Genes, Environment, and Eating Disorders: What the ...

UNC Chapel HillCenter of Excellence for Eating Disorders

Cynthia Bulik, PhD, FAED

Karolinska InstitutetCentre for Eating Disorders Innovation

Genes, Environment, and Eating Disorders:What the Clinician Needs to Know

@cbulik

Disclosures

§ Shire Pharmaceuticals (grant recipient; advisory board)

§ Idorsia (consultant)§ Pearson (author)

Gratitude

Talk Map

§ Why study genetics of eating disorders?

§ Understanding current results

§ Guidelines for clinicians

§ EDGI

Topography of Feeding and Eating Disorders (DSM-5)

• Anorexia Nervosa – Low Weight– Intense fear of weight gain– Inability to recognize seriousness

of low weight

• Bulimia Nervosa – Binge eating– Regular compensatory behaviors– Normal, overweight, obese

• Binge-Eating Disorder– Binge eating– No regular compensatory behaviors– Distress– Often overweight/obese

• Avoidant and Restrictive Food Intake Disorder (ARFID)(M>F?)– Feeding disturbance, refusal, fear– Nutritional deficiencies– Weight loss or failure to gain

Slide courtesy of Jet Termorshuizen

6

Eating Disorders

American Psychiatric Association: DSM-5, 2013Keski-Rahkonen & Mustelin, 2016

Fichter et al., 2016Yilmaz, Hardaway, Bulik. 2015

Watson et al., 2019

Anorexia nervosa(AN)

Bulimia nervosa(BN)

Binge-eatingdisorder (BED)

<1-4%~5.4

<1-2%~1.5

1-4%~1.5

Eating disorders

(EDs)

Epidemiology- Lifetime prevalence

- Mortality (SMR)

Heritability (twin-based)

~60% ~60% ~45%

GWAS 8 independent loci x x

Diagnostic Fluctuation AN

BED

EDNOS

BN

AN

BED

BN

EDNOS

REMISSION REMISSION

EDNOS

BN

BED

AN

Schaumberg et alPMID: 29911514

Why Study the Genetics of Eating Disorders?

§ Bodies revert to a negative settling point

Anorexia Nervosa is Perplexing!

• Starvation is reinforcing

§ Fats are aversive § Activity is more reinforcing than food

§ Perplexing hypermetabolicperiod during renourishment

Paradoxical Response to Negative Energy Balance

Energy consumed

ExercisePhysical activityRestFidgetingPurging

Energy expended

Broad Applicability

Knowledge about eating disorders informs our understanding of many related phenotypes.

Obesity

Physical activity

Major depressive

disorderAnxiety

disorders

Metabolism

Nutrition

GWAS Basics

Variant #1 (C/T)Less common: C

Cases

Controls

Variant #2 (A/G)Less common: G

Cases

Controls

Variant #3 Variant #4...

CasesCurrent or past AN

ControlsNo history of eating disorders

ATTGGGCGAGTGTTCTAACCCGATTGGGTGAGTGTTCTGGCCCG

How to Read a Manhattan Plot

Chromosome

Significance level

5 x 10 -8

N=802 Abbott Abdellaoui Adams Adkins Adolfsson Agartz Agerbo Agrawal Aiello Air Akil Albani Alda Alliey-Rodriguez Almli Als Amstadter Andersen Anderson Andlauer Andreassen AnjorinAntilla Arbisi Arnold Arranz Aschauer Ashley-Koch Askland Atkinson Atzmon Austin Avdibegoviä Awasthi Babić Bacanu Backlund Badner Bækvad-Hansen Baker Banaschewski BarchasBarlassina Barr Barta Bass Batterson Bau Bauer Baune Beckham Beekman Belliveau Bellivier Bellodi Benarroch Bennett Bergen Berger Berlin Berrettini Bethell Bey Bienvenu Biernacka BierutBigdeli Bisson Black Blackwood Bloch Boden Boehnke Bøen Boks Bolger Boocock Boomsma Boraska Perica Børglum Bradley Brashear Breen Brentani Brown Bryant Buckner Budde BudmanBulik Bulik-Sullivan Bunney Burmeister Burton Bustamante Buttenschøn Bybjerg-Grauholm Byerley Byrne Cai Calabrese Caldas De Almeida Camarena Cappi Cardona Silgado Carracedo CasasBrugué Castelao Cath Cavallini Cerrato Cervantes Chambert Charney Chen Cheon Chou Chouinard Churchhouse Cichon Ciullo Clair Clarke Coffey Coleman Collier Consortium Conti CookCopeland Coppola Coric Corley Cormand Corvin Coryell Costello Courtet Couvy-Duchesne Cox Craddock Craig Crowley Cruceanu Cullen Culverhouse Curtis Cusi Czerski Dale Dalsgaard DalvieDaly Dannlowski Daskalakis Davies Davis De Geus De Jager Deary Deckert Degenhardt Del Favero Del-Favero Delahanty Delorme Dempfle Dennis Denys Depaulo Depienne Derks Derringer DiFlorio Dietrich Dion Direk Disner Djurovic Dmitrzak-Weglarz Dobbyn Domenici Domschke Doyle Dumont Duncan Dunn Dzubur Kulenovic Eapen Edenberg Edlund Ehli Ehrlich Eley ElvsåshagenElzerman Erbes Erdman Eriksson Escott-Price Esko Etain Evans Falkai Fan Farrer Favaro Feeny Fernandez Fernandez-Aranda Figee Finucane Fischer Flickinger Flint Florio Flory Forbes ForoudForstner Forty Frank Franz Fraser Freimer Frisén Frye Fullerton Fyer Gaddis Gade Gage Galea Garcia-Delgar Garnham Garrett Gaspar Gelaye Gelernter Geller Gershon Geuze GiambartolomeiGiegling Gilbert Gill Gillespie Goci Uka Goes Goldstein Gonidakis Gordon Gordon-Smith Grabe Grados Green Greenberg Greenwood Grevet Grice Grigoroiu-Serbanescu Grove Grünblatt GuanGuffanti Guijarro Guillaume Guo Guzman-Parra Haas Haavik Hack Hagstrøm Hakonarson Hall Halvorson Hamilton Hammamieh Hammerschlag Hamshere Hancock Hanna Hansen HartmannHartz Hatzikotoulas Hauser Hautzinger Hayward Heath Hebebrand Hedderly Heilbronner Heiman Hemmings Henders Herms Herpertz-Dahlmann Herrera Hervas Hewitt Heyman Hickie HindsHinney Hipolito Hoekstra Hoffmann Hofman Hohmann Holland Holmans Homuth Hong Hopfer Horn Horwood Hottenga Hougaard Hounie Huang Huckins Hultman Hutz Huyser IbanezIbanez-Gomez Illmann Ising Jakovljevic Jamain Jankovic Jansen Jenike Jett Jimenez-Murcia Johansson Johnson Jones Jong Jorgenson Jovanovic Jun Junglen Juréus Kahn Kandaswamy KaprioKarlsson Karstoft Kaufman Keenan Kelsoe Kendler Kennedy Kent Kessler Khan Khramstova Kidd Kiefer Kim Kimbrel King Kirov Kittel-Schneider Klengel Kloiber Klump Knott Knowles KnudsenKoen Koenen Kogevinas Koh Koller Konstantinidis Konte Kook Kral Kranzler Krauter Kremen Kretzschmar Krogh Kuntsi Kuperman Kupka Kurlan Kutalik Landén Lang Lange LangleyLanzagorta Lavebratt Lawford Lawrence Lawson Leber Lebois Leboyer Leckman Lee Leeuw Lesch Leventhal Levinson Levy Lewis Li Liang Liberzon Lichtenstein Linnstaedt LissowskaLitterman Liu Lochner Logue Loo Loohuis Lori Lowe Lucae Ludolph Lugonja Luykx Lynskey Lyon Lyons Maaser Macciardi Macintyre Madden Madruga-Garrido Maes Magnusson Maher MahonMaier Maihofer Malaty Malt Maples-Keller Maras Marchini Marmar Martin Martinsson Mathews Mattheisen Maurer Mavissakalian Mayoral Mayoral-Cleries Mbarek Mccarroll MccrackenMcelroy Mcfarlane Mcglinchey Mcgough Mcgrath Mcgregor Mcguffin Mcinnis Mcintosh Mckay Mclaughlin Mclean Mcleay Mcmahon Mcqueen Mcquillin Medeiros Medland Mehta Melle MengMetspalu Micali Middeldorp Miguel Mihailov Milaneschi Milani Milberg Miller Mir Mitchell Moessner Monteleone Montgomery Morer Morey Morken Morris Mors Mortensen Mostafavi MotaMühleisen Müller-Myhsok Müller-Vahl Mullins Münchau Munn-Chernoff Murphy Myers Naarden Nagy Nauck Neale Nelson Nestadt Ng Nguyen Nicolini Nievergelt Nigg NimgaonkarNordentoft Norman Nöthen Nurmi Nurnberger Nwulia Nyholt O'donnell O'donovan O'reilly Oedegaard Okun Olde Loohuis Onnink Ophoff Orcutt Ori Oruc Ösby Osiecki Oskarsson OwenPaciga Pálmason Panizzon Papeå¾Ovã¡ Paschou Pato Pauls Pavlides Pearson Pedersen Penninx Pergadia Perlis Perry Pers Peters Peterson Pettersson Peverill Peyrot Pfennig PiacentiniPietrzak Piras Pittenger Plessen Polderman Polimanti Pollak Polusny Porteous Posthuma Potash Preisig Pulver Purcell Quiroz Ramos Ramos-Quiroga Rasmussen Ratanatharathorn RauchRegeer Reichborn-Kjennerud Reif Reinbold Ressler Reus Rhee Ribases Ribasés Rice Richards Richter Riddle Ridinger Rietschel Riley Ripke Risbrough Rivas Rivera Rizzo Roberts RobertsonRoessner Roffman Rommelse Rosário Rosenberg Rothbaum Rothenberger Rouleau Roussos Roy-Byrne Ruderfer Ruggiero Ruhrmann Rujescu Rung Rutten Ryu Sã Nchez-Mora Saccone SaeedMirza Sampaio Samuels Sanchez Sánchez-Mora Sandor Schaefer Schalling Scharf Schatzberg Scheftner Scherag Scherbaum Schijven Schimmelmann Schlögelhofer Schoevers SchofieldSchork Schulze Scott Seedat Seligowski Seng Serretti Sheerin Shehktman Shen Shi Shilling Shin Shugart Sigurdsson Silove Singer Sinnamon Sinzig Sklar Slaney Slof-Op'TLandt SmalleySmeland Smit Smith Smoller Sobell Solovieff Song Sonuga-Barke Soyka Spalletta Spijker Sponheim Stahl Stallings Stamenkovic State Stefansson Steffens Stein Steinberg Stephan StewartStorch Stordal Stranger Strauss Streit Strohmaier Stuhrmann Sul Sullivan Sumner Szatkiewicz Szelinger Szymanska Tansey Tarnok Tarter Teicher Teumer Thapar Thompson ThomsonThorgeirsson Thornton Tian Tiemeier Tischfield Todorov Torres Trapido Treutlein Trubetskoy Trzaskowski Tsetsos Tübing Turecki Turiel Uddin Uher UhlmannUitterlindenUmbricht UrsanoVaalerVallada Van Den Heuvel Van Der Auwera Van Furth Van Grootheest Van Hemert Van Hooff Vanyukov Vedder Veenstra-Vanderweele Vermetten Verweij Vieta Viktorin Vincent Vinkers VisscherVoisey Völzke Vulink Wagner Walitza Wall Walters Wanderer Wang Watson Webb Weickert Weissman Wellmann Wendland Werge Willemsen Williams Williamson Willsey Wilmot WinslowWinternitzWittWodarzWolanczykWolfWolffWoodsWorbeWray Xi XuYanovskiYaoYehudaYilmazYoungYuZai Zandi Zayats Zeggini Zelaya Zerwas ZhangZhaoZill Zinner Zöllner

Eating Disorders Working Group of the Psychiatric Genomics Consortium (PGC-ED)

Leipzig, 2017Glasgow, 2018

Anaheim, 2019

Preben Bo Mortensen

Nick MartinMikael Landén

Martin Kennedy

Bulik, Sullivan, Thornton

Tracey Wade

Flinders Jenny Jordan

Composition of Freeze 2

74%

20%

<6%

33 datasets with 16,992 cases and 55,525 controls

from 17 countries

–log

10(P)

●●●●●●●

●●●

●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●

●●●●●●●●

●●●●●●

● ●●●●●●●● ●●● ●●● ●●● ●

● ●●● ●●●● ●●●●●●●●●● ●●●●● ●

● ●●●

●●●● ●●● ●●● ●● ●●● ●● ●● ● ●●● ●● ●●● ●●● ●●● ●●● ●● ● ●● ●● ●●● ●●● ● ●●● ● ●● ●● ● ●●● ●●● ● ●●● ● ●●●● ●● ●● ●●● ●● ● ●● ● ●●● ● ● ●●● ●● ● ● ●● ●● ● ●● ●● ●● ●●●● ●● ●●● ● ●● ● ●● ●●● ● ● ● ●● ●● ● ●●● ● ●●● ●● ●● ●● ●●● ●●●● ●● ●●● ●● ●●● ● ●●●● ●● ● ●●● ● ●●● ●●●● ● ● ●● ●● ●● ●● ●● ●●● ● ●● ●●●● ●● ●● ● ●●● ● ●● ●● ●● ● ● ●● ●● ● ●● ●●●●● ●● ●● ●● ● ●● ●●●● ●● ●●● ●●● ●● ●● ●●●●●● ●● ● ●●● ●●●●●● ●● ● ●● ● ●●●● ● ●●● ●●● ●● ●● ●●● ●● ● ●● ● ● ●● ● ●● ●● ●●●●● ●●● ●● ● ●●●●● ● ●●● ●●●● ● ●● ●● ●●● ● ●●● ● ●● ● ●● ●●●● ● ●●● ●●● ●● ● ●●●●● ● ●● ● ●●● ● ●● ● ●●●● ● ●●● ●● ●● ●●● ●●● ● ● ●●●●● ●●● ● ●● ●● ●● ●● ●● ●●● ●● ● ●●●● ● ●● ●● ●● ●●● ●●● ●● ●●●● ●● ● ● ● ●● ●●●●●●● ● ●●● ●● ●●●● ●● ●● ● ●●●●● ●● ●●● ●● ●●●● ● ● ●● ● ● ●●● ●● ●● ●● ●● ●● ● ●● ●● ● ●● ●● ●●● ●●●● ●●● ● ●● ●●● ●● ● ●●● ● ●● ●● ●● ● ● ● ●● ●● ●●● ● ●● ●●●●● ●● ● ●●●● ●● ●●● ●●● ● ●●● ●● ●●● ●●● ●● ●●● ●● ●● ●●●●●● ●● ●●● ●●●● ● ● ●● ● ●●● ●●●●● ●● ●●● ●● ●● ●● ●●● ● ● ●●● ●●●● ●●● ●● ●● ● ●●●●●● ●● ●● ●●●● ●●● ● ●● ●●● ●● ●● ●●● ● ●● ●● ●● ●● ●● ● ●● ●●●● ●●●● ●●●● ● ●●●● ● ● ● ● ●● ● ●● ●● ● ●● ●●● ●● ●●● ● ●● ● ●● ●● ●● ●●● ●● ● ●●● ●● ●● ●●●● ● ●●● ●● ●● ●●● ●●● ● ●● ●●● ● ● ●● ●●●● ●● ● ●●● ● ●●● ● ● ●● ●● ● ●●● ●● ●●● ● ● ● ● ●●●●● ●●● ●●● ●● ●●● ●● ● ● ●●●● ● ●● ●●●● ●●● ● ● ●●●●● ●●● ●●●● ●● ●● ●● ●●●● ●● ●●● ● ●●●● ●● ● ●●●● ● ● ●●● ● ●●●●● ● ●●● ● ●●● ● ●●● ●●●●●● ● ●●●● ●●● ● ●●● ● ●● ●● ●● ●● ● ●●●● ●● ●● ●●● ●● ● ●●● ●●●● ● ●●●●●● ●●● ● ● ● ● ●● ● ●●● ●● ●●●● ● ●●●●● ●●● ● ●●●● ●●● ● ●●● ●● ●●●●● ●● ●● ●● ●● ●● ● ●●● ● ● ●● ●●●●●● ●● ●● ● ●●●● ●●● ●●● ●● ● ●● ●●● ●●●● ●●● ●●● ●●●● ●●●● ●●● ●●● ●●● ● ●● ●●● ●● ●● ●●● ●● ●●● ●●●● ● ●●●●● ●● ●● ●●●●●● ●● ● ●●●●● ●●● ●● ● ●●● ● ●● ● ●● ● ●● ●● ●●● ●● ●●●● ●● ●●● ●● ●● ● ●●●●● ●●● ●●● ●●● ●● ●● ● ●●● ● ● ● ●● ●●●● ●● ●● ●●●● ● ●● ●● ●● ●●● ●●●●●●● ● ●● ●●● ●● ●● ●●●● ●●●●● ●● ●● ●● ●● ● ●●● ●●● ●●●● ● ●●● ● ● ●●●●●●●● ● ● ●●● ●● ●●● ●● ●●● ● ● ● ● ● ●● ●● ● ●●● ●●● ●● ●●● ● ●● ●● ●●●● ●● ●● ●● ●●●● ●● ● ●● ●●● ●●● ● ●●●● ● ●● ●●● ● ●●●● ●●● ●●● ●● ●● ● ●●● ●●●●● ●● ●● ●● ● ● ●●● ●●● ● ● ●●● ● ●● ●●●●● ●● ●●● ●●● ●●●●● ●●● ●●● ●●● ● ●●●●● ●●●● ● ●● ●● ●●●● ●●● ●●●●● ●● ●● ●● ●●●●●●● ●●● ● ●●●●● ●●●● ● ●●●●● ●● ●● ●● ●●● ●● ●●●● ●●● ●●● ●●●●● ●●●● ●● ●● ●● ● ●●● ● ●●●●● ●● ●●● ●● ● ● ●● ●● ●●●●●● ● ●●● ●●● ●●●● ● ●●●●● ●● ●●● ● ●●● ●●●●●● ●● ●● ●●●● ● ●● ● ● ● ●●●●●● ●●●● ● ●●● ●●●● ● ●● ● ● ●●●● ●● ●●●● ●● ● ●●●●●●● ● ● ● ●● ●●● ●● ●● ● ●●●● ●● ●● ●●● ●●● ●●●●● ●● ●● ●●● ●●●● ●● ●●● ● ●● ●●● ●● ● ●● ● ● ●●●● ● ●●●● ● ●● ● ●●●● ●● ●●● ●● ●●●●●● ●● ●● ● ●●● ● ●● ●●● ●● ● ●●● ●●●● ●● ●● ●●●● ●●●●● ●● ● ●●●● ● ●●●● ●●● ●●●● ●● ●●● ●●●● ●● ●●● ●● ●● ●●●● ●●●● ●●● ●●●●●● ●● ●●●●● ● ●●● ●●●●● ●●●● ●● ● ●●●●●●● ●● ●● ●●● ●● ●●●● ●●● ●● ●● ●●●● ● ●●● ●● ●● ●● ●●● ●●●●● ●●●●● ● ●●●● ● ●● ●● ●●●● ●● ●●● ●● ● ●● ● ●● ●●● ● ●● ●●● ●● ●●● ●●●● ●●● ● ●● ●● ●●● ●●● ● ● ●● ●●●●●● ●●● ●●● ●●●● ●●●● ● ●●●●●● ●●●●●●● ●● ●●● ● ●● ●●●●●●● ●●●● ●●●● ● ●●●● ●● ●● ●● ●● ●●● ●●●●● ●● ●●●●● ● ●● ● ●● ●●●●● ●●● ● ●●●● ● ●●●● ●● ●● ●● ● ● ●●●●● ●● ● ●●●● ● ●●●● ●●● ●●● ●●● ●●●●●● ● ●● ●●● ● ●●● ● ●●● ● ●●● ●● ●●●●●● ●● ● ●●● ● ●●●● ●●●●● ● ●● ●●●●●● ● ●● ●●● ●●●● ●●● ●● ●● ● ●●●●●● ● ● ●●●● ●●●●●●●● ● ● ●●● ●●● ●●●● ●●● ● ●● ●● ●●●●●● ●● ●● ●●● ● ●●●● ●●● ●●● ●●●●● ● ●●● ●●● ● ● ● ● ●●● ●● ●●●●●● ● ●● ● ●●● ●● ●●●● ●●● ● ●●●●● ●● ●●●● ●● ● ●● ●●● ● ●●●●● ●● ●●● ●● ●● ●● ●●●● ●●● ●●●●●● ●●● ● ●● ●●●●● ● ●●● ●● ●●●● ● ●●●●● ●● ●●● ●●●●● ●●●● ●●● ● ●●●●● ● ●● ●●● ●● ●● ● ●●● ● ● ●● ●●●●● ● ● ●●●● ●●●● ●● ●● ●●● ●● ●●● ●●●● ● ● ● ● ●●● ●●●●● ●●●● ●● ●●● ●●● ●● ●● ●● ●● ● ●● ● ●●● ●●●● ●● ●●●● ●●● ● ● ●●●● ● ●● ●●●● ● ●●●● ●●●● ●●●● ●● ● ●●●●●●● ●●● ● ● ●●● ●●●● ● ●● ●● ●● ●●●●●● ●● ●●●● ●● ●●● ●● ●●●● ●●●● ●● ●●●●●●●● ● ●●●● ●● ● ●● ● ● ●●●● ● ●● ●●●● ●● ● ● ●●●●● ●● ●●● ●●●● ●●● ● ●●●● ●●●●● ● ●●● ●● ●● ● ● ●●●●●● ●●● ●●●● ● ● ●●●● ●● ●● ● ●● ●●● ● ●●● ● ● ● ●●● ●●● ●●● ●●●●● ●●● ● ●●●● ●● ● ●● ●●● ●●●●● ●● ●●● ●● ● ●● ●● ●● ● ●●● ●●●●●●● ●● ● ●●●● ●●● ●●●● ●●●● ●●● ●●● ●●● ●●●●●●●● ●●● ●●● ●●● ●● ●● ●●●● ●●● ●● ●● ● ●●● ●●● ● ●●●● ●● ●●●● ●● ● ● ●●● ●●● ●● ● ●●●●●● ● ●●● ●●● ●●●● ●● ●●●●●● ●● ● ●●● ●●●●●●●●● ●●●● ●●●●●● ● ●●●●● ●●●●●●●● ● ●●●●● ● ●●●● ● ●●● ● ●●● ●● ●●● ●●● ●● ● ●●●●● ●● ●●● ●●●● ● ●● ●●● ●●●● ● ● ● ●● ●● ●●●●● ●● ● ● ●● ●●●●● ● ●●● ●● ● ●● ●●●●●●●● ● ●● ● ●●●●●●● ●●● ● ●●●●● ●● ●● ●● ●●● ●●● ●●●● ●● ●●● ●● ●● ●●●●●● ●● ●●● ●●●●● ●●●●● ●●●● ●●● ●● ● ●●●●● ●●● ●●● ●●● ● ●●●● ●●● ●●●● ● ●●●●●● ● ●● ●●●● ●● ●●●● ●●● ●●● ●●● ●●● ●● ●●●●●● ●● ●● ●● ●● ●● ●● ●● ●●● ●● ●●●●● ●●● ●●●●● ● ●●● ●●●●● ●● ●●● ●●● ●● ●● ●●●●● ● ●●●●● ● ●●●●● ●●● ●● ●● ● ●●● ●● ● ●●● ●●● ●●●● ●●● ●●● ●●●●●● ●●● ● ●● ●●●●● ● ●● ●●●● ●●● ● ●● ●● ●●●● ●● ●●●● ●●● ●●●●● ●●●●●● ●●●●●● ●● ●●●●●●●● ●●● ● ●● ●●● ●● ●●●● ●●●●● ●●●●●● ●● ●● ●●● ●●●● ●●●● ●● ●●●● ●●●● ●●● ●● ●● ●● ●● ●●●●●● ●●●● ●●●● ●● ●●●●●● ●●● ●●● ●●●● ●●●●●●●● ●●●● ●●● ●●●●● ● ●●●●●●● ● ● ●● ●●●● ●●●●●●●● ●●●●● ●●●●● ●●●● ●● ●● ●● ●●●● ●●●●● ● ●● ●● ● ●●●● ●●● ● ●●● ●● ●● ● ●● ●● ●● ●●●●● ●● ●●● ●●●● ● ●●●● ●●●● ●● ● ●● ●●● ●●●● ● ● ●●●●● ●● ●● ●●●●● ●● ●● ●●● ●●● ●●●● ●● ●●● ●●● ●● ● ● ●● ●● ●● ●●●● ● ●● ● ●●●● ●●●● ●●● ●●●● ● ●●●● ●●● ●●●● ●●●●● ● ● ● ●●●●● ●●●●●●● ●●●● ●● ●●●●●●● ● ●● ●● ●● ●● ● ●●●● ●●● ● ●●● ●●● ●●●● ● ●●●● ●● ●●● ●● ●● ●●●●●● ●●●●● ●●●● ●● ●● ●●●● ●● ●●● ●●● ●● ●●●●●● ●●●●●●●● ●●●● ●●●● ●● ●●●●● ●●●●● ●●● ● ●●●● ●●●●● ●●● ●●● ●●● ●●●● ●● ●●●● ● ●●●● ●●●●● ●●● ●●●●● ●● ●●●● ●●● ●● ●●●●● ●●● ●● ● ●●● ● ●●●●● ●● ●●● ● ● ●● ●●● ●●●●● ●● ● ● ●●●●●● ●● ●●●●● ●●● ●●●●● ●●● ●●●● ●●●● ●● ●●●● ●● ●●● ●● ●●● ●●●●● ● ● ● ● ●●●● ●●●● ●●●●● ●● ●●●●●● ●●● ●● ●●● ●● ● ●● ●●●●●● ●●● ● ●●● ●●●● ●●●● ●● ●●●●●●●● ● ●●●●● ●● ●●● ●●● ●●●●● ●●●●● ●● ●●●● ●●● ●●●●● ●● ●●●● ● ●●●●●● ●●●●●● ●●● ● ●●●● ● ●● ●● ●● ●●●●●●● ●● ●● ● ●● ●●● ●● ●● ●● ● ●● ●●●●●●●● ●●●●● ●●●● ● ●● ● ● ● ●●●● ● ● ●●●●● ●● ●●●●●●● ●● ● ● ●●●●● ● ●● ●● ●● ●●●●● ●●●● ●●● ●●● ●● ● ●●● ●●● ●●●●●● ● ●●●● ● ●●●●● ● ●● ● ●●●●● ●●● ●●●●●●● ●● ●●●● ●●●●● ●●● ● ●●● ●●●● ● ●●●●●● ●●● ●●●●●●● ● ●●● ●● ●●● ●●●●●●●● ●●●●●● ● ●●● ●●●● ●● ●●● ●● ● ● ●●● ●●●● ●●●● ●●●● ●●● ●●●● ● ● ●●●●● ●●●●●●●●● ●●● ●●● ●●● ●● ●●● ●●●●●● ●●●● ● ●●● ● ●● ●●●●●● ●● ●●●●● ● ●● ●●●●● ● ● ●●●● ●● ●●●● ●●● ● ●●● ●● ●●●● ● ●●●●●● ● ●●●● ●●●● ● ●●● ●● ●● ●●● ●●●●● ●●● ● ●●●● ●● ●●● ●● ● ●●●●●●● ●●● ●●●● ●● ●● ●●●●●●● ● ●● ●●●●●● ●●●●● ●●●●●● ●● ●●● ●● ●●● ●● ●●●● ●● ●●● ●●● ● ● ●●● ●●●●● ●● ●●●●● ●● ●● ●●● ●●●●● ●● ●●●● ● ●●● ●●● ●●●● ●●●● ● ●●●●●●● ●● ● ●●● ●● ●● ●●● ●● ● ●●●●●●●●●● ●●● ●●● ●●● ●●●●●● ● ●● ●●●●●● ● ●●● ●●●● ●● ●●●●●● ●●● ● ● ●●●● ●●●● ●●● ● ● ●●●●●● ● ● ●● ● ●●●●● ● ●●●●●●● ●●● ●● ●●●● ● ●● ●●●● ● ●●●●●●● ●●● ● ●●●●●● ●●● ●●● ●●●●● ●●● ●●● ●●●●● ●●● ●●● ●●●● ●●●● ●● ●●●●●●● ●●●●●●●● ●● ●● ● ●●●●● ●●●●● ● ●●●● ●● ●●● ●● ●●●●●●●● ●● ●●●●● ●●● ●●●●●●●●● ●● ●● ●● ● ●● ●● ●● ●●● ●●● ●●●● ●●●●●● ● ●● ●●● ●●●● ●● ● ● ●●●● ●●●●●●●● ●●●● ●●●●●●● ●● ● ●●●●●● ●●● ●● ●● ●●● ● ●●●●●● ● ● ●●●●● ●●● ●●● ●●● ●●●● ● ●● ●●● ● ●● ●●●● ● ●●●● ● ●●●●● ●●● ●●● ●●●●●● ●●●●● ● ●●●●●● ●●●● ● ●● ●●● ●●●● ● ●●●●●●●● ●●●● ● ●●●●● ●● ●●●●●● ●●●● ●● ●●● ●●●●● ●●●● ● ●●● ● ●●●● ●●●●● ● ●●●● ●●●●●●● ●●●● ●●●● ●● ●●● ● ● ●●●● ●●● ● ●●●●●● ●● ● ●●●●● ●●●●●●●● ●●●●● ●●● ●● ● ●●●●● ●●●● ● ● ●● ●● ● ●● ●●●● ●● ●●● ● ●● ● ●●●●● ● ●●●●●● ● ●●●●●●● ●●●● ●●●● ●●● ● ●●● ● ●●● ●● ●●● ●● ●●● ● ●● ●● ●● ●● ●● ●●●● ●●●● ● ●●● ●●●●● ●● ● ●● ● ●●● ●●● ●● ●●●● ●● ●● ●●● ● ●● ●●● ●● ●● ●●●● ●●●● ●●●● ●●● ●●● ●● ●●● ●●●● ●●●●● ●●● ●●● ● ●●●●●● ●●●● ●●●● ●● ●● ●●●● ●●●● ●● ●●●●● ●● ● ●●● ●●●●● ●●● ●● ●●●●● ●● ●●●●● ●●● ●●●● ●●●●● ●●●● ●●●●●● ● ● ● ●●●● ● ●●●● ●● ●● ●●● ●●● ●●● ●● ●●●●●● ●●●●●●●●● ●●●● ●●●●● ●● ●● ●● ●●● ●● ●●●● ●● ●●●●● ●●●●●● ●● ●●● ● ●●● ●●● ●●● ●●●● ●● ●●●●●● ●●●●●●● ●● ●●●●●● ●●● ●●●●●● ●●● ●●● ●● ●●● ●●●●● ● ●●● ●●●● ● ●● ●●●●●●●●●●●● ●●● ●●●● ●●● ●●● ●● ●● ●● ●●●●● ●● ●● ●● ●●●●●● ●●● ●● ●●● ●●● ●●● ●●● ●●●●● ●● ●●● ●●●● ● ●●● ● ●●● ●●● ●●●●● ●●●●●●●●● ●● ● ●●● ●●● ●●●●●●● ●●● ●●● ●● ●●● ● ●● ● ●●● ● ● ●●● ●●● ● ● ●● ●●●●●●●●●●●●●● ●● ●●●● ●●● ●●●●● ●● ● ●●● ●●● ●●●●● ●●●● ●●●●●●● ●● ●●●●● ● ●●● ●●● ●●● ●●● ● ●●● ●●●● ●●●●●● ●● ●●●● ● ● ● ●●●●● ●● ●● ●● ●● ●● ●●● ●●●●●● ● ●●● ●●● ●● ●●●● ●●●●●● ●●● ●●● ●● ●●●●● ●●● ●●●●● ●●●● ●● ●●●● ●● ●● ●●● ●●●● ●● ● ●● ●● ●●●●●● ●●● ● ●●●●●●●●● ●●●● ●● ●● ●● ●●●●●●● ●●●●● ●●●●●●●●●●●●● ●●● ●●●● ●●●● ●●● ● ●● ●●● ●● ●● ●●●●●●● ●● ●●●●● ●● ●●●●●●● ● ●●● ●●●● ● ●●●●●●● ● ●● ●●●●● ●●●● ●● ●●●●● ●●●●● ● ●●● ● ●●● ●●●●● ●●● ●● ●● ●● ●● ●● ●●●●●● ●●●●●● ●●● ●● ● ●●●●● ●● ● ●●●●● ●●● ●● ●●● ●● ●●● ●● ●●● ●● ●● ●●● ●●●●● ●●● ● ●● ●●●●●● ●● ●● ●●●●● ●● ●● ●● ●●● ●●●● ●●● ● ●●●●●● ●●● ●●●●●● ●●●●●●● ● ●●● ●●●● ●● ●● ●●●●●● ●● ●●●●●● ●● ●● ●●●●●●● ●●●●● ● ● ●● ● ●●● ●●●●● ●●●● ●●●●●●●● ● ●● ●●● ●●●●● ● ●●●●●●● ●●●●● ● ●●●● ● ●● ●●● ● ●●●●●● ●●●●●● ● ● ●●●●●● ● ●● ●●●●●●● ● ●●●● ●● ●● ●● ●●●●●●●●● ●●● ●●●●● ●●● ●●● ●●● ●● ●●● ●● ●● ● ●●●● ● ●●● ● ●●●●● ●● ●●●● ●●●● ● ●●●●●● ●● ●●●●●●● ●●● ●●● ● ●● ●●●●●● ●● ●●●●● ●●● ●● ●●●●●●● ●● ●●● ●● ●● ●●●● ● ●●● ●●●● ●●● ●●● ● ● ●● ● ● ● ●●● ● ●● ●● ●

●

●

●●

● ●●●●●●●● ●●●● ●●●● ●●●● ●● ●● ●● ● ●● ●●● ●●● ●● ● ●●● ● ●● ●● ●●● ●●● ●● ●●● ●●● ●●● ●● ●● ●●●●● ●●● ●●●● ●● ●●● ● ●● ●●● ●●●● ● ●● ●● ● ●● ● ●● ●● ●● ● ●● ●● ●●● ●●● ●● ●●● ●●● ●● ●●● ● ● ●● ●●● ●● ● ● ●●● ● ● ●●● ● ●● ● ●● ●● ●● ●● ● ●● ● ●● ●● ●● ●● ●● ● ●● ●●● ●● ● ●●● ● ●●● ● ●● ●●● ● ●● ●● ● ●● ●● ●●● ● ●●●● ● ●● ●● ●●● ●●●● ●● ●● ● ●● ● ●● ● ●● ● ●●● ●●●● ● ●● ● ●● ●●● ● ● ●● ●● ● ●●●● ●●●● ●●● ● ●●● ●● ●● ●● ●● ●● ●● ●●● ●● ●●● ● ●● ● ●●● ●● ● ●●● ●●● ● ● ●●●●● ●● ●●●● ● ●● ●●● ●●● ●●● ●●● ●● ●●● ● ●●● ● ●● ●●● ● ●●●●● ●●● ● ● ●●● ●● ●● ●● ●●● ●● ●● ●● ●● ●●● ●● ● ●● ● ●●●● ●● ●●● ● ●●●● ● ●● ●● ● ●●● ● ●● ●● ●●● ●● ●● ● ●● ●●●● ● ●● ●● ●●●● ●●●●● ●● ●● ●● ●● ●●● ●●●● ● ●●● ●●● ●●●●●● ●● ●●●● ●●●● ● ●● ●●●● ●●●● ● ●● ●● ●● ●●● ●●● ●●●● ● ● ● ●● ●●● ● ● ●●● ●● ●● ●●● ●● ●● ●● ● ●●● ● ●●●●● ●● ● ● ● ●● ●● ● ●● ●● ●●● ●●●● ● ●● ● ●●● ●●● ● ●● ● ●● ●● ●● ●● ●●● ●● ●●● ●● ● ●● ● ●● ●● ● ●● ● ●● ●●● ●●● ● ●● ●● ●● ● ●● ●●●●● ●●●● ● ●● ● ●●● ● ●●●●●● ● ●● ●● ● ●● ●● ●● ●●● ●●●● ● ●● ● ● ●● ●● ● ●●●● ●●● ● ●●●●● ●● ●●●● ●●● ●●●●● ● ●●● ●●●● ●●●● ●●● ● ●● ● ●●●●● ●● ●● ●● ●● ● ●● ●●● ●●●● ●●●●●● ● ● ●●● ● ● ●● ●●● ●● ●● ●● ● ●●● ●●●● ●● ● ● ●●●● ● ● ● ●●● ●● ●●● ● ●●●●● ●● ● ●● ● ●● ● ● ● ●●●● ●● ●● ●●●● ● ●● ●●●●● ●● ●●● ● ●●● ● ●●● ●●● ●● ●●● ●● ●● ● ●● ●●● ●● ●●●● ● ●●● ● ●●●●● ●●● ●●● ●● ● ● ● ●●● ● ●●● ●● ●● ●●● ●●●●●● ●●● ●● ●● ●●● ● ●●●●● ●● ● ● ●●● ●● ●● ●●● ●● ●● ● ●● ● ●●●● ●●●●● ●●● ●●●●● ●●●●● ●●●● ●●●● ●● ●●● ● ●● ●●●●● ●● ●● ●● ● ●●●● ● ●●●●●● ● ●● ●●●● ● ●●● ●●● ●●● ● ●● ●● ●●●● ●● ●●● ● ●●● ●●● ●●●● ● ●●● ● ●● ●● ●●●● ●● ●●● ●● ●● ●● ●● ●●●● ● ●● ●● ● ●● ●●●●● ●● ● ●●●● ●● ●●● ● ●● ● ● ●●● ●● ●●●●● ● ● ● ●●●● ● ●●●● ●●● ●● ● ●● ● ●●● ●● ●●● ● ●● ●● ●●●●●● ●● ●● ●●●●● ●●● ●●●● ● ●● ●●●●● ●● ●● ●● ●●●● ●● ● ●● ●●● ●●● ● ● ● ●●● ●● ●● ●● ●●●● ● ●●● ● ●●● ●●● ●● ●● ●●● ●●●● ●●● ●●●● ●● ● ● ●● ●●● ●● ●● ●● ●●● ●●●● ●●●●● ● ●●●● ●●●● ● ●● ●● ● ●● ●●● ●● ● ●● ●●●●● ●●●● ●● ●●● ● ●● ● ●● ●● ●●● ● ●● ●● ● ●●●● ●● ● ●● ● ● ●●● ●●●●●● ●●● ● ●● ●● ●●●●● ●●●●●●● ● ●●●● ● ● ● ● ● ● ●●●● ●● ● ●●● ●●●● ●● ● ●● ●●●● ● ● ● ●● ●● ● ● ● ●●●● ●● ●● ●● ●●● ●● ●●● ●●● ●● ●●●●●● ●● ●●● ●● ● ● ● ● ●●● ●●● ●●● ● ●● ●●●●● ●● ●●● ●● ● ● ●●●●●● ●● ●●●●● ●●● ●●●● ●● ●● ● ●●● ●●● ●● ● ●● ●● ●●● ● ●● ●●● ●● ●● ● ●● ●●● ●●● ●●● ● ● ●●●●● ● ●●●●●● ●● ●●● ●● ●● ●● ●●● ● ●●● ●● ●● ● ●●● ●● ●● ●●● ●● ●●● ● ●●● ● ●● ●●●●● ●●●● ●● ● ● ●●● ● ●●●● ● ●●● ● ● ●●●●●● ●●●● ●●● ●●●● ● ●●●● ●●● ●● ●●● ●●●● ● ●●● ● ● ●●● ●●● ● ●●●● ●●● ●● ● ●● ●●● ●●● ●●● ●● ●● ●● ●●● ●●●●● ● ●●●● ●● ● ●●●● ●●●● ● ●● ●●● ●● ● ●● ●● ●● ●●●●●● ●● ●●●● ●●● ● ●● ● ●● ● ●● ●●●● ●● ●● ● ●● ●● ● ●●●●● ●●● ●● ●● ● ●●●●●● ●●●● ●●● ●● ●●●● ● ●● ●●●● ● ●●● ●● ●●● ●●● ●● ●● ● ●● ● ●●●●● ●●●●●● ● ●● ●● ●● ●●● ●● ● ●● ●●● ●● ●● ● ●●● ●●● ● ●●●● ● ●●●●●● ●●● ● ●● ●● ●●●● ●● ●●● ●●●●● ●● ● ●●●●●●● ●● ●●●● ● ●●●●●●● ● ●● ●● ●●● ●● ●●● ●●● ● ● ● ●●●●● ●●●● ●● ●●● ● ●● ●●●● ● ●● ●●● ●● ●● ● ●●●● ●● ● ●●●●●●●●●● ●●●● ● ● ● ●●●●● ● ●● ●●● ● ● ●●●● ● ●●●●● ●● ●●● ●● ●●●● ●● ●●●● ●●●●● ●● ●●● ● ●●●● ● ●●●●● ●●● ● ●● ●● ● ●●●● ●●● ● ●●● ● ●● ●●●●● ● ● ● ● ●●●● ● ●● ●●● ●● ●●● ●●●● ●●●● ●●●●●●● ●● ●● ●●●● ●●● ● ●●● ● ● ●●●●●● ●● ●●● ●●●●● ●● ● ●● ●●●●● ●● ●●●●● ●● ● ●●● ●● ●● ●● ● ●●●●● ● ●●● ●●● ● ●●●●● ● ●●● ●● ●●●● ●● ●●● ● ●●● ● ●● ●● ●●●●●●●●● ●● ● ●●●●●● ● ●●●● ●● ● ●● ●●● ● ●●●●●●●● ●●●● ●●●●●● ●● ●● ● ●● ●● ●●● ●● ●●● ●●● ●●●● ●●●● ●● ●● ●● ●●●●●●●● ●● ●● ●●● ●●●● ● ●● ● ●●● ●●● ● ●● ●●●● ●●● ● ● ●●●●● ● ● ●●● ●●●●● ●●● ● ●●●● ●●●●●● ●● ●●● ●●● ●●●● ● ● ●● ●●●●● ●●●●●●●● ●●● ●●●●●●●● ●●● ●●● ● ●●●● ● ●● ●●●● ● ●●● ●●●●● ●● ●●● ●● ● ●● ●●●●● ● ●●● ● ● ●● ●● ●● ●●●●●● ● ●● ●●●● ●● ●●●●●●● ●● ● ●●●●●● ●●● ●● ●●●● ●●● ●●● ●●● ●● ● ●●●● ●●● ●● ● ●●●●●● ● ●●●●● ●●●●● ●●● ●●●●● ●●●● ● ●● ●●●●● ●●●● ●●●●● ●●● ●●●● ●●● ● ●● ●●● ●● ●●● ● ●● ●●●● ●● ●● ●●●●● ● ●●●● ● ● ●● ●● ●● ●● ●●●●● ●● ● ●●● ●●●● ●●●● ●●●● ● ●●●● ●● ●● ●● ● ●● ● ●●●● ●● ●●●● ●●●● ●● ●●● ●● ● ●● ●● ●● ●●● ●●● ●●● ● ●●●●● ●●●● ●●● ●● ●●● ●● ●●●● ● ●●●●●●●● ●●● ●●● ●●●●●●●●● ●●● ●●● ●● ● ●●● ●●● ●●●●● ● ●●●● ●● ●● ●●● ●●● ●●● ● ●●●● ● ● ●●● ● ●● ●●●● ●● ● ●●● ●●●● ●● ●● ●●● ●●●●●● ● ●●●● ●●● ●● ●● ●● ●● ●●● ●●● ●●●●●● ● ●●●● ●●● ●●●● ●● ●●● ● ●●●● ● ●●● ●●● ●●● ●● ●● ●●●●●●●●●●● ●●●● ●● ●●● ●●● ●●● ● ●●●●● ●● ●● ●●●●●● ●● ●● ●●●●●●●● ●●●●●● ●●● ●●●●●● ● ●●● ●● ●● ●●●●●● ●● ●●●● ●●● ●●●●● ● ● ●●●●●●●●● ● ●●● ●● ● ● ● ●●●●●●● ●●● ●● ● ● ●● ●● ●●●● ●●● ●● ●●●● ● ●●●●● ●●●●● ● ●●● ●●● ● ●●● ●●● ●●●●●● ●●●● ●●●● ●●● ●● ●● ● ●●●●● ●●●● ●●●●●● ●● ●● ● ●●●● ●●●● ●●●●● ●● ●●● ●●● ● ●●●●● ●●●● ●●●● ● ●●●● ● ●● ●●●●●●●●● ●● ●●● ●● ● ●●●●● ● ●● ●●●●● ●●●● ●●● ● ●●● ●● ●● ●●●● ●● ●●● ●●●●●● ●●● ●●●● ●● ●●●●●●●● ●●●●●● ●●●● ●●● ●●● ●●●●● ●●● ●●●●● ● ●●●●● ●●●●●●● ●●●● ●●●● ●●●● ●● ● ●●●● ●● ●● ●●● ●● ●●●● ● ●●● ●● ●● ●● ●●● ● ●●● ● ●● ● ●● ●●● ●● ●● ● ●●● ●●●● ●● ●●● ●● ●●●● ● ● ●●●● ●● ●●●●●●●●● ●●●●● ● ●●●● ●●●●●● ●● ●●●● ● ●● ● ●●● ●●●●●●● ●●● ●●● ● ●●●●● ●●●● ●●●● ●●● ●●● ● ●●●●●●● ●●●●● ● ● ●● ●●● ●● ●●● ●● ●●●●● ●● ●●● ●●● ●● ●●● ●●●● ●●● ●●●● ●●●● ●●● ●●●● ●●● ●●●● ●● ●●●● ●●●●● ●● ●●●●● ●●● ●● ● ●●● ● ●●● ●●● ●● ●●● ●●●● ●●● ●●● ●●● ●●●●●●●● ●●●●● ● ●● ●● ●●● ●●●● ● ●●● ●●● ●● ● ●●●●● ●●● ●●● ●●●●● ●●●● ●● ●●●● ●●● ●●●●● ●● ●●●● ●● ●●●●● ● ●● ●● ●●● ●● ●●● ●● ●● ●● ●●●●● ● ●●●● ●●●● ●●● ●●●●● ● ●●●● ● ●●●●●●● ●● ● ●●●●●● ●●● ● ●● ● ●● ●● ●●● ● ●●●●● ● ●●●● ●● ● ●●●● ●●●●● ●●● ●●● ●● ●● ●●● ●●● ● ●●●●● ●●● ●●●● ●● ●●●●●●● ●●● ●● ●● ●●● ●●● ●●●●● ●● ●●●●● ●● ●●●● ●● ●●●● ● ●●●●●● ●●●● ●● ●● ●●●●● ●●●● ● ●●●● ●● ●●●●●● ●●●● ● ●● ●●● ● ●●● ● ●● ●● ●● ● ●●●●●●● ●●●●● ●●●●●● ●●●●● ● ●●●● ●●●●● ●● ●● ●●●● ●●●●●●●●● ● ● ●●● ●●● ●●● ● ●● ●●● ● ●● ●● ●●●● ●●● ●●●●●● ●● ●● ●●● ●●● ● ●●●●● ● ●●● ●●●● ●●● ●●● ●●●●●● ●●●●●●● ● ●●● ●●●●●● ● ●●●●●● ●●●● ●● ●● ●● ●● ●●●● ● ●● ●● ●●●● ●● ● ●● ●● ●●●●●● ●● ●●●●● ●● ● ●● ●●●● ●● ● ●● ●●●● ●●●● ● ●●●● ●● ● ●●● ● ●● ●●● ● ●●●●●● ●● ●●●●● ●●●●● ● ●●●● ●●●● ● ●●●●●● ●● ● ●● ●●●● ● ●●●●●●● ● ●●●● ●●● ●●●● ●● ●●●●● ●●● ●●● ●●● ● ●●● ● ●●●● ●● ●● ●●●● ●●● ●●● ●●●●● ●●●●●● ●● ●● ● ●● ●●● ●●● ●● ●●●●● ●●●●●●●●● ●● ● ●● ●● ● ●●●●● ● ● ●● ●●●●● ● ●●●● ●●● ●●● ●● ●●●●●●● ●●● ●● ●●●●● ● ●●● ● ●● ●●●● ●●●●●●● ● ●●●● ●●●●●●● ●●● ●●●● ● ●●●●●●●● ●●●●●●●● ●●●●● ●●●● ● ●●●● ●● ● ●● ●●● ●● ●●● ●●● ●● ●●● ● ●●●●● ●● ● ● ●●●● ●● ● ●●●● ● ● ●●● ●● ●●● ●●●●●● ●● ●● ●●●● ●●●●● ● ●●●●●●●● ● ●● ●● ●● ●● ●●●●● ● ●● ●●● ● ● ●●●●● ●● ●●●●● ●●● ●●●● ●● ● ●●●●●●● ●● ●●● ●●● ●●●●● ●●●●● ●●●● ●●● ●●● ● ●●● ●●●●● ●● ●●●● ●●●●●●●●●●●● ●●● ●●● ● ●●● ●●●●●● ●● ●●● ●● ● ● ●●●●●●●●● ●● ●●●●●●●● ●●●● ● ●●● ●● ●●● ● ●● ● ●●● ●●●● ● ●● ●● ● ●●● ●●● ●●● ●● ●●● ●●●● ●● ●●●●● ●● ● ●●●●●● ● ● ●●●● ●●●●●●●●●●● ●● ●●●● ●●● ●●●● ●● ●● ●● ●●●● ●●●● ● ● ●●● ●● ●●●● ●●●●● ● ●● ●●● ● ●●●●● ● ●● ●● ●● ●●● ●●●●● ●●● ●●● ●●●●● ●● ●●●●● ● ● ●●●●●● ●●●●●●●●●● ●● ●●● ●●●●●● ●●●●●● ●●●● ●●●● ●●●●● ●● ●● ● ●●●● ● ●●●● ●●● ●●●●●●● ● ●●● ●●● ●●● ●● ●● ●●● ●●●●●● ●●●●●●●● ●●● ● ●● ●●● ● ●●●●● ●●●●● ● ●●● ●● ●●● ●● ●●● ● ●●●●●●●●●● ●●●●●●● ●●●●● ●● ●●●● ●● ● ●●●●● ●●● ●●● ●●● ●●●●●●● ●●● ● ●●● ● ●●●●● ●● ●●●●● ●●●●●● ●● ●● ●●● ●●●● ● ●●●●● ●● ● ●●●● ●● ●● ●● ●●●● ●●●● ● ●● ●● ●●●●●●●●●● ●●●● ●● ●●●● ● ●●●●● ● ●●● ●●●● ●●●● ● ●● ●● ● ● ●●●● ●●●● ● ●●●● ●●● ●● ●●●●● ●●●● ●●● ●●●●● ●●●● ●● ● ●● ●● ● ●●●●● ● ● ●●● ●●● ●●● ●●● ●●● ●●●●● ● ●●● ● ●●●●●● ●●● ●● ● ●● ●●●●●● ●●● ● ●●● ● ●● ●● ●●● ●●●● ●●● ●●● ● ●●●● ●●● ● ●●●●●●● ● ●●●●●●● ●●●●● ●● ●● ●●●● ●● ●●●●● ●● ●● ●● ●●●●●● ●●●●●● ●●●● ●● ●●● ●● ● ●●●●●● ● ●●●● ●●●● ● ●●●●●●● ●●● ● ●● ●●●●● ●●● ●● ● ●●●●●●● ●● ●● ●● ●●●●●● ●● ●● ●● ●●●● ● ● ● ●●● ● ●●●● ●●●● ●●● ●●●●● ●●●●●●● ●●●●●●● ●●●●● ●●●● ● ●● ●●● ●●● ●●● ●● ●● ● ●● ●●● ●● ●●● ●●● ●● ● ● ●●● ●●● ● ●● ●●● ●●●●●●●● ● ● ● ●●●● ●●●● ●●●●●● ●● ●●●● ●●●● ● ●●●●●● ●●●●●●●● ●● ●●● ●● ● ●●● ●●● ● ●●● ●●●●● ● ●●●●●●● ●● ●●●● ●●● ●● ●●●●●● ●● ●●●● ● ●●● ●● ● ●● ●●●●●●● ●● ●● ●● ●● ● ●●● ●● ●●●● ●●●●●●●●● ●●● ●●● ● ●● ●●●● ● ●●●● ●● ●● ●● ●● ● ●● ●● ●●●● ● ●● ●●●●●●●●●● ● ●●●●●●●●● ●● ● ● ●● ●●●●●● ●●●● ●●●● ● ●●● ●● ● ●●●● ●●●●● ●●●● ●● ● ● ● ●● ●●●●●● ● ● ●● ●●●● ●●●●●●● ●●●●● ● ● ●●● ●●● ●● ●●●●● ●●●●●●● ●●●●●●●● ● ●●●●● ●● ●●● ● ●●●●● ●●●●●●●●●● ●●●● ●●●●●●● ●●●● ●●●●●●● ●●● ●●●●●●●● ●●● ● ●● ●●● ●●●●● ● ●●● ●● ● ● ●● ●●● ●●●●●● ●● ● ●●●● ● ●●● ●●●●● ●●● ●●●●●● ●●●● ●● ●●●●● ●●● ●●●● ●●●●● ●● ●●● ●● ●●●●●● ●●● ●●●● ●●●●● ●● ●●● ●●● ●●●● ●● ●●●● ●●● ●● ●●● ●● ●●● ●● ●●●●●●● ●●● ●●●●●● ●●●●● ●●● ●●●● ●● ●●●● ●●●● ●●●● ●●●● ●●● ● ●●● ● ●● ●●●

●●●●●●●

●●●

●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●

●●●●●●●●

●●●●●●

● ●●●●●●●● ●●● ●●● ●●● ●

● ●●● ●●●● ●●●●●●●●●● ●●●●●● ●

● ●●●●

●● ●●●● ●●● ●●●● ●●● ●● ●● ●● ●● ●●● ●● ●●● ● ●● ● ●●●● ●● ●● ●● ●● ●● ●● ●● ● ●●● ● ●● ●●● ●● ●● ●●● ●● ● ●●● ● ●● ●●● ● ●●● ● ●●● ● ● ●●● ●● ● ●●●● ●● ●● ● ●●● ● ●● ● ●● ●● ● ●● ●● ●●● ●●● ●● ●● ●●● ● ●●● ●●●● ●●● ●● ●●● ●● ● ●● ● ●● ● ● ● ●●●● ● ●● ● ●●●● ●● ●●●● ● ●●● ●● ●●● ●●● ●● ●● ●●● ● ●● ●●● ●●● ●●● ●● ●● ●● ●● ●● ●● ●●● ●●● ●●● ● ●● ●● ●● ●● ● ● ●● ●● ●● ● ●●● ●● ● ● ●● ●● ●● ●● ●●● ●● ●● ●●●● ●●● ●● ●● ●●●● ● ●● ●●● ●● ●● ●● ● ●●● ●● ● ●● ● ● ●● ●● ●●● ●● ●● ●● ● ●● ● ●●● ●●● ● ●●● ● ●● ● ● ●● ● ●● ● ● ●● ●● ●●● ●●● ● ● ●●● ●●● ●● ●● ●● ●●● ●● ● ●● ● ●●● ● ●●● ●● ●● ●●● ●● ● ● ●● ● ●● ●● ●●● ●●● ●● ●● ●●● ●● ● ●●● ● ●●● ● ● ● ●● ●● ●● ● ●● ● ●● ●● ●●● ● ● ● ●● ●● ● ● ●●● ●● ●● ● ●● ●● ● ●●●●●● ● ●● ●● ●● ●●● ●●● ● ●●●● ●●● ●●● ●● ● ●● ● ●●●● ●● ● ● ●● ●● ●●●● ●● ● ● ● ● ●●● ●●●● ●● ●● ●● ●●● ● ●●●● ●●● ●●● ● ●●● ● ●● ●● ● ●● ●● ●● ●●● ● ●●●●● ● ●● ●● ●●● ●● ●●● ● ● ● ●●●● ●● ●● ●● ● ●●●●● ● ●●● ●●● ●●●● ●● ●●● ●● ●●● ●●● ●●● ●● ●● ●● ● ● ●● ●●●● ● ●●●● ●● ● ●● ● ●●● ● ●●● ●● ● ● ● ●● ● ●● ● ● ●●● ●● ●● ●●● ●● ● ●● ●● ● ●● ●● ●● ●●●● ● ●●● ●●●● ●● ● ● ●●● ●●● ●●● ●● ● ●●● ●●● ●● ●● ●● ●● ●● ●●● ●● ●●●● ●● ●● ●●● ● ●● ●● ● ●●● ●● ●●●● ●

●●●●●●●

●●●

●●●●●●●●

●●●

●

●●●

●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●●

●●●●●

●●●

●●

●●●

●

●●

●●●●●●● ●●● ●●●

●●● ●

● ●●● ●●●● ●●●●●●

●●●● ●●●●●● ●

● ●●●●

●● ●●●

● ●●

● ●●●● ●●● ●● ●● ●● ●● ●●● ●● ●●● ● ●● ● ●●●● ●● ●● ●● ●● ●● ●● ●● ● ●●● ● ●● ●●● ●● ●● ●●● ●● ● ●●● ● ●● ●●● ● ●●● ● ●●● ● ● ●●● ●● ● ●●●●

●● ●● ● ●●● ● ●● ● ●● ●● ● ●● ●● ●●● ●●● ●● ●● ●●● ● ●●● ●●●● ●●● ●● ●●● ●● ● ●● ● ●● ● ● ● ●●●● ● ●● ● ●●●● ●● ●●●● ● ●●● ●● ●●● ●●● ●● ●● ●●● ● ●● ●●● ●●● ●●● ●● ●● ●● ●● ●● ●● ●●● ●●● ●●● ● ●● ●● ●● ●● ● ● ●● ●●● ●● ● ●●● ●● ● ● ●● ●● ●● ●● ●●● ●● ●● ●●●● ●●● ●● ●● ●●●● ● ●● ●●● ●● ●● ●● ● ●●● ●● ● ●● ● ● ●● ●● ●●● ●● ●● ●● ● ●● ● ●●● ●●● ● ●●● ● ●● ● ● ●● ● ●● ● ● ●● ●● ●●● ●●● ● ● ●●● ●●● ●● ●● ●● ●●● ●● ● ●● ● ●●● ● ●●● ●● ●● ●●● ●● ● ● ●● ● ●● ●● ●●● ●●● ●● ●● ●●● ●● ● ●●● ● ●●● ● ● ● ●● ●● ●● ● ●● ● ●● ●● ●●● ● ● ● ●● ●● ● ● ●●● ●● ●● ● ●● ●● ● ●●●●●● ● ●● ●● ●● ●●● ●●● ● ●●●● ●●● ●●● ●● ● ●● ● ●●●● ●● ● ● ●● ●● ●●●● ●● ● ● ● ● ●●● ●●●● ●● ●● ●● ●●● ● ●●●● ●●● ●●● ● ●●● ● ●● ●● ● ●● ●● ●● ●●● ● ●●●●● ● ●● ●● ●●● ●● ●●● ● ● ● ●●●● ●● ●● ●● ● ●●●●● ● ●●● ●●● ●●●● ●● ●●● ●● ●●● ●●● ●●● ●● ●● ●● ● ● ●● ●●●● ● ●●●● ●● ● ●● ● ●●● ● ●●● ●● ● ● ● ●● ● ●● ● ● ●●● ●● ●● ●●● ●● ● ●● ●● ● ●● ●● ●● ●●●● ● ●●● ●●●● ●● ● ● ●●● ●●● ●●● ●● ● ●●● ●●● ●● ●● ●● ●● ●● ●●● ●● ●●●● ●● ●● ●●● ● ●● ●● ● ●●● ●● ●●●● ●

Chromosome

3

4

5

6

7

8

9

10

11

12

13

14

15

16

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

●●●

temozolomideresponse

Sjögren’sSyndrome

IBD, ulcerative colitis, Crohn’s, macrophage functions, blood protein levels, obesity-related traits, HDL, Parkinson’s

Age at menarche, obesity, body fatEsophageal adenocarcinoma, Barrett's esophagus, intellectual disabilityBMI

Autoimmune

Metabolic

Neuropsychiatric

Sex hormones

GWAS Results

Hunna Watson, PhDNature GeneticsPMID: 31308545

SNP-h2 11–17% (se = 1%)

There’s Valuable Information Below the Red Line!

Genetic Correlations

§ Estimates genetic correlations from published summary statistics

§ Do not need to measure all of the traits on the same people

§ Between diseases, “genetic analogue of comorbidity”

§ Not phenotypic correlations!

PMID: 25642630

Brendan Bulik-Sullivan

Obsessive�compulsive disorder (PGC)Major depressive disorder (PGC)

Schizophrenia (PGC)Anxiety (UKB)

Depressive symptomsNeuroticism (UKB)Years of educationCollege completion

Attainment of a college or a university degreePhysical activity (objectively-measured)

HOMA-IR: Insulin resistance (age- & sex-adjusted)Fasting insulin (age- & sex-adjusted)

Leptin (not BMI-adjusted)Fasting insulin (BMI-adjusted)

Type 2 diabetesHDL cholesterol

Body fat percentage (UKB)Fat mass (UKB)

Body mass index (UKB)Waist circumference

Overweight (BMI 25-30)Obesity class 1 (BMI 30-35)

Waist-to-hip ratioHip circumference

Extreme body mass indexObesity class 2 (BMI 35-40)

Waist circumference (BMI-adjusted)Fat�free mass

-0.25 0.25 0.500.00Genetic correlation rg

CategoryPsychiatric disorder/trait

Personality trait

Educational attainment

Physical activity

Metabolic trait

Anthropometric trait

Negative (-)

Positive (+)

GeneticCorrelationswithAnorexia
















Personality trait


Physical activity

Metabolic trait


Negative (-) Positive (+)

Genetic Correlations Between Anorexia and Psychiatric, Educational, and Physical Activity
















Personality trait


Physical activity

Metabolic trait



Genetic Correlations Between Anorexia and Metabolic Factors
















Personality trait


Physical activity

Metabolic trait



Genetic Correlations Between Anorexia and Anthropometric / Body Measurement Factors
















Personality trait


Physical activity

Metabolic trait


Negative (-)

Positive (+)

Reconceptualizing Anorexia Nervosa as Metabo-Psychiatric

§ Perplexing ability to reach and maintain low BMI

§ Frequent return to a “negative settling point”

§ Negative genetic correlations with BMI and other “unfavorable” metabolic parameters

§ Positive genetic correlations with HDL

§ Paradoxical reaction to negative energy balance

Implications and Next Steps

§ Greater attention to metabolic factors may improve outcome

§ Explanation for why adequate refeeding is essential to preventing relapse?

§ Need to understand metabolic mechanisms!

Does the DSM Feeding & Eating Disorders Section Actually Carve Nature at Its Joints?

Micali Loos Herle Abdulkadir Hübel Breen

What is a polygenic risk score (PRS); genetic risk score (GRS); polygenic score (PGS)?

Christopher Hübel

Single score per person, weighted sum of risk alleles

Utility of PRS…

§ Can we improve risk assessment by combining PRS with other measures of risk?

§ Can we use PRS to screen for mental health disorders in the population?

§ Can PRS help in making a diagnosis or clinical decisions?

§ Are psychiatric PRS associated with treatment response?

§ Are PRS associated with adverse physical health outcomes in mental illness? (e.g., weight gain with antipsychotic medication)

READ THIS PAPER: PMID: 33052393

N 17,050

Age [years] 55.6 ± 7.7

Height [cm] 164.7 ± 7.1

Weight [kg] 71.0 ± 14.3

BMI [kg/m2] 26.2 ± 4.9

Waist circumference [cm]

83.1 ± 12.5

Hip circumference [cm] 102.1 ± 9.8

Waist-to-hip ratio 0.8 ± 0.1

Body fat [%] 34.2 ± 7.5

Fat mass [kg] 24.9 ± 9.7

Fat-free mass [kg] 46.1 ± 7.3

SES [Townsend] -1.8 ± 2.8

We don’t have GWAS of bulimia and BED yet, so…

Eating Disorder Cases

Mental health questionnaire (n = 156,465) & ICD-10 diagnoses

Anorexia nervosa Bulimia nervosa Binge-eating disorder

768 423 561

Controls 15,500

https://doi.org/10.1002/eat.23481

Genomic Topography of Eating Disorders

Polygenic Scores Associated with Eating Disorders in the UKBiobank –All Traits

Polygenic Scores Associated with Eating Disorders in the UKBiobank – Psychiatric Traits

0.75 1.00 1.25 1.50

Odds Ratio (OR) per standard deviation (SD) increase of polygenic scores

Polygenic Scores Associated with Eating Disorders in the UKBiobank – Metabolic Traits

0.75 1.00 1.25 1.50

Odds Ratio (OR) per standard deviation (SD) increase of polygenic scores

Polygenic Scores Associated with Eating Disorders in the UKBiobank – Anthropometric Traits

To what end?

§ Identify subtypes of illness based on PRS

§ Predict likely course of illness and tailor treatment accordingly

§ Move toward personalized medicine approach to treatment instead of “one-size-fits-all”

§ Drug repositioning or development based on genetic results

§ Eliminate mortality

Translating Information for Clinicians, Families, and Patients

Science communication

§ Anti-intellectualism and anti-science are rampant in some parts of the world

§ Scientists’ responsibility to interpret and contextualize

§ Clinicians’ responsibility to have general understanding and assist patients & families

§ Important role for genetic counseling!

Messaging Do’s and Don’t’s

§ Genetics is just one piece of the risk puzzle

§ All or nothing thinking (genes OR environment; nature OR nurture)

§ Challenges understanding probabilities

§ Genetic destiny

§ Genetic guilt

§ Eating disorders are genetic not psychological

§ Genetic simplification (I have THE gene[s] for eating disorders)

§ Genetic testing…NO!

A Relatable Model

Genetic Risk Genetic Protective Environmental ProtectiveEnvironmental Risk

Role of Genetic Counseling

Genetic counseling for mental illnesses has been shown to help:• Alleviate stigma and shame• Correct misconceptions about the condition• Prepare family members to intervene• Promote help-seeking behaviors• Only one study on eating disorders…• 107 individuals with personal history of an ED

Julianne Michael, UNC-GPMID: 32666600

Without Guidance, Individuals Overestimate Risk to Children

100% of respondents overestimated risk to daughters!

Take Home Messages

§ It is our responsibility not just to do the science, but to package the information for patients and families

§ Clinicians should make an effort to integrate genetics into their own case conceptualizations and develop comfort with answering their patients’ questions

§ Know your limits! If you live in a country with genetic counseling, make use of your colleagues. If not, find resources for your patients.

§ Don’t perpetuate misinformation

Anorexia Nervosa

Bulimia Nervosa

Binge-Eating Disorder

ARFID (pending)

What’s New About EDGI?§ Global goal 100K

§ NIMH (US, New Zealand, Australia, and Denmark)

§ Plus, the United Kingdom and Sweden

§ Coming soon: Mexico, the Netherlands, Puerto Rico, Taiwan, Italy, & more!

§ Same questionnaires around the world

§ Diversifying samples!

§ Digital consent and questionnaires

§ Simple at-home saliva collection (COVID-safe!)

§ Engaging advocacy community

§ Engaging clinicians!

www.edgi.org

EDGI Domains: Genes and Environment

Depression

Anxiety

Tobacco Use

Life events

Trauma

Physical Activity

OCD

Alcohol & Drug Use

EDGI Phenotyping

Measure DomainED100K Lifetime ED diagnosesEating Disorder Examination-Q Current ED symptomsGLAD Depression and Anxiety MDD/GADED-Quality of Life ED-specific health related QOLShort Form Health Survey-12 General mental and physical healthPHQ-9 DepressionGAD-7 AnxietyHeaviness of Smoking/Vaping Nicotine useAUDIT Lifetime alcohol useDUDIT Lifetime drug useCompulsive Exercise Test Driven exerciseObsessive-Compulsive Inventory-R Obsessive-compulsive symptomsMultidimensional Perfectionism PerfectionismLife Events Trauma historyED treatment history Lifetime ED-related utilization

edgi.nz edgi.org.au

EDGI Social Media

@EDGI_NZ @EDGI_AUS

@EDGI.NZ @EDGI.AUS

EDGI Talks: YouTube Channel EDGI Study

EATING DISORDERS WORKING GROUP OF THE PSYCHIATRIC GENOMICS CONSORTIUMHunna J Watson PhD, MPsychClin, MBiostats, Zeynep Yilmaz PhD, Laura M Thornton PhD, Christopher Hübel MD, MSc, Jonathan RI Coleman PhD,a, Julien BryoisPhD, Anke Hinney PhD, Héléna A. Gaspar PhD, Virpi Leppä PhD, Manuel Mattheisen MD, Sarah Medland PhD,b, Stephan Ripke MD, PhD, Shuyang Yao PhD, Paola Giusti-Rodrìguez, Anorexia Nervosa Genetics Initiative, Ken B. Hanscombe PhD, Kristin L Purves MSc, Eating Disorders Working Group of the Psychiatric Genomics Consortium (PGC-ED), Roger AH Adan PhD, Lars Alfredsson PhD, Tetsuya Ando MD, PhD, Ole A Andreassen MD, PhD, Jessica H Baker PhD, Wade H Berrettini MD, PhD, Ilka Boehm PhD, Claudette Boni PhD, Vesna Boraska Perica PhD, Katharina Buehren MD, PhD, Roland Burghardt MD, Matteo Cassina MD, Sven Cichon PhD, Maurizio Clementi MD, Roger D Cone PhD, Philippe Courtet MD, Scott Crow MD, James Crowley PhD, Unna N Danner PhD, Oliver S P Davis MSc, PhD, Martina de Zwaan MD, George Dedoussis PhD, Daniela Degortes PhD, Janiece E DeSocio PhD, RN, PMHNP-BC, Danielle M Dick PhD, Dimitris Dikeos MD, Christian Dina PhD, Monika Dmitrzak-Weglarz PhD, Elisa Docampo Martinez MD, PhD, Laramie E Duncan PhD, Karin Egberts MD, Stefan Ehrlich MD, Geòrgia Escaramís PhD, Tõnu Esko PhD, Xavier Estivill MD PhD, Anne Farmer MD, Angela Favaro MD, PhD, Fernando Fernández-Aranda PhD, Manfred M Fichter MD, Dipl-Psych, Krista Fischer PhD, Manuel Föcker MD, Lenka Foretova MD, PhD, Andreas J Forstner MD, Monica Forzan PhD, Christopher S Franklin PhD, Steven Gallinger MD, Ina Giegling PhD, Johanna Giuranna MSc, Fragiskos Gonidakis MD, Philip Gorwood MD, PhD, Monica Gratacos Mayora MD, PhD, Sébastien Guillaume MD, PhD, Yiran Guo PhD, HakonHakonarson MD, PhD, Konstantinos Hatzikotoulas MD, PhD, Joanna Hauser MD, PhD, Johannes Hebebrand MD, Sietske G Helder PhD, Stefan Herms MSc, BeateHerpertz-Dahlmann MD, Wolfgang Herzog MD, Laura M Huckins PhD, James I Hudson MD, ScD, Hartmut Imgart MD, Hidetoshi Inoko PhD, Vladimir Janout PhD, Susana Jiménez-Murcia PhD, Antonio Julià PhD, Gursharan Kalsi PhD, Deborah Kaminská PhD, Jaakko Kaprio MD, PhD, Leila Karhunen PhD, Andreas KarwautzMD, Martien J H Kas PhD, James L Kennedy MD, FRCP(C), Anna Keski-Rahkonen MD, PhD, MPH, Kirsty Kiezebrink PhD, FHEA, RNutr, Youl-Ri Kim MD, PhD, Lars Klareskog MD, Kelly L Klump PhD, Gun Peggy S Knudsen PhD, Maria C La Via MD, Stephanie Le Hellard PhD, Robert D Levitan MD, Dong Li PhD, Lisa Lilenfeld PhD, Bochao Danae Lin PhD, Jolanta Lissowska PhD, Jurjen Luykx MD, PhD, Pierre Magistretti PhD, Mario Maj MD, PhD, Katrin Mannik PhD, Sara Marsal MD, PhD, Christian Marshall PhD, Morten Mattingsdal PhD, Sara McDevitt MB, MD, MRCPsych, MMedED, Peter McGuffin MD, Andres Metspalu PhD, MD, Ingrid MeulenbeltPhD, Nadia Micali MD, PhD, Karen Mitchell PhD, Alessio Maria Monteleone MD, Palmiero Monteleone MD, Melissa A Munn-Chernoff PhD, Benedetta Nacmias PhD, Marie Navratilova MUDr., PhD, Ioanna Ntalla PhD, Julie K O'Toole MD, Roel A Ophoff PhD, Leonid Padyukov MD, PhD, Aarno Palotie MD, PhD, Jacques Pantel PhD, Hana Papezova MD, PhD, Dalila Pinto PhD, Raquel Rabionet PhD, Anu Raevuori MD, PhD, Nicolas Ramoz PhD, Ted Reichborn-Kjennerud MD, PhD, Valdo Ricca MD, Samuli Ripatti PhD, Franziska Ritschel MSc, Marion Roberts PhD, Alessandro Rotondo MD, Dan Rujescu MD, Filip Rybakowski MD, PhD, Paolo Santonastaso MD, André Scherag PhD, Stephen W Scherer PhD, FRSC, Ulrike Schmidt MD, PhD, Nicholas J Schork PhD, Alexandra Schosser PhD, Jochen Seitz MD, Lenka SlachtovaPhD, P. Eline Slagboom PhD, Margarita C T Slof-Op 't Landt PhD, Agnieszka Slopien MD, PhD, Sandro Sorbi MD, Beata Świątkowska PhD, Jin P Szatkiewicz PhD, Ioanna Tachmazidou PhD, Elena Tenconi MD, Alfonso Tortorella MD, Federica Tozzi MD, Janet Treasure PhD, FRCP, FRCPsych, Artemis Tsitsika MD, PhD, Marta Tyszkiewicz-Nwafor MD, PhD, Konstantinos Tziouvas MD, MSc, Annemarie A van Elburg MD, PhD, Eric F van Furth PhD, Gudrun Wagner Dr, MSc, DPO, Esther Walton Dr. rer. nat., PhD, Elisabeth Widen MD, PhD, Eleftheria Zeggini PhD, Stephanie Zerwas PhD, Stephan Zipfel MD, Andrew W Bergen PhD, Joseph M Boden PhD, Harry Brandt MD, Steven Crawford MD, Katherine A Halmi MD, L. John Horwood MSc, Craig Johnson PhD, Allan S Kaplan MSc, MD, FRCP(C), Walter Kaye MD, James Mitchell MD, Catherine M Olsen PhD, MPH, John F Pearson PhD, Nancy L Pedersen PhD, Michael Strober PhD, Thomas Werge PhD, David C Whiteman MBBS(Hons), PhD, FAFPHM, D. Blake Woodside MD, Garret Stuber, Scott Gordon PhD, Jakob Grove PhD, Anjali K Henders BSc(Hons), Anders Juréus PhD, Katherine M Kirk PhD, Janne T Larsen MSc, Richard Parker BA(Hons), Liselotte Petersen PhD, Jennifer Jordan PhD, Martin Kennedy PhD, Grant W Montgomery PhD, Tracey D Wade PhD, Andreas Birgegård PhD, Paul Lichtenstein PhD, Claes Norring PhD, Mikael Landén MD, PhD, Nicholas Martin PhD, Preben Mortensen MD, Patrick Sullivan MD, FRANZCP, Gerome Breen PhD & Cynthia Bulik PhD

Laura Thornton Casey MacDermod

Lauren Harper Jerry Guintivano

Jessica Baker

NaEshia Ancalade Patrick Sullivan

Hunna Watson

edgi.org

edgi.org.au edgi.nz

edgi.se

EDGI Mexico

EDGI Netherlands

EDGI Italy

EDGI Taiwan

Nick MartinRichard ParkerNatalie Garden

Allison Miller Jenny Jordan Martin Kennedy

Lana ClelandHannah Kennedy

Bengt Fundín

Emma Forsén

Liselotte Petersen Zeynep Yilmaz Janne Larsen

Coming Soon!

edgiuk.org

Gerome Breen

@cbulik

Help EDGI Reach 100K!

@PGCgenetics Thank you!

EDGI-Aus acknowledges clinician and/or academic colleagues (Sarah Maguire, Andrea Phillipou, Tracey Wade, June Alexander, Sue Byrne, Sarah Wells, Bronwyn Raykos, Rachel Favilla, Olivia Soha), endED, Eating Disorders QLD, Inside Out Institute, Butterfly Foundation and the Australia & New Zealand Academy for Eating Disorders (ANZEAD) and the project team Natalie Garden, Mary Ferguson, and Lucy Winkler.

EDGI-NZ acknowledges clinician and/or academic colleagues (Rachel Lawson, Lois Surgenor, Andrea LaMarre, Roger Mysliwiec), Nicki Wilson (EDANZ), and Genevieve Mora (Voices of Hope), the Eating Disorders Association of New Zealand (EDANZ).

All EDGI sites thank, in particular, the essential contribution of those with lived experience who came forward to be EDGI ambassadors and to participate in EDGI.

edgi.nz

edgi.org.au

Genes, Environment, and Eating Disorders: What the ...

Documents

Transcript of Genes, Environment, and Eating Disorders: What the ...