Detailed experimental methods as well as additional experimental
Genomics experimental-methods
description
Transcript of Genomics experimental-methods
![Page 1: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/1.jpg)
Genomics: Experimental methods
Slides available www.bioinformatics.be
![Page 2: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/2.jpg)
Lab for Bioinformatics and computational genomics
10 “genome hackers” mostly engineers (statistics)
42 scientiststechnicians, geneticists, clinicians
>100 people hardware engineers,
mathematicians, molecular biologists
![Page 3: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/3.jpg)
Overview
Personalized Medicine,
Biomarkers …
… Molecular Profiling
First Generation Molecular Profiling
Next Generation Molecular Profiling
Next Generation Epigenetic Profiling
Concluding Remarks
![Page 4: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/4.jpg)
Overview
Personalized Medicine,
Biomarkers …
… Molecular Profiling
First Generation Molecular Profiling
Next Generation Molecular Profiling
Next Generation Epigenetic Profiling
Concluding Remarks
![Page 5: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/5.jpg)
![Page 6: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/6.jpg)
![Page 7: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/7.jpg)
![Page 8: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/8.jpg)
![Page 9: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/9.jpg)
![Page 10: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/10.jpg)
Personalized Medicine
• The use of diagnostic tests (aka biomarkers) to identify in advance which patients are likely to respond well to a therapy
• The benefits of this approach are to– avoid adverse drug reactions– improve efficacy– adjust the dose to suit the patient– differentiate a product in a competitive market– meet future legal or regulatory requirements
• Potential uses of biomarkers– Risk assessment– Initial/early detection– Prognosis– Prediction/therapy selection– Response assessment– Monitoring for recurrence
![Page 11: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/11.jpg)
Biomarker
First used in 1971 … An objective and « predictive » measure … at the molecular level … of normal and pathogenic processes and responses to therapeutic interventions
Characteristic that is objectively measured and evaluated as an indicator of normal biologic or pathogenic processes or pharmacologic response to a drug
A biomarker is valid if:– It can be measured in a test system with well
established performance characteristics – Evidence for its clinical significance has been
established
![Page 12: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/12.jpg)
Rationale 1:Why now ? Regulatory path becoming more clear
There is more at stake than efficient drug development. FDA « critical path initiative » Pharmacogenomics guideline
Biomarkers are the foundation of « evidence based medicine » - who should be treated, how and with what.
Without Biomarkers advances in targeted therapy will be limited and treatment remain largely emperical. It is imperative that Biomarker development be accelarated along with therapeutics
![Page 13: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/13.jpg)
Why now ?
First and maturing second generation molecular profiling methodologies allow to stratify clinical trial participants to include those most likely to benefit from the drug candidate—and exclude those who likely will not—pharmacogenomics-based
Clinical trials should attain more specific results with smaller numbers of patients. Smaller numbers mean fewer costs (factor 2-10)
An additional benefit for trial participants and internal review boards (IRBs) is that stratification, given the correct biomarker, may reduce or eliminate adverse events.
![Page 14: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/14.jpg)
Molecular Profiling
The study of specific patterns (fingerprints) of proteins, DNA, and/or mRNA and how these patterns correlate with an individual's physical characteristics or symptoms of disease.
![Page 15: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/15.jpg)
Generic Health advice
• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolarance)• Eat your green beans (glucose-6-phosphate
dehydrogenase Deficiency)• & your grains (HLA-DQ2 – Celiac disease)• & your iron (HFE - Hemochromatosis)• Get more rest (HLA-DR2 - Narcolepsy)
![Page 16: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/16.jpg)
Generic Health advice (UNLESS)
• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolarance)• Eat your green beans (glucose-6-phosphate
dehydrogenase Deficiency)• & your grains (HLA-DQ2 – Celiac disease)• & your iron (HFE - Hemochromatosis)• Get more rest (HLA-DR2 - Narcolepsy)
![Page 17: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/17.jpg)
Generic Health advice (UNLESS)
• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolerance)• Eat your green beans (glucose-6-phosphate
dehydrogenase Deficiency)• & your grains (HLA-DQ2 – Celiac disease)• & your iron (HFE - Hemochromatosis)• Get more rest (HLA-DR2 - Narcolepsy)
![Page 18: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/18.jpg)
Generic Health advice (UNLESS)
• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolerance)• Eat your green beans (glucose-6-phosphate
dehydrogenase Deficiency)• & your grains (HLA-DQ2 – Celiac disease)• & your iron (HFE - Hemochromatosis)• Get more rest (HLA-DR2 - Narcolepsy)
![Page 19: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/19.jpg)
EGFR based therapy in mCRC
![Page 20: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/20.jpg)
Overview
Personalized Medicine,
Biomarkers …
… Molecular Profiling
First Generation Molecular Profiling
Next Generation Molecular Profiling
Next Generation Epigenetic Profiling
Concluding Remarks
![Page 21: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/21.jpg)
Before molecular profiling …
![Page 22: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/22.jpg)
![Page 23: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/23.jpg)
![Page 24: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/24.jpg)
![Page 25: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/25.jpg)
Before molecular profiling …
![Page 26: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/26.jpg)
Before molecular profiling …
![Page 27: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/27.jpg)
![Page 28: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/28.jpg)
First Generation Molecular Profiling
• Flow cytometry correlates surface markers, cell size and other parameters
• Circulating tumor cell assays (CTC’s) quantitate the number of tumor cells in the peripheral blood.
• Exosomes are 30-90 nm vesicles secreted by a wide range of mammalian cell types.
• Immunohistochemistry (IHC) measures protein expression, usually on the cell surface.
![Page 29: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/29.jpg)
![Page 30: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/30.jpg)
![Page 31: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/31.jpg)
![Page 32: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/32.jpg)
First Generation Molecular Profiling
• Gene sequencing for mutation detection
• Microarray for m-RNA message detection • RT-PCR for gene expression
• FISH analysis for gene copy number • Comparative Genome Hybridization (CGH) for
gene copy number
![Page 33: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/33.jpg)
Basics of the “old” technology
• Clone the DNA.• Generate a ladder of labeled (colored)
molecules that are different by 1 nucleotide.• Separate mixture on some matrix.• Detect fluorochrome by laser.• Interpret peaks as string of DNA.• Strings are 500 to 1,000 letters long• 1 machine generates 57,000 nucleotides/run• Assemble all strings into a genome.
![Page 34: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/34.jpg)
![Page 35: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/35.jpg)
Genetic Variation Among People
0.1% difference among people
GATTTAGATCGCGATAGAGGATTTAGATCTCGATAGAG
Single nucleotide polymorphisms(SNPs)
![Page 36: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/36.jpg)
The genome fits as an e-mail attachment
![Page 37: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/37.jpg)
First Generation Molecular Profiling
• Gene sequencing for mutation detection
• Microarray for m-RNA message detection • RT-PCR for gene expression
• FISH analysis for gene copy number • Comparative Genome Hybridization (CGH) for
gene copy number
![Page 38: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/38.jpg)
mRNA Expression Microarray
![Page 39: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/39.jpg)
First Generation Molecular Profiling
• Gene sequencing for mutation detection
• Microarray for m-RNA message detection • RT-PCR for gene expression
• FISH analysis for gene copy number • Comparative Genome Hybridization (CGH) for
gene copy number
![Page 40: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/40.jpg)
![Page 41: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/41.jpg)
Overview
Personalized Medicine,
Biomarkers …
… Molecular Profiling
First Generation Molecular Profiling
Next Generation Molecular Profiling
Next Generation Epigenetic Profiling
Concluding Remarks
![Page 42: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/42.jpg)
Basics of the “new” technology
• Get DNA.• Attach it to something.• Extend and amplify signal with some color
scheme.• Detect fluorochrome by microscopy.• Interpret series of spots as short strings of
DNA.• Strings are 30-300 letters long• Multiple images are interpreted as 0.4 to 1.2
GB/run (1,200,000,000 letters/day). • Map or align strings to one or many genome.
![Page 43: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/43.jpg)
Next Generation Technologies
• Roche (454)–Emulsion PCR–Polymerase–Natural Nucleotides
• 100-500 Mb for 5-15k –1% error rate–Homopolymers
![Page 44: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/44.jpg)
![Page 45: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/45.jpg)
![Page 46: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/46.jpg)
![Page 47: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/47.jpg)
![Page 48: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/48.jpg)
One additional insight ...
![Page 49: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/49.jpg)
Read Length is Not As Important For Resequencing
0%
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
8 10 12 14 16 18 20
Length of K-mer Reads (bp)
% o
f P
aire
d K
-mer
s w
ith
Un
iqu
ely
Ass
ign
able
Lo
cati
on
E.COLI
HUMAN
Jay Shendure
![Page 50: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/50.jpg)
Short Read Techologies
• Illumina GA (HiSeq, MySeq)
• ABI SOLID
![Page 51: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/51.jpg)
![Page 52: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/52.jpg)
![Page 53: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/53.jpg)
![Page 54: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/54.jpg)
Other second generation technology: (ABI) SOLID
![Page 55: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/55.jpg)
![Page 56: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/56.jpg)
So what ?
![Page 57: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/57.jpg)
![Page 58: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/58.jpg)
Second generation DNA/RNA profiling
![Page 59: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/59.jpg)
Second Generation DNA profiling
• Enrichment Sequencing• ChIP-Seq (Chromosome
Immunoprecipitation)• A substitute for ChIP-chip• Eg. to find the binding sequence of
proteins (TFBS)
![Page 60: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/60.jpg)
Paired End Reads are Important!
Repetitive DNAUnique DNA
Single read maps to multiple positions
Read 1 Read 2
Known Distance
![Page 61: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/61.jpg)
Paired End Reads are Important!
Repetitive DNAUnique DNA
Single read maps to multiple positions
Read 1 Read 2
Known Distance
![Page 62: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/62.jpg)
Second Generation DNA profiling
• Exome Sequencing (aka known as targeted exome capture) is an efficient strategy to selectively sequence the coding regions of the genome to identify novel genes associated with rare and common disorders.
• 160K exons
![Page 63: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/63.jpg)
Second Generation DNA profiling
![Page 64: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/64.jpg)
Second Generation DNA profiling
![Page 65: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/65.jpg)
Bioinformatics tools
![Page 66: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/66.jpg)
Bioinformatics tools
![Page 67: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/67.jpg)
Con
tent
s-S
ched
ule
Besides the 6000 protein coding-genes …
140 ribosomal RNA genes275 transfer RNA gnes40 small nuclear RNA genes>100 small nucleolar genes
Function of RNA genes
pRNA in 29 rotary packaging motor (Simpson et el. Nature 408:745-750,2000)Cartilage-hair hypoplasmia mapped to an RNA (Ridanpoa et al. Cell 104:195-203,2001)The human Prader-Willi ciritical region (Cavaille et al. PNAS 97:14035-7, 2000)
Second Generation RNA profiling
![Page 68: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/68.jpg)
RNA genes can be hard to detects
UGAGGUAGUAGGUUGUAUAGU
C.elegans let-27; 21 nt (Pasquinelli et al. Nature 408:86-89,2000)
Often smallSometimes multicopy and redundantOften not polyadenylated (not represented in ESTs)Immune to frameshift and nonsense mutationsNo open reading frame, no codon biasOften evolving rapidly in primary sequence
Second Generation RNA profiling
![Page 69: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/69.jpg)
Although details of the methods vary, the concept behind RNA-seq is simple:
• isolate all mRNA• convert to cDNA using reverse transcriptase• sequence the cDNA• map sequences to the genome
The more times a given sequence is detected, the more abundantly transcribed it is. If enough sequences are generated, a comprehensive and quantitative view of the entire transcriptome of an organism or tissue can be obtained.
Second Generation RNA profiling
![Page 70: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/70.jpg)
• Comparing to microarray– Microarray
• Closed technology: Prior knowledge required• Affected by pseudo-genes (homologous of real genes)• Low sensitivity
– RNA-Seq• Open technology: No prior knowledge required• Not affected by pseudo-genes because exact
sequence is measured• Other information could be yielded (SNP, Alternative
splicing)
Second Generation RNA profiling
![Page 71: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/71.jpg)
ncRNAs in human genome
tRNA 60018S rRNA 2005.8S rRNA 20028S rRNA 2005S rRNA 200snoRNA 300miRNA 250U1 40U2 30U4 30U5 30U6 20U4atac 5U6atac 5U11 5U12 5
SRP RNA 1
RNase P RNA 1
Telomerase RNA 1
RNase MRP 1
Y RNA 5
Vault 4
7SK RNA 1
Xist1
H191
BIC1
Antisense RNAs 1000s?
Cis reg regions 100s?
Others ?
![Page 72: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/72.jpg)
![Page 73: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/73.jpg)
Mapping Structural Variation in Humans
- Thought to be Common 12% of the genome (Redon et al. 2006)
- Likely involved in phenotype variation and disease
- Until recently most methods fordetection were low resolution (>50 kb)
CNVs
>1 kb segments
![Page 74: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/74.jpg)
Size Distribution of CNV in a Human Genome
![Page 75: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/75.jpg)
![Page 76: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/76.jpg)
Next next generation sequencing
Third generation sequencing
Now sequencing
![Page 77: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/77.jpg)
Ultra-low-cost SINGLE molecule sequencing
![Page 78: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/78.jpg)
Pacific Biosciences: A Third Generation Sequencing Technology
Eid et al 2008
![Page 79: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/79.jpg)
Complete genomics
![Page 80: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/80.jpg)
Nanopore Sequencing
![Page 81: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/81.jpg)
Second Generation Protein profiling
• Proteomics MS-MS-based exclusively in discovery mode
• Automate diagnostics assay generation (next generation proteomics)• Aptamers as alternative to antibodies• ImmunoPCR
![Page 82: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/82.jpg)
MS/MS identification pipeline
pipeline overview
Bonanza
Bonanza + IggyPep
Goaldefine PTMs profile
prior to database
search
Goalmulti-tiered
database search
Goalfilter
dataset prior to
database search
![Page 83: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/83.jpg)
Second Generation Protein profiling
• Proteomics MS-MS-based exclusively in discovery mode
• Automate diagnostics assay generation (next generation proteomics)• Aptamers as alternative to antibodies• ImmunoPCR
![Page 84: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/84.jpg)
Overview
Personalized Medicine,
Biomarkers …
… Molecular Profiling
First Generation Molecular Profiling
Next Generation Molecular Profiling
Next Generation Epigenetic Profiling
Concluding Remarks
![Page 85: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/85.jpg)
CONFIDENTIAL# samples
# markers
MethylCap_Seq
Deep_Seq
Genome-wide methylation …. by next generation sequencing
Discovery Verification Validation
3 000 000
5
6 000
50EpiHealth
<50 only models
and fresh frozen
> 50
![Page 86: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/86.jpg)
CONFIDENTIALSequencing
DeepSeq
Molecular Unification
107 106 105 104 103 102 101 1108109
Full genome bp
Whole-genomeBisulphite seq
RUO Clinical
EPI
GENETIC
Whole-genomesequencing
Enrichment seq(MBD, RRBS)
Enrichment seq(Exome)
Probes(450-27K)
Enrichment Targeted Panels
Enrichment Targeted Panels
UltraDeep
![Page 87: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/87.jpg)
![Page 88: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/88.jpg)
Overview
Personalized Medicine,
Biomarkers …
… Molecular Profiling
First Generation Molecular Profiling
Next Generation Molecular Profiling
Next Generation Epigenetic Profiling
Concluding Remarks
![Page 89: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/89.jpg)
Math
Informatics
Bioinformatics, a life science discipline …
(Molecular)Biology
![Page 90: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/90.jpg)
Math
Informatics
Bioinformatics, a life science discipline …
Theoretical Biology
Computational Biology
(Molecular)Biology
Computer Science
![Page 91: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/91.jpg)
Math
Informatics
Bioinformatics, a life science discipline …
Theoretical Biology
Computational Biology
(Molecular)Biology
Computer Science
Bioinformatics
![Page 92: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/92.jpg)
Math
Informatics
Bioinformatics, a life science discipline … management of expectations
Theoretical Biology
Computational Biology
(Molecular)Biology
Computer Science
Bioinformatics
Interface Design
AI, Image Analysisstructure prediction (HTX)
Sequence Analysis
Expert Annotation
NPDatamining
![Page 93: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/93.jpg)
Math
Informatics
Bioinformatics, a life science discipline … management of expectations
Theoretical Biology
Computational Biology
(Molecular)Biology
Computer Science
BioinformaticsDiscovery Informatics – Computational Genomics
Interface Design
AI, Image Analysisstructure prediction (HTX)
Sequence Analysis
Expert Annotation
NPDatamining
![Page 94: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/94.jpg)
Translational Medicine: An inconvenient truth
• 1% of genome codes for proteins, however more than 90% is transcribed
• Less than 10% of protein experimentally measured can be “explained” from the genome
• 1 genome ? Structural variation• > 200 Epigenomes ??
• Space/time continuum …
![Page 95: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/95.jpg)
Translational Medicine: An inconvenient truth
• 1% of genome codes for proteins, however more than 90% is transcribed
• Less than 10% of protein experimentally measured can be “explained” from the genome
• 1 genome ? Structural variation• > 200 Epigenomes …
• “space/time” continuum
![Page 96: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/96.jpg)
![Page 97: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/97.jpg)
![Page 98: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/98.jpg)
Epigenetic (meta)information = stem cells
Cellular programming
![Page 99: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/99.jpg)
Cellular reprogramming
Tumor
Epigenetically altered, self-renewing cancer stem cells
Tumor Development and Growth
![Page 100: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/100.jpg)
Gene-specificEpigeneticreprogramming
Cellular reprogramming
![Page 101: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/101.jpg)
Wobblebase Mission
provide tools to both specialists (researchers, bioinformaticians, health care providers) and individual consumers that unlock the power of genomic data to the USER
enable personalized genomics today by simplifying the way we organize, visualize and manage genomic data.
![Page 102: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/102.jpg)
PGM: Personal Genomics Manifesto
Everybody who wants to get his genome sequenced has the human right to do so. No third party can own your genetic data, your genetic data is exclusively yours.
Nobody can be forced to get his genome analyzed or to reveal his genome to a third party.
Your genome should allways be treated as confidential, private information.
People should be advised not to share their identity AND their entire genome on a public forum.
People should be advised to use secure technologies that allow to maximally protect phenotypic and/or genotype data.
People should be able to actively explore, manage and get updated interpretation on their genomic data.
![Page 103: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/103.jpg)
• change the diagnostic/healthcare industry forever by setting a new standard and empowering the user
Wobblebase Mission
![Page 104: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/104.jpg)
Choosing the Red Pill
The Technical Feasibility Argument
The Quality Argument
The Price Argument
The Logistics around the sample on howto manage the data Argument
The Ethical debate
The Privacy/Security concern
![Page 105: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/105.jpg)
Updates are the single moste important feature of
Wobblebase
Notifications
![Page 106: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/106.jpg)
#Rs1805007
![Page 107: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/107.jpg)
Wobblebase
Socialnetworktwitter
Comparison
BioinformaticsAnalysispipelines
UpdatesNotifications
eHealth(fixed
vocabulary)
![Page 108: Genomics experimental-methods](https://reader038.fdocuments.in/reader038/viewer/2022102815/55501b8cb4c905af648b4f78/html5/thumbnails/108.jpg)
108
biobixwvcrieki
biobix.bebioinformatics.be