Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in...
Transcript of Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in...
![Page 1: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/1.jpg)
Genome Assembly Using de Bruijn Graphs
Biostatistics 666
![Page 2: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/2.jpg)
Previously: Reference Based Analyses
β’ Individual short reads are aligned to reference
β’ Genotypes generated by examining reads
overlapping each position
β’ Works very well for SNPs and relatively well for other types of variant
![Page 3: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/3.jpg)
Shotgun Sequence Reads
β’ Typical short read might be <25-100 bp long and not very informative on its own
β’ Reads must be arranged (aligned) relative to each
other to reconstruct longer sequences
![Page 4: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/4.jpg)
Read Alignment
β’ The first step in analysis of human short read data is to align each read to genome, typically using a hash table based indexing procedure
β’ This process now takes no more than a few hours per million reads β¦
β’ Analyzing these data without a reference human genome would require much longer reads or result in very fragmented assemblies
5β-ACTGGTCGATGCTAGCTGATAGCTAGCTAGCTGATGAGCCCGATCGCTGCTAGCTCGACG-3β
Reference Genome (3,000,000,000 bp)
GCTAGCTGATAGCTAGCTAGCTGATGAGCCCGA Short Read (30-100 bp)
![Page 5: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/5.jpg)
Mapping Quality β’ Measures the confidence in an alignment, which
depends on: β Size and repeat structure of the genome β Sequence content and quality of the read β Number of alternate alignments with few mismatches
β’ The mapping quality is usually also measured on a
βPhredβ scale
β’ Idea introduced by Li, Ruan and Durbin (2008) Genome Research 18:1851-1858
![Page 6: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/6.jpg)
Shotgun Sequence Data
5β-ACTGGTCGATGCTAGCTGATAGCTAGCTAGCTGATGAGCCCGATCGCTGCTAGCTCGACG-3β Reference Genome
GCTAGCTGATAGCTAGCTAGCTGATGAGCCCGA
AGCTGATAGCTAGCTAGCTGATGAGCCCGATCGCTG ATGCTAGCTGATAGCTAGCTAGCTGATGAGCC
ATAGCTAGATAGCTGATGAGCCCGATCGCTGCTAGCTC TAGCTGATAGCTAGATAGCTGATGAGCCCGAT
Sequence Reads
Reads overlapping a position of interest are used to calculate genotype likelihoods and Interpreted using population information.
![Page 7: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/7.jpg)
Limitations of Reference Based Analyses
β’ For some species, no suitable reference genome available
β’ The reference genome may be incomplete, particularly near centromeres and telomeres
β’ Alignment is difficult in highly variable regions
β’ Alignment and analysis methods need to be customized for each type of variant
![Page 8: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/8.jpg)
Assembly Based Analyses
β’ Assembly based approaches to study genetic variation β Implementation, challenges and examples
β’ Approaches that naturally extend to multiple variant types
![Page 9: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/9.jpg)
De Bruijn Graphs
β’ A representation of available sequence data
β’ Each k-mer (or short word) is a node in the graph
β’ Words linked together when they occur consecutively
Short Sequence
De Bruijn Graph Representation
Iqbal (2012)
![Page 10: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/10.jpg)
Effective Read Depth
β’ Overlaps must exceed k-mer length to register in a de Bruijn graph
β’ This requirement effectively reduces coverage
β’ Give read read length L, word length k, and expected depth D β¦
π·πππππππππ = π·πΏ β π + 1
πΏ
![Page 11: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/11.jpg)
Cleaning
β’ De Bruijn graphs are typically βcleanedβ before analysis
β’ Cleaning involves removing portions of the graph that have very low coverage
β’ For example, most paths with depth = 1 and even with depth <= 2 throughout are likely to be errors
![Page 12: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/12.jpg)
Variation in a de Bruijn Graph
β’ Variation in sequence produces a bubble in a de Bruijn graph
β’ Do all bubbles represent true variation? What are other alternative explanations?
Iqbal (2012)
![Page 13: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/13.jpg)
Effective Read Depth - Consequences
β’ Consider a simple example where L = 100
β’ With k = 21 β¦ β Each read includes 80 words β Each SNP generates a bubble of length 22 β A single read may enable SNP discovery
β’ With k = 75 β¦
β Each read includes 26 words β Each SNP generates a bubble of length 76 β Multiple overlapping reads required to discover SNP
![Page 14: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/14.jpg)
Properties of de Bruijn Graphs
β’ Many useful properties of genome assemblies (including de Bruijn graphs) can be studied using results of Lander and Waterman (1988)
β’ Described number of assembled contigs and their lengths as a function of genome size, length of fragments, and required overlap
![Page 15: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/15.jpg)
Lander and Waterman (1988) Notation
β’ The genome size G
β’ The number of fragments in assembly N
β’ The length of sequenced fragments L β The fractional overlap required for assembly Ρ²
β’ The depth of coverage c = LN/G
β’ Probability a clone starts at a position Ξ± = N/G
![Page 16: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/16.jpg)
Number of Contigs Ne-c(1-Ρ²)
β’ Consider the probability that a fragment starts is not linked to another before ending πΌ 1 β πΌ πΏ 1βπ = πΌ 1 βπ/πΊ
πΊππ 1βπ = πΌπβπ 1βπ
β’ Then, the expected number of fragments that are
not linked to another is πΊπΌπβπ 1βπ = ππβπ 1βπ
β’ This is also the number of contigs!
![Page 17: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/17.jpg)
Number of Contigs
Genome Coverage (or depth) c
Num
ber o
f Con
tigs (
G/L
uni
ts)
Number of contigs peaks when depth
c = (1 β Ξ±)-1
![Page 18: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/18.jpg)
Contig Lengths β’ Probability a fragment ends the contig:
πβπ 1βπ
β’ Probability of contig with exactly j fragments: 1 β πβπ 1βπ πβ1
πβπ 1βπ
β’ The number of contigs with j fragments is: ππβ2π 1βπ 1β πβπ 1βπ πβ1
β’ How many contigs will have 2+ fragments?
![Page 19: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/19.jpg)
Contig Lengths (in bases) β’ The expected contig length, in fragments, is
πΈ π½ = ππ 1βπ β’ Each fragment contributes X bases β¦
π π = π = 1 β πΌ πβ1πΌ for 0 < π β€ πΏ(1 β π) π π = πΏ = 1 β πΌ πΏ(1βπ)
β’ After some algebra:
πΈ π = πΏ[1βπβπ 1βπ
πβ ππβπ 1βπ ]
β’ The expected contig length in bases is E(X) E(J)
πΏ[ππ 1βπ β 1
πβ π]
![Page 20: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/20.jpg)
Contig Lengths
Genome Coverage (or depth) c
Cont
ig L
engt
h (in
uni
ts o
f L b
ase
pairs
)
Lander and Waterman
also studied gap lengths
![Page 21: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/21.jpg)
Enhanced De Bruijn Graphs
β’ Usefulness of a de Bruijn graph increases if we annotate each note with useful information
β’ Basic information might include the number of times each word was observed
β’ More detailed information might include the specific individuals in which the word was present
![Page 22: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/22.jpg)
Variant Analysis Algorithm 1: βBubble Callingβ
β’ Create a de Bruijn graph of reference genome β Bubbles in this graph are paralogous sequences
β’ Using a different label, assemble sample of interest
β’ Systematically search for bubbles
β Nodes where two divergent paths eventually connect
Iqbal (2012)
![Page 23: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/23.jpg)
Word size k and Accessible Genome
Iqbal (2012)
![Page 24: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/24.jpg)
Power of Homozygous Variant Discovery (100-bp reads, no errors)
Iqbal (2012)
![Page 25: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/25.jpg)
Power of Heterozygous Variant Discovery (100-bp reads, no errors)
Iqbal (2012)
![Page 26: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/26.jpg)
Power of Homozygous Variant Discovery (Simulated 30x genomes, 100-bp reads)
Iqbal (2012)
![Page 27: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/27.jpg)
Power of Heterozygous Variant Discovery (Simulated 30x genomes, 100-bp reads)
Dotted lines (β¦) refer to theoretical expectations. Solid lines (---) refer to simulation results. Iqbal (2012)
![Page 28: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/28.jpg)
Variant Analysis Algorithm 2: Path Divergence
β’ Bubble calling requires accurately both alleles β Power depends on word length k, allele length,
genome complexity and error model β Low power for the largest events
β’ Path divergence searches for regions where a
sample path differs from the reference
β’ Especially increases power for deletions β Deletion often easier to assemble than reference
![Page 29: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/29.jpg)
Path Divergence Example
Black line represents assembly of sample. We can infer a variant between positions a and b,
because the path between them differs from reference.
![Page 30: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/30.jpg)
Variant Analysis Algorithm 3: Multi-Sample Analysis
β’ Improves upon simple bubble calling by tracking which paths occur on each sample
β’ Improved ability to distinguish true variation from paralogous sequence and errors
Iqbal (2012)
![Page 31: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/31.jpg)
Classifying Sites
β’ Evaluate ratio of coverage along the two branches of each bubble and in each individual
β’ If the ratio is uniform across individuals β¦ β Error: Ratio consistently low for one branch β Repeat: Ratio constant across individuals
β’ If the ratio varies across individuals β¦
β Variant: Ratio clusters around 0, Β½ and 1 with probability of these outcomes depending on HWE
![Page 32: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/32.jpg)
Variant Analysis Algorithm 4: Genotyping
β’ Calculate probability that a certain number of k-mers cover each path
β’ To improve accuracy, short duplicate regions within a path can be ignored.
β’ Allows likelihood calculation for use in imputation algorithms
Iqbal (2012)
![Page 33: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/33.jpg)
Example Application to High Coverage Genome
β’ 26x, 100-bp reads, k = 55
β’ 2,777,252,792 unique k-mers β 2,691,115,653 also in reference β 23% more k-mers before cleaning
β’ 2,686,963 bubbles found by Bubble Caller
β 5.6% of these also present in reference
β’ 528,651 divergent paths β 39.8% of these also present in reference
β’ 2,245,279 SNPs, 361,531 short indels, 1,100 large or complex events
β Reproduces 67% of heterozygotes from mapping (87% of homozygotes)
![Page 34: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/34.jpg)
Comparison to Mapping Based Algorithms
![Page 35: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/35.jpg)
Summary
β’ Assembly based algorithms currently reach about 80% of the genome
β’ These algorithms can handle different variant types more conveniently than mapping based approaches
β’ Incorporating population information allows repeats to be distinguished from true variation
![Page 36: Genome Assembly Using de Bruijn GraphsContig Lengths (in bases) β’ The expected contig length, in fragments, is πΈπ½= π. π1βπ β’ Each fragment contributes X bases](https://reader033.fdocuments.in/reader033/viewer/2022043006/5f902c667703620135533450/html5/thumbnails/36.jpg)
Recommended Reading
β’ Iqbal, Caccamo, Turner, Flicek and McVean (2012) Nature Genetics 44:226-232
β’ Lander and Waterman (1988) Genomics 2:231-239