Vortragstagung der DGfZ und GfT am 6./7. September 2006 in Hannover

Genetic analyses of porcine MBL genes and their association with immunological traits

in pigs

C. Phatsara1, D. Jennen

1, S. Ponsuksili

2, E. Murani

3, D. Tesfaye

1,

K. Schellander1, K. Wimmers

3

1Institute of Animal Science, Animal Breeding and Husbandry Group, University of Bonn,

Endenicher Allee 15, 53115 Bonn; 2Research Institute for the Biology of Farm Animals

(FBN), Research Group Functional Genomics, Wilhelm-Stahl-Allee 2, 18196 Dummerstorf,

Germany, 3Research Institute for the Biology of Farm Animals, Molecular Biology Research

Division, Wilhelm-Stahl-Allee 2, 18196 Dummerstorf

Introduction

Mannose-binding lectin (MBL) or mannose-binding protein (MBP), a member of the collectin

family of proteins, is an important factor in the lectin pathway of the complement cascade.

Binding of MBL leads to opsonization through complement activation and deposition of C3.

Its association to MBL-associated serine protease (MASP) initiates the lectin pathway. Two

types of MBL (MBL-A and MBL-C), were characterized in rat (Mizuno et al., 1981), mouse

(Hansen et al., 2000), and bovine (Kawai et al., 1997). While only one MBL was identified in

human and chickens (Laursen & Nielsen, 2000), two forms of MBL were characterized in pig.

A porcine liver MBL cDNA of 723-bp was characterized (Agah et al., 2001) and showed a

higher identity to rat MBL-C than MBL-A proteins. Another MBL were characterized and

proposed as the porcine MBL1 gene, which is homologous to the rodent MBL1 gene and

MBL1P1 pseudogene of humans and chimpanzees (Lillie et al., 2006). In this study,

chromosomal assignment, expression in different tissues, and association with complement

activity of the porcine MBL genes, were analyzed.

Materials and methods

Standard PCR was performed in 20 µl reaction volume. Thermocycling program was initial

denaturation at 95 °C for 5 min, followed by 35 cycles at 94 °C for 30 seconds, 59 °C for 30

seconds, 72 °C for 1 min, and final extension at 72 °C for 10 min. Additionally, touchdown

PCR was used to amplify MBL1. Gene-specific primers used in this study are described in

Table 1. Semiquantitative RT-PCR was employed in order to survey expression of the porcine

MBL genes in muscle, heart, spleen, tonsil, lymph node, lung, liver, kidney, testis, and brain

from adult animals. First-strand cDNA was synthesized from 1 µg of total RNA using random

hexamer primers and oligo (dT)12N with superscript II (Invitrogen, Karlsruhe, Germany) as

reverse transcriptase enzyme. Standard PCR using MBL1-a, and MBL2-a primer sets were

done to detect MBL1 and MBL2 transcripts. The 18S gene was used as an internal control.

Mapping of MBL genes on chromosome was performed by radiation hybrid panel. Moreover,

genetic mapping was performed by two-point linkage analysis using CRIMAP program.

Partial porcine MBL2 gene of 15 pigs were amplified and sequenced using CEQ™ 8000

Genetic Analysis System (Beckman Coulter, Krefeld, Germany) to screen for sequence

variants. PCR Restriction Fragment Length Polymorphism (PCR-RFLP) was performed using

HinfI and AdeI digestive enzymes for MBL1 and MBL2 polymorphic sites. For the MBL1

gene, animals were genotyped at a previously identified C to T substitution on position 328 of

the sequence (AF208528) reported by Marklund et al. (2000). For the MBL2 gene, animals

were genotyped at the G to A transition, which is found in this study, on position 645 of

sequence (NM 214125). Digested PCR products were visualized on 2.5% agarose gel to

determine the genotype distribution. Analysis of variance was performed using the procedure

‘mixed’ and the ‘repeated measure’ statement of the SAS software package. A model was

fitted in order to identify other significant environmental and genetic effects apart from the

MBL1 and MBL2 genotypes and its interaction by stepwise elimination of non-significant

effects. Animal effect was the subject specified in the repeated statement.

Tab. 1 Gene-specific primers (5´-3´) used for porcine MBL genes amplification in this study

Primer set Sequence Annealing Temp.

(°C)

Product size

(bp)

MBL1-a CCCCAATATTTCCTGGAGGT

TCCTCCTTCTGTGTGTGGTG 59 222

MBL2-a GGGAGAAAAGGGAGAACCAG

CACACAGAGCCTTCACTCCA 59 278

MBL1-b AAGGGAGAACCAGGTATAGG

TGAACCCTGGCCCTGTTG 62-66 702

MBL2-b CTTCGCTCAGGGAAAACAAG

GTCATTCCACTTGCCATCCT 59 319

Results and discussion

Semiquantitative RT-PCR of ten tissues showed differential expression of porcine MBL

genes. Both MBL genes were highly expressed in liver. However, low MBL1 expression was

also found in lung, testis and brain, while expression of MBL2 was low in testis and kidney.

Porcine MBL1 expression pattern in this study is similar to the results reported by Lillie et al.,

(2006) showing high expression of MBL1 in liver as well. Differential expression of MBL1

and MBL2 in murine tissues was reported. RT-PCR study revealed that the liver is the major

site of expression for both MBL genes. Also low expression was found in kidney, brain,

spleen and muscle, but only murine MBL1 is expressed in testis (Wagner et al., 2003). An

SNP was found at the position 645 (G to A) of porcine MBL2 cDNA (NM_214125) in F2

DUMI pigs, but did not effect amino acid composition in the translated protein. This SNP

affecting an AdeI restriction site was found to be segregating in the F2 DUMI pigs. The AdeI

PCR-RFLP generates fragments of 319 bp (allele A), 286 bp and 33 bp (allele G). Genotyping

F2 DUMI pigs revealed frequencies of MBL1 alleles C and T of 0.67 and 0.33, respectively.

Frequencies of genotypes C/C, C/T, and T/T were 0.48, 0.38 and 0.14, respectively. For

MBL2, genotyping showed allele frequencies for allele G and A to be 0.41 and 0.59,

respectively. The distributions of gene frequencies were 0.21, 0.40 and 0.39 for G/G, G/A, and

A/A genotypes, respectively. The results of RH mapping assigned both porcine MBL genes to

chromosome 14 with retention frequencies of 16% for both genes. The most significantly

linked markers (two-point analysis) for porcine MBL1 and MBL2 were SW210 (89 cR; LOD

= 3.32) and SW1552 (35 cR; LOD =10.66), respectively. The closest marker on the linkage

map was S0007 with recombination frequencies and two-point LOD scores of 0.32, 3.34 and

0.23, 8.26, for porcine MBL1 and MBL2, respectively. MBL2 chromosomal location

established by RH mapping in our study is confirmed by gene assignment of porcine MBL2 to

position 3226.0 cR of SSC14 with nearest gene and markers DKK1 and SW1552, as reported

by Meyers et al. (2005) and Yasue et al. (2006). Comparative mapping data indicate that

porcine MBL1 might be located between SFPTA and SFPTD genes on SSC14. The

association analysis using the MBL1 and MBL2 and their interactions with time point revealed

no effect on haemolytic complement activity in classical (CH50) and alternative (AH50)

pathways of the SNPs that were analysed (Table 2). The C3c protein level, which reflects in

vivo complement activity, tended to be higher in MBL1 heterozygous genotypes (C/T) than in

the homozygous genotypes (C/C and T/T) (p=0.067). There was a highly significant effect of

time of measurement (P<0.001). Interactions of time and MBL genotypes in the repeated

measures models reflect the dependency of the profile of complement activity along the

experiment on the genotype. For complement activity, a slight MBL1 genotype dependent

deviation of the profiles of C3c concentration over time was found (p=0.056). This deviation

is most prominent late after Mycoplasma vaccination. No significant effect of interaction

between genotypes and time point on haemolytic complement activity assayed in the

alternative and classical pathway was found. Both parameters of haemolytic complement

activity, CH50 and AH50 do not directly involve MBL1 or MBL2 depending on sequences of

the complement cascade. In contrast, C3c serum concentration reflects complement activation

after vaccination that may act on the lectin pathway controlled by MBL.

Tab. 2: Least square means of haemolytic complement activity traits (AH50, CH50) and C3c

serum concentration for the effect of MBL1 and MBL2 genotype in DUMI resource

population

Genotype AH50 CH50 C3c

MBL1

C/C 56.29 ± 2.47 68.12 ± 3.31 0.190 ± 0.004

C/T 58.13 ± 2.60 65.25 ± 3.55 0.198 ± 0.005

T/T 54.27 ± 3.40 62.90 ± 4.31 0.192 ± 0.005

Effect (P):

MBL1 0.355 0.313 0.067

Time < 0.001 < 0.001 < 0.001

MBL1*Time 0.690 0.479 0.056

MBL2

G/G 58.24 ± 3.14 67.59 ± 4.36 0.201 ± 0.006

G/A 60.58 ± 2.60 68.89 ± 3.50 0.201 ± 0.005

A/A 56.69 ± 2.63 65.54 ± 3.61 0.194 ± 0.005

Effect (P):

MBL2 0.141 0.499 0.136

Time < 0.001 < 0.001 < 0.001

MBL2*Time 0.664 0.723 0.967

References

Agah, A., Montalto, M.C., Young, K., et al. (2001): Isolation, cloning and functional

characterization of porcine mannose-binding lectin, Immunology, 102, 338-343.

Hansen, S., Thiel, S., Willis, A., et al. (2000): Purification and characterization of two

mannan-binding lectins from mouse serum, J. Immunol., 164, 2610-2618.

Kawai, T., Suzuki, Y., Eda, S., et al. (1997): Cloning and characterization of a cDNA

encoding bovine mannan-binding protein, Gene, 186, 161-165.

Laursen, S.B. & Nielsen, O.L. (2000): Mannan-binding lectin (MBL) in chickens: molecular

and functional aspects, Dev. Comp. Immunol., 24, 85-101.

Lillie, B.N., Hammermueller, J.D., MacInnes, J.I., et al. (2006): Porcine mannan-binding

lectin A binds to Actinobacillus suis and Haemophilus parasuis, Dev. Comp. Immunol., In

Press, Corrected Proof

Marklund, L., Shi, X. & Tuggle, C.K. (2000): Rapid communication: Mapping of the

mannose-binding lectin 2 (MBL2) gene to pig chromosome 14, J. Anim. Sci., 78, 2992-2993.

Meyers, S.N., Rogatcheva, M.B., Larkin, D.M., et al. (2005): Piggy-BACing the human

genome - II. A high-resolution, physically anchored, comparative map of the porcine

autosomes, Genomics, 86, 739-752.

Mizuno, Y., Kozutsumi, Y., Kawasaki, T., et al. (1981): Isolation and characterization of a

mannan-binding protein from rat liver, J. Biol. Chem., 256, 4247-4252.

Wagner, S., Lynch, N.J., Walter, W., et al. (2003): Differential expression of the murine

mannose-binding lectins A and C in lymphoid and nonlymphoid organs and tissues, J.

Immunol., 170, 1462-1465.

Yasue, H., Kiuchi, S., Hiraiwa, H., et al. (2006): Assignment of 101 genes localized in

HSA10 to a swine RH (IMpRH) map to generate a dense human-swine comparative map,

Cytogenet Genome Res., 112, 121-125.