Genetics in the news.. Mutations are heritable changes in base sequences that modify the information...
-
Upload
sylvia-charles -
Category
Documents
-
view
212 -
download
0
description
Transcript of Genetics in the news.. Mutations are heritable changes in base sequences that modify the information...
![Page 1: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/1.jpg)
Genetics…in the news.
![Page 2: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/2.jpg)
Mutations
…are heritable changes in base sequences that modify the information
content of DNA.
![Page 3: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/3.jpg)
Wild-type Allelestwo definitions
• General: any allele existing at a frequency greater than 1% in a natural population,
• Experimental Geneticist: the one allele that dictates the most commonly found phenotype in a population.
• Forward mutation: any change that changes a wild-type allele to a
different allele…
A+ --> arecessive mutation
b+ --> Bdominant mutation
a --> A+ , B --> b+ reversions
• Reverse mutations: novel mutant alleles can revert back to wild-type…
![Page 4: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/4.jpg)
![Page 5: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/5.jpg)
Mutant Classifications…by their effect on DNA
Substitutions
![Page 6: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/6.jpg)
Mutagenic Agents
Base Analogs
Alkylating AgentsIntercalating Agents
Deaminating Agents
![Page 7: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/7.jpg)
To Know
![Page 8: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/8.jpg)
Mutant Classifications…by their effect on DNA
deletions and insertions
i d1 base?2 base?3 base?etc.
![Page 9: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/9.jpg)
Frameshifts
![Page 10: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/10.jpg)
Mutant Classifications…by their effect on DNA
inversions translocations
![Page 11: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/11.jpg)
Trinucleotide Repeat Expansions
FMR1
Fragile X Mental Retardation 1
cgg cgg cgg cgg cgg cgg cgg cggcgg
...GCGCGGCGGTGACGGAGGCGCCGCTGCCAGGGGGCGTGCGGCAGCG...
…CTGGGCCTCGAAGCGCCCGCAGCCA
cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cggcgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg
cgg cgg cgg cgg cgg cgg cgg cgg cggcgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cggcgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg ... > 230
![Page 12: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/12.jpg)
![Page 13: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/13.jpg)
![Page 14: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/14.jpg)
Ames Testtesting for mutagenicity
More mutagenic?
Barbecue beefIceberg LettuceCold Beer
![Page 15: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/15.jpg)
5’ 3’
3’ 5’
5’
5’
3’5’
N- -C
enhancer, silencer, core promoter?
? ? ? ??
AAUAAA
![Page 16: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/16.jpg)
Transposable Elements
…a segment of DNA that can move to, or move a copy of itself to another locus on the same or a different chromosome (hopping DNA),
…may be a single insertion sequence, or a more complex structure (transposon) consisting of two insertion sequences and one or more intervening genes.
![Page 17: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/17.jpg)
Inverted repeats.
Transcribed genes.
Transposable Elements
![Page 18: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/18.jpg)
Transpositionnormal gene, normal RNA, normal protein,
transposon inserted in gene, abnormal RNA, abnormal protein, loss of function.
![Page 19: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/19.jpg)
Transposons
Two transposable elements flanking other DNA, the whole complex ‘hops’.
Other genes.
![Page 20: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/20.jpg)
5’ 3’
3’ 5’
5’
5’
3’5’
N- -C
?? ? ? ?
?AAUAAA
![Page 21: Genetics in the news.. Mutations are heritable changes in base sequences that modify the information content of DNA.](https://reader035.fdocuments.in/reader035/viewer/2022081605/5a4d1b797f8b9ab0599b88f2/html5/thumbnails/21.jpg)
Assignments
• Chapter 7: Problems 7.1 - 7.12,
• Monday: Prokaryotic Genetics, 8.1 - 8.3s