Genetics and Recombinant DNA
description
Transcript of Genetics and Recombinant DNA
Genetics and Recombinant DNA
BIT 120
Cotton Pests
• Cotton Bollworm
How Do Farmers Deal With Pest Insects?
• Chemical Control
• Biological Control
Recombinant DNA
– Definition : DNA molecule produced artificially and containing sequences from unrelated organisms.
• Genetic Engineering
• Use of techniques involving recombinant DNA technology to produce molecules and/or organisms with new properties.
• Biotechnology
• All inclusive term for several technologies including but not limited to recombinant DNA. Refers to the use of technology in applications for solving fundamental problems in biology.
Restriction endonucleases
• Also called restriction enzymes: digest DNA at specific sequences
Sequence Recognition -R.E.
Restriction endonucleases -- cut double stranded DNA at specific sequences, protection against viruses in bacteria.
Sequences often palindromes: a sequence which is the same when read in either direction. ”A man a plan a canal: Panama”
Some common Restriction enzymes
Restriction digests and agarose gels - orientation
DNA ligase
DNA ligase joins 5'-phosphate and 3'-hydroxyl ends of DNA
Two fragments formed by EcoRI can be rejoined by ligase.
• Similarly, Eco RI fragments from two different pieces of DNA can be joined
Ligation
Plasmids
Extrachromosomal, circular small (2-3 kb) DNA in a bacterial cell which can replicate independently but which cannot integrate into the host chromosome.
Drug resistance plasmids are not essential for the cell's growth, but confer antibiotic resistance.
Plasmids used for molecular cloning have been artificially created by recombining fragments of various existing plasmids.
Plasmids contain multiple cloning sites with several restriction endonuclease sites.
Example of a Plasmid
Example of a plasmid + insert (DNA of interest)
Tools of recombinant DNA - cloning
Creating a Recombinant DNA molecule
A plasmid (vector) is digested with EcoRI at a single site to produce two sticky ends.
A sample of human DNA is also digested with EcoRI to produce pieces with the same sticky ends
Human DNA- or cDNA copied from mRNA using reverse transcriptase from retroviruses.
The two samples are mixed and allowed to hybridize, some molecules will form with pieces of human DNA inserted into the plasmid vector at the EcoRI site.
DNA ligase is used to covalently link the fragments.
Recombinant DNA molecule
Inserting recombinant DNA into Host
· Transformation
– cell made competent to take up DNA
– competent cells: electroporation – poke holes in membrane and calcium chloride- make cells more permeable to DNA
· Transfection
– when the cloning vector used has aspects of a virus, the host cell can be infected (transfected) to insert the recombinant molecule
· Electroporation
– the cell is placed in an electric field such that small pores are temporarily opened in the membrane. Added DNA can enter through these pores.
Transformation
Selection
– Antibotic resistance Plasmid vector contains an
ampicillin resistance gene making the cell resistant.
Growth of transformed cells (cells receiving the plasmid) can be identified on agar medium containing (e.g.) ampicillin.
Transformation
Further selection
The plasmid vector contains another identifiable gene (e.g., a second drug resistance or an enzyme activity), with the coding sequence of this gene containing the restriction site for insertion.
Insertion of the foreign DNA at this site interrupts the reading frame of the gene and result in insertional mutagenesis.
In the following example, the -galactosidase gene is inactivated. The substrate "X-gal" turns blue if the gene is intact, ie. makes active enzyme. White colonies in X-gal imply the presence of recombinant DNA in the plasmid.
X-gal selection
Cells ready for DNA uptake
• Competent cells: Treat the cells with calcium chloride which makes the cell membranes more permeable to DNA. This technique succeeds with species that aren't naturally competent e.g. E. coli.
• Electroporation - alternate method
Finding the proper orientation of clone
• Insert can go in both directions
• How to determine correct orientation
• Perform restriction digests using enzymes outside the cloning fragment
• Add total fragments up
• Must add up to right size
Link to Orientation
• http://homepages.strath.ac.uk/%7Edfs99109/BB211/RDTSampleAnswers.html
Finding the right Clone• Hybridization (see overhead as well)
Genomic library
• Source of DNA to clone
• all the cells in your body have identical DNA
• problem with this method is introns
Genomic Library Construction
cDNA libraries: alternate source(complimentary DNA library)
• Made from RNA by reverse transcription (reverse transcriptase is enzyme)
• RNA made into double stranded DNA• comes from tissue that expresses gene(s) of
interest• no introns• source abundant in message• difficult to work with- RNA degrades more
rapidly than DNA
cDNA library construction - step 1
cDNA library construction - step 2
cDNA library construction - step 3
Alternate cloning tool - PCR
• Polymerase chain reaction
• amplification of small DNA quantities
• clone from genomic or cDNA source
• thermostable polymerase - heat to separate DNA strands
PCR step 1: Denaturation
PCR step 2 - Annealing
PCR step 3 - Extension
After one round of PCR
After 2 rounds of PCR
After 3 round of PCR
Required Components of PCR
• DNA template DNA
• thermocycler (or water baths)
• pool of free dNTPs
• Taq (or other heat-stable) DNA polymerase
• Primers - annealed at appropriate temperatures
Conditions for PCR
• Denature: 94C to 100C , 1 minute
• For anneal temperature, 2C for every A and T, 4 C for every C and G. 1minute - 2 minutes - GO 3-5 DEGREES BELOW THAT TEMPERATURE
• Extension: 72 C for 2 minutes
• Do this 30 cycles
• machine programmable
Problem
• What is the annealing temperature for the following primer (a 21 mer)?:
AAGCTTGTCCAGAATTTCGGC
Solution
• 11 A/T X 2 = 22
• 10 C/G X 4 = 40
• 22 + 40 + 62
• Go a few degrees below that number, so you would anneal at about 58C
Applications of recombinant DNA
• Diagnosis of genes by RFLP (restriction fragment length polymorphisms)
• Example sickle cell anemia
RFLPrestriction fragment length polymorphism
converts a GAG codon (for Glu) to a GTG codon for Val
abolishes a sequence (CTGAGG, which spans codons 5, 6, and 7) recognized and cut by one of the restriction
enzymes.
Other diseases identified by RFLP
• Cystic fibrosis
• Huntington’s disease
• Loss (or gain) of restriction enzyme sites when amino acid change in middle of codon, and thus, protein
How do you know sequence of DNA?
• Sanger sequencing - named after Fred Sanger
• utilizes 2',3'-dideoxynucleotide triphospates (ddNTPs), molecules that differ from deoxynucleotides by the having a hydrogen atom attached to the 3' carbon rather than an OH group. (see upcoming figure)
Sanger (dideoxysequencing) sequencing
• Need polymerase
• dNTPs
• ddNTPs
• primer
• DNA template
Sanger method
Product of sequencing
Cellular expression systems
• Expression systems are based on the insertion of a gene into a host cell for its translation and expression into protein
• types of available systems
• . o Bacteria - e.g. Escherichia coli (E.coli), Bacillus subtilis (B. subtilis) o Yeast o Cultured insect cells – baculovirus or Drosophila o Cultured mammalian cells – HEK 293 cells, CHO cells
Bacteria
• Advantages:– short generation time– simple physiology– large yield of some proteins
• Disadvantages:– no post-translational modifications -
glycosylation, phosphorylation– degradation of proteins– misfolded proteins
Yeast
• Advantages:– can perform post-translational modifications– secrete proteins in media- easy to isolate from
there
• Disadvantages:– active proteases
Insect cells
• Advantages:– high expression level– correct folding– correct post-translational modification
• Disadvantages:– slow generation time– costly- media and cells– finicky
Mammalian cells
• Advantages:
– cellular machinery same as gene of interest
– folding, post-trans. Correct– amino acid bias the same
• Disadvantages:– expresses endogenous protein, need to find
correct cell line (by trial and error)
Mammalian Expression vectors
• Transient transfection - put into cells and protein expressed for a short period of time- usually 24 to 48 hours
• stable tranfection - integrated into genome- expression carried on indefinitely (need to select)
• expression vector allows for translation as well
Introducing DNA into cells
DEAE dextran - an inert carbohydrate polymer (dextran) coupled to a positively charged chemical group (diethylaminoethyl -DEAE). DNA probably sticks to DEAE-dextran via its negatively charged phosphate groups.
Calcium phosphate - forms an insoluble precipitate with DNA. It was discovered that cells efficiently take up this precipitate. More efficient than DEAE dextran or many cell types and can be used for both transient and stable transfection. Not suitable for cells which grow in suspension culture.
Introducing DNA into Cells
Electroporation - Cells are concentrated, mixed with the DNA and placed in a small chamber with electrodes connected to a specialised power supply. A brief electric pulse is applied, which is thought to ‘punch holes’ in the cell membrane, enabling the cell to take up DNA.
Lipofection - (liposome-mediated gene transfer) several lipid- based methods have been developed in which DNA is
encapsulated by synthetic lipid bilayers which resemble cell membranes. Liposomes are essentially spheres of synthetic membrane filled with DNA. These fuse spontaneously with cell membranes, releasing their contents into the cytoplasm.
Introducing DNA into cells
• Microinjection - The most efficient artificial means of getting DNA into cells. DNA is injected into the nucleus using a microelectrode needle. Very tedious method because each and every cell has to be injected individually. There are now computer-based systems which will assist in the process.
Creating a fusion protein
• Gene products are “fused” together, produced as a single polypeptide
• can then use a tag sequence to help isolate that protein
• can purify over a column and get rid of tag by cleavage (cutting)
Technique of Cell Culture
• Follow handout – 4 pages
• How did Tissue Culture develop
• What is Tissue Culture
• How is T.C. performed
• What can go wrong
• References