JOURNAL OF BACTERIOLOGY,0021-9193/01/$04.0010 DOI: 10.1128/JB.183.19.5544–5553.2001

Oct. 2001, p. 5544–5553 Vol. 183, No. 19

Copyright © 2001, American Society for Microbiology. All Rights Reserved.

Genetics and Regulation of Chitobiose Utilization inBorrelia burgdorferi

KIT TILLY,1* ABDALLAH F. ELIAS,1 JENNIFER ERRETT,1 ELIZABETH FISCHER,2 RADHA IYER,3

IRA SCHWARTZ,3 JAMES L. BONO,1† AND PATRICIA ROSA1

Laboratory of Human Bacterial Pathogenesis1 and Microscopy Branch,2 National Institute of Allergy andInfectious Diseases, National Institutes of Health, Rocky Mountain Laboratories, Hamilton,

Montana 59840, and Department of Biochemistry and Molecular Biology,New York Medical College, Valhalla, New York 105953

Received 2 April 2001/Accepted 29 June 2001

Borrelia burgdorferi spends a significant proportion of its life cycle within an ixodid tick, which has a cuticlecontaining chitin, a polymer of N-acetylglucosamine (GlcNAc). The B. burgdorferi celA, celB, and celC genes en-code products homologous to transporters for cellobiose and chitobiose (the dimer subunit of chitin) in otherbacteria, which could be useful for bacterial nutrient acquisition during growth within ticks. We found thatchitobiose efficiently substituted for GlcNAc during bacterial growth in culture medium. We inactivated the celBgene, which encodes the putative membrane-spanning component of the transporter, and compared growth ofthe mutant in various media to that of its isogenic parent. The mutant was no longer able to utilize chitobiose,while neither the mutant nor the wild type can utilize cellobiose. We propose renaming the three genes chbA,chbB, and chbC, since they probably encode a chitobiose transporter. We also found that the chbC gene wasregulated in response to growth temperature and during growth in medium lacking GlcNAc.

Borrelia burgdorferi, a Lyme disease agent, resides in themidgut of an ixodid tick for a significant part of its natural lifecycle (17). The bacteria are acquired from an infected smallmammal when a larval tick takes its first blood meal. The spi-rochetes multiply within the tick as the meal is digested, andthen their numbers decline precipitously when the tick molts tothe nymphal stage (8, 21). When a nymph feeds again on amammal (which can be months after the larval feeding), somebacteria move to the tick salivary glands and are transmitted tothe mammal, causing a mammalian infection.

The arthropod vector undergoes a number of physiologicaland metabolic changes to which resident bacteria are exposed.These changes include blood feeding and digestion, cuticlesynthesis and degradation that are required to accommodatethe blood meal and carry out the molt (27), and tick adaptationto the resting state between blood digestion and developmentof the next metamorphic stage. The ability of B. burgdorferi toadapt to this changing environment, and to the vastly differentmammalian environment, is likely to be essential to the suc-cessful completion of an infectious cycle.

Ixodid tick integument expansion during feeding and prep-aration for molting requires the synthesis of new cuticle, ofwhich chitin, a polymer of N-acetylglucosamine (GlcNAc), is acomponent (27). These ticks also have chitinous peritrophicmatrices that surround the blood meal within the midgut (24,32). Chitin components available during cuticle remodelingmay serve as nutrients for bacteria growing in ticks. Spiro-chetes require GlcNAc to reach high densities in culture (1,13). The genome sequence of B. burgdorferi (12) revealed sev-

eral genes likely to facilitate chitin by-product utilization by thebacteria. Among these are the celA, celB, and celC genes (Fig.1A), which encode a phosphotransferase system (PTS) pre-dicted to recognize the substrate(s) chitobiose (the dimersubunit of chitin, two b-1,4-linked GlcNAc molecules) and/orcellobiose (the dimer subunit of cellulose, two b-1,4-linkedglucose molecules) (Fig. 1B). The genome also includes a para-logous pair of genes whose products were predicted to haveb-N-acetyl-glucosaminidase (chitobiase) and/or b-glucosidaseactivities, which would cleave chitobiose or cellobiose into twomolecules of GlcNAc or glucose, respectively.

The celA, celB, and celC genes (BBB06, BBB04, and BBB05,respectively) reside on cp26 (the 26-kbp circular plasmid),whereas the genes encoding the putative chitobiase (BB0002)and b-glucosidase (BB0620) are located on the linear chromo-some (12). Further analysis of the genome sequence predictsthat B. burgdorferi can funnel free GlcNAc-6-P (resulting fromtransport via a PTS system) either into glycolysis, using a pu-tative GlcNAc-6-P deacetylase and glucosamine-6-P isomer-ase, or into cell wall biosynthesis, using a putative phosphoglu-comutase (12).

Mammals contain no chitin. However, tick cuticle, whichcontains chitin, is synthesized and degraded during tick devel-opment. Bacterial numbers within ticks fluctuate during thisprocess (21). Therefore, genes for chitobiose transport andcleavage most likely play key roles while the bacteria reside inthe tick. We have begun a study to determine if the B. burg-dorferi cel products actually facilitate chitobiose utilization and,by extension, might help bacteria grow in ticks. We foundthat chitobiose efficiently substitutes for GlcNAc in allowingB. burgdorferi to grow to high densities in culture. In contrast,celB mutant bacteria were unable to utilize chitobiose. Wetherefore propose that the cel genes be renamed chb genes, toreflect the sugar specificity of the encoded transporter. We also

* Corresponding author. Mailing address: 903 S. 4th St., Hamilton,MT 59840. Phone: (406) 363-9239. Fax: (406) 363-9394. E-mail: ktilly@nih.gov.

† Present address: U.S. Meat Animal Research Center, USDA,ARS, Clay Center, NE 68933.

5544

on July 4, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

propose that celB be renamed chbC, with celC and celA re-named chbA and chbB, respectively, based on the previouslyused rationale in which the gene name correlates with thesubunit of the PTS system encoded thereby (14). We use thesenames throughout this communication.

MATERIALS AND METHODS

Bacterial strains and mutant construction. Experiments were performed withB31-A (4), a clone derived from high-passage noninfectious B31 (1), or B31-4A,

a reisolate derived from mouse infection with a clone of low-passage B31 (7, 9).The chbC mutant was constructed by allelic exchange using a plasmid (pKK80)in which part of the chbC gene had been removed and replaced with the gyrBr

gene, encoding a mutant B subunit of gyrase that confers coumermycin A1

resistance (23) (Fig. 1A). PKK80 was made by: (i) PCR amplifying a 4.3-kbsequence including the chbC gene and flanking sequences (using primers cp26-24974 and cp26-20651 [Table 1]); (ii) cloning that fragment into pCR2.1 (In-vitrogen; Carlsbad, Calif.); (iii) recloning a SpeI-XbaI fragment containing thosesequences with part of the polylinker of pCR2.1 into SpeI-digested pOK12 (30);and (iv) replacing a 389-bp KpnI-NcoI fragment from the chbC gene with the

FIG. 1. Arrangement of chb genes and mechanism of chitobiose transport by a PTS transporter. (A) Relative orientation of the celB (chbC),celC (chbA), and celA (chbB) genes on a portion of cp26, with arrows indicating direction of transcription. The orientation and approximateposition of the insertion of gyrBr and deletion of chbC constructed in the chbC72 mutation are also shown. The gyrBr gene is not drawn to scale.(B) Expected arrangement of Chb (or Cel) proteins and mechanism of chitobiose transport and utilization. The phosphate group is predicted tobe donated by proteins common to all PTS systems, encoded by the chromosomal BB558, BB557, and BB448 genes (12). Cht, chitobiase. Modifiedfrom reference 16.

TABLE 1. Oligonucleotide primers used in this study

Primer Sequence (59339) Use

cp26-24974 CAGGACGACGTCCTATTGCC chb region amplificationcp26-20651 CCATCGATAAGAAACTTTTTATTAGTGC chb region amplificationcp26-24116 CCAAGCTTAAGTTTTGCAATAGCAATTC Allelic exchange; screeninggyrB-U178F-KpnI GGGGTACCTGTTGGTTTTAGCACTATA gyrBr amplificationgyrB-1905R-NcoI TGCCATGGTTACACATCAAGATTAATTAC gyrBr amplificationchbC-F TTAATTGCTTTAAGAGATGGC chbC probe; screeningchbC-R TACCATGAAGACCACAAAACC chbC probeFL-6 TTCAGGGTCTCAAGCGTCTTGGACT flaB probeFL-7 GCATTTTCAATTTTAGCAAGTGATG flaB probe

VOL. 183, 2001 B. BURGDORFERI chbC MUTANT 5545

on July 4, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

gyrBr gene, which had been cloned into pCR2.1 after amplification with primersthat provided those restriction enzyme sites (U178F-KpnI and 1905R-NcoI). ThegyrBr gene is inserted in the same orientation as the chbC gene. Recloning intopOK12 was necessary to avoid introducing an ampicillin resistance marker intoB. burgdorferi. Twenty-five micrograms of pKK80 DNA was used to transformelectrocompetent B31-A (25). The 552 resulting coumermycin A1-resistant col-onies were screened for the presence of allelic exchange by PCR using theprimers chbC-F and cp26-24116 (Table 1), and two mutants were obtained.Restriction enzymes and T4 DNA ligase were purchased from New EnglandBiolabs (Beverly, Mass.).

GlcNAc assay. The modified Morgan-Elson assay that we used (22) is linear inthe range from 0.1 to 1.6 mM GlcNAc (where BSKII medium contains 1.8 mMGlcNAc). To assay GlcNAc, 0.1 ml of sample was mixed with 0.1 ml of 0.8 Msodium borate and boiled for 12 min. After cooling to room temperature, 0.55 mlof 10% Ehrlich reagent was added and the tubes were incubated for 20 min at37°C. After cooling again to room temperature, the absorbance at 585 nm wascompared to that of a standard curve derived using known concentrations ofGlcNAc. Ehrlich reagent is 10% (wt/vol) p-dimethylaminobenzaldehyde in amixture of 9 ml of glacial acetic acid and 1 ml of concentrated HCl. Ehrlichreagent (10%) was prepared by diluting the above stock with 9 volumes of glacialacetic acid. BSKII medium and derivatives were assayed after passing the samplethrough a Centricon 10 filter (Amicon, Inc., Beverly, Mass.). Without this step,the protein in the medium precipitated and the samples became solid afterboiling. Of the free GlcNAc found in BSKII, 50 to 80% remained in an assayableform after this procedure.

Growth curves. For analyzing growth in various media, bacteria were dilutedfrom stationary phase (2 3 108 to 4 3 108 bacteria/ml) to 105 bacteria/ml andcounted daily using a Petroff-Hausser counting chamber and a dark-field micro-scope. The lowest concentration of bacteria accurately enumerated by thismethod is about 105 bacteria/ml. Typical dilutions inoculated less than 5 ml ofculture into 5 ml of fresh deficient medium, so only insignificant amounts ofnutrients were transferred with the inoculum. BSKII medium without gelatin or,in some cases, BSK-H medium (Sigma, St. Louis, Mo.) was used. Because ofbatch-to-batch medium variation and different times at which bacteria wereenumerated, experimental data could not be pooled, and representative growthcurves are shown. Experiments were repeated a minimum of two times and oftenwere repeated more than 10 times. In several experiments, bacterial viability wasconfirmed by concentrating the bacteria 5- to 10-fold and staining with theLIVE/DEAD BacLight bacterial viability kit (Molecular Probes, Wilsonville,Oreg.), according to the manufacturer’s instructions. Stained cells were visual-ized with a fluorescence microscope (Zeiss, Jena, Germany) and photographedwith a Nikon camera (9). On one occasion, the numbers were also confirmed bydirectly assessing CFU within the culture. In general, bacteria were enumerateduntil no change was detected. In various experiments, chitobiose was a gift fromS. Roseman and N. Keyhani (Johns Hopkins University, Baltimore, Md.) orpurchased from Sigma or Seikagaku (Tokyo, Japan). The source made no dis-cernible difference in the results.

Northern blot analysis. RNA was prepared and Northern blotting was per-formed by previously described methods (5). RNA was isolated from B31-Agrown in medium without GlcNAc at the peak of the first exponential phase (50h), during the death phase (100 h), and at the peak of the second exponentialphase (190 h). RNA was also isolated from B31-4A grown to late exponentialphase at 23°C, or from a 23°C culture diluted 100-fold, shifted to 34°C, and grownto late exponential phase (2 to 4 days). We also prepared RNA from a culture ofB31-A that had been grown to late exponential phase in BSKII lacking GlcNAcbut supplemented with 0.9 mM chitobiose. Probes were derived by PCR (primersdescribed in Table 1), were internal to the genes, and were labeled with [32P]dATP by random priming (Gibco BRL, Gaithersburg, Md.).

Southern blot analysis. B. burgdorferi plasmid DNA was prepared using Qia-gen columns (Qiagen, Chatsworth, Calif.). Restriction enzyme-digested or undi-gested DNA was separated by electrophoresis through a 0.3% agarose gel,blotted to nylon membranes, and hybridized as described previously (28, 29). ThechbC probe was prepared by PCR (primers described in Table 1), the gyrB probewas the fragment used for insertional inactivation, and both were labeled with[32P]dATP by random priming (Gibco BRL).

Transmission electron microscopy. Samples were pelleted and fixed 1 h with4% paraformaldehyde–2.5% glutaraldehyde–0.1 M sodium cacodylate buffer,pH 7.4, and then postfixed 1 h with 0.5% osmium tetroxide–0.8% potassiumferricyanide, and then 1% tannic acid. Samples were then stained overnight, enbloc, with 1% uranyl acetate. Samples were washed with water and then dehy-drated with a graded ethanol series and embedded in Spurr’s resin. Thin sectionswere cut with an RMC MT-7000 ultramicrotome (Ventana, Tucson, Ariz.) andstained with 1% uranyl acetate and Reynold’s lead citrate prior to viewing at 80kV on a Philips CM-10 transmission electron microscope (FEI, Hillsboro,Oreg.). Digital images were acquired with a digital camera system (Amount,Chazy, New York).

Scanning electron microscopy. Bacterial suspension (50 ml) was settled on0.1% poly-L-lysine-coated Thermanox coverslips for 30 min. Samples were fixedas described above through dehydration. Samples were then critical point driedunder CO2 in a Bal-Tec model cpd 030 drier (Bal-Tec, Middlebury, Conn.),mounted on aluminum studs, and sputter coated with 150 Å of iridium in a modelIBS/TM200S ion beam sputterer (VCR Group, South San Francisco, Calif.)prior to examination at 5 kV in a Hitachi S-4500 field emission scanning electronmicroscope (Hitachi, Tokyo, Japan)

RESULTS

B. burgdorferi utilization of chitobiose. In order to assess thesignificance of the chb genes for B. burgdorferi growth, wetested whether B. burgdorferi could use chitobiose in place ofGlcNAc. To do this, we grew clone B31-A in medium lackingGlcNAc (normally present at 1.8 mM) but supplemented withvarious amounts of chitobiose (Fig. 2). As previously described

FIG. 2. Growth of B31-A in medium containing various amounts of chitobiose (chi) substituting for GlcNAc. Complete BSKII medium contains1.8 mM GlcNAc. Bacteria were diluted to 105/ml, grown at 35°C in the indicated media, and enumerated daily using a Petroff-Hausser chamberand dark-field microscope.

5546 TILLY ET AL. J. BACTERIOL.

on July 4, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

(1, 13), the bacteria were unable to grow to typical high den-sity (2 3 108 to 4 3 108 bacteria per ml) in medium lackingGlcNAc. Bacterial growth was defective when the GlcNAcconcentration was reduced to 180 mM, and lowering the con-centration to 18 mM resulted in growth indistinguishable fromthat found in the absence of any added GlcNAc (data notshown). In contrast, supplementation with as little as 18 mMchitobiose restored normal growth and 1.8 mM chitobiose al-lowed growth to near normal numbers, but 0.18 mM chitobiosehad no positive growth effect (Fig. 2). These results indicatethat chitobiose concentrations 50 to 100 times lower than thoseof GlcNAc supported B. burgdorferi growth.

Temperature-shift effects on chb gene expression. Althoughmammals contain free GlcNAc and GlcNAc monomers andoligomers as components of modifications on proteins andother molecules (e.g., see reference 11), they do not appear tohave free chitobiose. Since chitobiose is likely to be present inticks, we determined if the chbC gene conformed to the pre-viously established correlation between temperature regula-tion in vitro and gene expression within ticks or mammals (26,31). RNA was prepared from infectious clone B31-4A aftergrowth at 23°C, simulating the ambient temperature foundinside a tick, or after a shift to 34°C, more closely resemblinga mammalian environment. Northern blot analysis showed thatchbC RNA is present at a higher level at 23°C than after theshift to 34°C (Fig. 3). Probes to the chbB and chbA genes,which are predicted, by sequence analysis, to be cotranscribedtogether with a downstream gene (Fig. 1), hybridized to abroad band of RNA whose level was unaffected by tempera-ture shift (data not shown). The flaB transcript, which was used

for normalization of RNA loading (Fig. 3B), has been previ-ously shown to be unaltered by temperature shift (5).

chbC gene inactivation. For several reasons, we chose tofurther analyze the importance of the chbC gene product forutilization of chitobiose and other medium components. First,the gene encodes the predicted membrane-spanning compo-nent of a chitobiose transporter (Fig. 1B), without which theother components would be ineffective. Second, the chbC genewas temperature regulated (Fig. 3), suggesting that it mightalso be regulated during bacterial growth within ticks. Third,the chbC gene has a monocistronic transcript, so a mutationshould not have polar effects. Consequently, we mutated thegene by partial deletion and insertion of the gyrBr gene (Fig.1A; see Materials and Methods). One of the two mutantsobtained, chbC72, was selected for further characterization.Southern blot (Fig. 4 and data not shown) and PCR analysis(data not shown) confirmed that the mutant had the expectedinsertion-deletion on cp26. In particular, a chbC probe hybrid-ized to bands in uncut or EcoRI-digested chbC72 plasmidDNA that were appropriately larger than those in B31-A DNA(Fig. 4, right panel). Also, a gyrBr probe hybridized to the samebands in chbC72 plasmid DNA and did not hybridize to B31-Aplasmid DNA (Fig. 4, left panel). To confirm the insertion site,we amplified the chbC-gyrBr junctions from the mutant andfound that they had the expected sequences (data not shown).The chbC mutant grew normally in complete BSKII medium(see below).

Growth in various derivatives of BSKII medium. AlthoughGlcNAc is an essential component of BSKII medium (1, 13),the medium also contains several other potential sources of

FIG. 3. Northern blot analysis of B31-4A RNA from bacteria be-fore and after a temperature upshift. (A) chbC probe; (B) flaB probe.Arrowheads indicate the 1.4-kb chbC and 1-kb flaB mRNA positions;growth temperatures (degrees Celsius) of cultures from which RNAwas prepared are indicated above the lanes. The exposure for the chbCprobe was approximately 10 times longer than that for the flaB probe.

FIG. 4. Southern blot analysis of the chbC region of wild-type andchbC72 bacteria. Undigested (2) or EcoRI-digested (R) plasmid DNAfrom B31-A or chbC72 was probed with gyrB or chbC PCR products.The wild-type gyrB gene is chromosomal, so it is not present in theseDNA preparations. The chbC probe contains a single EcoRI site,yielding 1.3-kbp (no longer present on the gel) and 7.5-kbp fragmentsin B31-A. The insertion-deletion event leads to a net increase of 1.7kbp in the sizes of cp26 and of the larger EcoRI fragment (whichbecomes 9.2 kbp). Sizes (in kilobase pairs) corresponding to migrationpositions of DNA standards are indicated on the left.

VOL. 183, 2001 B. BURGDORFERI chbC MUTANT 5547

on July 4, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

5548 TILLY ET AL. J. BACTERIOL.

on July 4, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

complexed GlcNAc. Yeastolate, an enzymatic digest of yeast(which has a chitinous cell wall) probably contains chito-oli-gomers. Serum includes glycosylated proteins with GlcNAc-containing modifications (e.g., see reference 11), glycolipids,and possibly other GlcNAc-containing molecules, which couldsupply GlcNAc. Using the Morgan-Elson assay for GlcNAc(22), we found that neither serum nor yeastolate contributessignificant free GlcNAc (data not shown). Gelatin is a nones-sential ill-defined product derived from animals and, therefore,was omitted in most experiments. In an attempt to separatethe contributions of various GlcNAc sources, we assayed thegrowth of the B. burgdorferi wild type and chbC mutant in BSKIImedium lacking GlcNAc, yeastolate, and both (Fig. 5). In me-

dium lacking yeastolate, wild-type and chbC mutant bacteriaboth grew more slowly than in complete medium, but to almostthe same density (Fig. 5A).

In medium lacking GlcNAc, both strains had complex growthpatterns (Fig. 5B). After dilution to 105 bacteria/ml, both grewto ;107 bacteria/ml, and then the numbers of viable bacteriadropped precipitously (death phase). After the death phase,the wild-type bacteria began a second exponential phase, at asomewhat lower growth rate, and finally achieved bacterialnumbers comparable to or greater than those found in the firstexponential phase. In contrast, the chbC mutant did not growfurther. Although chitobiose efficiently substituted for GlcNAcfor wild-type bacterial growth (Fig. 2 and Fig. 5C), growth of

FIG. 5. Growth of B31-A and the chbC72 mutant in various media. (A) Growth in BSKII with and without yeastolate (ye). (B) Growth in BSKIIwith and without GlcNAc. (C) Growth in BSKII with and without GlcNAc, and with the substitution of chitobiose (chi) (1.8 mM) for GlcNAc. (D)Growth of low-passage B31-4A in BSKII with and without GlcNAc, and with the substitution of chitobiose (chi) (1.8 mM) for GlcNAc. E. Growthin BSKII with and without both yeastolate (ye) and GlcNAc. Bacteria were enumerated as for Fig. 2. Representative experiments are shown.

VOL. 183, 2001 B. BURGDORFERI chbC MUTANT 5549

on July 4, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

the chbC72 mutant was not restored by the addition of chito-biose (Fig. 5C). Cellobiose (at 1.8 mM) did not restore the growthof either the wild-type or the chbC mutant bacteria (data notshown). The low-passage infectious clone B31-4A had thesame growth pattern as high-passage B31-A during growth inthese media (Fig. 5D), as did BL224, a clinical isolate from apatient in the early stages of Lyme disease (data not shown).

Although previous studies had shown 90% lower bacterialyield in medium lacking GlcNAc (1, 13), these authors did not

describe the complex growth pattern that we observed. Theinitial growth, death, and second exponential growth phaseswere all unanticipated, and our subsequent experiments weredesigned to help understand what bacterial genes and mediumcomponents contributed to these phases.

In medium lacking both GlcNAc and yeastolate (Fig. 5E),both strains grew to about 107 bacteria/ml, died, and did notgrow further. This growth pattern was the same as that foundfor the chbC mutant in medium lacking only GlcNAc. We

FIG. 6. Scanning (A to H) and transmission (I and J) electron microscopic appearance of B31-A (A, C, E, G, and I) and chbC72 (B, D, F, H,and J) bacteria at various times during growth in medium with or without GlcNAc. Bacteria are shown at 50 h, representing the first exponentialphase (A, B, I, and J); at 100 h, representing the death phase (C and D); and at 215 h, representing the second exponential phase for wild typebacteria (E and F). (G and H) Spirochetes from cultures grown in complete BSKII for 215 h. Scale bars 5 1 mm.

5550 TILLY ET AL. J. BACTERIOL.

on July 4, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

conclude that the second exponential phase requires the chbCgene product and involves utilization of a component of yeas-tolate (perhaps chitobiose).

Morphological analysis of bacteria by dark-field microscopyand scanning and transmission electron microscopy revealedthe dramatic changes that both the wild-type and chbC mutantbacteria undergo in medium lacking GlcNAc. At the peak ofthe first exponential phase, most wild-type and chbC mutantbacteria had round membrane-bound masses near their mid-points (Fig. 6A, B, I, and J). Transmission electron microscopy(Fig. 6I and J) showed that the membrane surrounding themasses was contiguous with that surrounding the rest of thespirochetes and that the cytosolic contents of the masses wereless electron dense than in the rest of the spirochete. In somecases, membranes with discontinuities appeared to partiallyseparate the masses from the bodies of the spirochetes anddisrupted flagellar bundles were detected. These masses differfrom previously described gemmae (2), which have well-de-fined contents, and spheroplasts (6, 10), which aggregate andhave numerous extended flagella. They do resemble, however,structures also called spheroplasts that were formed after treat-ing Borrelia hermsii or B. burgdorferi with penicillin (3, 8a).During the death phase, all bacteria had a progressively moreamorphous structure and assumed a less refractile appearance,and most eventually disappeared and presumably lysed (Fig.6C and D). Wild-type bacteria in the second exponential phaselooked normal by microscopic examination (Fig. 6E). By dark-field examination, few if any viable spirochetes were found atthe equivalent time in cultures of the chbC mutant, and par-ticulate structures observed by scanning electron microscopy(Fig. 6F) were probably medium components, since prepara-tions of BSKII medium without spirochetes looked the same(data not shown). Wild-type or chbC mutant bacteria grownfor the same amount of time in complete medium retainedtypical morphology (Fig. 6G and H), although their motilitydiminished with time.

One possible explanation for the second exponential phase

was that the bacteria able to grow had acquired an undefinedmutation, selected by growth in the absence of GlcNAc. Toaddress this possibility, we diluted a culture from this phaseback into medium with or without GlcNAc (Fig. 7). In mediumlacking GlcNAc, the bacteria exhibited the same growth pat-tern as previously (i.e., with first exponential, death, and sec-ond exponential phases), excluding the possibility of a mutantpopulation (Fig. 7). This experiment also shows that the bac-terial adaptation that leads to the second exponential phase islost after growth in fresh BSKII lacking GlcNAc. Finally, thebacterial number achieved in the second exponential phase inthis and many other experiments is higher than in the firstexponential phase. This higher density would not be achievedif scavenging of dead bacteria from the first exponential phasewere the only source of an essential nutrient for growth.

chbC expression during growth without GlcNAc. Inductionof the chbC gene (or another gene required for chitobioseutilization) in response to the absence of GlcNAc during growthin BSKII lacking GlcNAc might explain why the wild-typebacteria exhibit a complex growth pattern in this medium. Toaddress this possibility, we used Northern blot analysis to com-pare chbC expression at various times during growth withoutGlcNAc to expression in BSKII complete medium (Fig. 8).RNA was prepared from B31-A at the peak of the first expo-nential phase (50 h), during the death phase (100 h), and at thepeak of the second exponential phase (190 h) (indicated ongrowth curves in Fig. 8A). chbC transcript was present athigher levels in bacteria from the second exponential phase(Fig. 8B, lane 5), as expected from the growth characteristics ofwild-type and mutant bacteria in various depleted media. Afternormalizing to the constitutively expressed flaB transcript level(Fig. 8C), induction of chbC expression during the secondexponential phase was about 60-fold over that found in bacte-ria grown in BSKII complete medium (Fig. 8B, lane 1). WhenB31-A was grown without GlcNAc but with the addition ofenough chitobiose (0.9 mM) to contribute an equivalent molaramount of GlcNAc (Fig. 8B, lane 2), chbC transcript was

FIG. 7. Growth during first and second passages in BSKII without GlcNAc. B31-A bacteria were diluted to 105/ml in BSKII without GlcNAc,grown for 214 h (to the second exponential phase), and then diluted back to 105/ml in BSKII without GlcNAc (arrows). The same culture was alsodiluted into medium with GlcNAc, both at the t 5 0 time point and at 214 h. Bacteria were enumerated as for Fig. 2.

VOL. 183, 2001 B. BURGDORFERI chbC MUTANT 5551

on July 4, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

present at a level similar to that found during growth in normalBSKII medium (Fig. 8B, lane 1).

DISCUSSION

We have undertaken an analysis of chbC gene function be-cause we suspect that its product, along with those of the chbAand chbB genes, is important for bacterial growth within ticks.The studies described here support that idea, since the chbCgene product is required for utilization of chitobiose, a com-pound likely to be present in ticks but not found free in mam-

malian tissues. In other bacteria, chitobiose transporters areencoded in combination with secreted and periplasmic chiti-nases that can release chitobiose as a degradation product (15).In marine bacteria, which live in environments replete inchitin-containing material, the transporters are used for nutri-ent acquisition. B. burgdorferi does not contain a homolog ofknown chitinases but may instead rely on release of chitobioseby its tick host for a nutrient source.

Our model for explaining the unusual growth of B. burgdor-feri in medium lacking GlcNAc is the following. The first expo-nential phase growth involves utilization of GlcNAc recycledfrom nonessential bacterial components, which become deplet-ed. Despite the loss of available GlcNAc for cell wall biosynthe-sis, the bacteria continue to grow, and most eventually lyse be-cause of compromised cell wall integrity (see, e.g., reference 19).Some of the bacteria survive, however, through increased expres-sion of the chbC gene so that they can now utilize chito-oligomers,present at low concentration in yeastolate, to supply GlcNAc.

Support for this model is as follows: the lack of the secondexponential phase in the chbC mutant suggests that the ChbCprotein (and presumably the ChbA and ChbB proteins) isrequired for this growth. Consistent with this idea is the in-creased chbC transcript observed at that time. The absence ofa second exponential phase in medium lacking both GlcNAcand yeastolate suggests that yeastolate contributes a nutrientessential for this growth, presumably chito-oligomers. The abil-ity of chitobiose to substitute for GlcNAc in the wild type, butnot the chbC mutant, suggests that the Chb products are es-sential for chitobiose utilization.

We have found that lowering the level of GlcNAc in BSKIImedium to 10% of normal led to poor bacterial growth in cul-ture (data not shown). In contrast, chitobiose levels equivalentto 100-fold-lower GlcNAc concentrations sufficed for normalbacterial growth (Fig. 1), perhaps because the bacteria have atransporter specific for chitobiose but not for GlcNAc. If thecellular GlcNAc content of B. burgdorferi is similar to that ofE. coli, then this low amount of chitobiose would be almostcompletely consumed in the process of bacterial multiplicationfrom 105 to 2 3 108 cells per ml, suggesting that chitobiose isvery efficiently utilized by B. burgdorferi. Cellobiose did not sup-port bacterial growth, probably because it is not a source ofGlcNAc, even if successfully transported and cleaved.

The abnormal morphology of the bacteria during the deathphase (Fig. 6 and data not shown) is consistent with loss of cellwall integrity coupled with continuing membrane synthesis andsuggests that a critical function of GlcNAc is as a cell wallprecursor. The clustering of the gene encoding a putative chi-tobiase (BB0002), the enzyme that cleaves chitobiose to freeGlcNAc, with other genes encoding homologs of products in-volved in cell wall biosynthesis (see the introduction) is alsoconsistent with this interpretation. B. burgdorferi also has aparalogous gene (BB0620) whose product may be involved inchitobiose utilization (12). Although the levels of sequencesimilarity between these genes and those of other bacteria donot permit us to assign functions to their products, our pre-liminary results (data not shown) suggest that the BB0002product is not required for chitobiose utilization, either be-cause it recognizes a different substrate or because a redun-dant activity is encoded elsewhere.

FIG. 8. Northern blot analysis of RNA prepared from B31-A bac-teria grown in BSKII medium lacking GlcNAc, with and without chi-tobiose supplementation. (A) Growth curves, with numbers (corre-sponding to lanes in B and C) and arrows indicating times at whichRNA was prepared. The solid line indicates B31-A grown in completeBSKII medium, the dotted line indicates growth in BSKII withoutGlcNAc, and the dashed line indicates growth in BSKII lackingGlcNAc but supplemented with chitobiose. (B and C) Northern blotanalysis of RNA from the indicated time points. Lanes: 1, bacteriagrown in complete BSKII; 2, bacteria grown in BSKII without GlcNAcsupplemented with 0.9 mM chitobiose; 3 to 5, bacteria grown in BSKIIwithout GlcNAc, with RNA isolated from the first exponential phase,the death phase, and the second exponential phase, respectively. Theblot was hybridized first with a chbC probe (arrowhead in panel B) andthen rehybridized with a flaB probe (arrowhead in panel C). Theexposure for the chbC probe was approximately 10 times longer thanthat for the flaB probe. Densitometric comparison of the flaB hybrid-ization signals indicated that lanes 1 and 2 contained threefold moreRNA than lanes 3 to 5.

5552 TILLY ET AL. J. BACTERIOL.

on July 4, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

B. burgdorferi within ticks exhibit a growth pattern parallel tothe one that we describe in medium lacking GlcNAc (21).After Ixodes scapularis larvae feed on infected mice, the bacte-rial load in the tick midgut increases to several thousand spi-rochetes per tick and then drops to prefeeding levels as theticks molt. When the infected ticks next feed as nymphs, thenumber of spirochetes in the midgut increases over 100-foldand then plummets once again when the nymphs molt to adultticks. Piesman et al. (21) suggested that this growth patternmay be caused by limited GlcNAc availability when the ticksare actively synthesizing new chitinous cuticle during the molt-ing process. Bacteria with membrane-bound masses resem-bling those seen during GlcNAc limitation (Fig. 6) have beenobserved in unfed nymphal ticks that were infected as larvae(T. Schwan, personal communication). These bacteria havesurvived the stress that led to their population decline duringthe molt, and their structure may reflect a response to thatstress.

B. burgdorferi growth characteristics within ticks directly af-fect successful maintenance of a bacterial infectious cycle. Thenumber of spirochetes within ticks (18, 20, 21) as well as sur-face protein phenotype (e.g., see reference 18) affects transmis-sion to mammals. Here, we initiate a study into factors affect-ing spirochete growth by studying genes whose products arereasonably expected to play roles in bacterial metabolism with-in ticks. We investigated bacterial growth in the presence oflimiting chitobiose or GlcNAc, culture conditions that mimicpossible stresses encountered by the bacteria during life withinthe tick vector. Our results confirm that bacterial utilization ofchitobiose as a source of GlcNAc is dependent on the activityof the plasmid-borne chbC gene, which encodes a componentof a putative PTS transporter. Studying the physiological andregulatory consequences of chitin component metabolismwill increase our understanding of the dynamic interactionsbetween tick and spirochete that are pertinent to transmissionof bacteria to a mammal.

ACKNOWLEDGMENTSWe thank Janice McClory for preparing BSKII medium lacking

various components. Tom Schwan provided help with fluorescencemicroscopy, and we also thank him for drawing our attention to andpermitting us to describe similarities between spirochetes in flat ticksand spirochetes grown in medium lacking GlcNAc. Daniel Hoganhelped with DNA sequencing. G. Somerville, M. Chaussee, J. M. Mus-ser, T. Schwan, S. Kustu, and J. Hinnebusch provided helpful com-ments on the manuscript. Gary Hettrick, Anita Golden, and Asher Sie-gelman expertly prepared figures. We also thank Nemat Keyhani and SaulRoseman for a gift of chitobiose and advice on GlcNAc assays. Theparticipation of Caroline Ojaimi in some aspects of the transcriptionstudies is acknowledged. This work was supported in part by grantsAR41511 and AI45801 from the National Institutes of Health (to I.S.).

REFERENCES

1. Barbour, A. G. 1984. Isolation and cultivation of Lyme disease spirochetes.Yale J. Biol. Med. 57:521–525.

2. Barbour, A. G., and S. F. Hayes. 1986. Biology of Borrelia species. Microbiol.Rev. 50:381–400.

3. Barbour, A. G., W. J. Todd, and H. G. Stoenner. 1982. Action of penicillin onBorrelia hermsii. Antimicrob. Agents Chemother. 21:823–829.

4. Bono, J. L., A. F. Elias, J. J. Kupko III, B. Stevenson, K. Tilly, and P. Rosa.2000. Efficient targeted mutagenesis in Borrelia burgdorferi. J. Bacteriol. 182:2445–2452.

5. Bono, J. L., K. Tilly, B. Stevenson, D. Hogan, and P. Rosa. 1998. Oligopep-tide permease in Borrelia burgdorferi: putative peptide-binding components en-coded by both chromosomal and plasmid loci. Microbiology 144:1033–1044.

6. Bruck, D. K., M. L. Talbot, R. G. Cluss, and J. T. Boothby. 1995. Ultrastruc-

tural characterization of the stages of spheroplast preparation of Borreliaburgdorferi. J. Microbiol. Methods 23:219–228.

7. Casjens, S., R. van Vugt, K. Tilly, P. A. Rosa, and B. Stevenson. 1997.Homology throughout the multiple 32-kilobase circular plasmids present inLyme disease spirochetes. J. Bacteriol. 179:217–227.

8. de Silva, A. M., and E. Fikrig. 1995. Growth and migration of Borrelia burg-dorferi in Ixodes ticks during blood feeding. Am. J. Trop. Med. Hyg. 53:397–404.

8a.Dever, L. L., J. L. Jorgensen, and A. G. Barbour. 1993. In vitro activity ofvancomycin against the spirochete Borrelia burgdorferi. Antimicrob. AgentsChemother. 37:1115–1121.

9. Elias, A. F., J. L. Bono, J. A. Carroll, P. Stewart, K. Tilly, and P. Rosa. 2000.Altered stationary phase response in a Borrelia burgdorferi rpoS mutant. J.Bacteriol. 182:2909–2918.

10. Escudero, R., M. L. Halluska, P. B. Backenson, J. L. Coleman, and J. L.Benach. 1997. Characterization of the physiological requirements for thebactericidal effects of a monoclonal antibody to OspB of Borrelia burgdorferiby confocal microscopy. Infect. Immun. 65:1908–1915.

11. Fournier, T., N. N. Medjoubi, and D. Porquet. 2000. Alpha-1-acid glycopro-tein. Biochim. Biophys. Acta 1482:157–171.

12. Fraser, C. M., S. Casjens, W. M. Huang, G. G. Sutton, R. Clayton, R.Lathigra, O. White, K. A. Ketchum, R. Dodson, E. K. Hickey, M. Gwinn, B.Dougherty, J.-F. Tomb, R. D. Fleischmann, D. Richardson, J. Peterson, A. R.Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. van Vugt, N. Palmer,M. D. Adams, J. Gocayne, J. Weidmann, T. Utterback, L. Watthey, L. Mc-Donald, P. Artiach, C. Bowman, S. Garland, C. Fujii, M. D. Cotton, K. Horst,K. Roberts, B. Hatch, H. O. Smith, and J. C. Venter. 1997. Genomic sequenceof a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390:580–586.

13. Kelly, R. 1971. Cultivation of Borrelia hermsii. Science 173:443–444.14. Keyhani, N. O., and S. Roseman. 1997. Wild-type Escherichia coli grows on

the chitin disaccharide, N,N9-diacetylchitobiose, by expressing the celoperon. Proc. Natl. Acad. Sci. USA 94:14367–14371.

15. Keyhani, N. O., L. X. Wang, Y. C. Lee, and S. Roseman. 1996. The chitin cat-abolic cascade in the marine bacterium Vibrio furnissii. Characterization ofan N,N9-diacetyl-chitobiose transport system. J. Biol. Chem. 271:33409–33413.

16. Lai, X., and L. O. Ingram. 1993. Cloning and sequencing of a cellobiosephosphotransferase system operon from Bacillus stearothermophilus XL-65-6and functional expression in Escherichia coli. J. Bacteriol. 175:6441–6450.

17. Lane, R. S., J. Piesman, and W. Burgdorfer. 1991. Lyme borreliosis: relationof its causative agent to its vectors and hosts in North America and Europe.Annu. Rev. Entomol. 36:587–609.

18. Ohnishi, J., J. Piesman, and A. M. de Silva. 2001. Antigenic and geneticheterogeneity of Borrelia burgdorferi populations transmitted by ticks. Proc.Natl. Acad. Sci. USA 98:670–675.

19. Pavelka, M. S., Jr., and W. R. Jacobs, Jr. 1996. Biosynthesis of diaminopime-late, the precursor of lysine and a component of peptidoglycan, is an essen-tial function of Mycobacterium smegmatis. J. Bacteriol. 178:6496–6507.

20. Piesman, J. 1993. Dynamics of Borrelia burgdorferi transmission by nymphalIxodes dammini ticks. J. Infect. Dis. 167:1082–1085.

21. Piesman, J., J. R. Oliver, and R. J. Sinsky. 1990. Growth kinetics of the Lymedisease spirochete (Borrelia burgdorferi) in vector ticks (Ixodes dammini).Am. J. Trop. Med. Hyg. 42:352–357.

22. Reissig, J. L., J. L. Strominger, and L. F. Leloir. 1955. A modified colorimetricmethod for the estimation of N-acetylamino sugars. J. Biol. Chem. 217:959–966.

23. Rosa, P., D. S. Samuels, D. Hogan, B. Stevenson, S. Casjens, and K. Tilly.1996. Directed insertion of a selectable marker into a circular plasmid ofBorrelia burgdorferi. J. Bacteriol. 178:5946–5953.

24. Rudzinska, M. A., A. Spielman, S. Lewengrub, J. Piesman, and S. Kara-kashian. 1982. Penetration of the peritrophic membrane of the tick byBabesia microti. Cell Tissue Res. 221:471–481.

25. Samuels, D. S. 1995. Electrotransformation of the spirochete Borrelia burg-dorferi, p. 253–259. In J. A. Nickoloff (ed.), Methods in molecular biology.Humana Press, Inc., Totowa, N.J.

26. Schwan, T. G., J. Piesman, W. T. Golde, M. C. Dolan, and P. A. Rosa. 1995.Induction of an outer surface protein on Borrelia burgdorferi during tickfeeding. Proc. Natl. Acad. Sci. USA 92:2909–2913.

27. Sonenshine, D. E. 1991. Biology of ticks, p. 95–97. Oxford University Press,New York, N.Y.

28. Tilly, K., S. Casjens, B. Stevenson, J. L. Bono, D. S. Samuels, D. Hogan, andP. Rosa. 1997. The Borrelia burgdorferi circular plasmid cp26: conservation ofplasmid structure and targeted inactivation of the ospC gene. Mol. Micro-biol. 25:361–373.

29. Tilly, K., L. Lubke, and P. Rosa. 1998. Characterization of circular plasmiddimers in Borrelia burgdorferi. J. Bacteriol. 180:5676–5681.

30. Vieira, J., and J. Messing. 1991. New pUC-derived cloning vectors withdifferent selectable markers and DNA replication origins. Gene 100:189–194.

31. Yang, X., M. S. Goldberg, T. G. Popova, G. B. Schoeler, S. K. Wikel, K. E.Hagman, and M. V. Norgard. 2000. Interdependence of environmental fac-tors influencing reciprocal patterns of gene expression in virulent Borreliaburgdorferi. Mol. Microbiol. 37:1470–1479.

32. Zhu, Z., L. Gern, and A. Aeschlimann. 1991. The peritrophic membrane ofIxodes ricinus. Parasitol. Res. 77:635–641.

VOL. 183, 2001 B. BURGDORFERI chbC MUTANT 5553

on July 4, 2020 by guesthttp://jb.asm

.org/D

ownloaded from