Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change...
-
Upload
buck-francis -
Category
Documents
-
view
223 -
download
1
Transcript of Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change...
![Page 1: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/1.jpg)
Genetics:Gene Mutations and DNA Repair
![Page 2: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/2.jpg)
INTRODUCTION
The term mutation refers to a heritable change in the genetic material
Mutations provide allelic variations On the positive side, mutations are the foundation
for evolutionary change E.g. Light skin in high latitude human populations
On the negative side, mutations are the cause of many diseases
E.g. Hemophilia
![Page 3: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/3.jpg)
DNA Maintenance
Mutation rate are extremely low
1 mutation out of 109 nucleotides per generation
![Page 4: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/4.jpg)
Mutations can be divided into three main types 1. Chromosome mutations
Changes in chromosome structure 2. Genome mutations
Changes in chromosome number 3. Single-gene mutations
Relatively small changes in DNA structure that occur within a particular gene
Type 3 will be discussed in this set of lecture notes
CONSEQUENCES OF MUTATIONS
![Page 5: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/5.jpg)
A point mutation is a change in a single base pair It involves a base substitution
Gene Mutations Change the DNA Sequence
5’ AACGCTAGATC 3’3’ TTGCGATCTAG 5’
5’ AACGCGAGATC 3’3’ TTGCGCTCTAG 5’
A transition is a change of a pyrimidine (C, T) to another pyrimidine or a purine (A, G) to another purine
A transversion is a change of a pyrimidine to a purine or vice versa
Transitions are more common than transversions
![Page 6: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/6.jpg)
![Page 7: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/7.jpg)
10 μmNormal red blood cells Sickled red blood cells
10 μm
(a) Micrographs of red blood cells
: NH2 – VALINE – HISTIDINE – LEUCINE – THREONINE – PROLINE – GLUTAMIC ACID – GLUTAMIC ACID...
: NH2 – VALINE – HISTIDINE – LEUCINE – THREONINE – PROLINE – VALINE– GLUTAMIC ACID...
(b) A comparison of the amino acid sequence between normal -globin and sickle-cell -globin
NORMAL
SICKLECELL
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
© Phototake/Alamy © Phototake/Alamy
7
![Page 8: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/8.jpg)
Mutations may also involve the addition or deletion of short sequences of DNA
5’ AACGCTAGATC 3’3’ TTGCGATCTAG 5’
5’ AACGCTC 3’3’ TTGCGAG 5’
5’ AACGCTAGATC 3’3’ TTGCGATCTAG 5’
5’ AACAGTCGCTAGATC 3’3’ TTGTCAGCGATCTAG 5’
Deletion of four base pairs
Addition of four base pairs
![Page 9: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/9.jpg)
Mutations in the coding sequence of a structural gene can have various effects on the polypeptide Silent mutations are those base substitutions that
do not alter the amino acid sequence of the polypeptide
Due to the degeneracy of the genetic code E.g. AUU to AUC still codes for Ile
Missense mutations are those base substitutions in which an amino acid change does occur
Example: Sickle-cell anemia If the substituted amino acid does not affect protein
function (as measured by phenotype), the mutation is said to be neutral
Gene Mutations Can Alter the Coding Sequence Within a Gene
![Page 10: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/10.jpg)
Nonsense mutations are those base substitutions that change a normal codon to a termination codon
Frameshift mutations involve the addition or deletion of nucleotides in multiples of one or two
This shifts the reading frame so that a completely different amino acid sequence occurs downstream from the mutation
![Page 11: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/11.jpg)
![Page 12: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/12.jpg)
In a natural population, the wild-type is the most common genotype (may be encoded by a dominant or recessive allele)
A forward mutation changes the wild-type genotype into some new variation If it is beneficial, it may move evolution forward Otherwise, it will be probably eliminated from a
population A reverse mutation has the opposite effect
It is also termed a reversion (changes mutant back to wild-type)
Gene Mutations and Their Effects on Genotype and Phenotype
![Page 13: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/13.jpg)
Mutations can also be described based on their effects on the wild-type phenotype When a mutation alters an organism’s phenotypic
characteristics, it is said to be a variant Variants are often characterized by their differential
ability to survive Deleterious mutations decrease the chances of survival
The most extreme are lethal mutations E.g. Homozygous polydactyly in cats
Beneficial mutations enhance the survival or reproductive success of an organism
Some mutations are called conditional mutants They affect the phenotype only under a defined set of
conditions (such as temp affecting wild type and mutant bacteria)
![Page 14: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/14.jpg)
![Page 15: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/15.jpg)
A second mutation will sometimes affect the phenotypic expression of another
These second-site mutations are called suppressor mutations or simply suppressors
Suppressor mutations are classified into two types Intragenic suppressors
The second mutant site is within the same gene as the first mutation
Intergenic suppressors The second mutant site is in a different gene from the first
mutation
![Page 16: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/16.jpg)
These mutations can still affect gene expression A mutation, may alter the sequence within a promoter
Up promoter mutations make the promoter more like the consensus sequence
They may increase the rate of transcription Down promoter mutations make the promoter less like the
consensus sequence They may decrease the rate of transcription
Probably responsible for most differences between closely-related organisms (e.g. humans and chimps)
A mutation can also alter splice junctions in eukaryotes
Gene Mutations in Non-coding Sequences
![Page 17: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/17.jpg)
Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-13
(3'-UTR) is the section of messenger RNA (mRNA) that immediately follows the translation termination codon.
![Page 18: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/18.jpg)
Several human genetic diseases are caused by an unusual form of mutation called trinucleotide repeat expansion (TNRE) The term refers to the phenomenon that a sequence of
3 nucleotides can increase from one generation to the next
These diseases include Huntington disease (HD) Fragile X syndrome (FRAXA)
Mutations Due to Trinucleotide Repeats
![Page 19: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/19.jpg)
![Page 20: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/20.jpg)
Certain regions of the chromosome contain trinucleotide sequences repeated in tandem In normal individuals, these sequences are transmitted
from parent to offspring without mutation However, in persons with TRNE disorders, the length of a
trinucleotide repeat increases above a certain critical size It also becomes prone to frequent expansion This phenomenon is shown here with the trinucleotide repeat
CAG
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
n = 11
n = 18
![Page 21: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/21.jpg)
In some cases, the expansion is within the coding sequence of the gene Typically the trinucleotide expansion is CAG (glutamine) Therefore, the encoded protein will contain long tracks of
glutamine This causes the proteins to aggregate with each other This aggregation is correlated with the progression of the disease
In other cases, the expansions are located in noncoding regions of genes These expansions are hypothesized to cause abnormal
changes in RNA structure Thereby producing disease symptoms
![Page 22: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/22.jpg)
A chromosomal rearrangement may affect a gene because the break occurred in the gene itself
A gene may be left intact, but its expression may be altered because of its new location This is termed a position effect Movement may be next to a regulatory sequence or into
into a heterochromatic region and now expressed.
Changes in Chromosome Structure Can Affect Gene Expression
![Page 23: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/23.jpg)
Figure 16.2
Regulatory sequences are often bidirectional
![Page 24: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/24.jpg)
Geneticists classify the animal cells into two types Germ-line cells
Cells that give rise to gametes such as eggs and sperm Somatic cells
All other cells Germ-line mutations are those that occur directly in a
sperm or egg cell, or in one of their precursor Somatic mutations are those that occur directly in a
body cell, or in one of its precursor cells
Mutations Can Occur in Germ-Line or Somatic Cells
![Page 25: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/25.jpg)
Figure 16.4
Therefore, the mutation can be
passed on to future generations
The size of the patch will depend on the timing of the mutation
The earlier the mutation, the larger the patch
An individual who has somatic regions that are genotypically different
from each other is called a genetic mosaic
Therefore, the mutation cannot be passed on to future generations
![Page 27: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/27.jpg)
Mutations can occur spontaneously or be induced
Spontaneous mutations Result from abnormalities in cellular/biological processes
Errors in DNA replication, for example
Induced mutations Caused by environmental agents Agents that are known to alter DNA structure are termed
mutagens These can be chemical or physical agents
Refer to Table 16.4
OCCURRENCE AND CAUSES OF MUTATION
![Page 28: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/28.jpg)
![Page 29: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/29.jpg)
Are mutations spontaneous occurrences or causally related to environmental conditions? This is a question that biologists have asked
themselves for a long time
Jean Baptiste Lamarck Proposed that physiological events (e.g. use and disuse)
determine whether traits are passed along to offspring Charles Darwin
Proposed that genetic variation occurs by chance Natural selection results in better-adapted organisms
Spontaneous Mutations Are Random Events
![Page 30: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/30.jpg)
Joshua and Ester Lederberg were also interested in the relation between mutations and the environment
At that time (1950s), there were two new theories Directed mutation theory
Selected conditions could promote the formation of specific mutations allowing the organism to survive
This was consistent with Lamarck’s viewpoint
Random mutation theory Environmental factors simply select for the survival of those
individuals that happen to possess beneficial mutations This was consistent with Darwin’s viewpoint
Random Mutations Can Give an Organism a Survival Advantage
![Page 31: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/31.jpg)
Spontaneous mutations can arise by three types of chemical changes
1. Depurination
2. Deamination
3. Tautomeric shift
Causes of Spontaneous Mutations
The most common
![Page 32: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/32.jpg)
Depurination involves the removal of a purine (guanine or adenine) from the DNA The covalent bond between deoxyribose and a purine
base is somewhat unstable It occasionally undergoes a spontaneous reaction with water
that releases the base from the sugar
Fortunately, these can be repaired However, if the repair system fails, a mutation may result
during subsequent rounds of DNA replication
Causes of Spontaneous Mutations
![Page 33: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/33.jpg)
Spontaneous depurinationFigure 16.8
Three out of four (A, T and G) are the incorrect nucleotideThere’s a 75% chance
of a mutation
![Page 34: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/34.jpg)
Deamination involves the removal of an amino group from the cytosine base The other bases are not readily deaminated
Figure 16.9
DNA repair enzymes can recognize uracil as an inappropriate base in DNA and remove it
However, if the repair system fails, a C-G to A-T mutation will result during subsequent rounds of DNA replication
![Page 35: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/35.jpg)
Deamination of 5-methyl cytosine can also occur
Thymine is a normal constituent of DNA This poses a problem for repair enzymes
They cannot determine which of the two bases on the two DNA strands is the incorrect base
For this reason, methylated cytosine bases tend to create hot spots for mutation
Figure 16.9
![Page 36: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/36.jpg)
A tautomeric shift involves a temporary change in base structure
These rare forms promote AC and GT base pair
For a tautomeric shift to cause a mutation it must occur immediately prior to DNA replication
![Page 37: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/37.jpg)
Figure 16.10
RareCommon
![Page 38: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/38.jpg)
Figure 16.10
![Page 39: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/39.jpg)
16-42Figure 16.10
Temporary tautomeric shift
Shifted back to its normal fom
![Page 40: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/40.jpg)
An enormous array of agents can act as mutagens to permanently alter the structure of DNA
The public is concerned about mutagens for two main reasons: 1. Somatic mutagens are often involved in the
development of human cancers 2. Germ-line mutations may have harmful effects in
future generations Mutagenic agents are usually classified as
chemical or physical mutagens
Types of Mutagens
![Page 41: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/41.jpg)
Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-53
![Page 42: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/42.jpg)
Nonionizing radiation Includes UV light Has less energy Cannot penetrate deeply
into biological molecules Causes the formation of
cross-linked thymine dimers
Thymine dimers may cause mutations when that DNA strand is replicated
Figure 16.15
![Page 43: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/43.jpg)
43
Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at http://get.adobe.com/flashplayer.
![Page 44: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/44.jpg)
DNA Repair All species have a variety of DNA
repair systems to avoid the harmful effects of mutations.
Excision repair recognizes and removes a damaged base or damaged segments of DNA.
Base mismatch repair recognizes a base mismatch and removes a segment of the DNA strand with the incorrect base.
![Page 45: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/45.jpg)
Mismatch Repair
![Page 46: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/46.jpg)
Excision Repair
![Page 47: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/47.jpg)
DNA polymerase replaces missing or damaged bases.
![Page 48: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/48.jpg)
Mutant Hemoglobin Lab
![Page 49: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/49.jpg)
![Page 50: Genetics: Gene Mutations and DNA Repair. INTRODUCTION The term mutation refers to a heritable change in the genetic material Mutations provide allelic.](https://reader030.fdocuments.in/reader030/viewer/2022032612/56649f005503460f94c162a5/html5/thumbnails/50.jpg)
RNAi Lab
http://app.discoveryeducation.com/player/view/assetGuid/BD9EB326-950D-4C2E-A2A5-BC04E3D4CEB7