SUPPLEMENTAL INFORMATION

METHODS

Cell culture and chemicals

MEL cells were cultured in Dulbeccos Modified Eagle Medium (DMEM) with 10% fetal

bovine serum (FBS), to which penicillin (100 units/mL of medium) and streptomycin (100

g/mL of medium) were added (all from Invitrogen, Burlington, Ontario). All the experiments

were conducted with both uninduced MEL cells (0h) as well as cells treated with 1.8% DMSO

(Me2SO2) to induce differentiation and hemoglobinization1. Primary erythroid cells were

cultured as described 2. Briefly, cells were grown from fetal livers that were obtained from E12.5

embryos of wild-type and HO-1 knockout (FVB.129[B6] background) mice and resuspended in

serum-free StemPro-34 medium plus Nutrient Supplement (Invitrogen-Gibco, Carlsbad, USA)

plus 2 U/mL human recombinant erythropoietin (Epo; 100 ng/mL), murine recombinant stem

cell factor (SCF; 100 ng/mL), the synthetic glucocorticoid dexamethasone (Dex; 10-6 M), and

insulin-like growth factor 1 (IGF-1; 40 ng/mL). To induce terminal differentiation, continuously

self-renewing erythroblasts were washed twice in PBS and seeded in StemPro-34, containing 10

U/mL Epo, insulin (4x10-4 IU/mL), the Dex antagonist ZK-112993 (3x10-6M) 3 and iron-

saturated human transferrin (Fe2-Tf; 1 mg/mL=12.5 M = 25M = Fe = physiologic levels;

Sigma, St Louis, USA). Where indicated, cells were treated with 100 M of the HO-1 inhibitor,

tin-protoporphyrin IX (SnPP) (Frontier Scientific, Logan, USA) and 0.4 mM of heme synthesis

inhibitor, succinyl acetone (SA) (Sigma, St Louis, USA).

MEL cells stable transfection

Total RNA was isolated from MEL cells using RNeasy kit (Quiagen, Toronto, Canada)

following manufacturers instructions. Single stranded cDNA was synthesized using qScript

cDNA Synthesis Kit (Quanta Biosciences, Gaithersburg, USA). Primers bearing restriction

cleavage sites for the enzymes XhoI and HindIII (Thermo Scientific, Burlington, Canada) were

used to specifically amplify HO-1: HO-1(XhoI) foward 5 CGTCTCGAGCATAGCCCGGA

3 and HO-1(HindIII) reverse 5 TTGCTTTCTTAGAGGCCCAAGAGAA 3. The PCR

product was cleaved with the mentioned enzymes, purified and cloned in the pCDNA3.1

plasmid, generating pCDNAHO-1 plasmid. MEL cells were then transfected with either

pCDNA3.1 or pCDNAHO-1 using Lipofectamine 2000 (Life Tecnologies Inc., Burlington,

Ontario), following the manufacturers instructions. 48h after transfection, MEL cells were

resuspended in the ClonaCell-TCS Medium (STEMCELL Technologies, Vancouver,

Canada) containing 400ng/ml of G418 Sulfate (Bioshop Canada Inc, Burlington, Canada). G418

resistant clones were isolated after 2 weeks of selection and sorted according to their HO-1

expression levels. MEL cell clones showing the highest levels of HO-1 expression (MELHO-1)

were used in the experiments. MEL cells clones carrying only pCDNA3.1, without HO-1 cDNA

insert, were used as control.

Reactive oxygen species (ROS) measurement

Cells were seeded at a concentration of 0.5x106 cells/mL in 6-well plates and, an hour prior to

harvest, incubated with 10 M 5-6-chloromethyl-2',7'-dichlorodihydrofluorescein diacetate,

acetyl ester (CM-H2DCFDA; Life Tecnologies Inc., Burlington, Ontario). After incubation, cells

were harvested, washed twice in ice-cold PBS, and analyzed by flow cytometry (FACSCalibur;

BD Biosciences, Mississauga, Canada).

Apoptosis measurement

Apoptosis measurement was performed using Dead Cell Apoptosis Kit (Life Technologies Inc.,

Burlington, Ontario) following the manufacturers instructions. Experiments were performed in

triplicates where cells positive only for annexin-V were considered apoptotic and cells positive

for both annexin-V and PI were considered necrotic.

Real time PCR (qRT-PCR)

Total RNA was isolated from cells using RNeasy kit (Quiagen, Toronto, Canada) following

manufacturers instructions. Single stranded cDNA was synthesized using qScript cDNA

Synthesis Kit (Quanta Biosciences, Gaithersburg, USA). qRT-PCR reactions were performed

using qScript One-Step SYBR Green qRT-PCR Kit, Low ROX (Quanta Biosciences,

Gaithersburg, USA) and the following primers: HO-1 forward 5

GTCAAGCACAGGGTGACAGA 3, HO-1 reverse 5 ATCACCTGCAGCTCCTGAAA

3; -Actin forward 5 AGCCATGTACGTAGCCATCC 3, -Actin reverse 5

TGATGTCACGCACGATTTCC 3; Globin foward 5 - TGTGTTGACTTGCAACCTCAG

3, Globin reverse 5 GCAGAGGATAGGTCTCCAAAGC 3; TfR foward 5

GAAGTCCAGTGTGGGAACAGGT 3, TfR reverse 5

CAACCACTCAGTGGCACCAACA 3 . qRT-PCR reactions were amplified using 7500 Fast

Real-Time PCR System (Applied Biosystems, Streetsville, Canada) and data analysis was

performed with 7500 Software v2.0.5 (Applied Biosystems, Streetsville, Canada). Experiments

were performed in triplicates and values achieved by applying the 2-CT formula for statistical

analysis purposes 4.

Western blotting

Cells were harvested and lysed using Munros lysis buffer (10 mM Hepes [pH 7.6], 3 mM

MgCl2, 40 mM KCl, 5% glycerol, and 0.2% NP-40). Protein content was determined using

Bradford reagent (BioRad, Mississauga, Canada). 30 g of protein was resolved on a 15% SDS-

polyacrylamide gel and then transferred to a nitrocellulose membrane. Membranes were blocked

with blocking solution (5% milk powder or 5% albumin in TBS/0.2% Tween 20). They were

then incubated overnight with the indicated primary antibodies: actin (Sigma-Aldrich Inc,

Oakville, Canada; 1:5000); HO-1 (Stressgen, Ontario, Canada; 1:5000); ferritin (Sigma-Aldrich,

Inc., Oakville, Canada; 1:500); transferrin receptor (Abcam Inc, Cambridge, USA; 1:5000);

globin (MP Biomedicals Inc, Solon, USA; 1:10000); eIF2 (Cell Signaling Technology Inc,

Danvers, USA; 1:1000); Phospho-eIF2 (Cell Signaling Technology Inc, Danvers, USA;

1:1000). After washing, membranes were incubated with the appropriate secondary antibody,

mouse or rabbit horseradish peroxidasecoupled anti-IgG antibody (Jackson Laboratories, West

Grove, USA) in a 1:20000 dilution in blocking solution for 1h at room temperature. The western

blot was developed using HyBlot CLTM autoradiography film (Denville Scientific Inc,

Metuchen, USA). Presented representative results were selected out of three or more

experiments. ImageJ software (NIH) was used to perform all densitometric analysis.

Gel retardation Assay

Iron-regulatory protein (IRP) binding was determined using a band shift assay as described

previously 5. Briefly, 5106 cells were washed with ice-cold PBS and lysed at 4C in 80 l of

Munros lysis buffer. Samples were then diluted with 2 vol. of Munros buffer (without NP-40)

to a protein concentration of 1 g/l, and 10 g aliquots were analysed for IRP binding by

incubating them with an excess amount of 32P-labelled pSRT-fer RNA transcript (kindly

provided by Dr Lukas Khn, Swiss Institute for Experimental Cancer Research, CH-1015

Lausanne, Switzerland), which contains one IRE. This RNA was transcribed in vitro from

linearized plasmid template using T7 RNA polymerase in the presence of [32P]UTP. To form

RNAprotein complexes, cytoplasmic extracts were incubated for 10 min at room temperature

with an excess amount of labelled RNA. Heparin (5 mg/ml) was added for a further 10 min to

prevent non-specific binding. RNAprotein complexes were analysed in 6% non-denaturing

polyacrylamide gels. In parallel, duplicate samples were treated with 2% 2-mercaptoethanol

before the addition of the RNA probe to reveal the total levels of IRP1.

59Fe uptake from 59Fe2-Tf

59Fe2Tf was made from 59FeCl3 (PerkinElmer, Santa Clara, USA; 2Ci) as described

previously 6,7. For 59Fe2Tf uptake measurements, cells were incubated with 2 M (saturating

concentration) 59Fe2Tf, for 3 hours, following which samples were washed twice with ice-cold

PBS and collected by centrifugation (200 g for 5 min at 4 C).

Preparation of 59Fe-SIH

59FeCl3 was converted to ferric citrate by addition of a 20-fold molar excess of sodium citrate

(C6H5Na3O7.2H2O; Bioshop Canada Inc, Burlington, Canada). The volume was then adjusted

with distilled water to make final concentration of iron equal to 300 M. This [59Fe]ferric citrate

solution was diluted 7-10 fold with the same concentration of non-radioactive ferric citrate (pH

7.4). To form 59Fe-SIH, equal concentrations of ferric citrate and SIH solutions were mixed. The

concentration of 20 M iron was obtained by diluting the 59Fe-SIH mixture (100 M stock

solution) with the incubation medium. The cells were incubated for 3 hours, following which

samples were washed twice with ice-cold PBS and collected by centrifugation (200 g for 5min at

4C).

Measurement of 59Fe in heme and non-heme fractions

Measurements of 59Fe in heme and non-heme fractions were carried out as described previously

by an acid precipitation method8,9. Briefly, cells were collected by centrifugation (4000 g for 30

seconds), lysed in water and boiled in 1 ml of 0.2 M HCL; the samples were then transferred to

an ice-bath and 59Feheme-containing proteins were precipitated with ice-cold 7% trichloroacetic

acid (TCA; Bioshop Canada Inc, Burlington, Canada) solution, for 2 hours, and collected by

centrifugation (2800 g for 5 min at 4C). Precipitated proteins (containing 59Fe in heme) and

supernatants (containing non-heme 59Fe) were divided into separate tubes. Measurements of 59Fe

radioactivities in heme and non-heme fractions were carried out in a Packard Cobra gamma

counter (PerkinElmer, Santa Clara, USA).

Ter119- and Ter119+ cell sorting

Femora and humeri from wild type mice were collected and their bone marrows extracted. Bone

marrow cells were resuspended in Iscoves medium (Invitrogen, Burlington, Ontario) with 2%

bovine serum and passed through a 40 M cell strainer (BD Falcon, Becton Drive, USA).

Erythrocytes were lysed with 1 ml of lysis buffer (155 mM NH4Cl, 10 mM KHCO3, 0.1 mM

EDTA, pH 7.3) for 2 minutes on ice. Cells were washed in PBS with 0.5% bovine serum, and

then resuspended in PBS with 0.2% bovine serum. Cells were incubated with Ter119-APC

antibody (eBioscience, San Diego, USA) for 45 minutes on ice. After washing with PBS with

0.2% of bovine serum, cells were resuspended in PBS and Ter119- and Ter119+ cells were

sorted by flow cytometry (FACSVantage SE; BD Biosciences, Mississauga, Canada).

Heme and hemolgobin assay

Cellular heme content was assayed as described previously10. Briefly, following counting, cells

were resuspended in 500 L of concentrated formic acid. The heme concentration was

determined spectrophotometrically at 395 nm. The resulting absorbances were compared against

a standard curve of hemin. The experiment results were normalized by protein concentration.

Hemolgobin assay was performed as previously11,12. Briefly, 2-5x105 cells were transferred in

triplicates into a 96-well microtiter plate with conical bottomed wells and washed with 100 l

PBS. Cells were lysed in 50 l H2O. Thereafter, 125 l dye solution (0.5 mg/mL o-phenylene-

diamine-dihydrochloride; Sigma-Aldrich, St. Louis, USA), 50 mM citric acid, 0.1 M Na2HPO4;

add 1 L/mL of 30% H2O2) was added. The reaction was stopped with 25 L 8N H2SO4 and the

OD of samples at 492 nm was determined. The quantification results were normalized by cell

number and cell volume.

SUPPLEMENTAL REFERENCES

1. Friend C, Scher W, Holland JG, Sato T. Hemoglobin synthesis in murine virus-induced leukemic

cells in vitro: stimulation of erythroid differentiation by dimethyl sulfoxide. Proc Natl Acad Sci U S A.

1971;68(2):378-382.

2. Schranzhofer M, Schifrer M, Cabrera JA, et al. Remodeling the regulation of iron metabolism

during erythroid differentiation to ensure efficient heme biosynthesis. Blood. 2006;107(10):4159-4167.

3. Mikulits W, Chen D, Mullner EW. Dexamethasone inducible gene expression optimised by

glucocorticoid antagonists. Nucleic Acids Res. 1995;23(12):2342-2343.

4. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat

Protoc. 2008;3(6):1101-1108.

5. Kim S, Ponka P. Control of transferrin receptor expression via nitric oxide-mediated modulation

of iron-regulatory protein 2. J Biol Chem. 1999;274(46):33035-33042.

6. Martinez-Medellin J, Schulman HM. The kinetics of iron and transferrin incorporation into rabbit

erythroid cells and the nature of stromal-bound iron. Biochim Biophys Acta. 1972;264(2):272-274.

7. Ponka P, Schulman HM. Acquisition of iron from transferrin regulates reticulocyte heme

synthesis. J Biol Chem. 1985;260(27):14717-14721.

8. Borova J, Ponka P, Neuwirt J. Study of intracellular iron distribution in rabbit reticulocytes with

normal and inhibited heme synthesis. Biochim Biophys Acta. 1973;320(1):143-156.

9. Zhang AS, Sheftel AD, Ponka P. Intracellular kinetics of iron in reticulocytes: evidence for

endosome involvement in iron targeting to mitochondria. Blood. 2005;105(1):368-375.

10. Soe-Lin S, Sheftel AD, Wasyluk B, Ponka P. Nramp1 equips macrophages for efficient iron

recycling. Exp Hematol. 2008;36(8):929-937.

11. Dolznig H, Kolbus A, Leberbauer C, et al. Expansion and differentiation of immature mouse and

human hematopoietic progenitors. Methods Mol Med. 2005;105:323-344.

12. Kowenz E, Leutz A, Doderlein G, Graf T, Beug H. ts-oncogene-transformed erythroleukemic cells:

a novel test system for purifying and characterizing avian erythroid growth factors. Haematol Blood

Transfus. 1987;31:199-209.

SUPPLEMENTAL FIGURE LEGENDS AND FIGURES

Figure S1. Flow cytometry analysis of TfR surface expression. Representative histograms

show TfR (CD71) present on FL/HO-1+/+ and FL/HO-1-/- cells differentiated with EPO during

different time points (0, 24 and 48h).

Figure S2. MEL cells constitutively overexpress HO-1. (A) qRT PCR of control and stably

transfected with HO-1 cDNA (MELHO-1) MEL cells, showing HO-1 mRNA. (B) Western blot

of HO-1 in control and MELHO-1 MEL cells. Error bars represent standard deviation (n=3). (*)

p

for the indicated time intervals and then labelled with annexin-V-FITC and propidium iodine

(PI). The apoptotic single-stained (annexin-V-FITC) and the necrotic double-stained (annexin-V-

FITC and PI) cell population fluorescence were measured by flow cytometry. Error bars

represent standard deviation (n=3). (*) p