Genome Annotation: From Sequence to Biology Ashley Bateman & Andrew Tritt Genetics 677 Prof. Ahna...
-
date post
18-Dec-2015 -
Category
Documents
-
view
214 -
download
0
Transcript of Genome Annotation: From Sequence to Biology Ashley Bateman & Andrew Tritt Genetics 677 Prof. Ahna...
Genome Annotation: From
Sequence to Biology
Ashley Bateman & Andrew Tritt
Genetics 677Prof. Ahna Skop
Spring 2009
Introduction-over 450 organisms have been completely sequenced since 1995, and many more have working drafts-361 prokaryotes, 28 archaea, 20 protists, 8 plants, 15 fungi, 26 mammals, and 21 “other”(wikipedia)
List of Sequenced Organisms
QuickTime™ and a decompressor
are needed to see this picture.
http://www.nature.com/nrmicro/journal/vaop/ncurrent/images/nrmicro1901-f3.jpg
Reads ~200 bp
454 Sequencing: Sequencing by synthesis
1-fix DNA strands to beads in water-in-oil emulsion
2-DNA amplified by PCR
3-use PPi product of PCR to determine identity of added base
High Throughput Sanger Sequencing
~900 bp read
-DNA of interest inserted into a plasmid, and sequenced using primers for plasmid
QuickTime™ and a decompressor
are needed to see this picture.
QuickTime™ and a decompressor
are needed to see this picture.
~26-50 bp reads
-newest sequencing technology --> cheaper and faster
-small reads present problems if dealing with repetitive sequence
Solexa Sequencing
http://seqanswers.com/forums/showthread.php?t=21
The process of taking the DNA sequence produced by genome-sequencing projects, and adding layers of analysis/interpretation to understand its biological significance in a larger context
Genome Annotation
Genome Annotation: A
multistep process
3 general levels of annotation:
-1 Nucleotide-level(where)
-2 Protein-level (what)-3 Process-level (how)
Nucleotide-level Annotation: Mapping
-“…identify the punctuation marks…”-Identification and placement of known landmarks into the genome (genes, genetic markers, etc.)-Connects the pre-genomic literature with post-genomic research
Nucleotide-level Annotation: Finding Genomic Landmarks
-short sequences: PCR-based genetic markers (ID with e-PCR program)
-long sequences: RFLPs (ID with BLASTN, etc.)
Nucleotide-level Annotation: Gene Finding
Prokaryotes: ID ORFsEukaryotes: Sophisticated software needed (gene prediction)-overlapping ORFs-signal-to-noise ratio-splicing-unclear exon/intron delineations
-use algorithms that contain sensors to identify specific sequence features
- neural networks- rule-based system- hidden Markov model
-sequence similarity to known CDS-BLAST-cDNA-EST’s
Ab initio gene prediction - without use of prior knowledge about similarities to other genes
Gene Prediction Software
Hidden Markov Models
QuickTime™ and a decompressor
are needed to see this picture.
EXONA: 0.2C: 0.3G: 0.3T: 0.2
INTRONA: 0.25C: 0.25G: 0.25T: 0.25
1.0
0.85
0.05
0.10
0.95
0.05
-a set of states with transition and emission probabilities
-genes in a sequence predicted by finding most probable path
Example :
DNA Sequence : AGTTCGAATCGATGCTAAGACGA Possible Path : EEEEIIIIIIIIIIIIIIEEEEE Most probable path: EEEIIIIIIIIIIIIIIIIIEEE
Sequence Similarity
-currently, most powerful tool for detecting CDS
-Problems exist:-Fragmentary ESTs-Repetitive cDNA sequences-Ortholog-paralog problem-Incomplete data
ab initio predictions + similarity data = more powerful model
Nucleotide-level Annotation: non-coding RNAs and regulatory regions-include tRNAs, rRNAs, snRNAs, nRNAs
-transcription factor binding sites
-largely unknown; active area of bioinformatics research
Nucleotide-level Annotation: non-coding RNAs and regulatory regions
QuickTime™ and a decompressor
are needed to see this picture.
-red and blue boxes represent unknown positions of motifs
-Gibbs Motif Sampler1 and MEME infer models for motifs and identify motif locations within sequences1 Lawrence et al. 1993, Thompson et al. 2007
Nucleotide-level Annotation: Repetitive Elements & Segmental Duplications
Repetitive Elements:
-account for a large proportion of genome size variation
-important to (generally) exclude these from later assembly process
-problematic for next-gen sequencing technologies
Segmental Duplications:
-paralogs exist throughout many genomes
Nucleotide-level Annotation: Mapping Variation
-SNPs are important for population genetics and association mapping
AAGTCGATGCTAGCGCTACTAGCTAGGCTCGATGTTAAGTCGATGCTAGCGCTACTAGCTAGGCTAGATGTTAAGTCGATGCTAGCCCTACTAGCTAGGCTCGATGTTAAGTCGATGCTAGCGCTACTAGCTAGGCTAGATGTTAAGTCGATGCTAGCCCTACTAGCTAGGCTTGATGTTAAGTCGATGCTAGCGCTACTAGCTAGGCTCGATGTT
SNPs
Protein-level Annotation
-Assign putative functions to proteins of an organism
-Classify proteins into families:
-using similarities to better-characterized proteins of other species (BLASTP)
-on the basis of functional domains, motifs, and folds
-Search against protein databases of functional domains (e.g. PFAM)
-InterPro: integration of several protein databases -makes things much easier!
Process-level Annotation
-linking the genome to biological processes
-bench work required (e.g. microarrays, RNAi, etc.)
-classification scheme required: Gene Ontology (GO)
-standardized vocabulary for molecular function, biological process, and
cellular component
-hierarchy of terms provides flexibility for new additions
QuickTime™ and a decompressor
are needed to see this picture.
Process-level Annotation
-hierarchical structure of GO terminology
Organizing Annotation Efforts
Several models:- factory - museum- cottage
industry- party
Bioinformatics research in biomedical text mining to automate annotation process
QuickTime™ and a decompressor
are needed to see this picture.
Conclusion
A synthesis of biology and annotation must be developed…
…change is constant, databases are updated sometimes hourly…
…the experimental literature of the past must be tied with the genome annotations of the future!
Student Question
“The paper was mostly about predicting the number of genes and proteins in an organism. Why do we need to predict the number of genes and proteins in the cell? It appears that most studies identify genes based on phenotypes. For proteins, many methodologies exist for identifying protein function. I cannot see the purpose of this prediction--pardon my short sightedness.
Also, has a standardized format emerged in regard to the genome files?”
NCBI standardized format example