DNA AND GENETIC MATERIAL

Griffith’s Experiments

Frederick Griffith 1928 while creating a vaccine for a

pneumonia-causing bacteria 2 types of bacteria

S – kills mice R – harmless

Griffith’s Experiments

Frederick Griffith Group 1 – injects S bacteria, mice die Group 2 – injects R bacteria, mice live Group 3 – injects dead S bacteria, mice live

Wanted to see if it was the bacteria or a reaction with part of the bacteria (capsule)

Group 4 – injects dead S bacteria and live R bacteria, mice die Determines bacteria take up genetic

information from dead S bacteria to make them Virulent.

Virulent – able to cause disease

Griffith’s Experiments

Griffith’s Experiments

Virulent – able to cause disease Vaccine – substance that is prepared

from a killed or weakened microorganism and introduced into the body to protect the body against future infections by the microorganism.

Transformation – a change in phenotype caused when bacterial cells take up foreign genetic material.

Transformation

The idea of transformation is how viruses work.

A virus injects its DNA into a cell which is taken up by the nucleus and place into its own DNA sequence

When the cell is copying DNA and making proteins, it makes new viruses as well.

The viruses create a large enough population and destroy the cell to be released. Then infect other cells.

Transformation

If you would like more information, go to http://www.khanacademy.org/video/viruses?playlist=Biology

Structure of DNA

James Watson and Francis Crick – 1950’s determined the shape of DNA Double Helix – twisted ladder or

twisted railroad tracks.

Structure of DNA

The 2 strands linked by nucleotides Nucleotide – subunit that makes up

DNA

Structure of DNA

The 2 strands linked by nucleotides Nucleotide – subunit that makes up

DNA 3 parts of a nucleotide

deoxyribose sugar Phosphate group Base

DNA – Deoxyribonucleic Acid

Structure of DNA

Bases – Adenine (A) - purine Thymine (T) - purine Cytosine (C) - pyrimidine Guanine (G) - pyrimidine

Complimentary pairs – like puzzle pieces, two things that fit together, compliment each other. A-T, C-G (base-pairing rule)

Structure of DNA

Structure of DNA

Each strand of DNA is complimentary to the opposite.

If the first row is a strand of DNA, finish its complimentary strand below. ATCCGATCGAAGGTTTACGATCGGGTTAAC

A T

Structure of DNA

Others contributing to our knowledge of DNA Structure Erwin Chargaff – 1949, determined the

amount of A and T were always equal and that C and G were always equal, however they varied from each other. A=T and C=G, but A-T was not the same

as C-G

Review Questions

Summarize Griffith’s transformation experiments

Name the 3 parts of a nucleotide Relate the base pairing-rule to the structure

of DNA Explain why the 2 strands of the double

helix are described as “complimentary.” Suppose a strand of DNA has a nucleotide

sequence of CCAGATTG. What is the nucleotide sequence of the complimentary strand?

Replication of DNA

DNA Replication – process of copying DNA

Step 1 DNA needs to be unwound and the 2

strands separated by DNA Helicase. Additional proteins prevent the two

strands from reattaching. Replication forks - where the 2 strand

separate and create a “Y” shape

Replication of DNA

Replication of DNA

Step 2 At the replication forks, enzymes (DNA

Polymerase) moves along strands adding nucleotides to the exposed bases according to base-pairing rules

2 new strands are formed.

Replication of DNA

Replication of DNA

Step 3 DNA polymerase will remain attached

until all the DNA has been copied and it is signaled to detach

2 new DNA molecules are formed Each has a brand new strand and an

original strand.

Replication of DNA

Checking for errors Inevitably, errors will occur when copying

and the wrong nucleotide will be added. DNA polymerase in addition to adding

nucleotides will also proof-read the DNA If there is a mismatch the DNA polymerase

will replace the error with the correct nucleotide.

Normal error is 1 in 1 billion nucleotides. Each human cell has 6 billion nucleotide

pairs.

Replication of DNA

Having multiple replication forks increases speed for replication

Because DNA in eukaryotic cells is so long, it cannot be copied from one end to the other or it would take 33 days to copy.

A human chromosome is duplicated in 100 sections that are 10,000 nucleotides long

Due to this human DNA can be copied in 8 hours.

Review Questions

Describe the role of DNA Helicase in DNA replication.

What are the 2 roles of DNA polymerase in replication?

What is the effect of multiple replication forks on the speed of replication in eukaryotes?

Review Questions

Review Questions

What did Griffith find in his experiments with the Streptococcus pneumoniae bacteria?

What was the name of the process that was involved in changing Griffiths R bacteria into S bacteria?

What are the 3 parts of a nucleotide? During which part of interphase is DNA

replicated (from mitosis/meiosis unit)?

Review Questions

What did Watson and Crick discover? What is the complimentary sequence of

the following DNA molecule: GCCATTG? What enzyme unwinds and unzips DNA? What enzyme is responsible for DNA

replication and proofreading the new DNA strand?

What is the benefit of having multiple replication forks along a DNA strand?

Review Questions

What bases are purines? Pyrimidines?

If a human is made of 30% adenine, what percentage of DNA would be thymine? guanine? cytosine? How do you know?

Review Questions

Make sure you do review questions on slides 16 and 24-28

From genes to protein

Decoding the information in DNA Traits are determined by the proteins

that are built. Hair color, eye color, build, etc.

RNA (ribonucleic acid) Differs from DNA – 3 ways

1. 1 strand instead of 2 2. made of ribose sugar backbone instead

of deoxyribose 3. uracil (U) replaces thymine (T)

From genes to protein

Here is the story – information needs to be taken from DNA in the nucleus and turn it into a protein 1. DNA is copied in the form of RNA 2. RNA is transported to a ribosome 3. Ribosome is going to read the RNA

and put proteins together. We will break it down in a little more

detail, but to understand the rest, you need to know this much.

From genes to protein

Transcription – transferring info from DNA to RNA “scribe” – to write, “trans” - change from

one to another Step 1 on previous slide

Translation – making a protein “translate” – change form/language Changes info into a protein Step 3 on previous slide

From genes to protein

Transcription – change info from DNA to RNA RNA polymerase – an enzyme that

transcribes DNA into RNA by attaching and adding complimentary RNA 1. RNA polymerase binds to the gene

promoter – a specific sequence of DNA that acts as a “start” signal for transcription

2. RNA polymerase unwinds and separates DNA

Transcription - RNA polymerase adds complimentary RNA nucleotides.

From genes to protein

Transcribe the following DNA sequence into RNA CGTATTAGAAC G

From genes to protein

From genes to protein

When copying DNA, the entire sequence is copied, but when copying RNA only specific parts of the DNA are transcribed.

How does the RNA Polymerase know where to start and stop copying? Start and stop codons.

From genes to protein

Transcription – in nucleus Translation – once RNA is made it is

sent to the cytoplasm where translation will occur The RNA that takes the information from

nucleus to ribosomes is called mRNA (messenger RNA)

Codon – 3 base segments that code for amino acids.

From genes to protein

From genes to protein

In 1961, Marshall Nirenberg, an American biochemist, deciphered the first codon by making an artificial UUU codon and it produced a protein made entirely of Phenylalanine amino-acid subunits.

Scientists were later able to decipher other codons.

Genetic Code – amino acids and “start” and “stop” codons that are made by each of the possible 64 mRNA codons.

From genes to protein

Quick review. DNA is transcribed (copied) into mRNA

segements in nucleus mRNA leaves nucleus and is taken to

ribosomes Ribosomes will read the mRNA and

translate it into proteins.

From genes to protein

Translation Ribosomes read the mRNA tRNA (transfer RNA) – RNA molecules

that recognize 3 base segments and bring specific amino acids to the ribosomes. Each type of amino acid has a specific

tRNA that carries it to the ribosome. Anticodon – 3 nucleotide sequence on

the tRNA that recognizes the codon on the mRNA

From genes to protein

From genes to protein

Transcription / Translation

From genes to protein

Mutations can cause a nonfunctional protein Point mutation – mutations that

change one or just a few nucleotides in a gene on a chromosome.

Normal sequence DNA - TAC ACA CGT ATT mRNA - AUG UGU GCA UAA Amino acid - Met Cys Ala Stop

From genes to protein

Substitution Mutation DNA - TAC ACA CGT ATT mRNA - AUG UGA GCA UAA Amino acid - Met Stop

Insertion Mutation DNA - TAC ACA CGT ATT mRNA - AUG UGU CGC AUA A Amino acid - Met Cys Arg Ile

From genes to protein

Deletion DNA - TAC ACA CGT ATT mRNA - AUG UG_G CAU AA Amino acid - Met Trp His Think of it in terms of a sentence: “THE

CAT ATE” Turns into “THE ATA TE” no longer makes sense.

Review Questions

Distinguish 3 differences between RNA structure and DNA structure.

Describe how RNA is made during transcription.

What is the DNA sequence that would code for the amino acid for the codon CCU?

What is mRNA and tRNA? What is a codon? Anticodon?

Review Questions

Define transcription and translation. What is the process of making

proteins from mRNA? Where are anticodons found? What is a change in genetic code

called? Mutations that change one or just a

few nucleotides in a gene are called?

Genetic engineering

Genetic engineering – manipulating genes for practical purposes

4 steps of genetic engineering Cutting DNA Making recombinant DNA Cloning Screening

Genetic engineering

1. Cutting DNA Isolate and cut the portion of DNA that

codes for a certain trait In our example it is insulin (diabetes)

2. Make recombinant DNA – DNA made from 2 or more different organisms Human gene is added to bacterial DNA

and inserted into bacteria cell to be produced.

Genetic engineering

Genetic engineering

Genetic engineering

3. Gene Cloning – many copies of the gene are made each time the host cell reproduces.

4. Screening Isolation of the bacterial cells with the

insulin gene. That segment of DNA can then be

extracted and used.

Genetic engineering

Is genetic engineering good or bad?

What are some examples of how genetic engineering are used?

Genetic engineering in medicine Find malfunctioning gene, use a

functioning gene to include in a medication In hemophilia, blood cannot clot Medications can use proteins that someone

with hemophilia cannot produce and put it into a medication to help regulate the condition.

Other examples Growth hormone – growth defects, burns,

ulcers

Genetic engineering in medicine Vaccines – a solution containing all

or part of a harmless version of a pathogen.

Genetic engineering in medicine There is a risk to vaccines

If pathogen is incorrectly processed, you can infect someone with a dangerous pathogen

Some of the substances used to store and and process the vaccine can cause adverse effects in the body.

Genetic engineering in medicine Gene therapy – putting a healthy

copy of a gene into cells of a person whose copy of the gene is defective. Cell is removed from patient Healthy genes are inserted Cells returned Cells will produce substance they were

lacking

Genetic engineering in medicine DNA fingerprint – a pattern of dark

band on a photographic film that is made from an individuals DNA fragments. Each person has a unique DNA

fingerprint Often used for DNA identification in CSI

forensics or paternity cases.

Genetic engineering in medicine DNA fingerprinting activity

Genetic engineering in medicine Human Genome Project –

Attempting to determine the nucleotide sequence of the entire human genome and to map the location of every gene on each chromosome. Human genome contains about 6 billion

base-pairs and about 25,000 genes. Scientists have identified approximately

4,000 genetic disorders

Genetic engineering in medicine Cloning

How is it done? Is it good? Bad? Discuss.

Review Questions

What are 3 food crops that have been improved through genetic engineering

Write a 1-page opinion paper on genetic engineering and cloning.

Define recombinant DNA, gene cloning, vaccine, gene therapy, DNA fingerprint, Human Genome Project.

_____ is used to identify individuals in paternity cases and criminal cases.