Trait and Sex Selection: The Arrival of Non -Invasive Prenatal Genetic Testing
Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired...
-
Upload
christina-davidson -
Category
Documents
-
view
217 -
download
0
Transcript of Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired...
![Page 1: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/1.jpg)
Genetic EngineeringBiotechnology
![Page 2: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/2.jpg)
The manipulation of a trait in an organism to create a
desired change
What is Genetic Engineering?
![Page 3: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/3.jpg)
We have been manipulating DNA for generations! Artificial breeding
creating new breeds of animals & new crop plants to improve our food
![Page 4: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/4.jpg)
Animal breeding
![Page 5: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/5.jpg)
Breeding food plants “Descendants” of the wild mustard
the “Cabbage family”
![Page 6: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/6.jpg)
Breeding food plants
Evolution of modern corn (right) from ancestral teosinte (left).
![Page 7: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/7.jpg)
A Brave New World
![Page 8: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/8.jpg)
The code is universal Since all living
organisms… use the same
DNA use the same
code book read their
genes the same way
![Page 9: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/9.jpg)
TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT
human genome3.2 billion bases
![Page 10: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/10.jpg)
Can we mix genes from one creature to another?
YES!
Green Fluorosceint Protein (GFP)
![Page 11: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/11.jpg)
How do we do mix genes? Genetic engineering
find gene _______ DNA in both organisms _______ gene from one creature into other
creature’s DNA _______ new chromosome into organism organism _______ new gene as if it were its
own organism _______ gene as if it were its own _____________________________________:
Remember: we all use the same genetic code!
![Page 12: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/12.jpg)
Uses of genetic engineering Genetically modified organisms
(GMO) enabling plants to produce new
proteins ___________________________: BT corn
corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn)
___________________________: fishberries strawberries with an anti-freezing gene from
flounder
___________________________: golden rice rice producing vitamin A
improves nutritional value
![Page 13: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/13.jpg)
Basic steps in genetic engineering
1. Isolate the gene2. Insert it in a host using a vector3. Produce as many copies of the
host as possible4. Separate and purify the product
of the gene
![Page 14: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/14.jpg)
Gene Cloning Techniques
1- Grow the target microorganism
2.Extract/isolate DNA
DNA target
3- Digest fragment DNA
with restriction enzymes
4- Insert DNA fragments in a
plasmid cloning vector
Recombinant
![Page 15: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/15.jpg)
Each bacteria will grow to form an individual colony
Continued
“Vibrio DNA library”
5- Transform E. coli with
library
Each bacteria will receive a single plasmid from the
library
![Page 16: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/16.jpg)
Tools
1. DNA you want to clone2. Restriction endonucleases (molecular
scissors)
3. Cloning vector (e.g. pGEM, pBR322…)
4. Ligase enzyme (molecular glue)
![Page 17: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/17.jpg)
Step 1: Isolating the gene
![Page 18: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/18.jpg)
Step 1: Isolating the gene
![Page 19: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/19.jpg)
Cutting DNA DNA “scissors”
____________________________ ____________________________
used by bacteria to cut up DNA of attacking viruses
EcoRI, HindIII, BamHI
cut DNA at specific sites enzymes look for specific base
sequencesGTAACGAATTCACGCTTCATTGCTTAAGTGCGAAGTAACG|AATTCACGCTTCATTGCTTAA|GTGCGAA
![Page 20: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/20.jpg)
Restriction enzymes Cut DNA at specific sites
____________________________
GTAACG AATTCACGCTTCATTGCTTAA GTGCGAA
GTAACGAATTCACGCTTCATTGCTTAAGTGCGAA
restriction enzyme cut site
restriction enzyme cut site
![Page 21: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/21.jpg)
Sticky ends Cut other DNA with same enzymes
leave “sticky ends” on both can glue DNA together at “sticky ends”
GTAACG AATTCACGCTTCATTGCTTAA GTGCGAA
gene you want
GGACCTG AATTCCGGATACCTGGACTTAA GGCCTAT
chromosome want to add
gene to
GGACCTG AATTCACGCTTCCTGGACTTAA GTGCGAA
combinedDNA
![Page 22: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/22.jpg)
Restriction Endonucleases
• Restriction endonucleases, a.k.a. “restriction enzymes” or “enzymes” by
molecular biologists.
• Type II restriction enzymes recognize and cut specific DNA sequences
5’-NNNAAGCTTNNN-3’3’-NNNTTCGAANNN-5’
![Page 23: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/23.jpg)
Example
• Hind III (Haemophilus influenza Rd)– Recognizes: AAGCTT
– Cuts in between the two A’s
AAGCTT A AGCTTTTCGAA TTCGA A
![Page 24: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/24.jpg)
Types of Sticky Ends
5’ overhangs (HindIII)
5’AAGCTT 3’ 5’A 5’ AGCTT3’
3’TTCGAA 5’ 3’TTCGA 5’ A 5’
3’ overhangs (KpnI)
5’ GGTACC 3’ 5’ GGTAC 3’ C 3’
3’ CCATGG 5’ 3’ C 3’ CATGG 5’
![Page 25: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/25.jpg)
Types of Overhangs
Sticky ends Examples include HindIII & KpnI
Blunt Ends Example SmaI Recognize CCCGGG Cut between C and G
CCCGGG CCC GGGGGGCCC GGG CCC
![Page 26: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/26.jpg)
Sticky ends help glue genes togetherTTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTTAACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA
gene you want cut sitescut sites
AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTTTTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA
chromosome want to add gene tocut sites
AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA isolated gene
sticky ends
chromosome with new gene addedTAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC
CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC
sticky ends stick together
DNA ligase joins the strands ________________ DNA molecule
![Page 27: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/27.jpg)
Why mix genes together?
TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC
CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC
Gene produces protein in different organism or different individual
aa aaaa aa aa aa aa aa aa aa
“new” protein from organism ex: human insulin from bacteria
human insulin gene in bacteria
bacteria human insulin
How can bacteria read human DNA?
![Page 28: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/28.jpg)
Step 2: Inserting gene into vector
Vector – molecule of DNA which is used to carry a foreign gene into a host cell
![Page 29: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/29.jpg)
Plasmid Vector: pBR322
First modern cloning vector (1976)
![Page 30: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/30.jpg)
pBR322
• Contains: 1. colE1 origin of replication (ORI)
![Page 31: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/31.jpg)
Bacteria plus plasmid
Non-transformed bacteria
Nutrient media plus antibiotic
Overnight growth
Only coloniesfrom bacteria that
have plasmid
pBR322
• Contains: 2. Selectable Markers:
• Ampicillin Resistance (β-lactamase gene)• and Tetracycline
Resistance (tet gene)
![Page 32: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/32.jpg)
pBR322
• Contains: 3. A few good restriction sites for
inserting foreign DNA
PstI
EcoRI Bam
HI
BamH1
BamH1
Your favorite DNA
Digest
with BamH
1
and ligate
PstI
EcoRI Bam
HI BamHI
Your favorite
DNA
![Page 33: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/33.jpg)
pBR322
• Nice Features: √ 200 copies per E. coli cell√ Makes double stranded DNA√ All modern cloning vectors are
based on pBR322
![Page 34: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/34.jpg)
• Advantages over pBR3221. Makes 1000’s of copies/cell
2. Small size at 2.7 kilobase pairs (kb) = easier uptake by E. coli
Next Generation: pUC Plasmids
![Page 35: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/35.jpg)
Step 3: inserting vector into host
![Page 36: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/36.jpg)
Bacteria Bacteria are great!
one-celled organisms reproduce by mitosis
easy to grow, fast to grow generation every ~20 minutes
![Page 37: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/37.jpg)
A way to get genes into bacteria easily insert new gene into plasmid insert plasmid into bacteria bacteria now expresses new gene
bacteria make new protein
+
transformedbacteriagene from
other organism
plasmid
cut DNA
recombinantplasmid
vector
glue DNA
![Page 38: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/38.jpg)
Blue/White SelectionBacteria plus empty
plasmid Non-transformed bacteria
Only coloniesfrom bacteria that
have plasmid
Nutrient media plus antibiotic plus X-Gal
Overnight growth
Bacteria with plasmid plus insert
Colonies with insert - whiteColonies w/o insert - blue
![Page 39: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/39.jpg)
Grow bacteria…make more
growbacteria
harvest (purify)protein
transformedbacteria
plasmid
gene fromother organism
+
recombinantplasmid
vector
![Page 40: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/40.jpg)
Applications of biotechnology
![Page 41: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?](https://reader036.fdocuments.in/reader036/viewer/2022081516/56649e0c5503460f94af5664/html5/thumbnails/41.jpg)
any Questions?