GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes...
Transcript of GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes...
![Page 1: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/1.jpg)
GENE CLONING TOOLS
![Page 2: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/2.jpg)
Gene Cloning allows the separation and identification of a specific section of genetic material (DNA or RNA) from other sequences. It then allows the isolation of large numbers of copies of this sequence for molecular characterisation
Genetic engineering
Other terms that you will see that mean the same thing include:
DNA cloningmolecular cloning
recombinant DNA technology
![Page 3: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/3.jpg)
What is a gene and what is a coding region?
A gene is a nucleic acid sequence that code for a polypeptide or chain that has a
function in an organism
A gene sequence includes regulatory regions that are responsible for controlling
the spatial and temporal expression of the gene product (a protein or RNA)
A protein is encoded by a coding region which is the part of the gene between the
translation initiation codon (normally ATG)and the translation termination codon
(TAA, TGA or TAG)
It is important that you appreciate the difference between a gene and a coding
region.
In many genetic engineering experiments we will wish to express a protein and so
will only be interested in the coding region, not in the remainder of the gene from
which it is derived.
![Page 4: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/4.jpg)
Some uses of genetic engineering
Cloning allows full characterisation of a gene including identification and analysis of regulatory sequences and mechanisms controlling spatial and temporal gene expression (i.e. when and where the gene is expressed) by;
DNA sequence analysis
Determination of 5' and 3' ends of the mRNA transcript
Location of introns/exons,
Analysis of mutated forms of DNA
Transcription control elements
Trans-factors
Sequences that control transcript stability
Localisation of expressed protein
Reverse genetics
![Page 5: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/5.jpg)
2. Genome mapping and evolutionary studies
3. Expression of recombinant proteins, from the coding region, for structural and functional studies or large scale production of industrial or medical proteins
3. Protein engineering and directed evolution to generate new functional proteins
4. Diagnosis of human genetic diseases/ Forensic analysis
5. Gene therapy
6. Transgenic plants and animals
Some uses of genetic engineering
![Page 6: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/6.jpg)
We use a range of enzymes as basic tools to manipulate DNA and RNA during gene cloning and analysis processes
Restriction enzymes (site-specific cutting)
Phosphatases (removing 5’ phosphates)
Kinases (adding 5’ phosphates)
Ligases (joining fragments)
Nucleases (removing DNA)
Oligonucleotides (synthetic DNA eg primers and probes)
DNA polymerases (replicating, amplifying) eg. DNA sequencing, PCR, mutagenesis
Tools and techniques
![Page 7: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/7.jpg)
We use various approaches to investigate genes, gene expression and to characterise where and when a gene is expressed, and
where and when its product is localised and active.
Gene Cloning: Vectors, enzymes, PCR, agarose gelsGenes and polymorphisms: Southern blot, DNA
sequencing, Next generation sequencingTranscript analysis: Northern blot, intron/exon, start site
mapping, in situ hybridisationGlobal analysis: microarrays, proteomics, transgenic
knockout/in, Next generation sequencingProtein expression profiles: western blot,
immunocytochemistry, GFP, fusion proteinsProtein expression studies: over-expression, functional analysis
in cellsMolecular interactions: immunoprecipitation, phage display,
yeast hybrid systems, FRET, SPR,
Tools and techniques
![Page 8: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/8.jpg)
Catalase coding region
?
Experimental design sub-cloning
How can I sub-clone this catalase coding region into an
protein expression vector so that I can express and purify the
catalase?
What steps would I need to follow and what tools/techniques
would I need to use?
Let’s think about what tools are available.
Non-coding regions
![Page 9: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/9.jpg)
1. Vectors
2. Agarose gels
3. Restriction enzymes: cut DNA
4. Modifying enzymes: remove or add chemical group (eg
phosphate or nucleotide)
5. Ligases: join DNA
6. Polymerases: synthesise DNA (& RNA) and/or remove
nucleotides
7. Synthetic DNA – oligonucleotides, synthetic genes
8. Polymerase chain reaction PCR
Key molecular biology tools
Now let’s consider a basic gene cloning flow diagram
![Page 10: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/10.jpg)
Basic Steps in CloningPurify vector DNA (e.g.
plasmid or phage)
Alkaline lysis
Purify target DNA to
be cloned eg
genomic, cDNA, or in
silico sourced clone
Transform ligation mix
into competent E. coli.
One cell takes up one
DNA molecule
Plate onto agar with
antibiotic
Only plasmid
containing cells grow
Colonies form on
plates by cell growth &
plasmid replication to
give a clone
Screen colonies to identify
those with recombinant
plasmid
Colony PCR or plasmid
isolation & restriction digest
Digest the circular
plasmid DNA with
Restriction enzyme(s)
Digest the target DNA
to be cloned with
Restriction enzyme(s)PCR amplify a DNA
fragment with
carefully designed
primers & digestLigate (join) digested
vector and target DNA
Mixture of vector &
recombinants
Alakaline phosphatase
treat the plasmid DNA
to remove 5’ P’s
![Page 11: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/11.jpg)
First I need to prepare DNA for cloning
http://www.acgtinc.com/
http://www.pharmatech.co.kr/
http://www.acgtinc.com/
PLASMID
DNAcDNA
GENOMIC
DNA
/oligo dT
purification of
mRNA
![Page 12: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/12.jpg)
First you need to prepare DNA for cloning
http://www.acgtinc.com/
cDNA
/oligo dT purification
of mRNA
We are going to recover the catalase coding region from cDNA that is synthesised
from mRNA.
The mRNA must be isolated from the correct cells and purified (ca. 3-5%) from other
RNAs
This is done by using an oligo dT column or oligo dT magnetic beads to isolated
mRNA which is polyadenylated.
cDNA synthesis then relies upon the enzyme Reverse transcriptase and a primer,
usually an oligo dT primer for first strand synthesis and then a self-priming or
specific primer plus a DNA polymerase for second strand synthesis.
If we know the gene sequences we can actually design two primers that are specific
for the coding region for use in first strand cDNA synthesis followed by PCR
![Page 13: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/13.jpg)
Let’s assume that we are starting with a collection of oligodT-
primed cDNA molecules; some of these will be ones that
contain our catalase sequence
Catalase coding region
We know the sequence of the gene from genome sequencing projects and can
access this information from databases such as Genbank
So we can design primers that can be used for PCR amplification of only the
coding region of the cDNA
![Page 14: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/14.jpg)
Polymerase Chain Reaction
http://www.youtube.com/watch?v=eEcy9k_KsDI
![Page 15: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/15.jpg)
Thermostable DNA polymerases:
DNA synthesis at high temperatures in PCR and other reactions
Taq• 5’ to 3’ exonuclease
and 5’ to 3’ DNA synthesis
Kod, Pfu• 5’ to 3’ DNA synthesis
and 3’ to 5’ exonuclease (proof-reading)
72 Co
94 Co
55 Co
etc
Initial
Denaturation Cycle 1 Cycle 2
Denaturation
Time
Te
mp
era
tu
re
Annealing Extension
PCR involves thermal cycling – 25-40 cycles
![Page 16: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/16.jpg)
![Page 17: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/17.jpg)
![Page 18: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/18.jpg)
5'
3'
template
primer
Eg. Restriction enzyme site
Promoter sequence eg T7 DNA pol
can be added to the 5’ end
• About 20 nt long primers
• ~50 % GC if possible and with similar TM >55 oC
• Avoid complementary primer sequences
• Avoid polypyrimidine (T, C) or polypurine (A, G) stretches
• Can add sequences to 5’-end
Things to consider in PCR primer design
![Page 19: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/19.jpg)
How do we design primers for PCR?
We know the sequence of the gene from genome sequencing projects and can
access this information from databases such as Genbank
So we can design primers that can be used for PCR amplification of only the
coding region of the cDNA
But….how will we be able to clone this PCR amplified coding sequence into a
cloning vector?
First we need to decide what cloning vector we will use
5’ 3’
5’3’
ATG
TAA
TGA
TAG
![Page 20: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/20.jpg)
Plasmids
Viruses/Bacteriophage
Cosmids• combination of plasmid and bacteriophage l
Phagemids– combination of plasmid and bacteriophage M13
Common cloning vectors
![Page 21: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/21.jpg)
pET28 TEV
5368 bp
expression region
lacI
Kanr
His6 tag
TEV cleavage site
His6 tag
T7 P
f1 ori
pBR322 ori
T7 TERM
BamHI (5167)
BglII (4965)
ClaI (1251)
EcoRI (5173)
EcoRV (3797)
HindIII (5192)
KpnI (5112)
NcoI (5070)
NheI (5135)
NotI (5199)
SacI (5183)
SalI (5186)
SmaI (1070)
SphI (4776)
XbaI (5031)
XhoI (5207)
XmaI (1068)
An example of a
cloning vector used
routinely in my lab
Antibiotic resistance
kanamycin
resistance
Origin of replication
Expressed gene regulation
Promoter
Multiple cloning site
Purification of
expressed protein
pET28 plasmid
vector
![Page 22: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/22.jpg)
Designing the primers for PCR?
If we are going to clone into pET28 we will need to add restriction sites at the
ends of the coding region
We do this by adding the restriction enzyme cleavage sequences to the 5’ end
of the primers.
If we add different sites to the 5’ and 3’ end of the coding region then we can do
directional cloning so that we know the sequence is inserted into the vector in
the correct orientation.
5’ 3’
5’3’
We will add an NcoI site at the 5’ end of coding region and EcoRI site at the 3’ end
EcoRI
When we PCR amplify the coding region using these primers we will
generate this sequence
We need to check whether we have the correct PCR product and digested vector
![Page 23: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/23.jpg)
CATCTGCTAGTCCAACCTACATCATGTCGTCAAGTCAT-1kb-ATTATTATCTCTCTGGATGTCAACATGAAACACCTGCTAACACTC
GTAGACGATCAGGTTGGATGTAGTACAGCAGTTCAGTA-1kb-TAATAATAGAGAGACCTACAGTTGTACTTTGTGGACGATTGTGAG
5’ 3’
5’3’
Always label 5’ and 3’ ENDS when writing
CATCTGCTAGTCCAACCTACATCATGTCGTCAAGTCAT-1kb-ATTATTATCTCTCTGGATGTCAACATGACACACCTGCTAACACTC
GTAGACGATCAGGTTGGATGTAGTACAGCAGTTCAGTA-1kb-TAATAATAGAGAGACCTACAGTTGTACTGTGTGGACGATTGTGAG
5’ 3’
5’3’
Select primer sites (ca. 20 nt)
A more detailed look at how to design the primers for
PCR of the coding region
![Page 24: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/24.jpg)
CATCTGCTAGTCCAACCTACATCATGTCGTCAAGTCAT-1kb-ATTATTATCTCTCTGGATGTCAACATGAAACACCTGCTAACACTC
GTAGACGATCAGGTTGGATGTAGTACAGCAGTTCAGTA-1kb-TAATAATAGAGAGACCTACAGTTGTACTTTGTGGACGATTGTGAG
5’ 3’
5’3’
Add sequences onto primer with a few extra 5’ nucleotides to ensure efficient
restriction enzyme cleavage.
NcoI = CCATGG; EcoRI = GAATTC
NcoI EcoRI
PCR
3’GTCCAACCTACATCATGTCG 3’ GACCTACAGTTGTACTTTGT
Always write primers as 5’ to 3’
sequences so the reverse strand needs
rewritten TCGTCTTAAGTGTTTCATGTTGACATCCAG5’ 3’
NcoI
CCATGG5’
4 nts
ATCC
EcoRI
GAATTC 5’
4 nts
TGCT
![Page 25: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/25.jpg)
• Electrophoresis through an agarose gel matrix
• At neutral pH DNA and RNA have a net NEGATIVEcharge due to phosphate groups and so move towards the ANODE (+ve electrode)
• Small molecules move through faster than longer/larger molecules so separation is on the basis of size
– For linear fragments rate of migration proportional to log10 molecular size
Can also separate on basis of conformationPlasmid DNA: Supercoiled, open circular
and linear are all the same molecular size but migrate differently
Analysing DNA fragments by agarose gel electrophoresis
![Page 26: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/26.jpg)
pET28 TEV
5368 bp
expression region
lacI
Kanr
His6 tag
TEV cleavage site
His6 tag
T7 P
f1 ori
pBR322 ori
T7 TERM
BamHI (5167)
BglII (4965)
ClaI (1251)
EcoRI (5173)
EcoRV (3797)
HindIII (5192)
KpnI (5112)
NcoI (5070)
NheI (5135)
NotI (5199)
SacI (5183)
SalI (5186)
SmaI (1070)
SphI (4776)
XbaI (5031)
XhoI (5207)
XmaI (1068)
Next we need to restriction
digest the vector and PCR
product with NcoI and EcoRI
![Page 27: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/27.jpg)
Endonucleases: Digest DNA at internal (often palindromic)
sites in DNA
– Restriction enzymes cleave DNA only at specific
recognition sites
– generating fragments for cloning
– map genes and polymorphisms (SNP’s)
5’3’
3’5’GAATTC
CTTAAG
5’3’
3’5’GAATTC
CTTAAG
5’3’
3’5’G3’
CTTAA5’
5’AATTC
3’G
Restriction enzymes
![Page 28: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/28.jpg)
Animation: Restriction enzymes
• http://highered.mcgraw-
hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites
/dl/free/0072437316/120078/bio37.swf::Restriction
Endonucleases
![Page 29: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/29.jpg)
Restriction enzyme sites
• Restriction enzymes can leave three different types of ends
– 5’ overhang (sticky end)
– 3’ overhang (sticky end)
– blunt
GAATTCCTTAAG
CAGCTGGTCGAC
GGTACCCCATGG
Eco RI Pvu II Kpn I
G3’ 5’AATTC
CTTAA5’ 3’G
CAG3’ 5’CTG
GTC5’ 3’GACGGTAC3’ 5’C
C5’ 3’CATGG
5’ OVERHANG BLUNT END 3’ OVERHANG
The ends generated allow different DNA fragments to be joined
![Page 30: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/30.jpg)
Restriction enzyme sites
• Some enzymes recognise different sites but generate the
SAME sticky ends
GGATCCCCTAGG
Bam HI Bgl II Sau 3A
AGATCTTCTAGA
NGATCNNCTAGN
G3’
CCTAG5’5’GATCT
3’A+ GGATCT
CCTAGA
Will not cut with Bam HI
or Bgl II, but will still cut
with Sau 3A
Bam HI end Bgl II end Product
![Page 31: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/31.jpg)
• Alkaline phosphatase:
– removes the 5’ phosphate groups from DNA, normally
the vector DNA
– needs inactivated usually by heat before the ligation
step (otherwise it can dephosphorylate the insert as
well!!)
Gene Cloning and DNA Analysis by T.A. Brown. © 2006 T.A. Brown.
Hydrolysis of phosphate ester
+ 2 PO4
-3
Often the restriction digested vector DNA is also treated with the
enzyme
![Page 32: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/32.jpg)
P
Why do we use alkaline phosphatase?
3’OH 5’PGATC
CATG5’ 3’OH
GATC
CATG
Vector Insert
Ligation
Vector plus insert
GATC
CATG
No ligation
3’OH 5’OH GATC
CATG5’OH 3’OH
Vector Vector
Vector with NO insert
![Page 33: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/33.jpg)
• Generates phosphodiester bonds between 3’OH and 5’ P
• Must have a 5’Phosphate (5’P) for ligase to function
The vector and insert DNA are then mixed in a ligase buffer
containing ATP and DNA ligase
3’OH 5’PGATC
CATGP5’ 3’OH
GATC
CATG
Vector Insert
Join two double strand
molecules together if they
have suitable ends
3’OH 5’P
O-P-O
Repair single-strand breaks
in the phosphodiester
backbone useful in some site-directed
mutagenesis applications
![Page 34: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/34.jpg)
The E. coli cells are treated with CaCl2 or
RbCl2 to disrupt their cell walls and can
be stored frozen at -80oC.
For a transformation reaction aliquots of
cells are thawed on ice and DNA is
added, typically around 40 -5 0 ng.
After incubating on ice the cells are heat
shocked for around 1-2 min at 42oC so
that cells take up the DNA
Very few of the cells will actually become
transformed and so we need to be able to
identify those cells that have been
transformed and we do this by antibiotic
selection
Following a ligation reaction an aliquot is
transformed into competent E. coli cells.
![Page 35: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/35.jpg)
All the transformed
colonies will contain a
vactor, but NOT all will
contain recombinant
plasmids
(1) Clones containing vector molecules can grow –
they are antibiotic resistant!
• Reduce vector only (eg alkaline
phosphatase)
(2) How do you identify recombinants?
Blue white selection (based on lacZ activity)
Colony PCR
Purify plasmid & restriction digest
Hybridization screening
Most common
then
DNA sequence
Selection and screening
![Page 36: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/36.jpg)
E. coli DNA polymerase I: synthesises DNA using a template and primer
– Three activities: • 5’-3’ exonuclease (repair)
• 5’-3’ DNA synthesis
• 3’-5’ exonuclease (proof-reading)
DNA PolymerasesUses: DNA synthesis (and sometimes as an
exonuclease) DNA sequencing DNA mutagenesis
DNA labelling
These are useful for some DNA manipulation including• Filling in sticky ends to make them blunt ends • Radioactive labelling ends• DNA synthesis reactions that use a primer
Klenow fragment
T4 DNA pol
T7 DNA pol
![Page 37: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/37.jpg)
DNA Polymerases that are now more
commonly used than Pol I
• T7 and T4 phage DNA polymerases: – Klenow activities, but more efficient
• Thermostable DNA polymerases: – DNA synthesis at high temperatures in PCR and
other reactions
– Taq• 5’ to 3’ flap exonuclease and 5’ to 3’ DNA synthesis
– Kod, Pfu• 5’ to 3’ DNA synthesis and 3’ to 5’ exonuclease (proof-
reading)
• Reverse transcriptase: – synthesises cDNA using RNA as a template and a
DNA primer
![Page 38: GENE CLONING TOOLS - University of Leeds · Gene Cloning: Vectors, enzymes, PCR, agarose gels Genes and polymorphisms: Southern blot, DNA sequencing, Next generation sequencing Transcript](https://reader035.fdocuments.in/reader035/viewer/2022071609/6147bc11afbe1968d37a3df0/html5/thumbnails/38.jpg)
1. Gene cloning essentials 3
1.1 Introduction 4
1.2 Gene cloning applications 4
1.3 Gene cloning in the laboratory 5
1.4 Gene cloning processes 14
1.5 Further types of gene cloning 18
1.6 Chapter summary 21
2. Polymerase chain reaction 23
2.1 Introduction 23
2.2 How PCR works 24
2.3 The PCR protocol 26
2.4 PCR techniques and applications 31
2.5 Forensic DNA analysis 40
2.6 Future prospects 41
2.7 Chapter summary 41
Reading associated with this lecture