5049Development 124, 5049-5062 (1997)Printed in Great Britain © The Company of Biologists Limited 1997DEV5134

Genetic characterization of the role of the two HOX proteins, Proboscipedia

and Sex Combs Reduced, in determination of adult antennal, tarsal, maxillary

palp and proboscis identities in Drosophila melanogaster

Anthony Percival-Smith*, Jennifer Weber, Elaine Gilfoyle and Peggy Wilson

Department of Zoology, University of Western Ontario, London, Ontario, Canada, N6A 5B7*Author for correspondence (e-mail: aperciva@julian.uwo.ca)

Both Proboscipedia (PB) and Sex Combs Reduced (SCR)activities are required for determination of proboscisidentity. Here we show that simultaneous removal of PBand SCR activity results in a proboscis-to-antenna trans-formation. Dominant negative PB molecules inhibit theactivity of SCR indicating that PB and SCR interact in amultimeric protein complex in determination of proboscisidentity. These data suggest that the expression pattern ofPB and SCR and the ability of PB and SCR to interact ina multimeric complex control the determination of fouradult structures. The absence of PB and SCR expressionleads to antennal identity; expression of only PB leads tomaxillary palp identity; expression of only SCR leads totarsus identity; and expression of both PB and SCR, whichresults in the formation of a PB-SCR-containing complex,leads to proboscis identity.

However, the PB-SCR interaction is not detectable invitro and is not detectable genetically in the head regionduring embryogenesis, indicating the PB-SCR interac-tion may be regulated and indirect. This regulation mayalso explain why ectopic expression of SCRQ50K and SCRdo not result in the expected transformation of the

maxillary palp to an antennae and proboscis, respec-tively.

Previous analysis of the requirements of SCR activity foradult pattern formation has shown that ectopic expression ofSCR results in an antenna-to-tarsus transformation, butremoval of SCR activity in a clone of cells does not result ina tarsus-to-arista transformation. Here we show in five inde-pendent assays the reason for this apparent contradictoryrequirement of SCR activity in tarsus determination. SCRactivity is required cell nonautonomously for tarsus determi-nation. Specifically, we propose that SCR activity is requiredin the mesodermal adepithelial cells of all leg imaginal discsat late second/early third instar larval stage for the synthesisof a mesoderm-specific, tarsus-inducing, signaling factor,which after secretion from the adepithelial cells acts on theoverlaying ectodermal cells determining tarsus identity.

This study characterizes a combinatorial interaction betweentwo HOX proteins; a mechanism that may have a major rolein patterning the anterior-posterior axis of other animals.

Key words: HOX function, proboscipedia, Sex combs reduced,induction, pattern formation, Drosophila, limb development

SUMMARY

er-

lP),

al

)dg-ts

etsr-

INTRODUCTION

The conserved Hox genes function in laying out the body palong the anterior-posterior axis of many, and maybe manimal phyla (Carroll, 1995; Slack et al., 1993). All Hox genencode a protein that contains the DNA-binding protedomain, the homeodomain (HD) (McGinnis and Krumlau1992). The activity of the Hox genes were initially identifiein Drosophilaby the phenotypes produced by loss-of-functioor gain-of-function alleles. A mutation in a Drosophila Hoxgene results in the transformation of one body part into ano(Lewis, 1978; Kaufman et al., 1990). Ironically, most of thinformation on how the HOX proteins work has come from tanalysis of the role of Ultrabithorax (UBX) in gut developmeand not their role in the determination of segmental iden(Capovilla et al., 1994). The reason for this is the lack knowledge about what genes are specifically regulated by H

lanost,esinf,dn

there

henttityofOX

proteins during determination of segmental identity, and thlack of knowledge about what activities are required for detemination of segmental identity (Andrews and Scott, 1992).

In gut development, UBX activity is required in the visceramesoderm for the synthesis of Decapentaplegic (DP(Capovilla et al., 1994). Using a change of specificity mutationUBX has been shown to act directly as a transcriptionactivator of dppexpression (Capovilla et al., 1994). UBX bindsthe dpp regulatory region via the HD. However, UBX alone isunable to recognize with high affinity the cis-regulatory dppsequences. UBX requires the cofactor Extradenticle (EXD(Chan et al., 1994). Both EXD and UBX activities are requirefor determination of the correct segmental identity of parasements 5 and 6 (Peifer and Wieschaus, 1990). EXD interacwith UBX and other HOX proteins through a hexapeptidsequence of amino acids found in most HOX produc(Johnson et al., 1995; Chan et al., 1996). This UBX-EXD inte

5050

tiond

3heatate

etA

-

CR

he

al-

of

seS-n,

a

,s

-S-1

ndthhe

A. Percival-Smith and others

action is considered generally important because of the prerties of HOX activity. Individual HOX proteins perform verydistinct and specific functions during development. Therefoit is very surprising the HDs of the various HOX proteinrecognize basically the same DNA-binding sites (Gehringal., 1994), but conversely that the HDs of the various HOproteins determine much of the specificity of their functio(Chan and Mann, 1993; Furukubo-Tokunaga et al., 19Gibson et al., 1990; Mann and Hogness, 1990; Zeng et 1993). The interaction with EXD and maybe other cofactoallows an explanation of these two properties of HOX activi

An observation that can also be explained by HOX cofacinteractions is the presence of more segments with uniidentity than Hox genes to determine their identity: 1segments and 8 Hox genes. It has been suggested that proteins interact with one another combinatorially in detemination of positional value along the anterior-posterior axparticularly in vertebrate systems, where there is extensoverlap of the expression domains of the HOX proteins (Huand Krumlauf, 1991). However, there is no evidence in vtebrates that this actually occurs. The embryonic expresspattern of the HOX proteins that pattern the thoracic aabdominal segments of Drosophilagenerally do not result incoexpression of two HOX proteins in the same cell (Peiferal., 1987). There is extensive coexpression of Proboscipe(PB) with Deformed (DFD) and Sex Combs Reduced (SCin the head (Pultz et al., 1988; Chadwick and McGinn1987; Kuroiwa et al., 1985; Mahaffey and Kaufman, 1987During embryogenesis, PB and DFD are coexpressed inmaxillary segment, and PB and SCR are coexpressed inlabial segment. In the imaginal discs, PB and SCR are copressed in the labial imaginal disc (Randazzo et al., 19Pattatucci and Kaufman, 1991; Glickman and Brower, 198

A second interesting point about HOX function is thfunction of the genes that they are known to regulaAlthough HOX proteins act as transcription factors regulaing gene expression cell autonomously, there are goexamples of HOX-regulated genes being components of nonautonomous developmental pathways. Ultrabithor(UBX) activity in the visceral mesoderm binds to the dpppromoter (Capovilla et al., 1994). The product of the dppgene is a secreted factor with significant amino acid simility to tumor growth factor β (Padgett et al., 1987). In theendoderm, DPP is required for expression of LAB and tformation of the second gut constriction (Immergluck et a1990).

Here we show that PB and SCR, which are coexpressethe labial segment, interact in the determination of the labstructure, the proboscis. We also show that SCR activityrequired cell nonautonomously for tarsus determination.

MATERIALS AND METHODS

Stock constructionFor a description of the genetic markers and balancer chromosoused here, see Lindsley and Zimm, 1992. The flies were maintaon standard Drosophilamedia supplemented with Baker’s yeast. Thvarious chromosomes described in this study were constructestandard Drosophilacrossing schemes (Table 1).

op-

re,s etXn

93;al.,rs

ty.torque4

HOXr-is,ivent

er-ionnd

etdiaR)is,).

the theex-91;8).ete.t-od

cellax

ar-

hel.,

d inial is

mesinede

d in

FLP-mediated mitotic recombinationThe crosses used for generating the FLP-mediated recombinaevents are as follows: Scr1 clones in the proboscis, stocks DJ102 anAPS112 (Table 1) were crossed; pb27 Scr2 clones in the proboscis,stocks GS3 and AP201 were crossed; pb27 clones in the proboscis,stocks GS3 and APS202 were crossed; pb27 Scr2 clones in a pb27/pb20

mutant background, stocks APS121 and DJ402 were crossed; pb27

clones in a pb27/pb20 mutant background, stocks APS121 and DJ40were crossed. The first instar larval progeny of these crosses were shocked for 30-45 minutes at 36.5°C. Progeny with the approprigenotype were screened for clones.

Construction of the heat-shock promoter/ Scr and pbfusion genesThe hsp/Scr and hsp/ScrQ50K fusion genes were constructed asfollows. The unique XbaI site of pNMT4 was deleted by filling in theXbaI site of pNMT4 with deoxynucleotides and ligating, yieldingpNMT4∆X (Schneuwly et al., 1987). pPL20 was digested with ClaIand XbaI, and this DNA was used in subsequent PCRs (LeMotte al., 1989). All PCR reactions used the high-fidelity, heat-stable DNpolymerase, Pfu. To construct the two hsp/Scra/b fusion genes, thefollowing PCRs were performed. Primers APS-5 (ACGCGCGGCCGCACGACAACGACCCCTGGCT) and APS-15 (ACGCGCGGC-CGCTCTAGAGATCGGGCCACACTCTCTAC) were used in a PCRreaction using pPL20 as the template (LeMotte et al., 1989). The Pproduct was digested with NotI and gel isolated. This NotI fragment,which encodes the N-terminal portion of SCR, was inserted into tunique NotI site of pNMT4∆X, yielding pNMT4∆XNScr. PrimersAPS-16 (TGTGGCCCGATCTCTCTAGACAAGGGCGTCC) andAPS-17 (TCGCTCTAGACAGTACCCGAAAAGTGCCAC) wereused in a PCR and the resulting fragment was digested with XbaI andgel isolated. This fragment was inserted into the unique XbaI site ofpNMT4∆XNScr. Insertion of this XbaI fragment creates a full-lengthScrgene, which is the same as wild-type Screxcept for the change ofamino acid 226 and 227 from Asn Lys to Arg Ser. Two identicpP{hsp/Scr, ry+} plasmids were constructed from completely independent PCR reactions. Scra has the expected DNA sequence.

To construct the two pP{hsp/ScrQ50K, ry+} genes, the Q50K changewas introduced at the last step described for the constructionpP{hsp/Scr, ry+}. A PCR was performed using primers APS-10(TGCGCCGGTTCTTGAACCAGATCTT) and APS-16, and a PCRwas performed with APS-9 (AAGATCTGGTTCAAGAACCG-GCGCA) and APS-17. Gel-isolated fragments from both of thePCR reactions were used in a PCR with primers APS-16 and AP17. The resulting fragment, which now contains the Q50K mutatiowas digested with XbaI and inserted into the XbaI site ofpNMT4∆XNScr, yielding pP{hsp/ScrQ50K, ry+}. Two completelyindependent PCRs were used to construct hsp/ScrQ50Ka/b. The Q50Kchange was confirmed by DNA sequencing.

At the beginning of this project, no full-length pb cDNA existed(Cribbs et al., 1992). Using PCR, we amplified a pb-coding regionfragment from a pupal total cDNA population. cDNA made frompupal poly(A)+ RNA with AMV reverse transcriptase was used in PCR with primers APS-1 (ACGCGCGGCCGCAATTGAAATA-GAAAGAATC) and APS-2 (ACGCGCGGCCGCGACACTGAATA-GAAATACA). The product was reamplified with APS-1 and APS-2cut with NotI and the fragment gel isolated. This fragment wainserted into the unique NotI site of pNMT4. This yielded pP{hsp/pba,ry+} and pP{hsp/pbb, ry+}. Both pba and pbb cDNAs are derived fromthe 2-µ-4b spliced form of PB mRNA (Cribbs et al., 1992). Toconstruct the pbQ50K genes, the initial PCR product made with APS1 and APS-2 was used in two PCRs. One PCR used primers APand APS-4 (GCGGCGGTTTTTGAACCAAACTT), and the otherused the primers APS-2 and APS-3 (AAGTTTGGTTCAAAAAC-CGCCGC). The products of these two reactions were purified aused in a PCR with the primers APS-1 and APS-2. The full-lengproduct isolated from this PCR contains the Q50K change. T

5051The roles of PB and SCR

pb

blering

50%.

thel inaserer 5

t theEL.ialsnd

ctiv-

8),ps,tionn,

ll

ae a-0).

t;

i- ofusmi-thena,

theds totos

tivi-leto

Fig. 1. The phenotypes of the individual loss- or gain-of-function ofPB or SCR activity. (A) Loss of PB activity in a pb27/pb20

hemizygous individual. (B) Gain of PBa activity in the antenna. Thisis an example of a FLP-mediated ectopic expression experimentusing the P{w+, pba>y+> Tubα1}B line. (C) Gain-of-SCR activity inthe antenna. (D) Loss of SCR activity in the proboscis. (A,C) Thearrows indicate a claw, the arrowheads indicate a pulvilli, and besidethe diamond are the sex combs. (B,D) The filled circles indicatemaxillary palp-like bristles, and the filled square marks the thickenedportion of the arista.

product was digested with NotI and inserted into pNMT4 yielding twoconstructs pP{hsp/pbQ50Ka, ry+} and pP{hsp/pbQ50Kb, ry+}. TheQ50K change was confirmed by DNA sequencing. The pbQ50Ka andpbQ50KbcDNAs are derived from the 2-µ-4a and 2-µ-4b spliced formof PB mRNA, respectively (Cribbs et al., 1992). The hsp/Scrandhsp/pbfusion genes were introduced into the Drosophilagenome byP-element transformation (Rubin and Spradling, 1982).

FLP-mediated ectopic expression (Flip-out) constructsWe constructed a FLP-mediated ectopic expression vector (flip-othat contained a unique NotI site into which we inserted our variousNotI fragments containing Scr- and pb-coding regions. The compo-nents that we used to assemble this vector were kindly supplied bStruhl (Struhl and Basler, 1993). The 2.1 kb BamHI-SalI fragmentfrom J35, which carries a single FRT site, a transcriptional termition region and the unique NotI site, was isolated and inserted betweethe BglII and XhoI sites of pW6 (Klemenz et al., 1987), yieldingpW6NotI. The 2.6 kb EcoRI-KpnI fragment carrying the Tub α1promoterwas derived from KB700 by digesting KB700 with NotI,filling in the ends using DNA polymerase and attaching EcoRI linkers.This fragment was isolated and digested with EcoRI and KpnI, andthe resulting fragment was inserted between the unique KpnI andEcoRI sites of pW6NotI, yielding pP{w+, NotI >Tub α1}. Before thelast step, the unique NotI site of J35 was deleted by filling it in andreligating, yielding J35∆NotI. The XbaI fragment carrying the y gene,flanked by two partial FRT sites, was inserted into the unique XbaI ofpP{w+, NotI> Tubα1} resulting in pP{w+, NotI>y+>Tubα1}. Into theunique NotI site of this vector, were inserted NotI fragments carryingpba, pbQ50Ka, pbQ50Kb, Scra, Scrb and ScrQ50Ka. The P-elementcarrying these constructs was inserted into the Drosophilagenome byP-element-mediated transformation (Rubin and Spradling, 1982).

The y+ gene between the FRT sites was excised by crossing one of the established lines with males of stocks GS1 or DJ400. progeny of these crosses were heat shocked for 20 minutes to 1 at 36.5°C to induce expression of FLP protein from the heat-shockpromotor/FLP fusion gene. For the assay of rescue of the phenotype by PBa and PBQ50Kb, stock APS303 was crossed withAPS301 and APS303 was crossed with APS302, respectively (Ta1). The progeny was heat shocked for 30 minutes at 36.5°C duembryogenesis 0 and 24 hours AEL.

Cuticle preparations First instar larvae and dissected adult heads were mounted in Hoyer’s 50% lactic acid (Wieschaus and Nüsslein-Volhard, 1986)

In situ hybridization We found that a good salivary gland marker can be made from Sp6 promoter of the pSPT19-Neo plasmid supplied as a contromany kits. The in situ hybridization was performed essentially described in Tautz and Pfeifle (1989), except that the embryos wnot digested with proteinase K, but were incubated in acetone fominutes on ice.

Determination of the temperature-sensitive period of thepb1 allele Flies from the stocks 2097 and 2178 were crossed. The time thahatched first instar larvae were collected was defined as 24 hours AThe vials were placed at 18°C or 28.5°C and, at specific times, vwere either shifted up or down. The time of pupation at 18°C a28.5°C was used to normalize the results to 25°C.

RESULTS

Clones of pb Scr null mutant proboscis cells adoptantennal identityPrevious genetic observations suggest that PB and SCR a

s

ut)

y G.

na-n

anyThehour

ities may interact (Fig. 1). (i) The proboscis of a null pbmutant is transformed into a pair of tarsi (Kaufman, 197and (ii) these alleles also result in reduced maxillary palwhich some investigators have interpreted as a transformaof the maxillary palps into antennae (Fig. 1A) (Kaufma1978). (iii) Ectopic expression of PB from a heat-shockpromoter/pbfusion gene (Cribbs et al., 1995), or in a smaclone of cells from a Tubulin α1 (Tub α1) promoter/ pb fusiongene (Fig. 1B) result in the transformation of the antenninto maxillary palps. (iv) Ectopic expression of SCR fromheat-shock promoter/Scrfusion gene results in the transformation of the aristae into tarsi (Fig. 1C) (Gibson et al., 199(v) The proboscis of semilethal loss-of-function Scr alleles,and clones of Scr null mutant cells in the proboscis adopmaxillary palp identity (Fig. 1D) (Pattatucci et al., 1991Struhl, 1982).

That both PB and SCR activities are required for determnation of proboscis identity, and that individual expressionPB and SCR activities determine maxillary palp and tarsidentities, respectively, suggests a simple model for deternation of four developmental identities. We propose that expression patterns of PB and SCR determine antenmaxillary palp, tarsus and proboscis identities. Specifically, absence of PB and SCR expression, the default state, leaantennal identity, expression of only PB activity leads maxillary palp identity, expression of only SCR activity leadto tarsus identity, and expression of both PB and SCR acties leads to proboscis identity. A prediction of this simpmodel is that a proboscis primordial cell that is unable express either PB or SCR will adopt antennal identity.

5052

ininesondantof

ants ofyal.,otheo-

isndidtedl.,

-othe

r

r,

n.

peisall

A. Percival-Smith and others

We have tested this prediction by constructing a chromsome with a Flip recombinase target site (FRT), and the nullpb27 allele and the null Scr2 allele. This chromosome wasused in a combined Flip-mediated mitotic recombinati(Golic, 1991; Xu and Rubin, 1993) and minute techniqexperiment (Basler and Struhl, 1994) to generate clonesproboscis cells that were homozygous for the pb27 Scr2

alleles. These mutant proboscis cells develop with antenfate (Fig. 2A), confirming the prediction of the simple modeThe transformation is not just the transformation of tproboscis into an arista (Fig. 2A), but also a third antensegment with the appropriate sensilla (Fig. 2B). Alobserved, were thick thorny bristles (zahnborsten) indicaof a second antennal segment transformation (Fig. 2Although we do not observe defined first and second antesegments in the pb27 Scr2 clones of cells, we neverthelesthink that pb27 Scr2 mutant proboscis cells represent a tranformation to a true complete antenna.

Genetic evidence with PB Q50K molecules that PBand SCR interact in a multimeric complexPB and SCR are nuclear-localized, homeodomain-containproteins suggesting that they both function as transcriptioregulators (Pultz et al., 1988; Glickman and Brower, 1988)this is the case, two mechanisms for the role of PB and Sin proboscis determination may be proposed. In both modPB regulates a set of PB-regulated genes that, when exprein isolation, determine maxillary palp identity. Similarly, SCregulates a set of SCR-regulated genes that, when expressisolation, determine tarsal identity. In one model, expressionboth sets of PB-regulated genes and SCR-regulated genthe same cell determines proboscis identity. In a second moexpression of PB and SCR proteins in the same cell lead

Fig. 2. (A,B) A pb27 Scr2 mosaic analysis and (C,D) ectopicexpression of PBQ50Katransforms the tarsal mouthparts of apbnull mutant to arista. (A,B) Clones of pb27 Scr2 cells inthe proboscis. (A) Transformation to an arista and (B)transformation to a third antennal segment with secondantennal segment bristle. (C) The aristal mouthparts of apb27, P{hsp/pbQ50Ka, ry+}/pb20 individual from a cross ofAPS110 and 2172 that had been heat shocked at 36.5°C for15-30 minutes between 67 and 72 hours AEL. (D) The samehead shown in C but viewed from below to demonstrate thecomplete lack of pseudotrachea. Asterisk (*), aristaltransformations; filled squares, the sensilla trichodea; arrow,a thorny second antennal segment bristle.

o-

onue of

nall.

henalsotiveB).

nnalss-

ingnal. IfCRels,ssedRed in of

es indel,s to

formation of a PB-SCR-containing, heteromeric, protecomplex that regulates a novel set of genes that determproboscis identity, the PB-SCR-regulated genes. If the secmodel is correct, it should be possible to design dominnegative PB and SCR molecules that will inhibit the activity the other.

In choosing the mutations used for the designed dominnegative PB and SCR molecules, we thought the propertiepreviously described change of DNA-binding specificitmutants made them ideal candidates (Percival-Smith et 1990; Hanes and Brent, 1991; Schier and Gehring, 1992). BPB and SCR have a glutamine at position 50 of the homdomain (HD), and we have created pband Scrgenes where thisglutamine has been substituted for a lysine. This changeexpected to change the DNA-binding specificity of PB aSCR from Antennapedia class DNA-binding sites to Bicoclass DNA-binding sites, as has been extensively documenfor other HDs (Percival-Smith et al., 1990; Capovilla et a1994). The result of this change would be that the PBQ50K andSCRQ50K molecules, as well the PBQ50K SCR and PB-SCRQ50K-containing complexes, would not only have diminished affinity for their normal interaction site, but would alshave an increased affinity for another set of sites dragging PBQ50K and SCRQ50K molecules, as well as the PBQ50K SCRand PB-SCRQ50K-containing complexes, away from theinormal site of interaction.

We fused the pbQ50Ka gene behind a heat-shock promoteand introduced this hsp/pbQ50Ka fusion gene into theDrosophila genome by P-element-mediated transformatioInduction of PBQ50Ka expression does not affect wild-typeproboscis formation. This inability to produce a phenotymay be due to PBQ50Ka not being vastly overexpressed, as the case with the dominant negative approach in yeast (H

5053The roles of PB and SCR

m, to

xR

ect

ere of

to

isare

le, of

ity

atve

es-

ells

ryE)3H).dent

n,.r-eicotis

sringartic

al.,

ice

ic

ofet

Fig. 3. PBQ50Kb has reduced PB activity. All panels are pb27/pb20

individuals. (A-C) Antennae; (D-F) maxillary palps; (G-I)proboscises. (A,D,G) No expression of PB protein; (B,E,H)expression of PBa; (C,F,I) expression of PBQ50Kb. (J) An antennalsacculus; (K) a sacculus in the proboscis of a pb27/pb20 individualexpressing PBQ50Kb and (L) a zahnborsten in a pb27/pb20 individualexpressing PBQ50Kb. Filled circles, maxillary palp-like bristles;asterisks, arista-like structures; arrowhead, sacculi; arrow in H, thepseudotrachae; arrow in L, the zahnborsten.

and Johnson, 1987; Herskowitz, 1987). To avoid this problewe assayed a situation where SCR activity was alonecomplex with PBQ50Ka, such that the PBQ50Kamolecule did nothave to compete with the wild-type PB molecule for compleformation with SCR. In the simple model proposed, SCactivity in a pb mutant is left ON by itself in the proboscisprecursor cells to determine tarsus identity. If PBQ50Kahas theproperties of a dominant negative molecule, we would expthat the tarsal mouthparts of a pbmutant would be transformedto aristae, as aristal identity represents a regulatory state whboth PB and SCR activity are OFF. We found that inductionPBQ50Ka expression in a pb27/pb20 null mutant combinationresults in the transformation of the tarsal mouthparts inaristae (Fig. 2C,D). This indicates that PBQ50Ka is a dominantnegative molecule. This proboscis-to-arista transformationnot associated with pseudotrachea formation (Fig. 2D) as pb hypomorphic alleles (Kaufman, 1978).

Although ectopic expression of PBQ50Ka does result in theexpected transformation of a dominant negative PB molecuan expected control result would be that ectopic expressionPB from a hsp/pbfusion gene should rescue the pbnull mutantphenotype (Cribbs et al., 1995; Randazzo, 1991). The toxicof ectopic expression of PBa/b did not allow this control. It isstill important to demonstrate that PBQ50K molecules havereduced activity relative to PB molecules if the claim thPBQ50Ka has the genetic properties of a dominant negatimolecule is correct. Another concern is that PBa and PBQ50Ka

are derived from different spliced forms of PB mRNA 2-µ-4band 2-µ-4a, respectively. To address these concerns, we invtigated whether PBa expressed in a clone of cells from the Tubα1 promoterwould rescue the pb null phenotype and PBQ50Kb

would not. The pba and pbQ50Kb genes were inserted intopP{w+, NotI>y+>Tubα1}, and introduced into the Drosophilagenome by P-element-mediated transformation. Clones of cexpressing PBa in a pb27/pb20 individual exhibit rescue of thepb null phenotype: the antenna is transformed to a maxillapalp (Fig. 3B), the reduced maxillary palp is rescued (Fig. 3and the tarsal mouthparts are rescued to a proboscis (Fig. These rescue phenotypes were observed in two indepentransformed lines. Clones of cells expressing PBQ50Kb in apb27/pb20 individual exhibit the phenotype expected of dominant negative PB molecule: the antennae are not traformed to maxillary palps (Fig. 3C), the reduced maxillarpalps are not rescued (Fig. 3F) and the tarsal mouthpartstransformed towards antennae (Fig. 3I,K,L). We observed tarsus-to-arista transformation (Fig. 3I), the presence of antenna sense organ, the sacculus (Fig. 3K), and the presof thick thorny bristles, the zahnborsten (Fig. 3L). These phnotypes were observed in two independent transformed lin

Genetic evidence that the interaction between PBand SCR is regulatedAlthough the analysis with PBQ50K molecules stronglysuggests an interaction between PB and SCR molecules, expected transformations were not observed. Ectoexpression of SCR, from a heat-shock promoteror a Tubulinα1 promoter Scrfusion gene, does not transform the maxillarpalp into a proboscis and ectopic expression of SCRQ50K doesnot reduce the maxillary palps (data not shown). We have aperformed assays to detect a direct interaction between in vsynthesized PB and SCR, but all our assays failed to detec

ans-y arethetheencee-es.

twopic

y

lsoitrot an

interaction. These assays were: coimmunoprecipitatiocofractionation, crosslinking and cooperative binding to DNAWe have a suggestion for this inability to detect a direct inteaction in vitro that is based on some peculiarities of thembryonic phenotype of loss of PB function and ectopexpression of PB protein. A direct PB-SCR interaction may nbe detectable in vitro because the PB-SCR interaction regulated in vivo.

One of the original observations that initiated this work wathat PB and SCR are coexpressed in the labial segment duembryogenesis and in the labial imaginal disc of third instlarvae. However, one of the most interesting and useful geneproperties of pbnull alleles is their adult viable phenotype; PBhas no detectable activity during embryogenesis (Pultz et 1988). The cuticle and salivary glands of pb null mutant firstinstar larvae are wild type. Indeed, it seems that embryonlabial segmental identity is determined by SCR activity alon(Struhl, 1983; Pattatucci et al., 1991). The embryonphenotype of Scr null mutant alleles is reduction of the T1beard, duplication of the maxillary sense organs, disruptionhead involution and no salivary gland formation (Pattatucci

5054

drd

-R.of0);rdB;

me

g

T1

A. Percival-Smith and others

Fig. 4.PB activity inhibitsSCR activity in the thoraxbut not the head. (A-C) Firstinstar larval cuticlepreparations; (D-F) in situhybridizations with asalivary gland-specific probeto 10 hours AEL embryos.(A,D) The result of ectopicexpression of PB; (B,E) theresult of ectopic expressionof both PB and SCR and(C,F) the result of ectopicexpression of SCR. Thearrows in A and B indicatethe reduced T1 beards, andthe asterisks in C indicate theectopic T1 beards in T2 andT3; note that the ectopic T1beards are lacking in B. The squares in D-F are beside the normal salivary glands. The arrowheads point to the ectopic salivary glands inducedby ectopic expression of SCR. Note the presence of ectopic salivary glands when both PB and SCR are ectopically coexpressed.

al., 1991; Zeng et al., 1993; Panzer et al., 1992). Loss of bPB and SCR activities has the same cuticular phenotype asof SCR activity alone, indicating that PB has no activity evwhen SCR activity is absent (data not shown). Ectopexpression of SCR protein results in ectopic T1 beards in and T3, and ectopic salivary glands in the head (Gibson et1990; Panzer et al., 1992; Zeng et al., 1993). All these preously described phenotypes lead to the question, ‘Why dPB activity expressed in the embryonic labial segment ninteract with SCR activity and inhibit SCR activity in determination of embryonic labial identity?’

Since PB activity is dispensable during embryogenesiswas surprising that ectopic expression of PBa/b protein duringembryogenesis had such a strong phenotype (Fig. 4A). One20 minute heat shock at 5 hours AEL results in inhibition

Table 1. TabName Genotyp

2178 pb27/TM32172 pb20/TM32097 pb1 pp/TM32185 Scr2 pp cu/TM6B2184 Scr1 pp cu/TM6BAPS101 pb27 Scr2 pp cu/ TM3APS202 y w; P{ry+, neor, FRT}82B pb27/ TM6B, P{walLyAPS201 y w; P{ry+, neor, FRT}82B pb27 Scr2 pp cu P{w+

APS111 y w; P{ry+, neor, FRT}82B Scr1 pp cu P{w+, ry+

APS112 y w; P{hspFLP}/CyO; P{ry+, neor, FRT}82B ScDJ102 y w; P{ry+, neor, FRT}82B Sb63bM(3)95A2 P{y+

GS3 w1118P{hspFLP}; P{ry+, neor, FRT}82B Sb63bMGS1 y raf/FM6; P{hspFLP}/CyODJ400 y w; P{hspFLP}/CyO; Ki ftz11/ TM6B, P{walLy}82-w+ w1118; P{ry+, neor, FRT}82B P{ry+, w+}90EScr3 P{hsp/Scr, ry+}APS110 pb27, P{hsp/pbQ50Ka, ry+}/TM3APS301 yw; P{w+, pba>y+>Tubα1}A; pb27/TM6B, P{waAPS302 yw; P{w+, pbQ50Kb>y+>Tubα1}A; pb27/TM6B, APS303 yw; P{hspFLP}; pb20/TM6B, P{walLy}DJ403 y w; P{hspFLP}/CyO; P{ry+, neor, FRT}82B pb2

DJ402 y w; P{hspFLP}/CyO; P{ry+, neor, FRT}82B pb2

APS121 y w; P{ry+, neor, FRT}82B pb20 Sb63bM(3)95A2

*The w allele on the y wchromosome is Df(1) w67c23.2.

oth lossenicT2 al.,vi-

oesot-

, it

10-of

germband retraction, inhibition of head involution anreduction of the T1 beard (Fig. 4A). Reduction of the T1 beais one of the phenotypes of a Scrnull allele indicating that PBinhibits SCR activity during T1 beard formation. To characterize this further, we ectopically coexpressed PB with SCEctopic expression of SCR alone results in the formation ectopic T1 beards in T2 and T3 (Fig. 4C) (Gibson et al., 199however, with ectopic coexpression of PB with SCR, T1 beaformation in all thoracic segments is suppressed (Fig. 4Table 2). PBQ50Ka also inhibits SCR activity in induction ofectopic T1 beards (data not shown). Also, we observe the sasuppression of ectopic beard formation by PB using SCRa.These data indicate that PB inhibits SCR activity durinembryogenesis in T1 beard formation.

Although ectopic expression of PB protein reduced the

le of stockse* Origin

Pultz et al. (1988)Pultz et al. (1988)Kaufman (1978)Pattatucci (1991)Pattatucci (1991)this work

} this work, ry+}90E/TM6B, P{walLy} this work}90E/TM6B, P{walLy} this workr1 pp cu P{w+, ry+}90E/TM6B, P{walLy} this work, ry+}96E P{w+, exd+}/TM6B, P{walLy} this work(3)95A2/TM2 Basler et al. (1994)

G. Struhlthis workXu et al. (1993)Gibson et al. (1990)this work

lLy} this workP{walLy} this work

this work7/ TM6B, P{walLy} this work7 Scr2 pp cu P{w+, ry+}90E/TM6B, P{walLy} this workP{y+, ry+}96E/TM6B, P{walLy} this work

5055The roles of PB and SCR

nse

s aal.,

dhisurs

hearwerePBic

n isheCRedter-of

esheere

ndntals

ble ofus-

ive

-

cisic

rbialandat-n of-

isndtheat-legndR

Table 2. Ectopic expression of PB inhibits the phenotypecaused by ectopic expression of SCR in the thorax but not

the head% embryos with

% larvae with ectopic ectopic salivaryEctopic expression of T1 beards* glands†

SCR 71 (n=67) 53 (n=87)PB-SCR 5 (n=65) 49 (n=113)

*5 hour old embryos were heat shocked for 40 minutes at 36.5°C.†3 hour old embryos were heat shocked for 25 minutes at 36.5°C.

Fig. 5.The results of ectopic expression of PBQ50Kaon adult legdevelopment. (A) A wild-type tarsus. In all panels: arrowhead,pulvillus; arrows claw; asterisk, arista-like structure. (B) A first legand (C) a third leg that developed after ectopic expression ofPBQ50Ka. In both panels the posterior claw is absent, and in C itlooks as if the claw is replaced by an arista-like structure indicatedbeside the asterisk. The example in B has arista-like structuresdeveloping further up the tarsus. (D,E) Also the result of ectopicexpression of PBQ50Ka. (D) Ectopic rows of sex combs developing ona male first leg, and (E) the shortening and malformation of a firstleg. (E) The tarsus is also transformed toward aristal identity.

beard, the other cuticular phenotype of an Scr null allele, anectopic maxillary sense organ, was not found. We performan extensive series of heat shocks at different times duembryogenesis, but did not observe ectopic maxillary seorgans. However, recent analysis of this Scr homeotic trans-formation has questioned whether this Scr phenotype iduplication of the maxillary sense organ (Pederson et 1996). Another phenotype of a Scr null allele not observedwith ectopic expression of PB is inhibition of salivary glanformation (Fig. 4D) (Panzer et al., 1992). To characterize tfurther, we ectopically coexpressed PB and SCR at 3 hoAEL to determine if PB could inhibit the ability of ectopicallyexpressed SCR to induce ectopic salivary glands. Tfrequency of ectopic salivary gland formation was similwhen SCR was expressed alone, as when PB and SCR coexpressed (Table 2; Fig. 4E). As observed with loss of activity, salivary gland specification is not affected by ectopexpression of PB.

These experiments suggest that the PB-SCR interactioregionally specific during embryogenesis: occurring in tthorax, but not the head. This result indicates that the PB-Sinteraction is regulated. If the PB-SCR interaction is regulatduring embryogenesis, it may be regulated during adult demination, potentially explaining why ectopic expression SCRQ50K did not inhibit PB activity in maxillary palpformation, and also why ectopic expression of SCR donot result in a maxillary palp-to-proboscis transformation. Tregulation of the PB-SCR interaction also suggests that this a factor(s) mediating PB and SCR complex formation.

SCR activity is required cell nonautonomously fortarsus determinationIn the course of this study of the PB-SCR interaction, we fouthat our various stocks allowed us to address a fundameproblem with our model for the determination of the variouadult structures. Although ectopic expression of SCR is ato induce an arista-to-tarsus transformation (Fig. 1C), lossSCR activity in a mosaic analysis does not result in a tarsto-arista transformation (Struhl, 1982).

Ectopic expression of PB Q50Ka and PB proteinstransform tarsi toward aristaeThe goal of ectopic expression of the dominant negatPBQ50Kmolecule was to inhibit SCR activity. Indeed PBQ50Ka/b

do inhibit SCR activity in determination of the tarsal mouthparts of a pb27/pb20 null mutant (Figs 2C,D; 3). This effect ofPBQ50Ka/b suggests that PB and SCR determine probosidentity by forming a PB-SCR-containing, heteromercomplex. Another goal of ectopic expression of PBQ50K and

edring

PB was to inhibit SCR activity via complex formation in otheregions of the body plan besides the labial segment and laimaginal disc. During embryogenesis, SCR is expressed in, is required for, determination of T1 segmental identity (Ptatucci et al., 1991). We have shown that ectopic expressioPB and PBQ50K inhibits SCR activity required for determination of embryonic T1 segmental identity (Fig. 4; Table 2).

The larval expression pattern of SCR is complex. SCRexpressed in the first leg imaginal disc of third instar larvae ahighly expressed in a patch of ectoderm cells that are primordia of the sex combs (Glickman and Brower, 1988; Ptatucci and Kaufman, 1991). SCR is also expressed in all discs in the mesoderm primordia, the adepithelial cells athroughout the labial imaginal disc. The requirement of SC

5056

ent

a

ns--

he50ldll aed,fore

beCRRoron

isfic,

sus

ourns

ni-en-ion

s inrm

ing,ond

nd

A. Percival-Smith and others

Fig. 6. The phenotypes ofclonal loss of PB activity in theproboscis. (A) An aristaltransformation, (B) a mixedaristal/tarsal transformation and(C) a tarsal transformation.Asterisks, arista-like structures;arrow, a claw; arrowhead, apulvillus.

activity defined by genetic analysis is also complex (Stru1982; Gibson et al., 1990). Our initial expectation for thphenotype of ectopic expression of PBQ50Ka during the larvalstage had been a transformation of the first leg identity to secleg identity and the reduction in the number of sex combs.

Ectopic expression of PBQ50Ka from a hsp/pbQ50Ka fusiongene at late second and early third instar larval stageadministration of a short 10 or 20 minute heat shock is vtoxic. The survivors exhibit a number of leg phenotypes: increased number of sex combs on male first legs (Fig. 5ectopic sex combs on lower tarsal segments of the male leg, a twisted and shortened leg phenotype (Fig. 5E) antarsus-to-arista transformation of the ends of all tarsi (F5B,C). Ectopic expression of PBa/b during third instar larvalstage by administration of a short 10 minute heat shockvery toxic. The survivors of ectopic expression of PBa/b havesimilar phenotypes as those produced by ectopic expresof PBQ50Ka. Although we did not get the expected phenotywith ectopic expression of PBQ50Ka in the leg, anything but,the aristal transformation of all legs was interesting becaof the expression pattern of SCR common to all the imaginal discs. SCR is expressed in the mesodermal adthelial cells of all leg imaginal discs (Glickman and Browe1988). If PBQ50Ka and PBa/b were inhibiting SCR activity toresult in the tarsus-to-arista transformation of all six legSCR must be determining tarsal identity via a cell nonatonomous mechanism, that is, SCR activity expressed in adepithelial cells must be dictating tarsal identity in thectoderm.

Mosaic analysis with null Scr and pb allelesWe have repeated the mosaic analysis performed by St(1982) with the null Scr1 and Scr2 alleles and have also foundthat the tarsi are not transformed to aristae. These resultsexplained by the proposed nonautonomous mechanism of Sfunction. In a mosaic analysis, a clone of Scr mutant cells issurrounded by Scr+ cells. Also, the markers used in our studieand others, can only be scored in the ectoderm. The nautonomous mechanism proposes that tarsus determinatiothe ectoderm does not require SCR activity in the ectodercells, but requires that a SCR-dependent, tarsus-inducsignal factor is synthesized in the mesoderm. Hence, imosaic organism with a Scr1 clone in the ectoderm of thetarsus, SCR activity in the mesoderm is still directing syntheof the tarsus inducer. Also important to note is that a cloneScr1 adepithelial cells will not secrete the tarsus-inducinfactor, but the surrounding Scr+ adepithelial cells will still be

hl,e

ond

byeryanD),firstd aig.

is

sionpe

uselegepi-r,

s,u-thee

ruhl

areCR

s,on-n of

maling,n a

sis ofg

secreting the tarsus-inducing factor; thus, Scr1 clones in themesoderm produce no phenotype.

This cell nonautonomous proposal also has independsupport from a mosaic analysis with the pb27 null allele in theproboscis. This experiment was originally conceived ascontrol, because a previous mosaic analysis with a pb1 ssa chro-mosome had shown a reproducible proboscis-to-tarsus traformation (Struhl, 1981b). The null pb phenotype of a completely mutant organism is a tarsal transformation of tproboscis (Kaufman, 1978). Hence, it was surprising that % (Fig. 6A) of pb27 clones in the proboscis adopt aristaidentity, 15% a mixed aristal and tarsal identity (Fig. 6B), an35% tarsal claws and pulvilli (Fig. 6C). The proposed cenonautonomous requirement for tarsal determination onSCR-dependent, tarsus-inducing, mesodermally synthesizsignaling factor and the interaction between PB and SCR proboscis determination explains this result nicely. In thmosaic analysis, a clone of pb27 ectodermal cells is produced.Remember that the markers that we used, Sb M, can onlyscored in ectodermal derivatives. In these clones of cells, Sactivity is no longer associated with PB activity, but SCactivity expressed in ectodermal cells is not sufficient fsynthesis of the tarsus inducer. PB activity present in the npb27 mutant cells (that is wild type for PB activity) of themesoderm is interacting with SCR activity such that SCRnot free by itself for the synthesis of the mesoderm-specitarsus inducer. This situation results in the clone of pb27 ecto-dermal cells adopting an aristal identity because no tarinducer is synthesized.

Clones of pb Scr cells in the labial region of a pbmutant adopt tarsus identityThe nonautonomous mechanism is a robust explanation of results as it also explains why infrequent tarsal transformatioare observed in a pb27 mosaic analysis, but never observed ia pb27 Scr2 mosaic analysis. FLP-mediated mitotic recombnation is very efficient; a mosaic organism has many indepdent clones (Xu and Rubin, 1993). The tarsal transformatof the proboscis observed in the pb27 mosaic analysis could bea result of two clones of pb27 cells: one clone marked with theectodermal markers and a second unmarked clone of cellthe mesoderm. This results in a clone of cells in the mesodethat can synthesize the SCR-dependent, tarsus-inducsignaling factor and a clone of ectoderm cells that can respto the synthesis of this factor (pb27). However, when the samedouble clone situation occurs in a pb27 Scr2 mosaic analysis,the clone produced in the mesoderm lacks SCR activity a

5057The roles of PB and SCR

hata

aal).

ent

ustion

llsR,

anip-

can not produce the tarsus-inducing factor, which explains wpb27 Scr2 clones invariantly adopt aristal identity (Fig. 2A,B)If these explanations are correct, then an ectodermal clonpb27 Scr2 mutant cells in a pb null mutant background willadopt tarsal identity and not aristal. This result is expecbecause SCR activity in the mesoderm of a pb null mutant isreleased from interaction with PB such that the tarsus induwill be synthesized, and removal of SCR activity in thectoderm will have no effect.

We have tested this prediction using FLP-mediated mitorecombination with a fly of the genotype y w; P{hspFLP}/+;P{ry+, neor, FRT}82B pb27 Scr2 P{w+, ry+}90E/ P{ry+, neor,FRT}82B pb20 Sb63b M(3)95A2 P{y+, ry+}96E. Clones of pb27

Scr2 cells in the ectoderm of a pb27/pb20 mutant do adopt tarsalidentity, and not aristal identity as in a pb+ organism (Fig. 7A).This experiment has some technical problems. The flies wthis genotype are very sick and only a few eclose so thamajority of adults had to be dissected from the pupal casThe transformed proboscis everts with a low frequency (F7A). Also, the pb null phenotype is mixed; in this genebackground, we often observe mixed tarsal and aristal traformations (Fig. 7B). However, even with this problem withe pb phenotype, it is important to point out that the pb27 Scr2

clones in a wild-type background never adopt tarsal identbut in a pbbackground they do adopt tarsal identity (Fig. 7A

isc-tein;

that

CRCRnpic

nd

hat

Fig. 7. The phenotypes of clones of pb27 Scr2 cells and pb27 cells in apb27/pb20 mutant background. (A) A clone of pb27 Scr2 cells in apb27/pb20 mutant background. The arrow points to two tarsal clawsone is y+ and the other is y. (Insert) An enlargement of this areawhere the y+ claw is indicated by a black arrow and the y- claw isindicated by the white arrow. (B) The phenotype of the pb27/pb20

combination in this experiment. Asterisk, an arista; arrow, two tarsclaws. (C) A clone of pb27 cells in the proximal portion of thetransformed proboscis. The arrowheads indicate Sb+ y bristles. (D) Aclone of pb27 Scr2 cells in the proximal portion of the transformedproboscis. The arrowhead indicates the clone that is transformed third antenna segment identity.

hy.e of

ted

cere

tic

itht aes.ig.

ticns-

th

ity,).

Thus, the prediction is correct, pb27 Scr2 clones of proboscisprecursor cells will adopt tarsal identity in a pb mutant.

An interesting observation made in this experiment was tpb27 homozygous clones in the proximal proboscis in pb27/pb20 background have a pb phenotype (Fig. 7C). But pb27

Scr2 homozygous clones in the proximal proboscis of pb27/pb20 background show a transformation of the proximleg-like structure to third antennal segment identity (Fig. 7DWe find this interesting because Scr Antp Ubxhomozygousclones of cells in the proximal leg adopt third antennal segmidentity Struhl, 1982). Indeed, pb27 Scr2 clones in a pb back-ground in the proboscis are a phenocopy of Scr Antp Ubxclones in the leg, and ectopic expression of SCR from a hsp/Scrfusion gene in the antenna (Gibson et al., 1990).

Cell nonautonomous requirement of SCR activity fortarsus determination in ectopic expressionexperiments of SCRThe cell nonautonomous requirement of SCR activity for tarsdetermination proposes that the arista-to-tarsus transformainduced by ectopic expression of SCR from a hsp/Scrfusiongene is due to expression of SCR in the adepithelial ce(Gibson et al., 1990). Hence, ectopic expression of SCspecifically in the ectoderm of the arista, should not inducearista-to-tarsus transformation. We have tested this using flout Scr ectopic expression constructs, P{w+, Scra/b>y+>Tubα1}. A clone of ectoderm cells that expresses SCR activitynot transformed to tarsal identity (Fig. 8A). Also, tarsal strutures are observed in arista that are not expressing SCR proin Fig. 8B a claw is observed at the end of a y+ arista. We haveobserved arista-to-tarsus transformation in the three lines express SCRa and the one line that expresses SCRb. This trans-formation of the ectoderm without apparent expression of Salso supports a cell nonautonomous requirement for Sactivity in determination of tarsus identity. As has beeobserved previously (Zecca et al., 1995), we found that ectoexpression of SCR from the Tub α1 promoterwas very low,which may explain why ectopic sex combs on the second athird legs were not observed.

When is SCR activity required for tarsusdetermination?From our analysis of the PB-SCR interaction, we propose t

,

al

to

Fig. 8. The phenotype of clonal ectopic expression of SCR activity.(A) The result of ectopic expression of SCR activity in the ectodermcells of the arista. The arista in A is y, but wild type in structure.(B) A tarsal transformation in a FLP-mediated ectopic expressionexperiment with P{w+, Scra>y+>Tubα1}C. The antenna is y+, butthe tip of the arista has a claw indicated by the arrow. The end of thetransformed arista is shown in the insert.

5058

s-esPB anbe-ive

ra-

theen

anpeRg.

is°C,ge

pic-ic

the

thexseys

scis

A. Percival-Smith and others

0

20

40

60

80

100

20 40 60 80 100 120 140

1st instar 2nd instar 3rd instar Pupa

% A

rist

a

Time After Egg Laying (hours)

160

Fig. 9.The temperature-sensitive period of the pb1 allele. The timesafter egg laying that the larvae of a cross between stocks 2178 and2097 were either shifted up from 18°C to 28.5°C (j), or shifted downfrom 28.5°C, to 18°C (d), are normalized to development at 25°C.The time intervals of the major stages after hatching are indicatedbelow the time axis. The percentage of pb1/pb27 individuals thatexhibited an aristal transformation were plotted; the percentage oftarsal transformations was essentially the reciprocal. The solid barindicates the temperature-sensitive period of the pb1 allele, and thedashed thick bar indicates the temperature-sensitive period of the Scr8

allele determined in an independent study (Pattatucci et al., 1991).

pb

Scr

PB-regulated

SCR-regulated

PB SCR-regulated

pb

Scr

PB-regulated

SCR-regulated

PB SCR-regulated

pb

Scr

PB-regulated

SCR-regulated

PB SCR-regulated

pb

Scr

PB-regulated

SCR-regulated

PB SCR-regulated

?

Antenna Tarsus

Maxillary Palp Proboscis

Expression State

PB- SCR- PB- SCR+

PB+ SCR- PB+ SCR+

SCR

PBPB SCR

pb

Scr

PB SCR-regulated

pb

Scr

PB SCR-regulated

SCR

Tarsus inducer

Tarsus genes Tarsus genes

Tarsus inducer

Mesoderm Ectoderm

Tarsus

A

B

Fig. 10.The model for the PB-SCR interaction and the determinationof four developmental fates (A), and the model for the cellnonautonomous requirement of SCR activity in a wild-type leg (B).(A) The four squares represent four cells each expressing one of fourpossible expression patterns of PB and SCR. The expression of pband Scrgenes is indicated by the wavy arrow and the presence of anellipsoid representing SCR and a sphere representing PB. In thelower part of each cell are represented three sets of genes, the PB-regulated, SCR-regulated and PB-SCR-regulated genes. Althoughthe figure is drawn showing activation of the expression of these setsof genes, our intention is only to indicate some form of regulation:positive, negative or both. The protein factor marked with a questionmark is meant to indicate only that it regulates the PB-SCRinteraction. In model B, the two squares represent an adepithelial cellon the left and a distally located ectodermal cell on the right. In thelower part of each cell are represented three classes of genes, theSCR-regulated, tarsus inducer gene, the tarsus determination genesand the PB-SCR-regulated genes. The arrow between the cellsindicates the action of the secreted tarsus inducer.

the class of pballeles that result in the proboscis-to-arista tranformation produce a PB protein inactive for most PB activitiexcept the ability to interact with SCR. Expression of these proteins with SCR results in SCR being sequestered intoinactive PB-SCR complex such that only arista identity can determined. The first pb allele identified was the temperaturesensitive pb1 allele. We propose that the temperature-sensitcomponent of PB1 protein activity is its ability to interact withand inhibit SCR activity: at 18°C an inactive PB1-SCRcomplex forms, and at 28.5°C PB1 is completely inactiveleaving SCR active to determine tarsus identity. The tempeture-sensitive period of the pb1 allele was reported to be latethird instar larval/ early pupal stage (Villee, 1944).

We have re-examined the temperature-sensitive period ofpb1 allele, as the temperature-sensitive period reflects whSCR activity is required for tarsus determination more thwhen PB activity is required. In a temperature-shift-uprotocol, SCR activity is being turned ON at a specific timafter hatching. In a temperature-shift-down protocol, SCactivity is being turned OFF at a specific time after hatchinThe temperature-sensitive period for the pb1 allele, and hencewhen SCR activity is required for tarsus determination, between 65 hours and 100 hours after egg laying at 25which corresponds to late second/early third instar larval sta(Fig. 9). This period corresponds with the period when ectoexpression of PBQ50Ka results in the tarsus-to-arista transformation, and corresponds with the period when ectopexpression of SCR from a heat-shock promoter results in arista-to-tarsus transformation.

DISCUSSION

A model for the determination of the proboscis.The data presented in the first part of this paper support a m

odel

where both the expression patterns of PB and SCR andability of PB and SCR to interact in a multimeric complecontrol the determination of four adult structures. We propothat the choice of which of the four developmental pathwathat result in antennae, maxillary palps, tarsi and the probo

5059The roles of PB and SCR

in

inndhein

pi- aneix-see

ofs-mig.

lts.

Rth,

ofn

h

the

er,

cting isheng

nisedn

us-

en-lex

noter,rentRf a

onhes-

are entered is controlled by the expression patterns of PBSCR (Fig. 10A). Specifically, the absence of PB and Sexpression, which we have defined for this discussion asdefault state, leads to antennal identity; expression of onlyleads to maxillary palp identity; expression of only SCR leato tarsus identity and expression of both PB and SCR leadproboscis identity (Fig. 10A). Also proposed in this modelthat PB regulates a set of PB-regulated genes requiredmaxillary palp determination and SCR regulates a set of SCregulated genes required for tarsus determination. But wPB and SCR are expressed together, PB and SCR form aSCR-containing, heteromeric complex that regulates a noset of genes, the PB-SCR-regulated genes. We also suggesPB-SCR complex formation is regulated, that is, it may beindirect interaction involving other cofactors (Fig. 10A).

The results presented in this paper that support this moare as follows. (i) Proboscis progenitor cells unable to exprPB and SCR adopt antennal fate (Fig. 2A,B). The transformtion of the proboscis includes an arista, the third antensegment, and elements of the first or second antennal segm(ii) Using dominant negative molecules PBQ50Ka/b, we haveproduced Scr loss of function phenotypes. The results widominant negative PB molecules strongly suggest that PB SCR interact in a multimeric protein complex. (iii) The inteaction between PB and SCR seems to be indirect. We hbeen unable to detect a direct interaction between PB and in vitro, and we also have genetic evidence that the PB-Sinteraction is regulated during Drosophilaembryogenesis. Wedetect PB inhibiting SCR activity in T1 beard formation in ththorax; however, PB does not inhibit SCR activity in formatioof salivary glands in the head. This suggests that the PB-Sinteraction is regionally specific during embryogenesoccurring in the thorax and not the head. This may also expwhy we were unable to observe a reduction of the maxillpalps with ectopic expression of SCRQ50K, and a maxillarypalp to labial palp transformation with ectopic expressionSCR. There are many models that can explain this regiospecificity, but all involve the presence of a factor(s) in additito PB and SCR. This additional factor may be involved in tpost-translational modification of either PB or SCR whicwould be required for the interaction to occur, or the factor mbe a bifunctional protein, or protein complex, with one domathat binds PB and another domain that binds SCR.

The model is drawn to resemble the α1-α2 hypothesis inten-tionally (Herskowitz, 1989). In yeast, the two homeodomacontaining proteins encoded by MATα2 and MATa1 genesinteract (Goutte and Johnson, 1988; Dranginis, 1990; Li et 1995). In haploid a cells, the α2 protein forms a homodimerthat binds to specific α2-binding sites in a-specific genesrepressing their expression. In a/α diploid cells where both α2anda1 are expressed, a-specific genes are still repressed by tα2 protein. In addition, α2 and a1 proteins form a heterodimethat binds to specifica1/α2-binding sites in haploid-specificgenes repressing their expression. Overexpression odominant negative α2 molecule in ana/α cell results in thederepression of both a-specific genes and haploid-specifigenes (Hall and Johnson, 1987). This yeast interactionsimilar to the PB-SCR interaction in both form and thmethods used to demonstrate it. However, the PB-SCR inaction may be indirect, where the α2 a1 interaction is direct(Li et al., 1995). The yeast example is also raised because

andCR the PBdss to is forR-

hen PB-velt that

an

delessa-

nalents.

thandr-ave

SCRCR

enCR

is,lainary

ofnalonhehayin

in-

al.,

her

f a

c iseter-

the

amino acid sequence of the EXD protein in the homeodomashows similarity with MATa1 (Rauskolb et al., 1993) and theUBX-EXD interaction is one of the few well-characterizedinteractions between two homeodomain-containing proteinsvivo (Chan et al., 1994; Johnson et al., 1995; Peifer aWeischaus, 1990). However, the PB-SCR interaction is tonly reported interaction so far between two HOX proteins vivo.

SCR activity is required cell nonautonomously fortarsus determinationIn the second part of the paper, we explain why, when ectocally expressed from a heat-shock promoter, SCR inducesarista-to-tarsus transformation (Gibson et al., 1990). Wpropose a model for this transformation, and indeed all swild-type tarsi, where SCR activity is required cell nonautonomously for tarsus determination. Specifically, we propothat SCR activity, expressed in all leg imaginal discs in thmesodermal adepithelial cells, is required for the synthesisa tarsus-inducing signaling factor. This secreted tarsuinducing, signaling factor induces the overlaying ectodercells to adopt a tarsal fate as opposed to an aristal fate (F10B). This proposal is supported by five independent resu(i) Ectopic expression of PBQ50K or PB result in a tarsus-to-arista transformation of all six tarsi because much of SCactivity expressed in the adepithelial cells is complexed wiPBQ50K or PB reducing the amount of tarsus-inducingsignaling factor made. (ii) The nonautonomous requirementSCR activity explains why a tarsus-to-arista transformatiowas not observed in a Scr1 mosaic analysis. Because, althougthe ectoderm cells lack a functional Scr gene, the underlyingmesoderm still expresses active SCR and hence secretestarsus-inducing, signaling factor. (iii) A null pb mutantphenotype is a proboscis-to-tarsus transformation; howevclones of pb mutant cells usually adopt aristal identity. This isbecause in a completely pb mutant organism, SCR is free inthe adepithelial cells of the labial imaginal discs to diresynthesis of the mesoderm-specific, tarsus-inducing, signalfactor, but in a mosaic analysis, even though SCR activityfree in the ectoderm, no signaling factor is synthesized in tmesoderm because SCR is still complexed with PB, directiproboscis identity. (iv) When a mosaic analysis with a pb27

Scr2 chromosome is performed in a wild-type background, ainvariant transformation of the proboscis to an antenna observed; however, if the same mosaic analysis is performin a pbgenetic background, the invariant aristal transformatiois not observed. This is because, in a pb background, the ade-pithelial cells are synthesizing the SCR-dependent, tarsinducing, signaling factor which induces the pb27 Scr2 clone ofcells to adopt tarsus identity. In a wild-type background, thSCR-dependent, tarsus-inducing, signaling factor is not sythesized, because SCR is bound up in a PB-SCR compdirecting proboscis identity in wild-type cells. (v) Ectopicexpression of SCR in the ectoderm cells of the arista does result in a transformation of the arista to a tarsus; howevtarsal transformations are observed when there is no appaexpression of SCR in the arista. This is because SCexpression in the ectoderm can not result in the synthesis otarsus-inducing, signaling factor. However, ectopic expressiof SCR in the mesoderm, which can not be detected with tyellow marker, does result in the synthesis of the tarsu

5060

msalndg

tyg.

wol)

fsste,inusaysndgR,

ereicR

icg

s,Pgs,esi-

thatpi-

s,ds.

isnt

tardyityityirdellgena-of

g).X

atndnt

ke

A. Percival-Smith and others

inducing signaling factor. This interlocking set of resulstrongly supports the proposed model.

The genetic data demonstrate a cell nonautonomrequirement for SCR activity, and we propose that SCR activexpressed in the adepithelial cells is required for the synthof a secreted tarsus-inducing, signaling factor. We have threasons for proposing this. (i) SCR protein is expressed inadepithelial cells of all three leg imaginal discs. The only othsite of expression of SCR in the leg discs is specific to the fileg imaginal disc (Glickman and Brower, 1988; Pattatucci aKaufman, 1991). (ii) Leg imaginal discs are composed of otwo germ layer derivatives: the mesoderm and the ectodeThe adepithelial cells are the primordial cells of the admesoderm (Currie and Bate, 1991). (iii) In the Scr1 mosaicanalysis, we observed whole legs that are Scr1 in the ectodermand, in clonal ectopic expression of SCR, we have obserantennae that are completely y+ with tarsal transformations.These two observations indicate that there is not a small pof the ectoderm that transiently expresses SCR and secretetarsus inducer which patterns the whole ectoderm.

The proposed nonautonomous model for SCR function isexample of induction. SCR is required for synthesis ofsignaling factor in the mesoderm of the leg imaginal discs tacts on the overlaying ectodermal cells directing tarsal demination. This is similar to the role of UBX activity in gudevelopment (Immergluck et al., 1990). Another well-charaterized example of induction is the requirement of Linsecreted from the anchor cell of the C. elegansgonad forepidermal vulva development (Hill and Sternberg, 1992).result of our work is the description of the characteristics ofSCR-regulated gene. The SCR-regulated gene, the tarinducer, should be expressed in the adepithelial cells of allleg discs but not the adepithelial cells of the antenna disc. gene product of this SCR-regulated gene should be a secrfactor that is either the ligand or involved in the activation a ligand required for tarsus determination. This SCR-regulagene may also be expressed during embryogenesis undecontrol of SCR, and required for gastric caeca formati(Reuter and Scott, 1990).

Arista versus antenna and tarsus versus legThe arista and tarsus are the distal portions of the antennaleg. The phenotype of the transformations of the probosshown in Fig. 7A,D indicates that the determination of tproximal and distal portions of the leg occurs by distinct mecanisms. There are two further relevant points: first, SCactivity is required cell nonautonomously only for tarsus detmination, and is required cell autonomously for determinatiof first leg identity (Struhl, 1982); second, in a completely pbnull mutant organism, the proboscis is transformed intostructure that is mainly a tarsus, which at the base has redproximal leg parts (tibia and femur) (Kaufman, 1978). Thetransformed mouthparts have first leg identity. SCR activityrequired cell autonomously for sex comb determination. Tinteresting observation made in the pb27 Scr2 mosaic analysisin a pb background was that pb27 Scr2 clones in the proximalregions of the leg-like mouthparts adopted third antensegment identity (Fig. 7D). There are several points that interesting about this transformation when compared to preously reported transformations (Struhl, 1981a, 1982). The fileg transformation of the proboscis requires SCR activ

ts

ousity

esisree

theerrstndnlyrm.ult

ved

atchs the

an ahatter-tc-

-3

A ansus- sixTheetedoftedr theon

andcisheh-R

er-on

aucedse ishe

nalarevi-rstity

alone; remove both PB and SCR activity and an antenna for(Fig. 2A,B). But to get a clone of cells adopting third antennsegment identity in the normal thoracic first leg, both SCR aANTP activity need to be removed (Struhl, 1982). RemovinANTP activity alone has no effect and removing SCR activiresults in the transformation of the first leg into a second le

We suggest that the Drosophilaleg is made up of two devel-opmental fields: the tarsus and the proximal leg. These tdevelopmental fields may correlate with the nuclear (proximaversus cytoplasmic (distal) intracellular localization oExtradenticle, and the distal expression of Distalle(Gonzalez-Crespo and Morata, 1996; Aspland and Whi1997). Also, that there are four genetic pathways working leg determination. The first pathway is the cell nonautonomoSCR-dependent, tarsus-inducing, signal pathway, and this ldown the plan for the basic unmodified tarsus. The secopathway is the relatively cell autonomous proximal lepathway, which can be activated by the expression of SCANTP or UBX and which lays out the basic plan for thproximal leg (Struhl, 1982). The third and fourth pathways acell autonomous pathways that SCR and UBX control. A basleg plan results in second leg identity, but expression of SCor UBX in both the proximal and distal portions of this basplan brings about modifications resulting in first or third leidentity, respectively.

Although this model explains much of our, and otherresults, it does not explain why ectopic expression of ANTtransforms the antenna into a complete pair of second leincluding the tarsus (Schneuwly et al., 1987). How doectopic expression of ANTP activity result in tarsus determnation when it is a SCR-dependent process? It is possible ANTP may activate expression of SCR in the antennal adethelial cells.

Temporal requirements of SCR activityThis model for leg determination, using four genetic pathwayalso explains why SCR has two temperature-sensitive perioThe temperature-sensitive period of pb1 is the late second/earlythird instar larval stage. This period is when SCR activity required for determination of tarsal identity. In an independestudy using the temperature-sensitive allele Scr8, the tempera-ture-sensitive period was determined to be late third inslarval/early pupal stage (Pattatucci et al., 1991). This stuscored a different phenotype, the requirement of SCR activfor the formation of sex combs. This suggests that SCR activis required cell nonautonomously during late second/early thinstar larval stage for tarsus determination, and later cautonomously during late third instar larval/early pupal stato modify the basic leg plan. These observations and explations are similar to those characterizing the requirement mab-5 activity during C. elegansdevelopment (Salser andKenyon, 1996), and the requirement of UBX activity durinDrosophila embryogenesis (Castelli-Gair and Akam, 1995Collectively, all these observations demonstrate that a HOproduct is required in a variety of developmental pathwaysdistinct temporal stages, and that the complex spatial atemporal expression pattern of HOX proteins is an importacomponent of their function.

We thank the Bloomington stock center for fly stocks. We thanGary Struhl for fly stocks, DNA constructs and helpful advise. W

5061The roles of PB and SCR

e

ter.

.

ing

is

ic

.

n

thank Danielle J. Hayden for assistance in constructing some offly stocks and H. Leung for help with the scanning electron micscope. We thank Marc Perry for his comments on the manuscript. Twork was supported by a grant to A. P.-S. from the Medical ReseaCouncil of Canada.

REFERENCES

Andrews, D. J. and Scott, M. P. (1992). Downstream of the homeotic genesThe New Biologist4, 5-15.

Aspland, S. E. and White, R. A. H.(1997). Nucleocytoplasmic localisation ofextradenticle protein is spatially regulated throughout developmentDrosophila. Development124, 741-747

Basler, K. and Struhl, G.(1994). Compartment boundaries and the control Drosophila limb pattern by hedgehog protein. Nature368, 208-214.

Capovilla, M., Brandt, M. and Botas, J. (1994). Direct regulation ofdecapentaplegicby Ultrabithorax and its role in Drosophila midgutmorphogenesis. Cell 76, 461-475

Carroll, S. B. (1995). Homeotic genes and the evolution of arthopods achordates. Nature376, 479-485.

Castelli-Gair, J. and Akam, M. (1995). How the Hox gene Utrabithoraxspecifies two different segments: the significance of spatial and tempregulation within metameres. Development121, 2973-2982.

Chadwick, R. and McGinnis, W.(1987). Temporal and spacial distribution otranscripts from the Deformedgene of Drosophila. EMBO J.6, 779-789.

Chan, S-K. and Mann R. S.(1993). The segment identity functions oUltrabithorax are contained within its homeodomain and carboxy-termisequences. Genes and Dev.7, 796-811.

Chan, S-K., Jaffe, L., Capovilla, M., Botas, J. and Mann, R. S.(1994). TheDNA binding specificity of Ultrabithorax is modulated by cooperativinteractions with Extradenticle, another Homeoprotein. Cell 78, 803-813.

Chan, S-K., Pöpperl, H., Krumlauf, R. and Mann R. S. (1996). Anextradenticle-induced conformational change in a HOX protein overcoman inhibitory function of the conserved hexapeptide motif. EMBO J.15,2476-2487.

Cribbs, D. L., Pultz, M. A., Johnson, D., Mazzulla, M. and Kaufman, T. C.(1992). Structural complexity and evolutionary conservation of tDrosophilahomeotic gene proboscipedia. EMBO J.11, 1437-1449.

Cribbs, D. L., Benassayag, C., Randazzo, F. M. and Kaufman, T. C.(1995).Levels of homeotic protein function can determine developmental identevidence from low-level expression of the Drosophila homeotic geproboscipediaunder Hsp70 control. EMBO J.14, 767-778.

Currie, D. and Bate, M. (1991). Development of adult abdominal muscles iDrosophila: Adult myoblasts express twist and are associated with nerDevelopment113, 91-102

Dranginis, A. M. (1990). Binding of yeast a1 and α2 as a heterodimer to theoperator DNA of a haploid-specific gene. Nature347, 682-685.

Furukubo-Tokunaga, K. Flister, S. and Gehring, W. J.(1993). Functionalspecificity of the Antennapedia homeodomain. Proc. Natl. Acad. Sci. USA90, 6360-6464.

Gehring, W. J., Qian, Y. Q., Billeter, M., Furukubo-Tokunaga, K., Schier,A. F., Resendez-Perez, D., Affolter, M. and Wüthrich, K.(1994).Homeodomain-DNA recognition. Cell 78, 211-223.

Gibson, G., Schier, A. F., LeMotte, P. and Gehring, W. J.(1990). Thespecificities of Sex combs reduced and Antennapedia are defined by a disportion of each protein that includes the homeodomain. Cell 62, 1087-1103.

Glickman, M. A. and Brower, D. L. (1988). Expression of Sex combs reduceprotein in Drosophila larvae. Dev. Biol.127, 113-118.

Golic, K. G. (1991). Site-specific recombination between homologochromosomes in Drosophila. Science252, 958-961.

Gonzalez-Crespo, S. and Morata, G.(1996). Genetic evidence for thesubdivision of the arthropod limb into coxopodite and telopoditDevelopment 122, 3921-3928

Goutte, C. and Johnson, A. D. (1988). a1 protein alters the DNA bindingspecificity of α2 repressor. Cell 52, 875-882

Hall, M. N. and Johnson, A. D.(1987). Homeodomain of the yeast repressoα2 is a sequence-specific DNA-binding domain but is not sufficient frepression. Science237, 1007-1012.

Hanes, S. D. and Brent, R.(1991). A genetic model for interaction of theHomeodomain recognition helix with DNA. Science251, 426-430.

Herskowitz, I. (1987) Functional inactivation of genes by dominant negatimutations Nature329, 219-222.

thero-hisrch

.

in

of

nd

oral

f

fnal

e

es

he

ity:ne

nves.

tinct

d

us

e.

ror

ve

Herskowitz, I. (1989). A regulatory hierarchy for cell specialization in yeast.Nature342, 749-757

Hill, R. J. and Sternberg, P. W.(1992). The gene lin-3 encodes an inductivesignal for vulval development in C. elegans. Nature358, 470-476.

Hunt, P. and Krumlauf, R. (1991). Deciphering the Hox code: Clues topatterning brachial regions of the head. Cell 66, 1075-1078.

Immergluck, K., Lawrence, P. A. and Bienz, M.(1990). Induction acrossgerm layers in Drosophila mediated by a genetic cascade. Cell 62, 261-268.

Johnson, F. B., Parker, E. and Krasnow, M. A.(1995). Extradenticle proteinis a selective cofactor for the Drosophila homeotics: Role of thhomeodomain and YPWM amino acid motif in the interaction. Proc. Natl.Acad. Sci. USA92, 739-743.

Kaufman, T. C. (1978). Cytogenetic analysis of chromosome 3 in Drosophilamelanogaster: isolation and characterization of four new alleles ofproboscipedia(pb) locus. Genetics90, 579-596.

Kaufman, T. C., Seeger, M. A. and Olsen, G. (1990). Molecular and geneticorganization fo the Antennapedia gene complex of Drosophila melanogasIn Advances in Genetics: Genetic Regulatory Hierarchies in Development, P.R. F. Wright, ed., Vol. 27. pp. 309-362.

Klemenz, R., Weber, U. and Gehring, W. J. (1987). The white gene as amarker in a new P-elemnt vector for gene transfer in Drosophila. NAR10,3947-3959

Kuroiwa, A., Kloter, U., Baumgartner, P. and Gehring, W. J. (1985).Cloning of the homeotic Sex combs reducedgene in Drosophila and in situlocalization of its transcripts. EMBO J.4, 3757-3764.

LeMotte, P. K., Kuroiwa, A., Fessler, L. I. and Gehring, W. J. (1989). Thehomeotic gene Sex combs reducedof Drosophila: gene structure andembryonic expression. EMBO J.8, 219-227

Lewis, E. B. (1978). A gene complex controlling segmentation in DrosophilaNature276, 565-570.

Li, T., Stark, M. R., Johnson, A. D. and Wolberger, C. (1995). Crystalstructure of the MATa1/MATα2 homeodomain heterodimer bound to DNA.Science270, 262-269.

Lindsley, D. and Zimm, G.(1992). The Genome of Drosophila melanogaster.Academic Press, San Diego, CA.

Mahaffey, J. and Kaufman, T. C. (1987). Distribution of the Sex combsreducedgene products in Drosophila melanogaster. Genetics117, 51-60.

Mann, R. S. and Hogness, D. S. (1990). Functional dissection of Ultrabithoraxproteins in D. melanogaster. Cell 60, 597-610.

McGinnis, W. and Krumlauf, R. (1992). Homeobox genes and axialpatterning. Cell 68, 283-302.

Padgett, R. W., St Johnston, D. and Gelbart, W. M.(1987). A transcript froma Drosophila pattern gene predicts a protein homologous to the transformgrowth factor-beta family. Nature325, 81-84.

Panzer, S., Weigel, D. and Beckendorf, S. K. (1992). Organogenesis inDrosophila melanogaster: embryonic salivary gland determination controlled by homeotic and dorsoventral patterning genes. Development114,49-57.

Pattatucci, A. and Kaufman, T. C. (1991). The homeotic gene Sex combsreduced of Drosophila melanogasteris differentially regulated in theembryonic and imaginal stages of development. Genetics129, 443-461.

Pattatucci, A. M., Otteson, D. C. and Kaufman, T. C.(1991). A functionaland structural analysis of the Sex combs reducedlocus of Drosophilamelanogaster. Genetics129, 423-441.

Pederson, J. D., Kiehart, D. P. and Mahaffey, J. W.(1996). The role of HOM-C genes in segmental transformations: Reexamination of the Drosophila Sexcombs reducedembryonic phenotype. Dev. Biol.180, 131-142.

Peifer, M., Karch, F. and Bender, W.(1987). The bithorax complex: control ofsegmental identity. Genes and Dev. 1, 891-898.

Peifer, M. and Wieschaus, E.(1990). Mutations in the Drosophila geneextradenticle affect the way specific homeodomain proteins regulatesegmental identity. Genes and Dev.4, 1209-1223.

Percival-Smith, A., Müller, M., Affolter, M. and Gehring, W. J. (1990). Theinteraction with DNA of wild-type and mutant fushi tarazuhomeodomains.EMBO J.9, 3967-3974.

Pultz, M. A., Diederich, R. J., Cribbs, D. L. and Kaufman, T. C.(1988). Theproboscipedialocus of the Antennapedia Complex: a molecular and genetanalysis. Genes and Dev.2, 901-920.

Randazzo, F. M., Cribbs, D. L. and Kaufman, T. C.(1991). Rescue andregulation of proboscipedia: a homeotic gene of the Antennapedia complexDevelopment113, 257-271.

Rauskolb, C., Peifer, M. and Wieschaus, E. (1993). extradenticle, a regulatorof homeotic gene activity, is a homolog of the homeobox-containing, Humaproto-oncogene pbx1. Cell 74, 1101-1112.

5062

s

f

.

A. Percival-Smith and others

Reuter, R. and Scott, M. P.(1990). Expression and function of the homeotigenes Antennapediaand Sex combs reducedin embryonic midgut ofDrosophila. Development109, 289-303.

Rubin, G. M. and Spradling, A. C. (1982). Genetic transformation ofDrosophila with transposable element vectors. Science218, 348-353.

Salser, S. J. and Kenyon, C.(1996). A C. elegansHox gene switches on, off,on, and off again to regulate proliferation, differentiation, anmorphogenesis. Development122, 1651-1661.

Schier, A. F. and Gehring, W. J. (1992). Direct homeodomain-DNAinteraction in the autoregulation of the fushi tarazugene. Nature356, 804-807.

Schneuwly, S., Klemenz, R. and Gehring, W. J.(1987). Redesigning the bodyplan of Drosophila by ectopic expression of the homeotic geAntennapedia. Nature235, 816-818.

Slack, J. M. W., Holland, P. W. H. and Graham, C. F.(1993). The Zootypeand the Phylotypic Stage. Nature361, 490-492.

Struhl, G. (1981a). A homeotic mutation transforming leg to antenna Drosophila. Nature292, 635-638.

Struhl, G. (1981b). Anterior and posterior compartments in the proboscisDrosophila. Dev. Biol.84, 372-385

Struhl, G. (1982). Genes controlling segmental specification in the Drosophilathorax. Proc. Natl. Acad. Sci. USA79, 7380-7384.

Struhl, G. (1983). Role of the esc+ gene product in ensuring the selectiveexpression of segment-specific homeotic genes in Drosophila. J. Embryol.exp. Morph.76, 297-331.

c

d

ne

in

of

Struhl, G. and Basler, K. (1993). Organizing activity of wingless protein inDrosophila. Cell 72, 527-540.

Tautz, D. and Pfeifle, C.(1989). A non-radioactive in situ hybridizationmethod for the localization of specific RNAs in Drosophila embryos revealtranslational control of the segmentation gene hunchback. Chromosoma98,81-85.

Villee, C. A. (1944). Phenogenetic studies of the homoeotic mutants oDrosophila melanogasterII. The effects of temperature on expression ofproboscipedia. J. Exp. Biol.96, 85-102.

Wieschaus, E. and Nüsslein-Volhard(1986). Looking at embryos, InDrosophila: A practical Approach, D. B. Roberts ed. (IRL Oxford) pp 199-228.

Xu, T. and Rubin, G. M. (1993). Analysis of genetic mosaics in developingand adult Drosophila tissues. Development117, 1223-1237.

Zecca, M., Basler, K.,and Struhl, G.(1995). Sequential organizing activitiesof engrailed, hedgehog and decapentaplegic in the Drosophila wing.Development121, 2265-2278.

Zeng, W., Andrews, D. J., Mathies, L. D., Horner, M. A. and Scott, M.P.(1993). Ectopic expression and function of the Antpand Scrhomeotic genes;the N terminus of the homeodomain is critical to functional specificityDevelopment118, 339-352.

(Accepted 24 September 1997)