Genetic Interactions Between Regulators of …...Genetic Interactions Between Regulators of...

Copyright � 2009 by the Genetics Society of AmericaDOI: 10.1534/genetics.108.099382

Genetic Interactions Between Regulators of ChlamydomonasPhosphorus and Sulfur Deprivation Responses

Jeffrey L. Moseley,*,1 David Gonzalez-Ballester,*,2 Wirulda Pootakham,†,2

Shaun Bailey* and Arthur R. Grossman*,†

*Department of Plant Biology, Carnegie Institution for Science, Stanford, California 94305 and †Departmentof Biological Sciences, Stanford University, Stanford, California 94305

Manuscript received December 3, 2008Accepted for publication December 14, 2008

ABSTRACT

The Chlamydomonas reinhardtii PSR1 gene is required for proper acclimation of the cells to phosphorus(P) deficiency. P-starved psr1 mutants show signs of secondary sulfur (S) starvation, exemplified by thesynthesis of extracellular arylsulfatase and the accumulation of transcripts encoding proteins involved in Sscavenging and assimilation. Epistasis analysis reveals that induction of the S-starvation responses inP-limited psr1 cells requires the regulatory protein kinase SNRK2.1, but bypasses the membrane-targetedactivator, SAC1. The inhibitory kinase SNRK2.2 is necessary for repression of S-starvation responses duringboth nutrient-replete growth and P limitation; arylsulfatase activity and S deficiency-responsive genes arepartially induced in the P-deficient snrk2.2 mutants and become fully activated in the P-deficientpsr1snrk2.2 double mutant. During P starvation, the sac1snrk2.2 double mutants or the psr1sac1snrk2.2triple mutants exhibit reduced arylsulfatase activity compared to snrk2.2 or psr1snrk2.2, respectively, butthe sac1 mutation has little effect on the abundance of S deficiency-responsive transcripts in these strains,suggesting a post-transcriptional role for SAC1 in elicitation of S-starvation responses. Interestingly,P-starved psr1snrk2.2 cells bleach and die more rapidly than wild-type or psr1 strains, suggesting thatactivation of S-starvation responses during P deprivation is deleterious to the cell. From these results weinfer that (i) P-deficient growth causes some internal S limitation, but the S-deficiency responses arenormally inhibited during acclimation to P deprivation; (ii) the S-deficiency responses are not completelysuppressed in P-deficient psr1 cells and consequently these cells synthesize some arylsulfatase and exhibitelevated levels of transcripts for S-deprivation genes; and (iii) this increased expression is controlled byregulators that modulate transcription of S-responsive genes during S-deprivation conditions. Overall, thework strongly suggests integration of the different circuits that control nutrient-deprivation responses inChlamydomonas.

THE elements phosphorus (P) and sulfur (S) areessential macronutrients for sustaining life. P is a

structural component of nucleic acids and phospholi-pids, and is a ubiquitous modifier of carbohydrates andproteins, while S is incorporated into sulfolipids,polysaccharides, proteins, cofactors, and a wide varietyof important metabolites including S-adenosyl-methio-nine, glutathione, and phytochelatins. The preferredforms of P and S that are assimilated by plants andmicrobes are the orthophosphate ion, PO4

3� (Pi), andthe sulfate ion, SO4

2�. The available pools of theseanions can vary significantly as environmental con-ditions change. Most organisms have a limited capacityto store S, and thus require a continual supply ofS-containing nutrients for survival. In contrast, cellsoften have considerable reserves of P, which are boundin polymers of DNA, RNA, and polyphosphate. The

ability of microbes to acclimate to periods of nutrientinsufficiency is essential to their survival in the naturalenvironment (reviewed by Grossman and Takahashi

2001).The green, unicellular alga Chlamydomonas reinhardtii

(Chlamydomonas throughout) exhibits both specificand general responses when experiencing P or S dep-rivation. The general responses are common to anumber of different stress conditions, while the specificresponses enable processes that are advantageous dur-ing particular nutrient deficiencies, often allowing forbetter scavenging of the limiting nutrient from internaland external stores. P and S limitation elicit qualitativelysimilar effects on growth and photosynthesis, differingonly in that the responses to S starvation occur morequickly following exposure of cells to medium devoid ofS. General responses to nutrient limitation that havebeen analyzed include the cessation of growth at low celldensities (Shimogawara et al. 1999; Zhang et al. 2002)and a reduction in photosynthetic O2 evolution, which ismostly a consequence of reduced photosystem II (PS II)

1Corresponding author: Carnegie Institution for Science, 260 Panama St.,Stanford, CA 94305. E-mail: [email protected]

2These authors contributed equally to this study.

Genetics 181: 889–905 (March 2009)

activity (Wykoff et al. 1998). The specific S-deprivationresponses include an elevated rate of extracellularSO4

2� uptake (Yildiz et al. 1994), secretion of extracel-lular arylsulfatases (Lein and Schreiner 1975; de

Hostos et al. 1988), and an increased cellular capacityto assimilate SO4

2� by increasing levels of enzymesrequired for cysteine biosynthesis (Ravina et al. 2002).Mechanisms for conserving S during limiting condi-tions include the rapid turnover of sulfolipids and theirreplacement with phospholipids (Sugimoto et al. 2007,2008), the synthesis of putative cell wall proteins witha very low abundance of S-containing amino acids(Takahashi et al. 2001), and a potential change in thepolypeptide composition of light harvesting complexes,favoring the synthesis of complexes with polypeptidescontaining low levels of sulfur amino acid (Nguyen et al.2008). Many S starvation-elicited responses appear to becontrolled, at least in part, at the level of gene expres-sion. Genes encoding the arylsulfatases (de Hostos

et al. 1989; Ravina et al. 2002), extracellular proteins(Takahashi et al. 2001), ATP sulfurylase (Yildiz et al.1996), adenylylphosphosulfate reductase, serine O-ace-tyl transferase, OAS (thiol)-lyase (Ravina et al. 2002),sulfite reductases, and putative SO4

2� transporters(Zhang et al. 2004), are upregulated in cells deprivedof S.

A suite of specific responses also enables Chlamydomo-nas to acclimate to P limitation. P-starved cells inducehigh-affinity Pi uptake (Shimogawara et al. 1999) andsynthesize extracellular phosphatases (Quisel et al. 1996)that enhance Pi scavenging from the environment.Polyphosphate stores (Hebeler et al. 1992; Werner et al.2007) and chloroplast DNA (Yehudai-Resheff et al. 2007)are also mobilized, and phospholipids are replaced bygalactolipids and sulfolipids (Riekhof et al. 2003) as cellsredistribute their internal P resources. P-starved cells alsoconserve Pi by inhibiting the turnover of chloroplasttranscripts by the phosphorylytic chloroplast polynucleo-tide phosphorylase (Yehudai-Resheff et al. 2007). Like S-deprivation responses, P deficiency-specific responses areoften regulated at the level of gene expression, as tran-scripts encoding extracellular phosphatases and Pi trans-porters increase markedly in abundance followingelimination of P from the growth medium (Kobayashi

et al. 2003; Chang et al. 2005; Moseley et al. 2006).Screens for mutants that fail to acclimate properly to S

limitation have enabled identification of three keyregulators of the S-deficiency responses (Davies et al.1994; Pollock et al. 2005). The Sulfur Acclimation 1(SAC1) gene encodes an integral membrane proteinthat is similar to the SLC13 family of transporters(Davies et al. 1996). SAC1 is a positive regulator criticalfor the activation of genes involved in scavenging andassimilating S from the environment (Davies et al. 1996;Ravina et al. 2002; Zhang et al. 2004; Gonzalez-Ballester et al. 2008). The light sensitivity of S-deficient sac1 strains probably reflects their inability to

decrease photosynthetic electron transport (Davies et al.1994; Wykoff et al. 1998), although the role of SAC1 inthe regulation of photosynthesis is not well understood.The SNF1-related protein kinase 2.2 (SNRK2.2) gene, pre-viously known as SAC3 (for Sulfur Acclimation 3), encodesa serine/threonine kinase that acts as a negative regula-tor of S deficiency-responsive gene expression (Davies

et al. 1999). The snrk2.2 mutants display low, constitutivearylsulfatase activity and express elevated basal levels ofS deficiency-responsive genes in S-replete medium(Davies et al. 1994; Davies et al. 1999; Ravina et al.2002; Gonzalez-Ballester et al. 2008). SNRK2.2 is alsorequired for the proper downregulation of chloroplasttranscription in S-starved cells (Irihimovitch andStern 2006). There is no clear epistasis relationshipbetween SAC1 and SNRK2.2. The sac1snrk2.2 doublemutants have lower constitutive arylsulfatase activity thansnrk2.2 cells when grown under nutrient-replete con-ditions, but in contrast to the sac1 single mutants, thedouble mutants can still partially upregulate ARS geneexpression in response to S deficiency (Davies et al.1994). A related serine-threonine kinase, SNRK2.1, hasrecently been shown to perform a central regulatory func-tion in controlling S-starvation responses (Gonzalez-Ballester et al. 2008). The snrk2.1 mutants are unableto activate expression of most S starvation-responsivegenes and cannot maintain normal basal levels ofexpression for some genes during S-replete growth. Asnrk2.1 null allele is even more light sensitive during Sstarvation than sac1, suggesting that SNRK2.1 also plays arole in modulating photosynthetic activity during Sstarvation (Gonzalez-Ballester et al. 2008). In con-trast to the nonepistatic relationship between SAC1 andSNRK2.2, the phenotype of a snrk2.1snrk2.2 doublemutant is indistinguishable from that of the snrk2.1single mutant, indicating that SNRK2.1 is epistatic toSNRK2.2 (Gonzalez-Ballester et al. 2008). Modelsbased on genetic data propose that SAC1, SNRK2.1,and SNRK2.2 interact to form a signaling cascade thatsenses the cellular S status, maintains basal levels of thetranscripts encoded by the S-responsive genes in S-replete cells, and activates (or represses) the expressionof target genes during S limitation (Pollock et al. 2005;Gonzalez-Ballester et al. 2008).

To date, a single regulator of P-deficiency responsivegene expression, encoded by the Phosphate StarvationResponse 1 (PSR1) gene, has been identified (Wykoff

et al. 1999). Two independent genetic screens resulted inthe generation of multiple psr1 alleles (Shimogawara

et al. 1999). The psr1 strains fail to accumulate extracel-lular phosphatases or activate high-affinity Pi uptakeduring P starvation, and consequently grow poorly ona hydrolysable P source such as glucose-1-phosphate(Shimogawara et al. 1999). In contrast to the pheno-type of S-deprived sac1 strains, P-starved psr1 cellsdownregulate photosynthesis more rapidly than wild-type cells (Shimogawara et al. 1999). Nevertheless,

890 J. L. Moseley et al.

when psr1 cells are deprived of P they become moresensitive to high light intensities than wild-type cells(Moseley et al. 2006).

PSR1 is a complex protein with characteristics of trans-criptional regulators, including a DNA-binding MYBdomain (reviewed by Lipsick 1996), a coiled-coildomain that may be involved in protein–protein inter-actions (reviewed by Burkhard et al. 2001) and a helix-loop-helix motif (reviewed by Jones 2004). The C-terminal region of PSR1 is rich in glutamine, a commonfeature of transcriptional activators (reviewed by Pabo

and Sauer 1992). More than 95% of PSR1 is located inthe nucleus, irrespective of cellular P status (Wykoff

et al. 1999). Although sequence-specific DNA bindinghas not been demonstrated for PSR1, the Arabidopsisthaliana homolog, PHR1, has been shown to bind reg-ulatory motifs in the promoters of P-starvation induciblegenes (Rubio et al. 2001). The vascular plant homologsof PSR1 contain similar DNA binding and protein–protein interaction domains, but lack the glutamine-richtranscriptional activation domains of the algal protein(Wykoff et al. 1999; Rubio et al. 2001). Candidate genetargets under PSR1 control have been identified on thebasis of altered transcript accumulation in P-deficient vs.P-replete conditions, and the loss of differential geneexpression in psr1 mutants (Moseley et al. 2006). PSR1controls expression of genes encoding enzymes with rolesin P scavenging, including the major secreted phospha-tase, PHOX, putative high-affinity Pi transporters, andproteins potentially involved in mobilizing polyphos-phate from internal stores. It has also been implicatedin the activation of genes whose products may reduce theaccumulation of excitation energy in the photosyntheticcomplexes during P starvation (Moseley et al. 2006).

Studies of fungal and plant model systems havedemonstrated that various regulatory pathways linkedto nutrient-deprivation responses have a set of com-mon target genes (reviewed by Gasch and Werner-Washburne 2002). Many genes that allow cells to copewith stress (e.g., a decreased potential for growth be-cause of suboptimal conditions) are regulated similarlyin Saccharomyces cerevisiae during P and S deprivation(Saldanha et al. 2004). A more specific intersectionbetween the regulation of P and S metabolism in S.cerevisiae was demonstrated with the finding that Pho4p,a P deprivation-responsive transcription factor, couldfunctionally substitute for the sequence-specific DNA-binding protein Cp1p, which is required for activationof methionine biosynthetic genes. Activation of Pho4pby P deprivation, overexpression of Pho4p, and the useof constitutive alleles, all resulted in suppression of me-thionine auxotrophy in the S. cerevisiae cep1 mutant,which lacks the Cp1p factor (O’Connell and Baker

1992). In this study we explore genetic interactionsbetween the regulators of P- and S-starvation responsesin Chlamydomonas, and provide evidence supportingthe integration of these pathways.

MATERIALS AND METHODS

Media and growth conditions: Tris-acetate-phosphate(TAP) medium was made according to the standard recipe(Gorman and Levine 1966). To make Pi-free (TA) medium,potassium phosphate (1.8 mm potassium, 1.1 mm Pi) wasreplaced with 1.8 mm potassium chloride. SO4

2�-free (TAP�S)medium was prepared by substituting chloride salts for theSO4

2� salts. Solid medium contained 0.75% agarose; TA plateswere always supplemented with 100 mm glucose-1-phosphatewhile TAP �S plates always contained 2 mm sodium or po-tassium thiocyanate (cells grew identically with either cation).TA liquid medium was not supplemented with glucose-1-phosphate, and TAP �S was not supplemented with thiocya-nate. Liquid cultures were grown in Erlenmeyer flasks at 25�,with agitation at 200 rpm, and under fluorescent bulbs atintensities of 30–40 mE m�2 s�1. Dark-grown liquid cultureswere grown similarly except that the flasks were securelywrapped in aluminum foil and were only exposed to light for�5 min during sampling. Cells on plates were grown at 25� at40–70 mE m�2 s�1.

Chlorophyll measurements and viability staining: To de-termine the chlorophyll content of liquid cultures, 0.75 ml of cellculture were transferred to a 1.5-ml eppendorf tube and cen-trifuged for 5 min at 13,800 3 g to pellet the cells. Thesupernatant was discarded and the chlorophyll in the pelletwas extracted with 0.75 ml of a mixture of 80% acetone, 20%methanol. The chlorophyll concentration per ml of culturedcells was estimated from the absorbance at 652 nm divided by34.5 (Arnon 1949). Viablity staining with Evans blue dye wasperformed as described previously (Yehudai-Resheff et al. 2007).

Phosphatase and sulfatase assays: Colorimetric assays foralkaline phosphatase (Shimogawara et al. 1999) and arylsulfa-tase (Davies et al. 1994) activities were performed. Cells weregrown on solid medium for 4–5 days and the color reactionswere allowed to develop for 20–24 hr before the cells werewashed from the surface of the medium with deionized water toallow examination of the colored precipitate embedded in themedium. Liquid assays for alkaline phosphatase and arylsulfa-tase activities were performed as described previously (Lein

and Schreiner 1975; de Hostos et al. 1988; Quisel et al. 1996).Strains and genetic analysis: A comprehensive list of strains

used in these studies is presented in Table 1. Wild-type strainswere CC-125 (nit� mt1) and CC-1690 (nit1 mt1). The psr1strains were psr1-1nit�mt1 which had been backcrossed five tosix times with CC-124 and CC-125, and psr1-2 (psr1-2TARG7cw15nit�) (Shimogawara et al. 1999). The psr1-1 mutant wascomplemented with plasmid pKS1, containing a genomicPSR1 sequence (Wykoff et al. 1999), to generate the psr1-complemented strain. A psr1-1nit�mt� strain was backcrossedthree times to CC-1690 to generate the psr1-1nit1 mt� strain,which was used in subsequent experiments and for a numberof crosses. psr1 progeny were scored as growing poorly on TA 1glucose-1-phosphate plates and failing to express abundantalkaline phosphatase on the basis of the colorimetric assay forthis activity (Shimogawara et al. 1999). The sac1 mutant (ars5-3nit�mt�) (Davies et al. 1994) was backcrossed three times toCC-1690 to produce a sac1(ars5-3) nit1 mt1 strain, while asnrk2.2 strain [sac3(are10)nit� mt�] (Davies et al. 1994) wascrossed once to CC-1690 to produce a snrk2.2(are10)nit1strain. The psr1-1nit1 mt� strain was crossed to sac1(ars5-3)nit1 mt1, sac1(ars4-15)nit� mt1 and sac1(ars4-55)nit� mt1.The sac1 progeny were identified by their inability to synthe-size arylsulfatase on TAP �S 1 2 mm thiocyanate plates. Arepresentative sac1(ars5-3) mutant and a psr1sac1(ars5-3) doublemutant from a tetratype tetrad were used for gene expressionstudies and enzyme activity assays. The snrk2.2(are10)nit1 mt1and snrk2.2(are16)cw15mt1 strains (Davies et al. 1999) were

Crosstalk Between P- and S-Deprivation Responses 891

crossed to psr1-1nit1 mt�. The snrk2.2 progeny were recognizedon the basis of their constitutive arylsulfatase activity on TAPmedium. Representative snrk2.2(are10) and psr1snrk2.2(are10)strains were chosen from a tetratype tetrad for furtheranalyses. Representative snrk2.1(ars11) and psr1snrk2.1(ars11)strains were selected by crossing psr1-1nit1 mt� to thesnrk2.1TaphVIII(ars11)nit� cw15mt1 strain (Pollock et al.

2005; Gonzalez-Ballester et al. 2008). The snrk2.1 mutants,which are paromomycin resistant due to integration of theaphVIII gene, grew poorly and did not induce arylsulfataseon TAP �S 1 thiocyanate (Pollock et al. 2005; Gonzalez-Ballester et al. 2008). Triple mutants were generated bycrossing the appropriate double-mutant strains, and a repre-sentative sac1snrk2.2(are10) strain was selected from the progeny

TABLE 1

Chlamydomonas strains used in this study

Name Genotype Parental strains Figure(s) Reference

CC-125a Wild type, nit1nit2 NA 1 and S1CC-1690 Wild type, nit1 NA 2–5, S1 and S2psr1-1 psr1-1cw1nit�mt� psr1-1cw15 3 CC-124, CC-125,

backcrossed 3 51, B and C Shimogawara

et al. (1999)psr1-1 (66) psr1-1cw1nit�mt1 psr1-1 3 CC-125 1, A and D–E This studypKS1 #19 psr1-1cw1nit� complemented

with PSR1 genomic clonepsr1-1cw 1 nit�mt 1, A–C and E This study

psr1(A4) psr1-1cw1nit1mt� CC-1690 3 psr1-1cw 1 nit � mt1,backcrossed 3 3

2–5, S1, and S2 This study

psr1-2 psr1-2cw15 psr1-2cw15 3 CC-124, CC-125,backcrossed 3 4

S1 Shimogawara

et al. (1999)sac1(ars5-3) sac1(ars5-3)cw15nit1mt� CC-2267 3 ars5-1 Davies et al. (1996)sac1(B2) sac1(ars5-3)cw1nit1mt1 CC-1690 3 sac1(ars5-3)cw15nit1,

back-crossed 3 3S1 This study

sac1(E3) sac1(ars5-3)cw1nit1 psr1(A4) 3 sac1(B2) 3, 4, and S1 This studyCC-3801 sac1(ars4-15)nit� CC-425 J. Davies

(unpublished data)CC-3802 sac1(ars4-55)nit� CC-425 J. Davies

(unpublished data)snrk2.2(are10) snrk2.2(are10)cw1nit1mt1 CC-1690 3 CC-3798 Davies et al. (1999)snrk2.2(D2) snrk2.2(are10)cw1nit1 psr1(A4) 3 snrk2.2(are10) 3, 4, and S1 This studyCC-3800 snrk2.2(are16)cw15mt1 CC-425 Davies et al. (1999)snrk2.2 (29) snrk2.2(are16)cw1 nit1 psr1(A4) 3 CC-3800 S1 This studysnrk2.1(ars11) snrk2.1(ars11)cw15nit2mt1 D66 Pollock

et al. (2005) andGonzalez-Ballester

et al. (2008)snrk2.1(D3) snrk2.1(ars11)cw1nit1 psr1(A4) 3 ars11 3, 4, and S1 This studysnrk2.1(F2) snrk2.1(ars11)cw1nit1 psr1(A4) 3 ars11 S1 This studysac1snrk2.2(F3) sac1(ars5-3)snrk2.2(are10)

cw1nit1CC-1690 3 psr1sac1snrk2.2(A1) 3, 4, and S1 This study

psr1sac1(E1) psr1-1sac1(ars5-3)cw1nit1 psr1(A4) 3 sac1(B2) 3, 4, and S1 This studypsr1sac1(H3) psr1-1sac1(ars5-3)cw1nit1 psr1(A4) 3 sac1(B2) S1 This studypsr1sac1(49) psr1-1sac1(ars5-3)cw1nit� psr1-1(66) 3 sac1(ars5-3) S1 This studypsr1ars4-15 psr1-1sac1(ars4-15) nit1 psr1(A4) 3 CC-3801 This studypsr1ars4-55 psr1-1sac1(ars4-55) nit1 psr1(A4) 3 CC-3802 This studypsr1snrk2.2(D3) psr1-1snrk2.2(are10)cw1nit1 psr1(A4) 3 snrk2.2(are10) 3–5, S1, and S2 This studypsr1snrk2.2(N1) psr1-1snrk2.2(are10)cw1nit1 psr1(A4) 3 snrk2.2(are10) S1 This studypsr1snrk2.2(#28) psr1-1snrk2.2(are16)cw1 psr1(A4) 3 CC-3800 S1 This studypsr1snrk2.1(B1) psr1-1snrk2.1(ars11)cw1nit1 psr1(A4) 3 ars11 3, 4, and S1 This studypsr1snrk2.1(A3) psr1-1snrk2.1(ars11)cw1nit1 psr1(A4) 3 ars11 S1 This studypsr1sac1snrk2.1(A3) psr1-1sac1(ars5-3)snrk2.1

(ars11)cw1nit1psr1sac1mt� 3 psr1snrk2.1mt1 3, 4, and S1 This study

psr1snrk2.2snrk2.1(A2)

psr1-1snrk2.2(are10)snrk2.1(ars11)cw1nit1

psr1snrk2.2mt� 3 psr1snrk2.1mt1 3, 4, and S1 This study

psr1sac1snrk2.2(A1) psr1-1sac1(ars5-3)snrk2.2(are10)cw1nit1

psr1sac1mt� 3 psr1snrk2.2mt1 3–5, S1, and S2 This study

psr1sac1snrk2.2(D1) psr1-1sac1(ars5-3)snrk2.2(are10)cw1nit1

psr1sac1mt� 3 psr1snrk2.2mt1 S1 This study

NA, not applicable.a Strains used for enzyme and transcript assays presented in this study are boldface.


of a backcross of the psr1sac1snrk2.2(are10) strain to CC-1690.The presence of the sac1(ars5-3) and snrk2.2(are10) alleles in therespective triple-mutant strains was verified by amplificationof the pJD76 and pJD67 insertional markers from isolatedgenomic DNA (see Davies et al. 1994 and supplemental data).cw1 nit1 representative mutant strains were selected forphenotypic and epistasis analysis to eliminate any potentialcontributions to the observed phenotypes by the cw15, nit1, ornit2 mutations. Although for some genotypes the phenotypicexpressivity varied significantly between individual isolates, allof the representative strains used in the experiments describedin the results section were selected because they displayedaverage responses within an observed phenotypic range.

RNA isolation: Total RNA was isolated using a protocolmodified from Schloss et al. (1984). Briefly, cells from 50 mlof culture were pelleted by centrifugation, frozen in liquid N2,and stored at �80�. The pelleted cells were kept frozen untilthey were lysed in 3 ml of a solution containing 50 mm Tris-HCL pH 7.5, 150 mm sodium chloride, 15 mm EDTA pH 8, 2%SDS and 40 mg/ml proteinase K (Invitrogen, Carlsbad, CA).The aqueous emulsion of lysed cells was extracted fourtimes with 3 ml of a 50:50 mixture of acidic (pH 4.5) phenol(United States Biochemicals, Cleveland) and chloroform(Fisher, Pittsburgh), followed by two extractions with 3 mlchloroform (Fisher). Nucleic acids were precipitated by add-ing 3 ml (volume equal to the original cell suspension volume)of 8 m lithium chloride to the extracted solution, incubatingthe mixture at 4� for at least 4 hr and then collecting thenucleic acids by centrifugation at 14,500 3 g for 30 min.Nucleic acid pellets were washed with 70% ethanol, vacuum-dried, and dissolved in water. Trace DNA contamination wasremoved by digestion with TurboDNase (Ambion, Austin, TX)according to the manufacturer’s instructions.

Real-time quantitative RT–PCR: Real-time quantitativeRT–PCR was performed using the iScript One-Step RT–PCRkit with SYBR green and the Chromo4 Real-Time System (Bio-Rad Laboratories, Hercules, CA) according to the protocoldescribed previously by Moseley et al. (2006). The primersfor amplification were: CBLP, forward (59-CTTCTCGCCCATGACCAC-39), reverse (59-CCCACCAGGTTGTTCTTCAG-39);PHOX, forward (59-TTCCGTTTCCGTTCTCTGAC-39), reverse(59-CCCTGCATCTTGTTCTCCAG-39); ARS1, forward (59-CGCGCCGTCACTTGTTTGTTG-39), reverse (59- GCCCACTTCTTTACCCAGCACCTC-39); ARS2, forward (59-GTACTGCCGCGTGCGTGATTCC-39), reverse (59-CCTAAACATTTGGCTCCGCAGTCC-39); SLT1, forward (59- ACGGGTCTTCGAGCGAATTGC -39), reverse (59-CGACTGCTTACGCAACAATCTTGG-39);SLT2, forward (59-GTACGGAGTTCC TTACGCGC-39), re-verse (59-TTCTTCGCCACCGATGAGC-39); SULTR2, forward(59- ACGTGGCATGCAGCTCAT-39), reverse (59-CTTGCCACTTTGCCAGGT-39); SAT1, forward (59-TGCGGCACCCTTTCCCAGAG-39), reverse (59-CACCCGATCACACGCAAACTTCA-39); OASTL4, forward (59-GGCCCTCCTGGAAGCTGAATCA-39), reverse (59-CCCCACCCCACCCATTAGTAGTC-39);ECP76, forward (59-CCTCGCTCTCCTCGCTGCTG-39), re-verse (59-CGGCCGACTTGGGTAATTGC-39); SBDP, forward(59-GGACGGCAGCATCATGGTGAGC-39), reverse (59-TCCACACGCCCTTGACCTTGAG-39). The sizes of the amplifica-tion products range from 100 to 300 bp. The purity of PCRamplification products was assessed by melting curve analysisand by gel electrophoresis.

RESULTS

Arylsulfatase is induced in P-starved psr1 cells: Thepsr1 mutants, represented by psr1-1 in this study, are

unable to acclimate properly to P starvation and con-sequently bleach and exhibit much less growth thanwild-type strains on TA medium supplemented withglucose-1-phosphate as the sole P source (Shimogawara

et al. 1999) (Figure 1A, growth, �P 1S). The P-starvedpsr1 strain also displays very low phosphatase activitycompared with the wild-type strain CC-125 or the psr1mutant that was complemented with the PSR1 gene(Shimogawara et al. 1999; Wykoff et al. 1999) [Figure 1,A (phosphatase activity, �P 1S) and B]. However, wenoted that psr1 cells exhibit significant arylsulfataseactivity in Pi-free medium, and that this activity is notobserved in the wild-type or the psr1-complementedstrains [Figure 1, A (sulfatase activity, �P 1S) and C].Similar induction of arylsulfatase is observed when thepsr1-2 strain is starved for Pi (see supplemental FigureS1). The activation of arylsulfatase in P-deficient psr1 cellsis not a consequence of secondary light stress sincesimilar arylsulfatase activity is produced by psr1 cellsgrown without Pi in the light or in the dark (compareFigure 1, C and D). The wild-type, psr1, and psr1-complemented strains all show copious arylsulfataseactivity after growth in SO4

2�-free medium [Figure 1, A(sulfatase activity, 1P�S) and E], indicating that the psr1mutation shows no apparent alteration in normal accli-mation responses to S deprivation. The arylsulfataseactivity measured for psr1 cells after 7 days of P starvationis �7% of the peak activity measured after 24 hr of Sstarvation (compare Figure 1, C and E).

Activation of SO42�-assimilation pathway genes in

P-deficient psr1 cells: A previous study analyzed globalpatterns of P deficiency-responsive gene expression inthe parental wild-type strain and the psr1 mutant,demonstrating that a number of genes encoding pro-teins associated with S assimilation were upregulated inP-starved psr1 cells (Moseley et al. 2006). To validatethese results we used quantitative real-time PCR tocompare the relative abundance of transcripts from across section of genes involved in S scavenging andassimilation. After 24 hr of P deprivation in wild-typecells, the transcript abundance of PHOX, which encodesthe major, derepressible secreted phosphatase, increasedby �5000-fold, whereas expression of the S-assimilationgenes either remained constant or declined slightly(Figure 2). In contrast, psr1 cells grown for 24 hr inP-free medium failed to upregulate PHOX, but ex-hibited �30- to 200-fold increases in the levels of theARS1 and ARS2 transcripts, which encode the major,secreted arylsulfatase enzymes (Figure 2). Althougharylsulfatase activity steadily increased in P-deficientpsr1 cultures over a 7-day period (Figure 1C), the peakabundance of ARS2 transcripts was observed at 24 hrafter the cells were transferred to medium devoid of Pi(data not shown). The SLT1 and SLT2 transcripts,encoding putative Na1/SO4

2� transporters, increase inabundance by �2000-fold and �50-fold, respectively,compared to the transcript levels in P-replete cells


(Figure 2). The amount of the SULTR2 transcript, whichencodes a putative H1/SO4

2� transporter, increased inthe psr1 strain by �40-fold after 24 hr of P starvation.Smaller increases of between 2.5- and 20-fold wereobserved for SAT1, OASTL4, ECP76, and SBDP mRNAs,

encoding, respectively, a serine acetyl-transferase, anO-acetyl-serine(thiol)lyase (cysteine synthase), an extra-cellular protein potentially associated with the cell walland a putative selenium-binding protein. It should benoted that the maximum levels of all of these transcripts

Figure 1.—psr1 growth and hydrolytic activity. (A) Growth, phosphatase, and sulfatase activities of wild-type (CC-125), psr1, andpsr1-complemented strains on solid agar media. 1P 1S plates were made with TAP medium, which contains 1.1 mm Pi and 0.4 mm

SO42�. �P 1S plates were made with TA medium, containing no added Pi, but supplemented with 100 mm glucose-1-phosphate.

1P �S plates contained 2 mm potassium thiocyanate, but no added SO42�. Cells were grown for 5 days and then assayed for phos-

phatase and sulfatase activity using the colorimetric assays described in materials and methods. The colorimetic assays weredeveloped over an �24-hr period. (B) Quantitative analysis of phosphatase activity over 7 days of growth in TA liquid medium(no added Pi, no glucose-1-phosphate) for wild-type, psr1, and the psr1-complemented strain. Alkaline phosphatase activity is rep-resented as absorbance at 410 nm of p-nitrophenol produced per milligram of chlorophyll. Data points are the average of du-plicate measurements, 6 SD. (C) Arylsulfatase activity in the same cultures was measured using a similar method to thatdescribed in B and as reported by Davies et al. (1994). (D) Alkaline phosphatase (AP) and arylsulfatase activity (ARS) inwild-type and psr1 cultures grown for 3 days in the dark in TAP (1P) vs. TA (�P) medium. Enzyme activities were normalizedto equal cell number (A410 per 4 3 108 cells) rather than equal chlorophyll in this experiment, since dark-grown cells accumulateless chlorophyll than cells grown in the light (Ford et al. 1981). However, for these strains, this number of cells (in the light) isapproximately equivalent to 1 mg of chlorophyll (Moseley et al. 2002), so the enzyme activites are roughly comparable between B,C, D, and E. (E) Arylsulfatase activity in TAP and after 24 hr of growth in TAP �S medium.


in psr1 cells starved for P were one to two orders ofmagnitude below peak levels attained for wild-type cellsstarved for S (Gonzalez-Ballester et al. 2008; D.Gonzalez-Ballester and W. Pootakham, unpublishedresults). The results shown in Figures 1 and 2 clearlydemonstrate that the regulatory pathway that controls Sdeficiency-responsive gene expression is partially acti-vated in P-starved psr1 cells.

Epistasis analysis of PSR1 and regulators of theS-deficiency response: Are components of the signal

transduction pathway that elicit changes in gene ex-pression during S starvation also involved in theaberrant activation of S-assimilation genes in P-starvedpsr1 cells? To investigate the relationship between PSR1and genes that encode regulators of S-deficiency accli-mation responses, the psr1-1 mutant was crossed to sac1,snrk2.2, and snrk2.1 strains. As mentioned in the in-troduction, SAC1 and SNRK2.1 encode a putative sensorand serine/threonine kinase, respectively, that arerequired for activation of S deficiency-responsive gene

Figure 2.—Expressionof S deficiency-responsivegenes in P-starved wild-typeandpsr1mutantcells.Relativeabundance of P deficiencyand S deficiency-responsivetranscripts compared to thethe CBLP control transcriptin wild-type (CC-1690) andpsr1 cells grown in TAP, andafter 24 hr of growth in TA.Relative transcript abun-dance is calculated fromthe equation 2�DC(t) 3 105.PHOX encodes alkalinephosphatase, ARS1 encodesarylsulfatase 1, ARS2 enco-des arylsulfatase 2, SLT1encodes SAC1-like SO4

2�-transporter 1, SLT2 encodes

SAC1-like SO42�-transporter 2, SULTR2 encodes a putative H1/SO4

2� transporter, SAT1 encodes serine acetyl transferase, OASTL4encodes O-acetyl serine (thiol)lyase 4, ECP76 encodes a 76-kDa extracellular protein, and SBDP encodes a putative selenium-bindingprotein. Results from two independent experiments are shown.

TABLE 2

Summary of arylsulfatase (ARS) activity and S deficiency-responsive gene expression phenotypesin psr1 and S-deficiency acclimation regulatory mutants

1P 1S �P 1S 1P �S

Genotype ARS activity �S expression ARS activity �S expression ARS activity �S expression

Wild type � � � � 1111 1111

psr1 � � 1 1 1111 NDsac1 � � � � �/1a �/1

psr1bsac1 � � 1 1 �/1 NDsnrk2.2 1 1 1 11 111 1111

psr1snrk2.2 1 1 1111 111 111 NDsac1snrk2.2 1 1 1 11 11 1c

snrk2.1 � � � � � �psr1snrk2.1 � � � � � NDpsr1sac1snrk2.1 � � � � � NDpsr1snrk2.1snrk2.2 � � � � � NDpsr1sac1snrk2.2d 1 1 1 111 11 ND

Arylsulfatase activity and �S transcript abundance are represented on an arbitrary scale from � to 1111, where � representsbasal levels and 1111 represents maximum levels. ND, not done.

a Some sac1 strains produce limited amounts of arylsulfatase and activate the expression of �S genes slightly. This variation isrepresented by 1/�.

b Epistatic lesions are boldface.c The only data on �S gene expression for this genotype are from RNA blot analysis of ARS2 by Davies et al. (1994).d The synergistic epistasis relationship between PSR1 and SNRK2.2 is maintained with respect to gene expression, but not with

respect to arylsulfatase activity.


expression (Davies et al. 1996; Gonzalez-Ballester

et al. 2008). SNRK2.2 encodes a serine/threonine kinasethat acts as a negative regulator of S deficiency-responsive gene expression (Davies et al. 1999; Ravina

et al. 2002). Assays for growth, alkaline phosphataseactivity, and arylsulfatase activity were used to comparethe acclimation response phenotypes of wild-type, psr1,sac1, snrk2.2, snrk2.1, and combinations of double andtriple mutants during P and S starvation (Figure 3 andTable 2). In control experiments, strains with wild-typePSR1 exhibited normal induction of phosphatase activ-ity in �P medium, but only low, basal levels of activitywere observed for strains carrying the psr1-1 allele[Figure 3, A (column 7) and B]. Conversely, after 24hr of S starvation arylsulfatase expression was blocked inall strains containing the snrk2.1 allele and in sac1strains that did not also contain the snrk2.2 mutation[Figure 3, A (column 6) and D]. As has been reportedpreviously, snrk2.2 strains have low, constitutive arylsul-fatase activity in S-replete medium, and accumulateapproximately one-third as much arylsulfatase activity inS-deficient medium as wild-type cells (Davies et al. 1994,1999) [Figure 3, A (columns 4 and 6) and D]. Theepistasis relationship between SAC1 and SNRK2.2 isunclear. Strains containing both the sac1 and snrk2.2alleles have slightly lower constitutive arylsulfatase activityin S-replete medium and express less arylsulfatase in S-deficient medium than the snrk2.2 single mutant (Davies

et al. 1994) [Figure 3, A (columns 4 and 6) and D].The level of arylsulfatase activity in P-starved psr1 and

psr1sac1 cells was similar, suggesting a hypostatic re-lationship between SAC1 and PSR1 with respect to thisphenotype [Figure 3, A (column 5) and C]. However, wecannot eliminate the possibility that the sac1(ars5-3)allele may produce some partially functional SAC1protein since in this allele the ARG7 marker is integratedinto the 13th intron of the SAC1 gene without generat-ing a deletion (see supplemental Figure S3) and SAC1transcript levels are normal (data not shown). However,double mutants of psr1 with either of two additional sac1alleles (ars4-15 and ars4-55) also produced arylsulfataseduring P starvation (data not shown). The sac1(ars4-55)allele is likely to be null since the SAC1 transcript couldnot be detected by quantitative real-time PCR (data notshown), supporting the conclusion that SAC1 is notrequired for the accumulation of arylsulfatase activityobserved in the psr1 mutant during P starvation.

In contrast to the results discussed for the sac1 alleles,SNRK2.1 is epistatic to PSR1; no P deficiency-induciblearylsulfatase is expressed in any of the psr1 strains thatalso harbor a snrk2.1 allele [Figure 3, A (column 5) andC]. The SAC1 and SNRK2.1 genes are both essential fornormal activation of arylsulfatase when cells are ex-posed to �S conditions, but only the wild-type SNRK2.1allele is required for low-level arylsulfatase activity inP-starved psr1 cells. Conversely, a synergistic epistasisrelationship is observed between PSR1 and SNRK2.2since the arylsulfatase activity produced by P-starvedpsr1snrk2.2(are10) double mutants is far greater than thesum of the activities of either single mutant [compareFigure 3, A (column 5) and C]. Similar results wereobtained with psr1snrk2.2(are16) double mutants (seesupplemental Figure S1). The level of arylsulfataseactivity associated with psr1snrk2.2 cells deprived of Pfor 72 hr is comparable to the level attained by wild-typecells after 24 hr of S starvation (compare Figure 3, C andD). This result implies that SNRK2.2 inhibits fullactivation of arylsulfatase in P-starved psr1 cells.

As expected, the triple mutants psr1sac1snrk2.1 andpsr1snrk2.2snrk2.1 do not exhibit arylsulfatase on �P me-dium [Figure 3, A (column 5) and C], demonstratingthat SNRK2.1 is essential for arylsulfatase induction dur-ing P starvation. Interestingly, the psr1sac1snrk2.2 triplemutant does not display the high level of ARS in P-deficient cells that is observed in the psr1snrk2.2 doublemutant; rather the level of ARS activity resembles that ofthe psr1 single mutant. Consequently we conclude that (1)SNRK2.1 is absolutely essential for all arylsulfatase activityobserved during P deprivation of the psr1 mutant, (2)neither SAC1 nor SNRK2.2 is essential for the low level ofarylsulfatase activity that occurs when psr1 cells are starvedfor P, and (3) SAC1 is required for the high arylsulfataseactivity measured in P-deprived psr1snrk2.2 mutant cells.

S deficiency-responsive transcripts in psr1 andS-assimilation regulatory mutants: Comparison of ARS1transcript abundance in P-replete vs. P-starved wild-type,psr1, sac1, snrk2.2, snrk2.1, and the respective doubleand triple mutants (Figure 4A) is mostly consistentwith the level of ARS activity observed in these strains(Figure 3), with the exception of psr1snrk2.2 relative topsr1sac1snrk2.2 (see below). As shown in Figure 2, wild-type cells display no significant activation of ARS1 after24 hr of P deficiency, but ARS1 is upregulated 100- to200-fold in P-deprived psr1 cells. Like the situation in

Figure 3.—Epistasis analysis of PSR1, SAC1, SNRK2.2, and SNRK2.1. (A) Phenotypic analysis of growth, alkaline phosphatase,and arylsulfatase activities for single, double, and triple mutants on TAP (1P 1S), TA 1 glucose-1-phosphate (�P 1S) and TAP�S 1thiocyanate (1P�S) solid medium. All strains were spotted onto plates from TAP medium, grown for 4 days, and then assayed forphosphatase or arylsulfatase activities. (B) Liquid culture assays for alkaline phosphatase activites in TAP and after 24 and 72 hr ofgrowth in TA medium for wild-type cells (CC-1690) and various mutants, including psr1, sac1, snrk2.2, snrk2.1, and double- andtriple-mutant strains, described in the text and in Table 1. Data points are the average of duplicate measurements (6 SD). (C)Arylsulfatase activity assay of cells from the same strains as in B. (D) Comparison of arylsulfatase activity in TAP vs. after 24 hr ofgrowth in TAP �S medium. Data for A, B, C, and D are from one representative experiment; comparable results were obtainedfrom experimental replicates.


Figure 4.—ARS1 and PHOXgene expression in psr1 and thevarious S-deficiency response mu-tants. Relative abundance of (A)ARS1 transcripts and (B) PHOXtranscripts in wild-type (CC-1690),psr1, sac1, snrk2.2, snrk2.1, anddouble- and triple-mutant strainsgrown in TAP (1P), and after 24hr of growth in TA (�P). Thedata for the wild-type and psr1strains is reproduced from Figure2 to facilitate comparison withthe other strains. (C) Compari-son of the relative abundance ofthe indicated transcripts in thepsr1snrk2.2 and psr1sac1snrk2.2strains. Results from one to fourexperimental replicates are shownfor each strain and each condition.


wild-type cells, very limited ARS1 induction occurs in thesac1 and snrk2.1 strains (although there are differencesin the basal level of ARS1 transcripts between the testedstrains). An average�200-fold increase in ARS1 mRNA isobserved in P-deficient psr1sac1 cells, consistent withthe hypostatic relationship of SAC1 to PSR1 reportedabove; on the other hand, ARS1 mRNA does notaccumulate in P-starved psr1snrk2.1, psr1sac1snrk2.1,or psr1snrk2.2snrk2.1 mutant cells, confirming thatSNRK2.1 is absolutely required for activation of S de-ficiency-responsive gene expression in psr1 cells that arestarved for P.

The snrk2.2 mutant expresses ARS1 at a high basallevel (Figure 4A) (Davies et al. 1999), consistent withthe constitutive arylsulfatase activity observed in P-repletemedium [Figure 3, A (column 4) and C] (Davies et al.1994). However, we were surprised to observe that after24 hr of P starvation, ARS1 transcript abundance inthe snrk2.2 single mutant increased by �30-fold andreached an even higher level than that observed in psr1(Figure 4A). This increase in ARS1 mRNA does notyield a proportional increase in arylsulfatase activity(Figure 3C), suggesting that post-transcriptional mech-anisms may regulate arylsulfatase synthesis. In fact, aswith P-deficient psr1 cells, a general derepression ofS deficiency-responsive genes is observed in P-starvedsnrk2.2 cells (data not shown). Like the snrk2.2 singlemutant, P-replete psr1snrk2.2 cells have high basal levelsof ARS1 and other �S transcripts (Figure 4, A and C),but in this case the transcript levels that are producedin P-deficient cells are comparable with wild-type in-duction in �S (Gonzalez-Ballester et al. 2008). Thishigh level of expression is consistent with the higharylsulfatase activity observed in P-deficient psr1snrk2.2cells (Figure 3, A and C). Taken together, these resultssuggest that activators of the S-assimilation pathwayare stimulated both in wild-type and in psr1 underP-starvation conditions, but the negative regulatory effectof SNRK2.2 normally dominates, suppressing full expres-sion of S deficiency-responsive genes in cells starved for P.

Surprisingly, SAC1 appears to have only a limitedeffect on the abundance of�S transcripts in P-deficientsnrk2.2 or psr1snrk2.2 cells. Although P-starved sac1snrk2.2cells have slightly less arylsulfatase activity compared tosnrk2.2 cells, and psr1sac1snrk2.2 cells have significantlyless arylsulfatase activity than psr1snrk2.2 strains (Figure 3,A and C), the abundance of ARS1 and other S deficiency-responsive transcripts is minimally affected in any of thestrains containing the sac1 mutation (Figure 4, A and C).The discrepancy between the abundance of ARS tran-scripts and arylsulfatase activity in the psr1snrk2.2 andpsr1snrk2.2sac1 strains suggests that SAC1 in essential forpost-transcriptional regulation of arylsulfatase synthesis,activity, or both.

psr1snrk2.2 cells bleach during P limitation: Weobserved, on a per-volume basis, that psr1snrk2.2 cul-tures from two independent psr1snrk2.2(are10) isolates

began bleaching significantly after 3 days of growthin medium with no added Pi, whereas P-deficient wild-type and psr1 cultures exhibited no decline or less ofa decline, respectively, during the same time period(Figure 5A). The cell density increased over the 7 daystime course for all of the cultures with the exceptionof psr1snrk2.1snrk2.2 (wild-type cells divided two to threetimes, psr1 and psr1snrk2.2 cells divided one to twotimes) (Figure 5B), indicating that chlorophyll declinedon a per-cell basis in the psr1 and psr1snrk2.2 strains.Examination of cell staining with Evan’s Blue dye duringgrowth in P-deficient medium revealed that psr1snrk2.2cells began to lose membrane integrity following thethird day in medium devoid of P, in parallel with thebleaching (Figure 5C). Essentially no loss of viability wasobserved for wild-type cells over the same time period(Figure 5C). Viability of psr1 cells also declined after3 days of P starvation, but at a slower rate than inpsr1snrk2.2 cultures. Interestingly, P-deficient psr1snrk2.1snrk2.2 cells did not bleach and maintained signifi-cantly higher cell viability than psr1 or psr1snrk2.2 cul-tures (Figure 5, A and C). Furthermore, the bleaching ofP-deficient psr1 and psr1snrk2.2 cells is partially rescuedby growth in the dark (data not shown), suggesting thatto some extent the loss of cell viability may be caused byphotodamage. These results indicate that the high levelof activation of the S-deficiency responses is deleteriousto the survival of P-deficient psr1snrk2.2 cells, and thatthe cells can be rescued to a significant extent by thesnrk2.1 lesion, which blocks expression of the S-respon-sive genes.

DISCUSSION

We have demonstrated that the psr1 mutant activates Sdeficiency-responsive genes during growth in P-deficientmedium, and have investigated the role of the regulatoryelements SAC1, SNRK2.1, and SNRK2.2, which normallycontrol S-deprivation responses, in this activation re-sponse. Epistasis analysis indicates that activation of Sdeficiency-responsive genes in P-starved psr1 cells doesnot require a significant positive regulatory input fromthe SAC1 gene product. On the other hand, the centralregulatory kinase, SNRK2.1, is absolutely required forS-assimilation gene activation in P-deficient psr1 cells.The synergistically epistatic relationship between PSR1and SNRK2.2 shows that the SNRK2.2 kinase has aninhibitory effect on the expression of S-deficiency re-sponse target genes in psr1 cells deprived of P, similar toits role in S-replete wild-type cells. However, unlike thesituation for nutrient-replete cells, where S deficiency-responsive gene expression is only partially induced, theabsence of SNRK2.2 in the psr1snrk2.2 double mutantenables close to full activation of the �S target genesduring P deprivation. The phenotype of P-starvedpsr1snrk2.2 strains points to the existence of an internalsensor of cellular S status that is capable of almost fully


activating S deficiency-responsive gene expression evenwhen high levels of SO4

2� are present in the medium.The psr1sac1 and the psr1sac1snrk2.2 mutants reveal thatalthough SAC1 is not required for the induction ofS-deficiency responsive genes in P-deficient psr1 cells, itis required for the high activity of arylsulfatase observed

in P-starved psr1snrk2.2 cells, suggesting a role for SAC1in post-transcriptional regulation of some S deficiency-inducible proteins.

Regulation of S deficiency-response genes: What isthe mechanism of �S gene activation in P-starved psr1cells? In Figure 6 we present a speculative model to

Figure 5.—Chlorophyll con-tent and cell viability in �P cul-tures. (A) Time course ofchlorophyll concentration perculture volume in wild-type cellsand various mutants grown inTA (Pi-free) medium for 7 days.Chlorophyll concentrations arethe average of duplicate measure-ments, 6 SD. The data are fromone representative experiment;similar patterns were observedin two additional, independentexperiments (see supplementalFigure S2). (B) Change in cellnumber for wild-type cells andthe different mutant strains atvarious times following the trans-fer of cells to TA (Pi-free) me-dium. The changes in cellnumber are the average of twoto four technical replicates, 6SD. (C) Time course of viabilityof strains grown in TA (Pi-free)medium. Nonviable cells weredistinguished from viable cellsby staining with 0.25% Evans Bluedye. Percentage viability is calcu-lated from the average of two tofour measurements, 6 SD. Thedata are from one representativeexperiment; similar results wereobtained in an additional, inde-pendent experiment (see supple-mental Figure S2). For allexperiments the wild-type strainused was CC-1690 while the mu-tants were psr1, two independentpsr1snrk2.2 isolates (see Table 1),and psr1snrk2.1snrk2.2.


describe the interactions between the regulatory factorsthat control expression of the S-assimilation genes andactivation of the S-responsive genes in the psr1 mutant.Under nutrient-replete conditions where the externalconcentration of SO4

2� ion is high, the SNRK2.2 kinaserepresses S deficiency-responsive gene expression (Fig-ure 6A). Since the cell is both internally and externallyreplete for S, the positive regulators SAC1 and SNRK2.1

are not activated and only basal levels of transcripts forthe S-assimilation genes accumulate. However, exclu-sion of SO4

2� from the medium leads to activation ofSAC1 and SNRK2.1 (Figure 6B). From the phenotype ofsac1 mutants, in which the induction of S deficiency-responsive transcripts is attenuated (Davies et al. 1994;Zhang et al. 2004; Gonzalez-Ballester et al. 2008), weinfer that a major function of SAC1 is to inactivate

Figure 6.—Models of S deficiency-responsive gene regulation. (A) Wild-type, nutrient-replete conditions. (i) SO42� ion is

bound to SAC1 which is in an inactive state. (ii) SNRK2.2 makes the central kinase, SNRK2.1, ineffective in activation of geneexpression. (iii) The cell is internally replete for S, so (iv) SNRK2.1 is maintained in a basal activation state. (v) S deficiency-responsive genes are expressed at basal levels. (B) Regulation of S-starvation responses in wild-type cells under S-starvation con-ditions. (vi) SAC1 no longer binds SO4

2� ion and becomes activated. SAC1 causes inactivation of (vii) the SNRK2.2 repressor,which in turn allows SNRK2.1 to function as a transcriptional activator. (viii) Internal S deficiency further activates (ix) SNRK2.1,causing (x) full expression of S deficiency-responsive genes. (xi) SAC1 and SNRK2.2 also function in post-translation regulation ofarylsulfatase and other sulfur-responsive proteins. (C) Regulation of S-starvation responses in wild-type cells under P-starvationconditions. (xii) The SAC1 protein is bound to SO4

2� and is unable to block repression of gene expression by SNRK2.2. Sulfolipidbiosynthesis increases and SO4

2� uptake and assimilation may be limited during P stress, potentially causing (xiii) moderate in-ternal S deficiency. Nevertheless, (xiv) SNRK2.2 suppresses activation of the S-starvation responsive genes by (xv) SNRK2.1,so (xvi) expression of S-starvation responsive genes is maintained at the low basal level. (xvii) PSR1 becomes active and elicits(xviii) full expression of the P-starvation responsive genes. The cells fully acclimate to P-starvation conditions. (D) Regulationof S-starvation genes in psr1 mutant cells under P-starvation conditions. Since SO4

2� is plentiful in the medium, (xix) SAC1 isin the inactive state, and (xx) SNRK2.2 suppresses activation of the S-starvation responsive genes by SNRK2.1. psr1 cells may ex-perience (xxi) severe internal S deprivation as a result of (xxii) their inability to acclimate properly to P starvation. An equilibriumbetween repression by SNRK2.2 and (xxiii) activation of SNRK2.1 by the internal signal is achieved, resulting in (xiv) a low level ofinduction of S deficiency-responsive genes.


SNRK2.2 in S-starved cells, allowing for full, high-levelinduction of S deficiency-responsive gene targets by theactivator SNRK2.1 (Figure 6B). In�S sac1 mutant strains,repression by SNRK2.2 is never released and conse-quently there is only low-level activation by SNRK2.1. Wehave noted that many of the sac1 progeny from geneticcrosses have low and variable levels of arylsulfatase acti-vity when deprived of S (see supplemental Figure S1).This may reflect strain-to-strain variation in the balancebetween repression and activation of S deficiency-responsive gene expression by SNRK2.2 and SNRK2.1,respectively.

The phenotypes of snrk2.2 strains are very informativewith respect to our understanding of the roles of the S-deficiency response regulators. Nutrient-replete snrk2.2mutants display elevated basal expression of most S-assimilation genes compared to wild-type cells (Figure4A) (Davies et al. 1994; Ravina et al. 2002; Gonzalez-Ballester et al. 2008), but the loss of SNRK2.2 is notsufficient by itself to cause expression of S-assimilationgenes at the levels observed in S-starved cells. S deficiency-responsive transcripts are induced similarly in S-starvedwild-type and snrk2.2 cells (Davies et al. 1994; Ravina

et al. 2002; Gonzalez-Ballester et al. 2008), suggestingthat activation of the �S acclimation response is notachieved simply through repression of SNRK2.2; rather,the SAC1-dependent inactivation of SNRK2.2 is co-ordinated with the S deprivation-dependent activationof the SNRK2.1 kinase (Figure 6B). Although theabsence of SNRK2.2 does not significantly affect in-duction of S deficiency-responsive genes in S-starvedcells, like SAC1 the SNRK2.2 kinase also may play a rolein post-transcriptional regulatory processes that affectprotein expression and activity. S-starved snrk2.2 strainshave only 40–50% of the wild-type level of arylsulfataseactivity (Figure 3D) (Davies et al. 1994) and fail toaccumulate the normal complement of extracellularproteins that are expressed in �S cells (Davies et al.1994).

The partial derepression of S deficiency-responsivegenes that is observed in nutrient-replete and P-deficientsnrk2.2 mutants also occurs in sac1snrk2.2 doublemutants (Figure 4A) (Davies et al. 1994). Also, ARStranscript abundance increases in S-starved sac1snrk2.2cells, albeit to a somewhat lesser extent than in wild-type or in snrk2.2 single mutants (Davies et al. 1994),indicating that activation of the S deficiency-responsivegenes does not absolutely require SAC1 (Davies et al.1994).

In contrast to the situation in wild-type cells, SNRK2.2does not completely inhibit expression of S deficiency-responsive genes in P-starved psr1 cells (Figure 6D). Thisresult is consistent with the hypothesis that the meta-bolic state of P-starved cells leads to a secondary, internalS deficiency (discussed below) that results in partial geneactivation. Since the psr1sac1 double and psr1 singlemutants under �P conditions have similar levels of

transcripts associated with the S-deficiency response, thestimulatory signal that overrides SNRK2.2 repression isnot transmitted via SAC1. Therefore, accumulation ofS deprivation-associated transcripts in P-starved, psr1cells must depend either on a positive regulator thatinteracts with SNRK2.1 or on promiscuous modification/activation of SNRK2.1. Unlike the situation duringnutrient sufficiency, elimination of SNRK2.2 repres-sion in P-deficient psr1snrk2.2 mutant cells leads tofull activation of the signaling cascade and high Sdeficiency-responsive gene expression (Figure 4, A andC). Therefore, while low internal SO4

2� can lead topartial activation of SNRK2.1 in the psr1 strain, addi-tional relief of SNRK2.2 repression can cause fullactivation. Furthermore, under these conditions theactivation of �S responsive genes is uncoupled fromSAC1 since similar transcript levels are attained inP-starved psr1snrk2.2 and psr1sac1snrk2.2 cells (Figure4, A and C).

While SAC1 does not influence the level of transcriptsfrom S derpivation-responsive genes in P-starvedpsr1snrk2.2 cells, it does have a significant stimulatoryeffect on the level of arylsulfatase activity in this strain(Figure 3, A and C). SAC1 is an integral membraneprotein similar to SO4

2� transporters of the SLC13family, and it has been hypothesized that the proteinfunctions as a sensor of external SO4

2� (Davies et al.1996). In situations where the external SO4

2� con-centration is high and the abundance of ARS trans-cripts is comparable, such as nutrient-replete snrk2.2and sac1snrk2.2 cells, or P-starved psr1snrk2.2 vs.psr1sac1snrk2.2, the presence of SAC1 affects the amountof active arylsulfatase. In addition, preliminary dataindicates that SAC1 is also required for the accumula-tion of SO4

2� transporter polypeptides in psr1snrk2.2cells starved for P (W. Pootakham, unpublished re-sults), supporting a role for SAC1 in post-transcriptionalregulatory processes.

The partial induction of arylsulfatase and high-levelexpression of the S deficiency-responsive genes inS-starved sac1snrk2.2 strains and P-starved psr1sac1snrk2.2strains (Figures 3 and 4) confirm that gene activationduring S deficiency can be largely uncoupled fromSAC1 and SNRK2.2, providing us with new insight intothe regulation of the S-responsive pathway. A simplehypothesis is that the activation state of the SNRK2.1kinase can be directly affected by the intracellular Sstatus (Figure 6). Alternatively, an unknown regulatormay interact with SNRK2.1 and stimulate its activitywhen intracellular S is low. In all cases tested, SNRK2.1 isabsolutely required for induction of S-assimilationgenes, confirming the central regulatory role of thiskinase (Figure 6) (Gonzalez-Ballester et al. 2008).

P-limitation affects intracellular S metabolism: Whatleads to the activation of SNRK2.1 in P-starved psr1 cells?A hypothesis that is consistent with the experimentalevidence is that P limitation causes a secondary, internal


S deficiency, despite the abundance of SO42� in the�P

medium (Figure 6C). P-deficient cells could experi-ence internal S limitation as a consequence of at leasttwo acclimation responses: (i) cellular S is redirectedtoward sulfolipid synthesis for replacement of thyla-koid membrane phospholipids (Riekhof et al. 2003),and (ii) SO4

2� assimilation is inhibited, possibly theconsequence of a Pi conservation regime in which cellsredirect ATP away from SO4

2� assimilation and towardother essential processes. Recently, it was shown that P-starved cells accumulate 25 times more cysteine thannutrient-replete cells (Bolling and Fiehn 2005),supporting the idea that P deficiency causes significantchanges in the intracellular S status. In psr1 cellsstarved for P, the degree of internal P deficiency maybe even more extreme than in wild-type cells. Whilepsr1 mutants cannot scavenge Pi from the medium(Shimogawara et al. 1999) and may be defective inmobilization of internal P stores (Moseley et al. 2006),they arrest growth and downregulate photosynthesismore quickly than wild-type cells, indicating that theyare to some extent able to adjust to their abnormalphysiological state (Shimogawara et al. 1999). In thisrespect the phenotype of P-deficent psr1 mutantscontrasts with the phenotypes of S-starved sac1 andsnrk2.1 strains, which fail both to upregulate S scav-enging and assimilation and to downregulate photo-synthetic electron transport, resulting in photodamageand cell death at moderate light intensities (Wykoff

et al. 1998; Shimogawara et al. 1999; Gonzalez-Ballester et al. 2008). A possible consequence of theextreme P deficiency experienced by P-starved psr1cells may be that the level of secondary S stress reachesa threshold that activates SNRK2.1 beyond the pointat which it can be fully repressed by SNRK2.2, resultingin low-level induction of the S-assimilation genes (Fig-ure 6D). A constitutively inhibitory allele of SNRK2.2might produce a similar effect in S-starved cells. Thesehypotheses could be tested by comparing the levels ofS-containing metabolites in P-starved wild-type andpsr1 cells and by analyzing the phosphorylation state ofSNRK2.1.

Alternative models: While a preponderence of cir-cumstantial evidence suggests that S metabolism isaffected by P deficiency, alternative models can beinvoked to explain the mutant phenotypes. For exam-ple, there are six additional members of the SNRK2family of protein kinases besides SNRK2.1 and SNRK2.2in Chlamydomonas (Gonzalez-Ballester et al. 2008).If one or more of these members functions in a re-gulatory cascade that activates PSR1 during P starvation,in psr1 mutants where the regulatory pathway is blockedthe kinase(s) might interact with SNRK2.1 and causeaberrant induction of S deficiency-responsive geneexpression. Other stress signals could also contributeto the activation of S-starvation responses during Plimitation. In Arabidopsis, cysteine biosynthesis is en-

hanced during light and oxidative stress throughthe activity of the cyclophilin CYP20-3, which assists inthe folding of chloroplast serine acetyltransferase(Dominguez-Solis et al. 2008). We have ruled out lightstress as the causative agent in the activation of �Sresponses in the psr1 mutant since similar arylsulfataseactivity was observed in P-deficient cultures in the lightor in the dark (Figure 1D). Nevertheless, it is possiblethat other ‘‘general’’ stress signals are responsible forthe aberrant �S responses in P-starved psr1 cells.

Proximal vs. secondary phenotypes of psr1: Geneticanalysis of the interactions between regulators of the Sdeficiency-responsive genes and PSR1 provides a cau-tionary tale that illustrates the difficulty of decipheringthe wild-type function of a gene from its mutantphenotype. Some aspects of a mutant phenotype maybe caused by acclimation to a novel physiological statethat is caused by the lesion, rather than resulting directlyfrom the loss-of-function of a particular gene. Forexample, a preponderance of evidence indicates thatPSR1 encodes a nuclear-localized transcriptional activa-tor (Wykoff et al. 1999; Rubio et al. 2001). A possiblemodel that would account for the expression of the Sdeficiency-responsive genes in P-starved psr1 cells is thatPSR1 itself negatively regulates their expression, eitherby participating directly in the S deprivation-responsivesignaling cascade, interacting with the promoters of thetarget genes of this cascade, or by inducing expressionof a gene encoding a repressor of S-responsive genesduring P deficiency. While we cannot fully rule out a rolefor PSR1 in repressing the S-deficiency responses, thishypothesis does not explain why cells that acclimateproperly to P starvation would find it necessary torepress the S deficiency-responsive genes when plentyof SO4

2� is present in �P growth medium, or whyexpression of S-assimilation genes should increase in P-starved snrk2.2 cells (Figure 4), even though PSR1-dependent responses occur normally in this strain(Figures 3 and 4). Given the evidence that P starvationaffects the internal S status of the cell, regulation of theS-deficiency responses can be understood without in-voking any direct involvement of PSR1 in the signaltransduction pathway. Instead, the metabolic state ofP-starved psr1 cells provides an ‘‘artificial’’ intracellularenvironment in which interactions between the P- andS-stress responses are unmasked.

Similar care should be taken in ascribing control ofaspects of a wild-type acclimation response to a particularregulatory protein. For example, part of the response ofwild-type cells to P limitation is to stabilize chloroplastRNA transcripts (cpRNAs), and this stabilization corre-lates with downregulation of the chloroplast polynucle-otide phosphorylase (PNPase) (Yehudai-Resheff et al.2007). PSR1 has been implicated in this process, sincecpRNA abundance declines drastically in psr1 cells thatare starved for P and the expression of the PNP1 geneis not downregulated as it is in P-starved wild-type


cells (Yehudai-Resheff et al. 2007). However, reducedcpRNA abundance is also characteristic of S-starved cells(Irihimovitch and Stern 2006), making it unclearwhether the decline in cpRNAs in P-starved psr1 cells is aconsequence of their inability to reduce the level ofPNPase activity, the partial activation of the S-deficiencyresponse, or a combination of the two. It should bepossible to distinguish between these possibilities byanalyzing cpRNA stability and transcription rates inP-deficient psr1 cells.

Why would it be important for wild-type cells torepress S deficiency-responsive genes during P limita-tion? This would be a logical strategy for a cell thatperceives internal P and S deprivation but that cansense that SO4

2� is not limiting in the external environ-ment. Upregulation of S-deficiency responses would beboth energetically costly and futile in this situationsince, because of P insufficiency, the cell would beunable to grow even if it acquired more S. In thiscontext, it is unclear whether partial activation of S-deficiency responses provides any benefit to P-starvedpsr1 cells. Along this vein, we wondered whether themore rapid downregulation of photosynthesis in P-deficient psr1 cells compared to wild-type cells (Shimo-

gawara et al. 1999) was a byproduct of the partialactivation of the S-deficiency response, since photo-synthesis is downregulated more quickly during Sstarvation than in P starvation (Wykoff et al. 1999).Comparison of PAR curves for P-deficient wild-type,psr1, and psr1snrk2.1 cells revealed that the S-deficiencyresponses were not likely to be involved in the down-regulation of photosynthesis; both the psr1 andpsr1snrk2.1 strains showed a similar, rapid reduction inphotosynthetic electron transfer rates after 24 hr of Pstarvation, while wild-type cells maintained relativelyhigh rates of photosynthesis (data not shown). Cellviability during P starvation is actually improved in astrain that harbors both the psr1 and the snrk2.1mutations, compared to psr1 (Figure 5C). Furthermore,the rapid loss of chlorophyll and cell viability inpsr1snrk2.2 cultures during P deprivation (Figure 5)indicates that full activation of the S-deficiency responseis harmful rather than beneficial to the cell.

While P and S limitation have qualitatively similareffects on growth and photosynthesis (Wykoff et al.1998), some specific responses to these two limitationsare diametrically opposed. For example, while P-starvedcells turn over phospholipids and increase synthesis ofsulfolipids (Riekhof et al. 2003), the opposite occurs inS-starved cells; sulfolipids are degraded and phospho-lipid abundance increases (Sugimoto et al. 2007, 2008).It is conceivable that opposing responses prevent main-tenance of proper phospho- to sulfolipid ratios in thethylakoid membrane, contributing to the bleaching of�P psr1snrk2.2 cells. Examination of the lipid profilesof P-deficient psr1snrk2.2 cells should be informative inthis regard.

Conclusion: It has been somewhat surprising to findthat analysis of the phenotype of the psr1 mutant,which does not acclimate normally to P deprivation,provides insight into regulatory mechanisms control-ling S-starvation responses. However, there are still manyquestions about the SAC1, SNRK2.1, and SNRK2.2regulatory proteins that remain unanswered. What arethe internal signals that trigger S-starvation responses?What are the targets of the kinases? Do the phosphor-ylation states of the regulatory proteins change duringS starvation? Do the regulatory proteins physically in-teract, and does S starvation change these interactions?Detailed biochemical analyses will be required to achievea more comprehensive understanding of how cells accli-mate to P- and S-limiting conditions and the integrationbetween the two responses.

We thank Steve Pollock, Rachel Muir, and all members of theGrossman and Bhaya labs for helpful discussions. This work wassupported by National Science Foundation grants MCB0235878 andMCB-0824469 awarded to A.R.G.

LITERATURE CITED

Arnon, D. I., 1949 Copper enzymes in isolated chloroplasts, poly-phenoloxidase in Beta vulgaris. Plant Physiol. 24: 1–15.

Bolling, C., and O. Fiehn, 2005 Metabolite profiling of Chlamydo-monas reinhardtii under nutrient deprivation. Plant Physiol. 139:1995–2005.

Burkhard, P., J. Stetefeld and S. V. Strelkov, 2001 Coiled coils:a highly versatile protein folding motif. Trends Cell Biol. 11:82–88.

Chang, C.-W., J. L. Moseley, D. Wykoff and A. R. Grossman,2005 The LPB1 gene is important for acclimation of Chlamydo-monas reinhardtii to phosphorus and sulfur deprivation. PlantPhysiol. 138: 319–329.

Davies, J., F. Yildiz and A. R. Grossman, 1996 Sac1, a putativeregulator that is critical of survival of Chlamydomonas reinhardtiiduring sulfur deprivation. EMBO J. 15: 2150–2159.

Davies, J. P., F. Yildiz and A. R. Grossman, 1994 Mutants ofChlamydomonas reinhardtii with aberrant responses to sulfur dep-rivation. Plant Cell 6: 53–63.

Davies, J. P., F. H. Yildiz and A. R. Grossman, 1999 Sac3, anSnf1-like serine/threonine kinase that positively and negativelyregulates the responses of Chlamydomonas to sulfur limitation.Plant Cell 11: 1179–1190.

de Hostos, E. L., R. K. Togasaki and A. R. Grossman, 1988 Puri-fication and biosynthesis of a derepressible periplasmic arylsulfa-tase from Chlamydomonas reinhardtii. J. Cell. Biol. 106: 29–37.

de Hostos, E. L., J. Schilling and A. R. Grossman, 1989 Structureand expression of the gene encoding the periplasmic arylsulfa-tase of Chlamydomonas reinhardtii. Mol. Gen. Genet. 218: 229–239.

Dominguez-Solis, J. R., Z. He, A. Lima, J. Ting, B. B. Buchanan et al.,2008 A cyclophilin links redox and light signals to cysteine bio-synthesis and stress responses in chloroplasts. Proc. Natl. Acad.Sci. USA 105: 16386–16391.

Ford, C., S. Mitchell and W.-Y. Wang, 1981 Protochlorophyllidephotoconversion mutants of Chlamydomonas reinhardtii. Mol.Gen. Genet. 184: 460–464.

Gasch, A., and M. Werner-Washburne, 2002 The genomics ofyeast responses to environmental stress and starvation. Funct. In-tegr. Genomics 2: 181–192.

Gonzalez-Ballester, D., S. V. Pollock, W. Pootakham and A. R.Grossman, 2008 The central role of a SNRK2 kinase in sulfurdeprivation responses. Plant Physiol. 147: 216–227.

Gorman, D. S., and R. P. Levine, 1966 Cytochrome f and plastocy-anin: their sequence in the photosynthetic electron transportchain of Chlamydomonas reinhardtii. Proc. Natl. Acad. Sci. USA54: 1665–1669.


Grossman, A., and H. Takahashi, 2001 Macronutrient utilizationby photosynthetic eukaryotes and the fabric of interactions.Annu. Rev. Plant Physiol. Plant Mol. Biol. 52: 163–210.

Hebeler, M., S. Hentrich, A. Mayer, D. Leibfritz and L. H.Grimme, 1992 Phosphate regulation and compartmentationin Chlamydomonas reinhardtii studied by in vivo 31p-nmr, pp.717–720 in Research in Photosynthesis, edited by N. Murata.Kluwer Academic Publishers, Dordrecht, The Netherlands.

Irihimovitch, V., and D. B. Stern, 2006 The sulfur acclimationSAC3 kinase is required for chloroplast transcriptional repressionunder sulfur limitation in Chlamydomonas reinhardtii. Proc. Natl.Acad. Sci. USA 103: 7911–7916.

Jones, S., 2004 An overview of the basic helix-loop-helix proteins.Genome Biol. 5: 226.

Kobayashi, I., S. Fujiwara, K. Shimogawara, T. Kaise, H. Usuda

et al., 2003 Insertional mutagenesis in a homologue of a Pitransporter gene confers arsenate resistance on Chlamydomo-nas. Plant Cell Physiol. 44: 597–606.

Lein, T., and O. Schreiner, 1975 Purification of a derepressiblearlysulfatase from Chlamydomonas reinhardtii. Biochimica etBiophysica Acta 384: 1147–1157.

Lipsick, J. S., 1996 One billion years of Myb. Oncogene 13: 223–235.Moseley, J. L., T. Allinger, S. Herzog, P. Hoerth, E. Wehinger

et al., 2002 Adaptation to Fe-deficiency requires remodelingof the photosynthetic apparatus. EMBO J. 21: 6709–6720.

Moseley, J. L., C. W. Chang and A. R. Grossman, 2006 Genome-based approaches to understanding phosphorus deprivation re-sponses and PSR1 control in Chlamydomonas reinhardtii. Eukaryot.Cell 5: 26–44.

Nguyen, A. V., S. R. Thomas-Hall, A. Malnoe, M. Timmins, J. H.Mussgnug et al., 2008 Transcriptome for photobiological hy-drogen production induced by sulfur deprivation in the greenalga Chlamydomonas reinhardtii. Eukaryot. Cell 7: 1965–1979.

O’Connell, K. F., and R. E. Baker, 1992 Possible cross-regulationof phosphate and sulfate metabolism in Saccharomyces cerevisiae.Genetics 132: 63–73.

Pabo, C. O., and R. T. Sauer, 1992 Transcription factors: structuralfamilies and principles of DNA recognition. Annu. Rev. Biochem.61: 1053–1095.

Pollock, S., W. Pootakham, N. Shibagaki, J. Moseley andA. Grossman, 2005 Insights into the acclimation of Chlamydomo-nas reinhardtii to sulfur deprivation. Photosynthesis Res. 86: 475–489.

Quisel, J., D. Wykoff and A. R. Grossman, 1996 Biochemical charac-terization of the extracellular phosphatases produced by phospho-rus-deprived Chlamydomonas reinhardtii. Plant Physiol. 111: 839–848.

Ravina, C. G., C.-I. Chang, G. P. Tsakraklides, J. P. McDermott,J. M. Vega et al., 2002 The sac mutants of Chlamydomonas reinhardtiireveal transcriptional and posttranscriptional control of cysteinebiosynthesis. Plant Physiol. 130: 2076–2084.

Riekhof, W. R., M. E. Ruckle, T. A. Lydic, B. B. Sears andC. Benning, 2003 The sulfolipids 29-O-Acyl-Sulfoquinovosyldia-cylglycerol and Sulfoquinovosyldiacylglycerol are absent from aChlamydomonas reinhardtii mutant deleted in SQD1. Plant Physiol.133: 864–874.

Rubio, V., F. Linhares, R. Solano, A. C. Martin, J. Iglesias et al.,2001 A conserved MYB transcription factor involved in phos-

pate starvation signaling both in vascular plants and in unicellu-lar algae. Genes Dev. 15: 2122–2133.

Saldanha, A. J., M. J. Brauer and D. Botstein, 2004 Nutritionalhomeostasis in batch and steady-state culture of yeast. Mol. Biol.Cell 15: 4089–4104.

Schloss, J. A., C. D. Silflow and J. L. Rosenbaum, 1984 mRNAabundance changes during flagellar regeneration in Chlamydomo-nas reinhardtii. Mol. Cell. Biol. 4: 424–434.

Shimogawara, K., D. D. Wykoff, H. Usuda and A. R. Grossman,1999 Chlamydomonas reinhardtii mutants abnormal in their re-sponses to phosphorus deprivation. Plant Physiol. 120: 1–10.

Sugimoto, K., N. Sato and M. Tsuzuki, 2007 Utilization of a chlo-roplast membrane sulfolipid as a major internal sulfur source forprotein synthesis in the early phase of sulfur starvation in Chla-mydomonas reinhardtii. FEBS Lett. 581: 4519–4522.

Sugimoto, K., T. Midorikawa, M. Tsuzuki and N. Sato,2008 Upregulation of PG synthesis on sulfur-starvation forPS I in Chlamydomonas. Biochem. Biophys. Res. Commun.369: 660–665.

Takahashi, H., C. E. Braby and A. R. Grossman, 2001 Sulfur econ-omy and cell wall biosynthesis during sulfur limitation of Chlamy-domonas reinhardtii. Plant Physiol. 127: 665–673.

Werner, T., N. Amrhein and F. Freimoser, 2007 Inorganic poly-phosphate occurs in the cell wall of Chlamydomonas reinhardtiiand accumulates during cytokinesis. BMC Plant Biol. 7: 51.

Wykoff, D., J. Davies and A. Grossman, 1998 The regulation ofphotosynthetic electron transport during nutrient deprivationin Chlamydomonas reinhardtii. Plant Physiol. 117: 129–139.

Wykoff, D., A. Grossman, D. P. Weeks, H. Usuda and K. Shimogawara,1999 Psr1, a nuclear localized protein that regulates phospho-rus metabolism in Chlamydomonas. Proc. Natl. Acad. Sci. USA 96:15336–15341.

Yehudai-Resheff, S., S. L. Zimmer, Y. Komine and D. B. Stern,2007 Integration of chloroplast nucleic acid metabolism intothe phosphate deprivation response in Chlamydomonas reinhardtii.Plant Cell 19: 1023–1038.

Yildiz, F., J. P. Davies and A. R. Grossman, 1994 Characterizationof sulfate transport in Chlamydomonas reinhardtii during sulfur-limited and sulfur-sufficient growth. Plant Physiol. 104: 981–987.

Yildiz, F. H., J. P. Davies and A. R. Grossman, 1996 Sulfur availabil-ity and the SAC1 gene control adenosine triphosphate sulfurylasegene expression in Chlamydomonas reinhardtii. Plant Physiol. 112:669–675.

Zhang, L., T. Happe and A. Melis, 2002 Biochemical and morpho-logical characterization of sulfur-deprived and H2-producingChlamydomonas reinhardtii (green alga). Planta 214: 552–561.

Zhang, Z., J. Shrager, M. Jain, C.-W. Chang, O. Vallon et al.,2004 Insights into the survival of Chlamydomonas reinhardtii dur-ing sulfur starvation based on microarray analysis of gene expres-sion. Eukaryot. Cell 3: 1331–1348.

Communicating editor: A. P. Mitchell


Genetic Interactions Between Regulators of …...Genetic Interactions Between Regulators of...

Documents

Transcript of Genetic Interactions Between Regulators of …...Genetic Interactions Between Regulators of...