to accumulate at the standing slugstage, are detected when Ddrascl is used as a probe inNorthern transfer analysis under high-stringency hybridiza-tion conditions (Fig. 5A). When the same samples areanalyzed with the DdrasG probe, we observe a high level ofexpression ofDdrasG mRNA in growing cells, and during thefirst 4 hr of development, with an abrupt drop in transcriptlevel thereafter (Fig. SB). There is a low level of cross-hybridization of the two probes, which is not surprising giventheir extremely high homology, and at lower stringency theycross-hybridize very efficiently (data not shown). Reymondet al. (13) suggested that Ddras was also expressed in growingcells on the basis of their Northern blot analysis. Our resultsindicate that the ras-specific mRNA in vegetative cells isderived from DdrasG. The vegetative cell transcriptionobserved previously by Reymond et al. (13) was described as

Aa

1 2 3b

1 2 3

Bb

1 2 3.. t w t ......... .... r..- _

;ekb F

B; $kS

.tv,* ** * . =i- XF-

.>...

8 :or§$ s82

Developmental Biology: Robbins et al.

Dow

nloa

ded

by g

uest

on

Mar

ch 2

9, 2

021

942 Developmental Biology: Robbins et al.

being highly variable. Such variability could be the result ofinconsistent levels of cross-hybridization due to slightchanges in probe length and in hybridization conditions andis consistent with our interpretation.

Clearly, the Ddras and DdrasG genes show quite distinctpatterns of expression. The Ddras gene is only expressedsubsequent to multicellular aggregation, while the DdrasGgene is expressed during growth and early development. Theras proteins encoded by the two genes are identical betweenresidues 70 and 89, the region recognized by the antibodyY13-259. Using this antibody in Dictyostelium, ras proteinwas detected during growth and its concentration was foundto decline during development (16-18). The rate of ras proteinsynthesis also declined during early aggregation but in-creased transiently during pseudoplasmodial formation (16-18). The combined expression of the Ddras and DdrasGgenes would account for this protein accumulation pattern,but this does not preclude the possibility that there are otherras-related genes that encode immunologically cross-reactingproteins.Although other eukaryotic organisms possess more than

one ras gene (1), Dictyostelium is thus far unique in express-ing two genes at different stages of development. Presum-ably, this reflects a requirement for different ras proteinsduring growth and development. The DdrasG protein isslightly more homologous to the three human RAS proteinsthan is the Ddras protein and there is a region betweenresidues 137 and 145 where the Dictyostelium genes arehighly diverged and where DdrasG protein is significantlymore homologous to the proteins encoded by the humangenes (Fig. 3). The portions of the ras protein that complexwith GDP are known (40, 41) and residues 145 to 147 form theguanine-base binding site. The amino acids adjoining thisloop might, therefore, influence the precise function of theprotein. Mammalian ras genes have been shown to play a rolein cell proliferation (42, 43) and it is possible that this regionis more highly diverged in Ddras because the role of theencoded protein is not in proliferation but in the intracellulartransduction of cell to cell signals propagated during the laterstages of development. Dictyostelium is readily manipulatedgenetically by both orthodox and molecular approaches, andthe DdrasG gene may therefore prove valuable in determin-ing the function of the ras protein in cellular growth control.

This research was supported in part by grants from the MedicalResearch Council of Canada and the British Columbia Health CareResearch Foundation to G.W. and G.B.S. We wish to thank Drs.R. A. Firtel and C. D. Reymond for supplying the Ddrascl probe.

1. Barbacid, M. (1987) Annu. Rev. Biochem. 56, 779-827.2. Scolnick, E. M., Papageorge, A. G. & Shih, T. Y. (1979) Proc.

Natl. Acad. Sci. USA 76, 5355-5359.3. McGrath, J. P., Capon, D. J., Goeddel, D. V. & Levinson,

A. D. (1984) Nature (London) 310, 644-649.4. Gilman, A. G. (1984) Cell 36, 577-579.5. Toda, T., Uno, I., Ishikawa, T., Powers, S., Kataoka, T.,

Broek, D., Cameron, S., Broach, J., Matsumato, K. & Wigler,M. (1985) Cell 40, 27-36.

6. Chiarugi, V., Porciatti, F., Pasquali, F. & Bruni, P. (1985)Biochem. Biophys. Res. Commun. 132, 900-907.

7. Fleishman, L. F., Chahwala, S. B. & Cantley, L. (1986) Sci-ence 231, 407-410.

8. Wakelam, M. J. D., Davies, S. A., Houslay, M. D., McKay,I., Marshall, C. J. & Hall, A. (1986) Nature (London) 323, 173-176.

9. Europe-Finner, G. N., Luderus, M. E. E., Small, N. V., Van-Driel, R., Reymond, C. D., Firtel, R. A. & Newell, P. C. (1988)J. Cell Sci. 89, 13-20.

10. Segal, D. & Shilo, B.-Z. (1986) Mol. Cell. Biol. 6, 2241-2248.11. Swanson, M. E., Elste, A. M., Greenberg, S. M., Schwartz,

J. H., Aldrich, T. H. & Furth, M. E. (1986) J. Cell Biol. 103,485-492.

12. Furth, M. E., Aldrich, T. H. & Cordon-Cardo, C. (1987)Oncogene 1, 47-58.

13. Reymond, C. D., Gomer, R. H., Mehdy, M. & Firtel, R. A.(1984) Cell 39, 141-148.

14. Reymond, C. D., Gomer, R. H., Nellen, W., Theibert, A.,Devreotes, P. & Firtel, R. A. (1986) Nature (London) 323, 340-343.

15. Van Haastert, P. J. M., Kesbeke, P., Reymond, C. D., Firtel,R. A., Luderus, M. E. E. & Van Driel, R. (1987) Proc. Natl.Acad. Sci. USA 84, 4905-4909.

16. Pawson, T. & Weeks, G. (1984) in Genes and Cancer, eds.Bishop, J. T. & Greaves, M. (Liss, New York), pp. 461-470.

17. Pawson, T., Amiel, T., Hinze, E., Neave, N., Auersperg, N.,Sobolewski, A. & Weeks, G. (1985) Mol. Cell. Biol. 5, 33-39.

18. Weeks, G. & Pawson, T. (1987) Differentiation 33, 207-213.19. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular

Cloning:A Laboratory Manual (Cold Spring Harbor Lab., ColdSpring Harbor, NY).

20. Feinberg, A. P. & Vogelstein, B. (1983) Anal. Biochem. 132, 6-13.

21. Helms, C., Graham, M. Y., Dutchik, J. E. & Olson, M. V.(1985) DNA 4, 39-49.

22. Norrander, J., Kempe, T. & Messing, J. (1983) Gene 26, 101-106.

23. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl.Acad. Sci. USA 74, 5463-5467.

24. Weeks, C. & Weeks, G. (1975) Exp. Cell Res. 92, 372-382.25. Cocucci, S. M. & Sussman, M. (1970) J. Cell Biol. 45, 399-407.26. Sussman, M. (1966) Methods Cell Physiol. 2, 297-410.27. Blumberg, D. D., & Lodish, H. F. (1980) Dev. Biol. 78, 268-

284.28. Aviv, H. & Leder, P. (1972) Proc. Natl. Acad. Sci. USA 69,

1408-1412.29. Lehrach, H., Diamond, D., Wozney, J. M. & Boedtkev, H.

(1977) Biochemistry 16, 4743-4751.30. Willumsen, B. M., Christensen, A., Hubert, N. L., Papa-

george, A. G. & Lowy, D. R. (1984) Nature (London) 310,583-585.

31. McGrath, J. D., Capon, D. J., Smith, D. H., Chen, E. Y.,Seeburg, P. H., Goeddel, D. V. & Levinson, A. D. (1983)Nature (London) 304, 501-506.

32. Capon, D. J., Chen, E. Y., Levinson, A. D., Seeburg, D. H. &Goeddel, D. V. (1983) Nature (London) 302, 33-37.

33. Powers, S., Kataoka, T., Fasano, O., Goldfarb, M., Strathern,J., Broach, J. & Wigler, M. (1984) Cell 36, 607-612.

34. Neuman-Silberberg, F. S., Schejter, E., Hoffmann, F. M. &Shilo, B.-Z. (1984) Cell 37, 1027-1033.

35. Clark, R., Wong, G., Arnheim, N., Nitecki, D. & McCormick,F. (1985) Proc. Natl. Acad. Sci. USA 82, 5280-5284.

36. Jurnak, F. (1985) Science 230, 32-35.37. Weeks, G., Lima, A. & Pawson, T. (1987) Mol. Microbiol. 1,

347-354.38. Madaule, P. & Axel, R. (1985) Cell 41, 31-40.39. Chardin, P. & Tavitian, A. (1986) EMBO J. 5, 2203-2208.40. Willumsen, B. M., Papageorge, A. G., Kung, H.-F., Bekesi,

E., Robins, T., Johnson, M., Voss, W. C. & Lowy, D. R.(1986) Mol. Cell. Biol. 6, 2646-2654.

41. deVos, A. M., Tong, L., Milburn, M. V., Matias, P. M.,Jancank, J., Noguchi, S., Nishimura, S., Mivra, K., Ohtsuka,E. & Kin, S. H. (1988) Science 239, 888-893.

42. Mulcahy, L. S., Smith, M. R. & Stacey, D. W. (1985) Nature(London) 313, 241-243.

43. Feramisco, J. R., Gross, M., Kamata, T., Rosenberg, M. &Sweet, R. W. (1984) Cell 38, 109-117.

Proc. Natl. Acad. Sci. USA 86 (1989)

Dow

nloa

ded

by g

uest

on

Mar

ch 2

9, 2

021