Gap Junctions: The Claymore for Cancerous Cells · Gap Junctions: The Claymore for Cancerous Cells...

*Corresponding author: Hossein Hamzeiy (PhD) and Jaleh Barar (PhD), Tel.: + 98 411 3367914, Fax: +98 411 3367929, E-mail: [email protected], [email protected] Copyright © 2011 by Tabriz University of Medical Sciences

BioImpacts, 2011, 1(2), 113-119 doi: 10.5681/bi.2011.015 http://bi.tbzmed.ac.ir/

Gap Junctions: The Claymore for Cancerous Cells Masoud Asadi-Khiavi1,2,3, Hossein Hamzeiy1,2*, Sajjad Khani2, Ailar Nakhlband2 and Jaleh Barar2,4* 1Department of Pharmacology and Toxicology, School of Pharmacy, Tabriz University of Medical Sciences, Tabriz, Iran 2Research Center for Pharmaceutical Nanotechnology, School of Pharmacy, Tabriz University of Medical Sciences, Tabriz, Iran 3Student Research Committee, Tabriz University of Medical Sciences, Tabriz, Iran 4Ovarian Cancer Research Center, School of Medicine, University of Pennsylvania, Philadelphia, USA

Introduction

Cancer is a terrible disorder facing human today and unfortunately, lack of deep knowledge about cancer biology causes perfect treatment failing. However, several strategies have been developed upon recent findings in molecular biology. One of these approaches appears to be valuable because of inhibiting inter-cellular gap junction communication (GJIC) between cells. As a rule, lack of gap junctions was commonly observed in carcinogenesis (Leithe et al. 2006). Some critical small biomolecules like cAMP and Ca2+ as well as several small sized amino acids could pass through this communicative channel. Cellular apoptosis pathway, Akt signaling pathway, EGF pathway, p53 pathway, inhibition of matrix metalloproteinases (MMPs) and VEGF family ligands and receptors are the most important biomolecules and ways in cancer biology which could be affected by these small agents. As

mentioned, EGF pathway and its obedience biomolecules has vital role in carcinogenesis of epithelial derived carcinomas like breast and lung cancers (Cameron et al. 2003). This cell-surface tyrosine kinase receptor is a member of the ErbB family of receptors and mutations which could result in some epithelial derived carcinomas including breast cancer through affecting its expression or activity. EGFR over expression was reported in 20% - 50% of breast cancer (Agelaki et al. 2009). EGFR is activated by binding its specific ligands, including epidermal growth factor (EGF) and transforming growth factor α (TGFα). Due to activation by its ligands, EGFR switches from an inactive monomeric form to an active homodimer (Dong J and Wiley HS 2000). Several signal transduction cascades was initiated by downstream signaling proteins, principally the mitogen-activated protein kinase (MAPK), phosphatidylinositol-3-kinase (PI-3K/Akt), and finally signal transducer and activator of

A B S T R A C T A R T I C L E I N F O

Keywords: Cancer Cells EGFR Gap Junction Cytotoxicity Gene Expression

Article History: Received: 14 July 2011 Revised: 17 July 2011 Accepted: 20 July 2011 ePublished: 31 July 2011

Article Type: Research Article

Introduction: Gap junctions play an important role in the cell proliferation in mammalian cells as well as carcinogenesis. However, there are controversial issues about their role in cancer pathogenesis. This study was designed to evaluate genotoxicity and cytotoxicity of Carbenoxolone (CBX) as a prototype of inter-cellular gap junction blocker in MCF7 and BT20 human breast cancer cells. Methods: The MCF7and BT20 human breast cancer cell lines were cultivated, and treated at designated confluency with different doses of CBX. Cellular cytotoxicity was examined using standard colorimetric assay associated with cell viability tests. Gene expression evaluation was carried out using real time polymerase chain reaction (PCR). Results: MCF7 and BT20 cells were significantly affected by CBX in a dose dependent manner in cell viability assays. Despite varying expression of genes, down regulation of pro- and anti-apoptotic genes was observed in these cells. Conclusion: Based upon this investigation, it can be concluded that CBX could affect both low and high proliferative types of breast cancer cell lines and disproportionate down regulation of both pre- and anti-apoptotic genes may be related to interacting biomolecules, perhaps via gap junctions.

junctions

Asadi

114

transcription (STAT) pathways et al2006)adhesion and migrationinvolvement in the metastasis, angiogenesis and apoptosis inhibition 2005)it is believed that EGFR signal transduction could be modulatetransferredpromote (C34H50O7) [3Oleancellularjunctionsseveral derivatiand demonstrates a superficial resemblance to steroid structuresinhibitor 2001about Crespin determine the impacts of CBX on MCF7and BT20 human breast cancer cells in the view of apoptosis

Materials and

MaterialsThe MCF7Cell culture plates and flasks were obtained from National cell bank of Iran (Pasteur institute, Iran) and IWAKI, Japan respectively. RPMI1640 medium, TrypsinDithiotheritol (DTT), first strand reverse transcriptase (RT) buffer, Moloney murine leukemia virus reversetranscriptase (MMLVSigma Aldrich Co., (Poole, UK). Agarose and Fetal bovine serum (FBS) were bought from Gibco, Invitrogen (Paisley, UK). Ribonuclease inhibitor was obtained fromFermentas, Canada. (Glyceraldehyde 3

Asadi-Khiavi

114 | BioImpacts

transcription (STAT) pathways et al. 2008; Camp 2006) adhesion and migrationinvolvement in the metastasis, angiogenesis and apoptosis inhibition 2005). it is believed that EGFR signal transduction could be modulatetransferredpromote (C34H50O7) [3Olean-12 encellularjunctionsseveral derivatiand demonstrates a superficial resemblance to steroid structuresinhibitor 2001). about Crespin determine the impacts of CBX on MCF7and BT20 human breast cancer cells in the view of apoptosis

Materials and

MaterialsThe MCF7Cell culture plates and flasks were obtained from National cell bank of Iran (Pasteur institute, Iran) and IWAKI, Japan respectively. RPMI1640 medium, TrypsinDithiotheritol (DTT), first strand reverse transcriptase (RT) buffer, Moloney murine leukemia virus reversetranscriptase (MMLVSigma Aldrich Co., (Poole, UK). Agarose and Fetal bovine serum (FBS) were bought from Gibco, Invitrogen (Paisley, UK). Ribonuclease inhibitor was obtained fromFermentas, Canada. (Glyceraldehyde 3

Khiavi

BioImpacts

transcription (STAT) pathways . 2008; Camp which mainly undergoes to cell proliferation,

adhesion and migrationinvolvement in the metastasis, angiogenesis and apoptosis inhibition

. In regards to these miscellaneous biomoleculesit is believed that EGFR signal transduction could be modulatedtransferredpromote pathogenesis(C34H50O7) [3

12 encellular communicationjunctions, inhibits cell growthseveral types of derivation and demonstrates a superficial resemblance to steroid structures. inhibitor in cells

. However, there are some controversialabout gap junction Crespin et aldetermine the impacts of CBX on MCF7and BT20 human breast cancer cells in the view of apoptosis particularly

Fig.

Materials and

Materials The MCF7Cell culture plates and flasks were obtained from National cell bank of Iran (Pasteur institute, Iran) and IWAKI, Japan respectively. RPMI1640 medium, Trypsin-EDTA (0.05%Dithiotheritol (DTT), first strand reverse transcriptase (RT) buffer, Moloney murine leukemia virus reversetranscriptase (MMLVSigma Aldrich Co., (Poole, UK). Agarose and Fetal bovine serum (FBS) were bought from Gibco, Invitrogen (Paisley, UK). Ribonuclease inhibitor was obtained fromFermentas, Canada. (Glyceraldehyde 3

Khiavi et al

BioImpacts

transcription (STAT) pathways . 2008; Camp

which mainly undergoes to cell proliferation, adhesion and migrationinvolvement in the metastasis, angiogenesis and apoptosis inhibition

n regards to these miscellaneous biomoleculesit is believed that EGFR signal transduction could be

d by transferred via gap junction

pathogenesis(C34H50O7) [3

12 en-29communication, inhibits cell growthtypes of of

and demonstrates a superficial resemblance to steroid This drug

in cellsHowever, there are some controversialgap junction

et aldetermine the impacts of CBX on MCF7and BT20 human breast cancer cells in the view of

particularly

Fig. 1.

Materials and

The MCF7 and BT20 human breast cancer cell lines, Cell culture plates and flasks were obtained from National cell bank of Iran (Pasteur institute, Iran) and IWAKI, Japan respectively. RPMI1640 medium,

EDTA (0.05%Dithiotheritol (DTT), first strand reverse transcriptase (RT) buffer, Moloney murine leukemia virus reversetranscriptase (MMLVSigma Aldrich Co., (Poole, UK). Agarose and Fetal bovine serum (FBS) were bought from Gibco, Invitrogen (Paisley, UK). Ribonuclease inhibitor was obtained fromFermentas, Canada. (Glyceraldehyde 3

et al.

BioImpacts, 2011, 1(2),

transcription (STAT) pathways . 2008; Camp



by potentvia gap junction

pathogenesis(C34H50O7) [3

29-oic acid] (Fig. 1) as communication, inhibits cell growthtypes of

of Glycyrrhizin and demonstrates a superficial resemblance to steroid

This drug in cells

However, there are some controversialgap junction

et al. 2009)determine the impacts of CBX on MCF7and BT20 human breast cancer cells in the view of

particularly

1. The structure of carbenoxolone (CBX)

Materials and methods

and BT20 human breast cancer cell lines, Cell culture plates and flasks were obtained from National cell bank of Iran (Pasteur institute, Iran) and IWAKI, Japan respectively. RPMI1640 medium,

EDTA (0.05%Dithiotheritol (DTT), first strand reverse transcriptase (RT) buffer, Moloney murine leukemia virus reversetranscriptase (MMLVSigma Aldrich Co., (Poole, UK). Agarose and Fetal bovine serum (FBS) were bought from Gibco, Invitrogen (Paisley, UK). Ribonuclease inhibitor was obtained fromFermentas, Canada. (Glyceraldehyde 3

, 2011, 1(2),

transcription (STAT) pathways . 2008; Camp et al



potentvia gap junction

pathogenesis(C34H50O7) [3-

oic acid] (Fig. 1) as communication, inhibits cell growthtypes of cancer

Glycyrrhizin and demonstrates a superficial resemblance to steroid

This drug (Ye, Z. C.,

However, there are some controversialgap junction

. 2009)determine the impacts of CBX on MCF7and BT20 human breast cancer cells in the view of

particularly

The structure of carbenoxolone (CBX)

methods


EDTA (0.05%Dithiotheritol (DTT), first strand reverse transcriptase (RT) buffer, Moloney murine leukemia virus reversetranscriptase (MMLVSigma Aldrich Co., (Poole, UK). Agarose and Fetal bovine serum (FBS) were bought from Gibco, Invitrogen (Paisley, UK). Ribonuclease inhibitor was obtained fromFermentas, Canada. (Glyceraldehyde 3-phosphate dehydrogenase)

, 2011, 1(2),

transcription (STAT) pathways et al

which mainly undergoes to cell proliferation, adhesion and migration (involvement in the metastasis, angiogenesis and apoptosis inhibition (Gialeli


potent small moleculesvia gap junction

pathogenesis of cancer-(3-carboxy

oic acid] (Fig. 1) as communication blocker , inhibits cell growth

cancerGlycyrrhizin

and demonstrates a superficial resemblance to steroid This drug is often used as a gap junction

Ye, Z. C., However, there are some controversialgap junction role in

. 2009). determine the impacts of CBX on MCF7and BT20 human breast cancer cells in the view of

particularly at mRNA


methods


EDTA (0.05%Dithiotheritol (DTT), first strand reverse transcriptase (RT) buffer, Moloney murine leukemia virus reversetranscriptase (MMLV-rt, 200U/Sigma Aldrich Co., (Poole, UK). Agarose and Fetal bovine serum (FBS) were bought from Gibco, Invitrogen (Paisley, UK). Ribonuclease inhibitor was obtained fromFermentas, Canada.

phosphate dehydrogenase)

, 2011, 1(2), 113

transcription (STAT) pathways et al. 2005;

which mainly undergoes to cell proliferation, (Agelaki

involvement in the metastasis, angiogenesis and Gialeli


small moleculesvia gap junction

of cancercarboxy

oic acid] (Fig. 1) as blocker

, inhibits cell growthcancer.

Glycyrrhizin obtained from Licorice root and demonstrates a superficial resemblance to steroid

is often used as a gap junction Ye, Z. C.,

However, there are some controversialrole in. This study was designed to

determine the impacts of CBX on MCF7and BT20 human breast cancer cells in the view of

at mRNA



EDTA (0.05%Dithiotheritol (DTT), first strand reverse transcriptase (RT) buffer, Moloney murine leukemia virus reverse

rt, 200U/Sigma Aldrich Co., (Poole, UK). Agarose and Fetal bovine serum (FBS) were bought from Gibco, Invitrogen (Paisley, UK). Ribonuclease inhibitor was obtained fromFermentas, Canada. STAT1,

phosphate dehydrogenase)

113-119

transcription (STAT) pathways 2005;

which mainly undergoes to cell proliferation, Agelaki

involvement in the metastasis, angiogenesis and Gialeli et al


small moleculesvia gap junctions

of cancercarboxy

oic acid] (Fig. 1) as blocker

, inhibits cell growth and CBX is a semiobtained from Licorice root

and demonstrates a superficial resemblance to steroid is often used as a gap junction

Ye, Z. C., et alHowever, there are some controversial

role in This study was designed to


at mRNA



EDTA (0.05%–0.02%), TriDithiotheritol (DTT), first strand reverse transcriptase (RT) buffer, Moloney murine leukemia virus reverse

rt, 200U/Sigma Aldrich Co., (Poole, UK). Agarose and Fetal bovine serum (FBS) were bought from Gibco, Invitrogen (Paisley, UK). Ribonuclease inhibitor was obtained from

STAT1, phosphate dehydrogenase)

119

transcription (STAT) pathways (Loew 2005; Mamot and Rochlitz.

which mainly undergoes to cell proliferation, Agelaki et al

involvement in the metastasis, angiogenesis and et al


small molecules and could

of cancer (Ncarboxy-1-

oic acid] (Fig. 1) as blocker which mediated

and CBX is a semi

obtained from Licorice root and demonstrates a superficial resemblance to steroid

is often used as a gap junction et al

However, there are some controversial carcinogenesis

This study was designed to determine the impacts of CBX on MCF7and BT20 human breast cancer cells in the view of

at mRNA transcriptomics level.



0.02%), TriDithiotheritol (DTT), first strand reverse transcriptase (RT) buffer, Moloney murine leukemia virus reverse

rt, 200U/l) Sigma Aldrich Co., (Poole, UK). Agarose and Fetal bovine serum (FBS) were bought from Gibco, Invitrogen (Paisley, UK). Ribonuclease inhibitor was obtained from

STAT1, phosphate dehydrogenase)

Loew Mamot and Rochlitz.

which mainly undergoes to cell proliferation, et al. 2009

involvement in the metastasis, angiogenesis and et al. 2009; Camp


small moleculesand could(Nicholson 2003)

-oxopropoxy)oic acid] (Fig. 1) as

which mediated induces apoptosis

CBX is a semiobtained from Licorice root


et al. 2003However, there are some controversial

carcinogenesisThis study was designed to


transcriptomics level.




l) wasSigma Aldrich Co., (Poole, UK). Agarose and Fetal bovine serum (FBS) were bought from Gibco, Invitrogen (Paisley, UK). Ribonuclease inhibitor was obtained from

STAT1, AKT1, GAPDH phosphate dehydrogenase)

Loew et alMamot and Rochlitz.

which mainly undergoes to cell proliferation, . 2009

involvement in the metastasis, angiogenesis and . 2009; Camp


small molecules which may be and could

icholson 2003)oxopropoxy)

oic acid] (Fig. 1) as prototypic which mediated

induces apoptosis CBX is a semi


is often used as a gap junction 2003

However, there are some controversialcarcinogenesis

This study was designed to determine the impacts of CBX on MCF7and BT20 human breast cancer cells in the view of cell growth and





was purchased from Sigma Aldrich Co., (Poole, UK). Agarose and Fetal bovine serum (FBS) were bought from Gibco, Invitrogen (Paisley, UK). Ribonuclease inhibitor was obtained from

AKT1, GAPDH phosphate dehydrogenase)

et al. 2009; Mamot and Rochlitz.

which mainly undergoes to cell proliferation, . 2009)



which may be and could prevent or

icholson 2003)oxopropoxy)

prototypic which mediated

induces apoptosis CBX is a semi


is often used as a gap junction 2003; Li, J.,

However, there are some controversialcarcinogenesis

This study was designed to determine the impacts of CBX on MCF7and BT20

cell growth and transcriptomics level.




purchased from Sigma Aldrich Co., (Poole, UK). Agarose and Fetal bovine serum (FBS) were bought from Gibco, Invitrogen (Paisley, UK). Ribonuclease inhibitor was obtained from

AKT1, GAPDH phosphate dehydrogenase)

2009; Mamot and Rochlitz.

which mainly undergoes to cell proliferation, ) as well as



which may be prevent or

icholson 2003)oxopropoxy)-11

prototypic which mediated via Gap

induces apoptosis CBX is a semi-synthetic


is often used as a gap junction Li, J.,

However, there are some controversialcarcinogenesis(Cronier,



The structure of carbenoxolone (CBX).


0.02%), Tri-ReagDithiotheritol (DTT), first strand reverse transcriptase (RT) buffer, Moloney murine leukemia virus reverse


AKT1, GAPDH phosphate dehydrogenase), TP53,

2009; Afaq Mamot and Rochlitz.

which mainly undergoes to cell proliferation, as well as

involvement in the metastasis, angiogenesis and . 2009; Camp et al



icholson 2003). CBX 11-oxo

prototypic intervia Gap

induces apoptosis synthetic


is often used as a gap junction Li, J., et al

However, there are some controversial issues (Cronier,




ReagDithiotheritol (DTT), first strand reverse transcriptase (RT) buffer, Moloney murine leukemia virus reverse


AKT1, GAPDH , TP53,

Afaq Mamot and Rochlitz.


involvement in the metastasis, angiogenesis and et al.

n regards to these miscellaneous biomolecules, it is believed that EGFR signal transduction could be


CBX oxo-

inter-via Gap

induces apoptosis in synthetic


is often used as a gap junction et al. issues

(Cronier, This study was designed to

determine the impacts of CBX on MCF7and BT20 cell growth and



Reagent, Dithiotheritol (DTT), first strand reverse transcriptase (RT) buffer, Moloney murine leukemia virus reverse-


AKT1, GAPDH , TP53,

Afaq Mamot and Rochlitz.


involvement in the metastasis, angiogenesis and . ,

it is believed that EGFR signal transduction could be which may be

prevent or CBX

--

via Gap in

synthetic obtained from Licorice root


. issues

(Cronier, This study was designed to

determine the impacts of CBX on MCF7and BT20 cell growth and


ent, Dithiotheritol (DTT), first strand reverse transcriptase

-purchased from

Sigma Aldrich Co., (Poole, UK). Agarose and Fetal bovine serum (FBS) were bought from Gibco, Invitrogen (Paisley, UK). Ribonuclease inhibitor was obtained from

AKT1, GAPDH , TP53,

BCL2 (BForward and reverse oligonucleotide primers were provided from MWGThe Applied pyrocaPenicillIran). Taq DNA polymerase, polymerase chain reaction (PCR) reaction buffer, Random hexamer primers (pdN6), deoxynucleotide triphosphate monomers (dNTPs) and M(Crawley, UK). Carbenoxolone was obtained from Sigma Aldrich Co., (Poole, UK). All other chemicals not mentioned above were in the highest quality available.

Cell cultureThe MCF7and BT20 human breast cancer seededcells/cm2. These cells were saved in a humidified incubator (95% air and 5% CO2) at 37media consistFBS, penicillin G (200 U/ml) and streptomycin (200 concentrations 600lay open to expression profiling using real time RT

Cell The culturedat 40the 96CBX24 andgroup were washed once with phosphate buffered saline (PBS) and culture medium was replaced with 150 fresh media and then 50 PBS) was added to each well. After a 4 hr incubation with MTT at 37were exposed to 200 buffer (0.1 M glycine, 0.1 M NaCl, pH 10.5). The cultures were incubated for 30 min at 37crystals dissolvingmeasured at 570 nmreader, ELx 800 (Biotek, CA, USA).exclusion test was performed assessment of CBX. Briefly, cells were counted based onthe hemocytometedeath cell numbers. were conducted for morphological assessments using Olympus invert microscope Olympus DP20 camera and (Olympus optical Co.,

BCL2 (BForward and reverse oligonucleotide primers were provided from MWGThe SYBR Green PCR Master Mix Applied pyrocaPenicillIran). Taq DNA polymerase, polymerase chain reaction (PCR) reaction buffer, Random hexamer primers (pdN6), deoxynucleotide triphosphate monomers (dNTPs) and M(Crawley, UK). Carbenoxolone was obtained from Sigma Aldrich Co., (Poole, UK). All other chemicals not mentioned above were in the highest quality available.

Cell cultureThe MCF7and BT20 human breast cancer seededcells/cm2. These cells were saved in a humidified incubator (95% air and 5% CO2) at 37media consistFBS, penicillin G (200 U/ml) and streptomycin (200 g/ml). CBX was solved in RPMI 1640 media at concentrations 600lay open to expression profiling using real time RT

Cell vThe culturedat 40the 96CBX24 andgroup were washed once with phosphate buffered saline (PBS) and culture medium was replaced with 150 fresh media and then 50 PBS) was added to each well. After a 4 hr incubation with MTT at 37were exposed to 200 buffer (0.1 M glycine, 0.1 M NaCl, pH 10.5). The cultures were incubated for 30 min at 37crystals dissolvingmeasured at 570 nmreader, ELx 800 (Biotek, CA, USA).exclusion test was performed assessment of CBX. Briefly, cells were counted based onthe abilityhemocytometedeath cell numbers. were conducted for morphological assessments using Olympus invert microscope Olympus DP20 camera and (Olympus optical Co.,

BCL2 (BForward and reverse oligonucleotide primers were provided from MWG

SYBR Green PCR Master Mix Applied pyrocarbonate (DEPC) treated Penicillin G Iran). Taq DNA polymerase, polymerase chain reaction (PCR) reaction buffer, Random hexamer primers (pdN6), deoxynucleotide triphosphate monomers (dNTPs) and M(Crawley, UK). Carbenoxolone was obtained from Sigma Aldrich Co., (Poole, UK). All other chemicals not mentioned above were in the highest quality available.

Cell cultureThe MCF7and BT20 human breast cancer seeded cells/cm2. These cells were saved in a humidified incubator (95% air and 5% CO2) at 37media consistFBS, penicillin G (200 U/ml) and streptomycin (200

g/ml). CBX was solved in RPMI 1640 media at concentrations

M and finally 1000lay open to expression profiling using real time RT

viability The culturedat 40–50% confluency were subjected to MTT assay in the 96-well plates. The CBX concentrations24 and 48 hours at 37group were washed once with phosphate buffered saline (PBS) and culture medium was replaced with 150 fresh media and then 50 PBS) was added to each well. After a 4 hr incubation with MTT at 37were exposed to 200 buffer (0.1 M glycine, 0.1 M NaCl, pH 10.5). The cultures were incubated for 30 min at 37crystals dissolvingmeasured at 570 nmreader, ELx 800 (Biotek, CA, USA).exclusion test was performed assessment of CBX. Briefly, cells were counted based on

abilityhemocytometedeath cell numbers. were conducted for morphological assessments using Olympus invert microscope Olympus DP20 camera and (Olympus optical Co.,

Copyright © 2011 by Tabriz University of Medical Sciences

BCL2 (B-cell lymphoma 2)Forward and reverse oligonucleotide primers were provided from MWG

SYBR Green PCR Master Mix Applied Biosystems, Foster City, USA.

rbonate (DEPC) treated in G

Iran). Taq DNA polymerase, polymerase chain reaction (PCR) reaction buffer, Random hexamer primers (pdN6), deoxynucleotide triphosphate monomers (dNTPs) and M(Crawley, UK). Carbenoxolone was obtained from Sigma Aldrich Co., (Poole, UK). All other chemicals not mentioned above were in the highest quality available.

Cell cultureThe MCF7and BT20 human breast cancer

on 6cells/cm2. These cells were saved in a humidified incubator (95% air and 5% CO2) at 37media consistFBS, penicillin G (200 U/ml) and streptomycin (200


M and finally 1000lay open to expression profiling using real time RT

iability The cultured

50% confluency were subjected to MTT assay in well plates. The

concentrations48 hours at 37

group were washed once with phosphate buffered saline (PBS) and culture medium was replaced with 150 fresh media and then 50 PBS) was added to each well. After a 4 hr incubation with MTT at 37were exposed to 200 buffer (0.1 M glycine, 0.1 M NaCl, pH 10.5). The cultures were incubated for 30 min at 37crystals dissolvingmeasured at 570 nmreader, ELx 800 (Biotek, CA, USA).exclusion test was performed assessment of CBX. Briefly, cells were counted based on

ability of cells to exclude trypan blue dye using a hemocytometedeath cell numbers. were conducted for morphological assessments using Olympus invert microscope Olympus DP20 camera and (Olympus optical Co.,


cell lymphoma 2)Forward and reverse oligonucleotide primers were provided from MWG

SYBR Green PCR Master Mix Biosystems, Foster City, USA.

rbonate (DEPC) treated in G were obtained

Iran). Taq DNA polymerase, polymerase chain reaction (PCR) reaction buffer, Random hexamer primers (pdN6), deoxynucleotide triphosphate monomers (dNTPs) and M(Crawley, UK). Carbenoxolone was obtained from Sigma Aldrich Co., (Poole, UK). All other chemicals not mentioned above were in the highest quality available.

Cell culture The MCF7and BT20 human breast cancer

on 6-well plates at a density of 4cells/cm2. These cells were saved in a humidified incubator (95% air and 5% CO2) at 37media consistedFBS, penicillin G (200 U/ml) and streptomycin (200


M and finally 1000lay open to viability examinations as well as gene expression profiling using real time RT

iability assesThe cultured MCF7and BT20 human breast cancer



group were washed once with phosphate buffered saline (PBS) and culture medium was replaced with 150 fresh media and then 50 PBS) was added to each well. After a 4 hr incubation with MTT at 37were exposed to 200 buffer (0.1 M glycine, 0.1 M NaCl, pH 10.5). The cultures were incubated for 30 min at 37crystals dissolvingmeasured at 570 nmreader, ELx 800 (Biotek, CA, USA).exclusion test was performed assessment of CBX. Briefly, cells were counted based on

of cells to exclude trypan blue dye using a hemocytometer for obtaining vital cell numbers versus death cell numbers. were conducted for morphological assessments using Olympus invert microscope Olympus DP20 camera and (Olympus optical Co.,


cell lymphoma 2)Forward and reverse oligonucleotide primers were provided from MWG


rbonate (DEPC) treated were obtained

Iran). Taq DNA polymerase, polymerase chain reaction (PCR) reaction buffer, Random hexamer primers (pdN6), deoxynucleotide triphosphate monomers (dNTPs) and MgCl2 were(Crawley, UK). Carbenoxolone was obtained from Sigma Aldrich Co., (Poole, UK). All other chemicals not mentioned above were in the highest quality available.

The MCF7and BT20 human breast cancer well plates at a density of 4

cells/cm2. These cells were saved in a humidified incubator (95% air and 5% CO2) at 37

ed of RPMI 1640 complemented with 10% FBS, penicillin G (200 U/ml) and streptomycin (200

g/ml). CBX was solved in RPMI 1640 media at concentrations of 50

M and finally 1000viability examinations as well as gene

expression profiling using real time RT

ssessment MCF7and BT20 human breast cancer



group were washed once with phosphate buffered saline (PBS) and culture medium was replaced with 150 fresh media and then 50 PBS) was added to each well. After a 4 hr incubation with MTT at 37˚C, medium was removed and the cells were exposed to 200 buffer (0.1 M glycine, 0.1 M NaCl, pH 10.5). The cultures were incubated for 30 min at 37crystals dissolvingmeasured at 570 nmreader, ELx 800 (Biotek, CA, USA).exclusion test was performed assessment of CBX. Briefly, cells were counted based on

of cells to exclude trypan blue dye using a r for obtaining vital cell numbers versus

death cell numbers. were conducted for morphological assessments using Olympus invert microscope Olympus DP20 camera and (Olympus optical Co.,


cell lymphoma 2)Forward and reverse oligonucleotide primers were provided from MWG-


rbonate (DEPC) treated were obtained

Iran). Taq DNA polymerase, polymerase chain reaction (PCR) reaction buffer, Random hexamer primers (pdN6), deoxynucleotide triphosphate monomers

gCl2 were(Crawley, UK). Carbenoxolone was obtained from Sigma Aldrich Co., (Poole, UK). All other chemicals not mentioned above were in the highest quality available.



of RPMI 1640 complemented with 10% FBS, penicillin G (200 U/ml) and streptomycin (200

g/ml). CBX was solved in RPMI 1640 media at of 50



sment MCF7and BT20 human breast cancer


concentrations and 48 hours at 37

group were washed once with phosphate buffered saline (PBS) and culture medium was replaced with 150 fresh media and then 50 PBS) was added to each well. After a 4 hr incubation

C, medium was removed and the cells were exposed to 200 buffer (0.1 M glycine, 0.1 M NaCl, pH 10.5). The cultures were incubated for 30 min at 37crystals dissolving and then UV absorbance was measured at 570 nm reader, ELx 800 (Biotek, CA, USA).exclusion test was performed assessment of CBX. Briefly, cells were counted based on


death cell numbers. were conducted for morphological assessments using Olympus invert microscope Olympus DP20 camera and (Olympus optical Co.,


cell lymphoma 2)Forward and reverse oligonucleotide primers were

-Europhin, (Ebersberg, Germany).SYBR Green PCR Master Mix

Biosystems, Foster City, USA. rbonate (DEPC) treated

were obtained Iran). Taq DNA polymerase, polymerase chain reaction (PCR) reaction buffer, Random hexamer primers (pdN6), deoxynucleotide triphosphate monomers

gCl2 were(Crawley, UK). Carbenoxolone was obtained from Sigma Aldrich Co., (Poole, UK). All other chemicals not mentioned above were in the highest quality available.




g/ml). CBX was solved in RPMI 1640 media at of 50M, 100



sment MCF7and BT20 human breast cancer

50% confluency were subjected to MTT assay in well plates. The cells were treated with a range of

and each group were 48 hours at 37˚C. After which, the cells of each

group were washed once with phosphate buffered saline (PBS) and culture medium was replaced with 150 fresh media and then 50 PBS) was added to each well. After a 4 hr incubation

C, medium was removed and the cells l DMSO and

buffer (0.1 M glycine, 0.1 M NaCl, pH 10.5). The cultures were incubated for 30 min at 37

and then UV absorbance was using a spectrophotometric plate

reader, ELx 800 (Biotek, CA, USA).exclusion test was performed assessment of CBX. Briefly, cells were counted based on


death cell numbers. Light microscopic examinations were conducted for morphological assessments using Olympus invert microscope Olympus DP20 camera and (Olympus optical Co., Ltd., Tokyo, Japan)


cell lymphoma 2) andForward and reverse oligonucleotide primers were

Europhin, (Ebersberg, Germany).SYBR Green PCR Master Mix

Biosystems, Foster City, USA. rbonate (DEPC) treated

were obtained Iran). Taq DNA polymerase, polymerase chain reaction (PCR) reaction buffer, Random hexamer primers (pdN6), deoxynucleotide triphosphate monomers

gCl2 were (Crawley, UK). Carbenoxolone was obtained from Sigma Aldrich Co., (Poole, UK). All other chemicals not mentioned above were in the highest quality available.




g/ml). CBX was solved in RPMI 1640 media at M, 100M (1Mm)

viability examinations as well as gene expression profiling using real time RT

MCF7and BT20 human breast cancer

50% confluency were subjected to MTT assay in cells were treated with a range of

each group were . After which, the cells of each

group were washed once with phosphate buffered saline (PBS) and culture medium was replaced with 150 fresh media and then 50 l MTT reagent (2 mg/ml in PBS) was added to each well. After a 4 hr incubation






Light microscopic examinations were conducted for morphological assessments using Olympus invert microscope Olympus DP20 camera and

Ltd., Tokyo, Japan)


and Forward and reverse oligonucleotide primers were


Biosystems, Foster City, USA. rbonate (DEPC) treated water; streptomycin and

were obtained from Iran). Taq DNA polymerase, polymerase chain reaction (PCR) reaction buffer, Random hexamer primers (pdN6), deoxynucleotide triphosphate monomers

obtained(Crawley, UK). Carbenoxolone was obtained from Sigma Aldrich Co., (Poole, UK). All other chemicals not mentioned above were in the highest quality available.




g/ml). CBX was solved in RPMI 1640 media at M, 100

M (1Mm) viability examinations as well as gene


MCF7and BT20 human breast cancer 50% confluency were subjected to MTT assay in

cells were treated with a range of each group were

. After which, the cells of each group were washed once with phosphate buffered saline (PBS) and culture medium was replaced with 150

l MTT reagent (2 mg/ml in PBS) was added to each well. After a 4 hr incubation






Light microscopic examinations were conducted for morphological assessments using Olympus invert microscope CKX41 equipped with Olympus DP20 camera and

Ltd., Tokyo, Japan)


CYCS (Cytochrome c)Forward and reverse oligonucleotide primers were


Biosystems, Foster City, USA. water; streptomycin and

from CinnaGen, (Tehran, Iran). Taq DNA polymerase, polymerase chain reaction (PCR) reaction buffer, Random hexamer primers (pdN6), deoxynucleotide triphosphate monomers

obtained(Crawley, UK). Carbenoxolone was obtained from Sigma Aldrich Co., (Poole, UK). All other chemicals not mentioned above were in the highest quality available.





M (1Mm) viability examinations as well as gene









reader, ELx 800 (Biotek, CA, USA).exclusion test was performed for growth inhibition assessment of CBX. Briefly, cells were counted based on


Light microscopic examinations were conducted for morphological assessments using

CKX41 equipped with Olympus DP20 camera and CellA 3.3 software

Ltd., Tokyo, Japan)



Europhin, (Ebersberg, Germany).SYBR Green PCR Master Mix was obtained from


CinnaGen, (Tehran, Iran). Taq DNA polymerase, polymerase chain reaction (PCR) reaction buffer, Random hexamer primers (pdN6), deoxynucleotide triphosphate monomers

obtained (Crawley, UK). Carbenoxolone was obtained from Sigma Aldrich Co., (Poole, UK). All other chemicals not mentioned above were in the highest quality available.





M (1Mm) and viability examinations as well as gene

expression profiling using real time RT-PCR.





C, medium was removed and the cells l DMSO and 25



reader, ELx 800 (Biotek, CA, USA).for growth inhibition

assessment of CBX. Briefly, cells were counted based onof cells to exclude trypan blue dye using a

r for obtaining vital cell numbers versus Light microscopic examinations

were conducted for morphological assessments using CKX41 equipped with

CellA 3.3 software Ltd., Tokyo, Japan)



Europhin, (Ebersberg, Germany).was obtained from



from QIAGEN (Crawley, UK). Carbenoxolone was obtained from Sigma Aldrich Co., (Poole, UK). All other chemicals not mentioned above were in the highest quality available.


cells/cm2. These cells were saved in a humidified incubator (95% air and 5% CO2) at 37˚C. Cell culture



and then viability examinations as well as gene

PCR.


cells were treated with a range of each group were incubated for



C, medium was removed and the cells 5 l of Sorenson

buffer (0.1 M glycine, 0.1 M NaCl, pH 10.5). The cultures were incubated for 30 min at 37˚C


reader, ELx 800 (Biotek, CA, USA). Trypan blue for growth inhibition




CellA 3.3 software Ltd., Tokyo, Japan).







The MCF7and BT20 human breast cancer cells were well plates at a density of 4

cells/cm2. These cells were saved in a humidified ˚C. Cell culture



then cells were viability examinations as well as gene

PCR.


cells were treated with a range of incubated for



C, medium was removed and the cells l of Sorenson

buffer (0.1 M glycine, 0.1 M NaCl, pH 10.5). The for formazan


Trypan blue for growth inhibition




CellA 3.3 software




Biosystems, Foster City, USA. Diethyl water; streptomycin and



cells were well plates at a density of 4.




cells were viability examinations as well as gene












CellA 3.3 software




Diethyl water; streptomycin and



cells were .0×10



g/ml). CBX was solved in RPMI 1640 media at M, 300M,


MCF7and BT20 human breast cancer cells 50% confluency were subjected to MTT assay in











CellA 3.3 software


CYCS (Cytochrome c) Forward and reverse oligonucleotide primers were

Europhin, (Ebersberg, Germany). was obtained from

Diethyl water; streptomycin and


from QIAGEN (Crawley, UK). Carbenoxolone was obtained from Sigma Aldrich Co., (Poole, UK). All other chemicals not

cells were 0×104



g/ml). CBX was solved in RPMI 1640 media at M,


cells 50% confluency were subjected to MTT assay in


. After which, the cells of each group were washed once with phosphate buffered saline (PBS) and culture medium was replaced with 150 l






assessment of CBX. Briefly, cells were counted based on of cells to exclude trypan blue dye using a



CellA 3.3 software

Gap junctions in cancer cells


Gene expression Cells were subjected to gene expression evaluation justat 150exposure TriReagent quality and respectively by electrophoresis and NanoDrop®Spectrophotometer (NanoWilmington, DE, published Gene Bank 5.01 http://www.premierbiosoft.com) and listed in Table 1.The reverse transcripti11 DTT, 2 g of RN(200 U) in a total volume of 20 program was: 95 and reverse transcriptase, and incubation at 25 min, 42 real time PCR examinations. PCR experiment was performed to assess the expression of selected key genes as mentioned above.All amplification reactions were performed in a total 25µl volume using the iQ5 Optical System (BioLaboratories I1 µl cDNA, 1 µl primer (100 nM each primer), 12.5 µl 2X Power SYBR Green PCR Master Mix and 10.5 µl RNAse/DNAse free water. Thermal cycling conditions were as follow95˚C Interpretation of the result was performed using the Pfaffle method and the CT values were normalized to the expression rate of (Pfaffl 2001and negative control included in each experimentas internal positive co

Data analyzingOne way ANOVA was performed for statistical analysis using SPSS version 18 following with



Gene expression Cells were subjected to gene expression evaluation justat 150exposure TriReagent quality and respectively by electrophoresis and NanoDrop®Spectrophotometer (NanoWilmington, DE, published Gene Bank 5.01 http://www.premierbiosoft.com) and listed in Table 1.The reverse transcripti11 l DEPC treated water, 4 DTT, 2

g of RN(200 U) in a total volume of 20 program was: 95 and reverse transcriptase, and incubation at 25 min, 42 real time PCR examinations. PCR experiment was performed to assess the expression of selected key genes as mentioned above.All amplification reactions were performed in a total 25µl volume using the iQ5 Optical System (BioLaboratories I1 µl cDNA, 1 µl primer (100 nM each primer), 12.5 µl 2X Power SYBR Green PCR Master Mix and 10.5 µl RNAse/DNAse free water. Thermal cycling conditions were as follow

˚C for 15 sec, 56Interpretation of the result was performed using the Pfaffle method and the CT values were normalized to the expression rate of Pfaffl 2001

and negative control included in each experimentas internal positive co




Gene expression Cells were subjected to gene expression evaluation just

M which exposure time of 24 hr andTriReagent quality and respectively by electrophoresis and NanoDrop®Spectrophotometer (NanoWilmington, DE, published Gene Bank 5.01 http://www.premierbiosoft.com) and listed in Table 1.The reverse transcripti

DEPC treated water, 4 DTT, 2 l

g of RNA, 0.5 (200 U) in a total volume of 20 program was: 95 and reverse transcriptase, and incubation at 25 min, 42 ˚C for 50 min and then they were real time PCR examinations. PCR experiment was performed to assess the expression of selected key genes as mentioned above.All amplification reactions were performed in a total 25µl volume using the iQ5 Optical System (BioLaboratories I1 µl cDNA, 1 µl primer (100 nM each primer), 12.5 µl 2X Power SYBR Green PCR Master Mix and 10.5 µl RNAse/DNAse free water. Thermal cycling conditions were as follow

for 15 sec, 56Interpretation of the result was performed using the Pfaffle method and the CT values were normalized to the expression rate of Pfaffl 2001





Gene expression Cells were subjected to gene expression evaluation just

M which time of 24 hr and

TriReagent accordingquality and quantity ofrespectively by electrophoresis and NanoDrop®Spectrophotometer (NanoWilmington, DE, published Gene Bank 5.01 (Premier Biosoft International, http://www.premierbiosoft.com) and listed in Table 1.The reverse transcripti

DEPC treated water, 4 dNTPs (10 mM), 0.5 A, 0.5

(200 U) in a total volume of 20 program was: 95 and reverse transcriptase, and incubation at 25

C for 50 min and then they were real time PCR examinations. PCR experiment was performed to assess the expression of selected key genes as mentioned above.All amplification reactions were performed in a total 25µl volume using the iQ5 Optical System (BioLaboratories I1 µl cDNA, 1 µl primer (100 nM each primer), 12.5 µl 2X Power SYBR Green PCR Master Mix and 10.5 µl RNAse/DNAse free water. Thermal cycling conditions were as follow

for 15 sec, 56Interpretation of the result was performed using the Pfaffle method and the CT values were normalized to the expression rate of Pfaffl 2001). All reactions were performed in triplicate





Gene expression analysisCells were subjected to gene expression evaluation just

M which time of 24 hr and

accordingquantity of

respectively by electrophoresis and NanoDrop®Spectrophotometer (NanoWilmington, DE, published Gene Bank

(Premier Biosoft International, http://www.premierbiosoft.com) and listed in Table 1.The reverse transcripti

DEPC treated water, 4 dNTPs (10 mM), 0.5

A, 0.5 (200 U) in a total volume of 20 program was: 95 ˚and reverse transcriptase, and incubation at 25

C for 50 min and then they were real time PCR examinations. PCR experiment was performed to assess the expression of selected key genes as mentioned above.All amplification reactions were performed in a total 25µl volume using the iQ5 Optical System (BioLaboratories Inc., Hercules, USA). Each well contained: 1 µl cDNA, 1 µl primer (100 nM each primer), 12.5 µl 2X Power SYBR Green PCR Master Mix and 10.5 µl RNAse/DNAse free water. Thermal cycling conditions were as follows: 1 cycle at 94

for 15 sec, 56Interpretation of the result was performed using the Pfaffle method and the CT values were normalized to the expression rate of

. All reactions were performed in triplicate and negative control included in each experimentas internal positive co

Data analyzing One way ANOVA was performed for statistical analysis using SPSS version 18 following with



analysisCells were subjected to gene expression evaluation just

M which was time of 24 hr and

accordingquantity of

respectively by electrophoresis and NanoDrop®Spectrophotometer (NanoWilmington, DE, USA). published Gene Bank

(Premier Biosoft International, http://www.premierbiosoft.com) and listed in Table 1.The reverse transcripti


l RNasin (40 U), and 1 (200 U) in a total volume of 20

˚C for 5 min before addition of RNasin and reverse transcriptase, and incubation at 25

C for 50 min and then they were real time PCR examinations. PCR experiment was performed to assess the expression of selected key genes as mentioned above. All amplification reactions were performed in a total 25µl volume using the iQ5 Optical System (Bio

nc., Hercules, USA). Each well contained: 1 µl cDNA, 1 µl primer (100 nM each primer), 12.5 µl 2X Power SYBR Green PCR Master Mix and 10.5 µl RNAse/DNAse free water. Thermal cycling conditions

: 1 cycle at 94for 15 sec, 56-62

Interpretation of the result was performed using the Pfaffle method and the CT values were normalized to the expression rate of GAPDH

. All reactions were performed in triplicate and negative control included in each experimentas internal positive co

One way ANOVA was performed for statistical analysis using SPSS version 18 following with

Gene name

GAPDH

BCL2

AKT1

CYCS

STAT5

TP53

F: Forward; R:



analysisCells were subjected to gene expression evaluation just

was obtained as IC50 of CBX time of 24 hr and

according to manufacturer guideline. quantity of the extracted RNA was measured

respectively by electrophoresis and NanoDrop®Spectrophotometer (Nano

USA). published Gene Bank sequences using Beacon Designer

(Premier Biosoft International, http://www.premierbiosoft.com) and listed in Table 1.The reverse transcription reaction was performed using


RNasin (40 U), and 1 (200 U) in a total volume of 20

C for 5 min before addition of RNasin and reverse transcriptase, and incubation at 25

C for 50 min and then they were real time PCR examinations. PCR experiment was performed to assess the expression of selected key genes

All amplification reactions were performed in a total 25µl volume using the iQ5 Optical System (Bio


: 1 cycle at 9462˚C for 30 sec, and 72˚C for 25 sec.

Interpretation of the result was performed using the Pfaffle method and the CT values were normalized to the

GAPDH. All reactions were performed in triplicate

and negative control included in each experimentas internal positive control


Table 1.

Gene name

GAPDH

BCL2

AKT1

CYCS

STAT5

TP53

orward; R:


analysis Cells were subjected to gene expression evaluation just

obtained as IC50 of CBX time of 24 hr and total RNA was isolated using

to manufacturer guideline. the extracted RNA was measured

respectively by electrophoresis and NanoDrop®Spectrophotometer (Nano

USA). Primers were designed from sequences using Beacon Designer

(Premier Biosoft International, http://www.premierbiosoft.com) and listed in Table 1.

on reaction was performed using DEPC treated water, 4

dNTPs (10 mM), 0.5 RNasin (40 U), and 1

(200 U) in a total volume of 20 C for 5 min before addition of RNasin

and reverse transcriptase, and incubation at 25 C for 50 min and then they were

real time PCR examinations. PCR experiment was performed to assess the expression of selected key genes



: 1 cycle at 94˚C for 30 sec, and 72˚C for 25 sec.


GAPDH. All reactions were performed in triplicate

and negative control included in each experimentntrol.


Table 1.

Gene name

orward; R:


Cells were subjected to gene expression evaluation justobtained as IC50 of CBX

total RNA was isolated using to manufacturer guideline. the extracted RNA was measured

respectively by electrophoresis and NanoDrop®Spectrophotometer (Nano-

Primers were designed from sequences using Beacon Designer


on reaction was performed using DEPC treated water, 4

dNTPs (10 mM), 0.5 RNasin (40 U), and 1






: 1 cycle at 94˚C for 10 min, 40 cycles at ˚C for 30 sec, and 72˚C for 25 sec.


GAPDH as a housekeeping gene. All reactions were performed in triplicate

and negative control included in each experiment


Table 1.

orward; R: Reverse




respectively by electrophoresis and NanoDrop® Dro



on reaction was performed using l MMLV buffered with

dNTPs (10 mM), 0.5 lRNasin (40 U), and 1






˚C for 10 min, 40 cycles at ˚C for 30 sec, and 72˚C for 25 sec.


as a housekeeping gene. All reactions were performed in triplicate



Table 1. Genes with corresponding primers which used for gene expression

Accession No.

NM_002046.3

NM_000633.2

NM_005163.2

NM_018947.4

NM_007315.3

NM_001126114

Reverse




respectively by electrophoresis and NanoDrop®Drop Technologies,



on reaction was performed using MMLV buffered with l pdN6 (400 ng/

RNasin (40 U), and 1 (200 U) in a total volume of 20 l

C for 5 min before addition of RNasin and reverse transcriptase, and incubation at 25

C for 50 min and then they were real time PCR examinations. PCR experiment was performed to assess the expression of selected key genes








Genes with corresponding primers which used for gene expression

Accession No.

NM_002046.3

NM_000633.2

NM_005163.2

NM_018947.4

NM_007315.3

NM_001126114

Reverse




respectively by electrophoresis and NanoDrop®p Technologies,



on reaction was performed using MMLV buffered with

pdN6 (400 ng/RNasin (40 U), and 1

l. Thermal cycler C for 5 min before addition of RNasin









One way ANOVA was performed for statistical analysis Tukey’s Post Hoc


Accession No.

NM_002046.3

NM_000633.2

NM_005163.2

NM_018947.4

NM_007315.3

NM_001126114








pdN6 (400 ng/RNasin (40 U), and 1 l

. Thermal cycler C for 5 min before addition of RNasin

and reverse transcriptase, and incubation at 25 C for 50 min and then they were subjected to










Accession No.

NM_002046.3

NM_000633.2

NM_005163.2

NM_018947.4

NM_007315.3

NM_001126114








pdN6 (400 ng/l MMLV


and reverse transcriptase, and incubation at 25 ˚C for 10 subjected to










Cells were subjected to gene expression evaluation justobtained as IC50 of CBX at the


respectively by electrophoresis and NanoDrop®1000 p Technologies,




pdN6 (400 ng/lMMLV


C for 10 subjected to


All amplification reactions were performed in a total 25µl volume using the iQ5 Optical System (Bio-Rad





as well



Sequence

F: 5’R: 5’F: 5’R: 5’F: 5’R: 5’F: 5’R: 5’F: 5’R: 5’F: 5’R: 5’

Cells were subjected to gene expression evaluation justat the

total RNA was isolated using to manufacturer guideline. The the extracted RNA was measured

1000 p Technologies,




l), 1 MMLV-rt


C for 10 subjected to


All amplification reactions were performed in a total Rad





as well



Sequence

5’-AAGCTCATTTCCTGGTATGACAACGR: 5’-TCTTCCTCTTGTGCTCTTGCTGG

5’-CATCAGGAAGGCTAGAGTTACCR: 5’-CAGACATTCGGAGACCACACF: 5’- CGCAGTGCCAGCTGATR: 5’- GTCCATCTCCTCCTCCTCCTG F: 5’- ACCTTCCATCTTGGCTAGTTGTGR: 5’- ATCGCTTGAGCCTGGGAAATAGF: 5’- TCATCAGCAAGGAGCGAGAGR: 5’- TCAGGGAAAGTAACAGCAGAAAGF: 5’-TCAACAAGATGTTTTGCCAACTGR: 5’-ATGTGCTGTGA

Cells were subjected to gene expression evaluation just at the

total RNA was isolated using The

the extracted RNA was measured 1000

p Technologies, Primers were designed from

sequences using Beacon Designer (Premier Biosoft International,

http://www.premierbiosoft.com) and listed in Table 1. on reaction was performed using

MMLV buffered with ), 1

rt . Thermal cycler

C for 5 min before addition of RNasin C for 10

subjected to real time PCR examinations. PCR experiment was performed to assess the expression of selected key genes

All amplification reactions were performed in a total Rad




as a housekeeping gene . All reactions were performed in triplicate

as well



Sequence

AAGCTCATTTCCTGGTATGACAACGTCTTCCTCTTGTGCTCTTGCTGGCATCAGGAAGGCTAGAGTTACCCAGACATTCGGAGACCACACCGCAGTGCCAGCTGATGTCCATCTCCTCCTCCTCCTG ACCTTCCATCTTGGCTAGTTGTGATCGCTTGAGCCTGGGAAATAGTCATCAGCAAGGAGCGAGAGTCAGGGAAAGTAACAGCAGAAAG

TCAACAAGATGTTTTGCCAACTGATGTGCTGTGA



TCAACAAGATGTTTTGCCAACTGATGTGCTGTGA

Teststatistical differences representation.Trypan blue exclusion testsfive independent evaluationtriplicate

Results

Cytotoxicity assessmentTrypan blue exclusion test and MTT assay were conducted to evaluate the cytotoxicity of carbenoxolone in MCF7and BT20 human breast cancer cells. As shown in Fig.dose dependent manner

Fig. BT20 cells(50well as for 24 h (number of viable cellstest. Growth inhibition in each treatment was expressed as a percentage of the control. Each value represents the meanof at least five



TCAACAAGATGTTTTGCCAACTGATGTGCTGTGACTGCTTGTAGATG

Test. A statistical differences representation.Trypan blue exclusion testsfive independent evaluationtriplicate

Results

Cytotoxicity assessmentTrypan blue exclusion test and MTT assay were conducted to evaluate the cytotoxicity of carbenoxolone in MCF7and BT20 human breast cancer cells. As shown in Fig.dose dependent manner

Fig. 2BT20 cells(50-1000µM) for 24 h (well as for 24 h (number of viable cellstest. Growth inhibition in each treatment was expressed as a percentage of the control. Each value represents the meanof at least five



TCAACAAGATGTTTTGCCAACTGCTGCTTGTAGATG

. A statistical differences representation.Trypan blue exclusion testsfive independent evaluationtriplicate

Results

Cytotoxicity assessmentTrypan blue exclusion test and MTT assay were conducted to evaluate the cytotoxicity of carbenoxolone in MCF7and BT20 human breast cancer cells. As shown in Fig. 2dose dependent manner

2. The BT20 cells

1000µM) for 24 h (well as for 24 h (number of viable cellstest. Growth inhibition in each treatment was expressed as a percentage of the control. Each value represents the meanof at least five


AAGCTCATTTCCTGGTATGACAACGTCTTCCTCTTGTGCTCTTGCTGGCATCAGGAAGGCTAGAGTTACCCAGACATTCGGAGACCACACCGCAGTGCCAGCTGATGAAG GTCCATCTCCTCCTCCTCCTG ACCTTCCATCTTGGCTAGTTGTGATCGCTTGAGCCTGGGAAATAGTCATCAGCAAGGAGCGAGAGTCAGGGAAAGTAACAGCAGAAAG


. A pstatistical differences representation.Trypan blue exclusion testsfive independent evaluation triplicate manner.

Cytotoxicity assessmentTrypan blue exclusion test and MTT assay were conducted to evaluate the cytotoxicity of carbenoxolone in MCF7and BT20 human breast cancer cells. As shown

2, CBX treated cells led to dose dependent manner

The Effects of CBX on growth inhibition of MCF7 and BT20 cells. Cells were exposed to the indicated concentration

1000µM) for 24 h (well as for 24 h (number of viable cellstest. Growth inhibition in each treatment was expressed as a percentage of the control. Each value represents the meanof at least five


AAGCTCATTTCCTGGTATGACAACGTCTTCCTCTTGTGCTCTTGCTGGCATCAGGAAGGCTAGAGTTACCCAGACATTCGGAGACCACAC-3’

GAAG GTCCATCTCCTCCTCCTCCTG -ACCTTCCATCTTGGCTAGTTGTGATCGCTTGAGCCTGGGAAATAGTCATCAGCAAGGAGCGAGAG-TCAGGGAAAGTAACAGCAGAAAG


p valuestatistical differences representation.Trypan blue exclusion testsfive independent

using real time RTmanner.


, CBX treated cells led to dose dependent manner

Effects of CBX on growth inhibition of MCF7 and Cells were exposed to the indicated concentration

1000µM) for 24 h (well as for 24 h (number of viable cellstest. Growth inhibition in each treatment was expressed as a percentage of the control. Each value represents the meanof at least five independent experiments


AAGCTCATTTCCTGGTATGACAACGTCTTCCTCTTGTGCTCTTGCTGG-3’ CATCAGGAAGGCTAGAGTTACC-3’

3’ GAAG -3’

-3’ ACCTTCCATCTTGGCTAGTTGTG-3’ATCGCTTGAGCCTGGGAAATAG-3’

-3’ TCAGGGAAAGTAACAGCAGAAAG

TCAACAAGATGTTTTGCCAACTG-3’CTGCTTGTAGATG-

valuestatistical differences representation.Trypan blue exclusion testsfive independent

using real time RTmanner.




1000µM) for 24 h (well as for 24 h (▲) and 48 number of viable cellstest. Growth inhibition in each treatment was expressed as a percentage of the control. Each value represents the mean

independent experiments


AAGCTCATTTCCTGGTATGACAACG-3’

3’ 3’

TCAGGGAAAGTAACAGCAGAAAG-3’ 3’

-3’

BioImpacts

value less than 0.05 was considered to statistical differences representation.Trypan blue exclusion testsfive independent experiments

using real time RT




1000µM) for 24 h (♦) and 48 ▲) and 48

number of viable cells was determined by Trypan blue exclusion test. Growth inhibition in each treatment was expressed as a percentage of the control. Each value represents the mean



ioImpacts

less than 0.05 was considered to statistical differences representation.Trypan blue exclusion tests

experimentsusing real time RT

Cytotoxicity assessment Trypan blue exclusion test and MTT assay were conducted to evaluate the cytotoxicity of carbenoxolone in MCF7and BT20 human breast cancer cells. As shown

, CBX treated cells led to dose dependent manner (p < 0.05)


♦) and 48 ▲) and 48

was determined by Trypan blue exclusion test. Growth inhibition in each treatment was expressed as a percentage of the control. Each value represents the mean


Genes with corresponding primers which used for gene expression analysis

Product length

ioImpacts

less than 0.05 was considered to statistical differences representation.Trypan blue exclusion tests were performed in

experimentsusing real time RT

Trypan blue exclusion test and MTT assay were conducted to evaluate the cytotoxicity of carbenoxolone in MCF7and BT20 human breast cancer cells. As shown

, CBX treated cells led to (p < 0.05)


♦) and 48 ▲) and 48 h (



analysis

Product length

126

181

185

129

196

118

ioImpacts, 2011, 1(2),

less than 0.05 was considered to statistical differences representation.

were performed in experiments

using real time RT


, CBX treated cells led to (p < 0.05)


♦) and 48 h (□) in the case of MCF7 as h (■) in the case of BT20. The



analysis

Product length

126

181

185

129

196

118

, 2011, 1(2),

less than 0.05 was considered to statistical differences representation.

were performed in and gene expression

using real time RT-PCR performed


, CBX treated cells led to growth inhibition in (p < 0.05).


□) in the case of MCF7 as ■) in the case of BT20. The


independent experiments.

Product length

, 2011, 1(2),

less than 0.05 was considered to statistical differences representation. MTT assays a


PCR performed


growth inhibition in




Product length

, 2011, 1(2), 113-

less than 0.05 was considered to MTT assays a


PCR performed






-119



PCR performed







were performed in at least and gene expression

PCR performed






| 115


at least and gene expression

PCR performed





was determined by Trypan blue exclusion test. Growth inhibition in each treatment was expressed as a percentage of the control. Each value represents the mean ± SE

115

less than 0.05 was considered to MTT assays and

at least and gene expression

in





was determined by Trypan blue exclusion test. Growth inhibition in each treatment was expressed as a

SE

Asadi-Khiavi et al.

116 | BioImpacts, 2011, 1(2), 113-119 Copyright © 2011 by Tabriz University of Medical Sciences

Fig. 3. Photomicrographs of MCF7 and BT20 cells were taken by a light microscope at a magnification of 40×. MCF7 and BT20 cells were treated by 150 µM of CBX. The death cells are shown by black arrows. Panel A represent untreated MCF7 cells versus CBX treated MCF7 cells in panels B and C at exposure times of 24h and 48h respectively. Panel D represent untreated BT20 cells versus CBX treated BT20 cells in panels E and F at exposure times of 24h and 48h respectively.

As it shows, the growth of treated BT20 cells was affected notably, but in the case of MCF7 cells, anti-proliferative effect of CBX was lower than previous cells. However, CBX also showed statistically significant cytotoxicity in the MCF cells. Additionally, the treated and untreated cells displayed distinct morphologic differences in normal and death cells number and appearance upon light microscopic examinations (Fig. 3). Regarding the obtained data from MTT experiment as a standard colorimetric cell viability assay, IC50 were calculated as 150 M in both

cells (Fig 4), which is relatively similar to obtained IC50 from data of growth inhibition evaluation via Trypan blue exclusion test in Fig. 2. In the view of statistics (mean ±SE of at least five independent experiments), reduction in number of cells was observed after treatment by 150 µM of CBX as same as reduction in total amount of extracted RNA in both cells (data not shown). Despite mild exacerbation in CBX mediated cytotoxicity in a time dependent manner, it was not statistically significant even at exposure time of 72 hr in both cell lines (data not shown).

A

B

C

D

E

F

MCF7 Cells BT20 Cells

24h 24h

48h 48h

Untreated cells Untreated cells



Fig. were exposed to 1000µM) at exposure time of 24 h (repeated in the case of BT20 for mentioned concentrations and exposure timesconcentration could significantlyformazan as reductive metabolite of MTT (3Dimethylthiazolcell linesindependent experiments.

Gene expression analyses MCF7 and BT20 cells were incubµM) for 24 h. Twhich mentioned above were detected by using real time PCR andusing the Pfafeach geneGAPDHperformed in triplicate and negative control included in each experimentGreen

We effect related genesgenesthe cell cycle is involved in cancer1999GAPDHrespective ratio of expressed gene overexpression was used to represent gene expression changesNormalization of our data to the expression rate of GAPDHdown regulationcells but candidate genes



Fig. 4. Rwere exposed to 1000µM) at exposure time of 24 h (repeated in the case of BT20 for mentioned concentrations and exposure timesconcentration could significantlyformazan as reductive metabolite of MTT (3Dimethylthiazolcell linesindependent experiments.

Gene expression analyses MCF7 and BT20 cells were incubµM) for 24 h. Twhich mentioned above were detected by using real time PCR andusing the Pfafeach geneGAPDHperformed in triplicate and negative control included in each experimentGreen emitted fluorescent

We performedeffect of carbenoxolone related genesgenes AKT1the cell cycle is involved in cancer1999). GAPDHrespective ratio of expressed gene overexpression was used to represent gene expression changesNormalization of our data to the expression rate of GAPDHdown regulationcells but candidate genes



Results of MTT assay for evaluation were exposed to 1000µM) at exposure time of 24 h (repeated in the case of BT20 for mentioned concentrations and exposure timesconcentration could significantlyformazan as reductive metabolite of MTT (3Dimethylthiazolcell lines. Each value represents the mean ±independent experiments.

Gene expression analyses MCF7 and BT20 cells were incubµM) for 24 h. Twhich mentioned above were detected by using real time PCR and using the Pfafeach gene GAPDH as a housekeeping geneperformed in triplicate and negative control included in each experiment

emitted fluorescent

performedof carbenoxolone

related genesAKT1

the cell cycle is involved in cancer

. The GAPDH expression isrespective ratio of expressed gene overexpression was used to represent gene expression changes and was demonstratedNormalization of our data to the expression rate of GAPDH as a housekeeping down regulationcells but there was not candidate genes



esults of MTT assay for evaluation were exposed to 1000µM) at exposure time of 24 h (repeated in the case of BT20 for mentioned concentrations and exposure times.concentration could significantlyformazan as reductive metabolite of MTT (3Dimethylthiazol-

Each value represents the mean ±independent experiments.

Gene expression analyses MCF7 and BT20 cells were incubµM) for 24 h. Twhich mentioned above were detected by using real time

Interpretation of the resultusing the Pfaf

were normalized to the expressionas a housekeeping gene

performed in triplicate and negative control included in each experiment

emitted fluorescent

performedof carbenoxolone

related genes BCL2AKT1and

the cell cycle control is involved in cancer

The mRNA expression is

respective ratio of expressed gene overexpression was used to represent gene expression

and was demonstratedNormalization of our data to the expression rate of

as a housekeeping down regulation

there was not candidate genes



esults of MTT assay for evaluation were exposed to 1000µM) at exposure time of 24 h (repeated in the case of BT20 for mentioned concentrations and

. As shown in concentration could significantlyformazan as reductive metabolite of MTT (3

-2-yl)Each value represents the mean ±


Gene expression analyses MCF7 and BT20 cells were incubµM) for 24 h. Thewhich mentioned above were detected by using real time

Interpretation of the resultusing the Pfaffle method and


performed in triplicate and negative control included in each experiment and then quantified as a view of

emitted fluorescent

performed a quantitative PCR approach to assess the of carbenoxolone

BCL2and STAT5

control is involved in cancer

mRNA expression is



as a housekeeping down regulation of

there was not candidate genes themselves



esults of MTT assay for evaluation were exposed to the indicated concentration of CBX (501000µM) at exposure time of 24 h (repeated in the case of BT20 for mentioned concentrations and

As shown in concentration could significantlyformazan as reductive metabolite of MTT (3

yl)-2, 5Each value represents the mean ±


Gene expression analyses MCF7 and BT20 cells were incub

hen expression levels of candidate genes which mentioned above were detected by using real time

Interpretation of the resultfle method and


performed in triplicate and negative control included in and then quantified as a view of

emitted fluorescent

a quantitative PCR approach to assess the of carbenoxolone

BCL2 andSTAT5

control is involved in cancer

mRNA expression is



as a housekeeping of all

there was not themselves



esults of MTT assay for evaluation the indicated concentration of CBX (50

1000µM) at exposure time of 24 h (repeated in the case of BT20 for mentioned concentrations and

As shown in concentration could significantlyformazan as reductive metabolite of MTT (3

, 5-diphenyltetrazolium bromide) in Each value represents the mean ±



expression levels of candidate genes which mentioned above were detected by using real time




emitted fluorescent

a quantitative PCR approach to assess the of carbenoxolone

and STAT5and finally

control and a tumor suppressoris involved in cancer preventing

mRNA expression of these genes versus expression is



as a housekeeping all mentioned

there was not significant changes among these themselves



1000µM) at exposure time of 24 h (repeated in the case of BT20 for mentioned concentrations and

As shown in this diagramconcentration could significantlyformazan as reductive metabolite of MTT (3

diphenyltetrazolium bromide) in Each value represents the mean ±






emitted fluorescent intensity.

a quantitative PCR approach to assess the of carbenoxolone on the expression

CYSCand finally

and a tumor suppressorpreventing

expression of these genes versus illustrated in Figure 5. The



as a housekeeping mentioned significant changes among these

themselves.



1000µM) at exposure time of 24 h (♦) and 48 h (□) and also arerepeated in the case of BT20 for mentioned concentrations and

this diagramconcentration could significantly suppress the production of formazan as reductive metabolite of MTT (3

diphenyltetrazolium bromide) in Each value represents the mean ±



Interpretation of the resultfle method and finally



intensity.

a quantitative PCR approach to assess the on the expression CYSC ,

and finallyand a tumor suppressorpreventing



and was demonstrated Normalization of our data to the expression rate of

as a housekeeping gene, mentioned significant changes among these



♦) and 48 h (□) and also arerepeated in the case of BT20 for mentioned concentrations and

this diagramsuppress the production of

formazan as reductive metabolite of MTT (3diphenyltetrazolium bromide) in

Each value represents the mean ±

MCF7 and BT20 cells were incubexpression levels of candidate genes

which mentioned above were detected by using real time Interpretation of the result

finallywere normalized to the expression

as a housekeeping geneperformed in triplicate and negative control included in

and then quantified as a view ofintensity.

a quantitative PCR approach to assess the on the expression

, EGF pathway candidate and finally

and a tumor suppressorpreventing ( expression of these genes versus

illustrated in Figure 5. The respective ratio of expressed gene overexpression was used to represent gene expression

quantitatively Normalization of our data to the expression rate of

gene, mentioned genes in both type of significant changes among these




this diagram, CBX in 150 suppress the production of


Each value represents the mean ±

MCF7 and BT20 cells were incubated with CBX (150 expression levels of candidate genes

which mentioned above were detected by using real time Interpretation of the result

finally were normalized to the expression

as a housekeeping gene. All reactions were performed in triplicate and negative control included in

and then quantified as a view ofintensity.


EGF pathway candidate TP53

and a tumor suppressor May, P. and May, E.




gene, revealed significantgenes in both type of

significant changes among these


esults of MTT assay for evaluation of cell viability. the indicated concentration of CBX (50


, CBX in 150 suppress the production of


Each value represents the mean ± SE of at least five

ated with CBX (150 expression levels of candidate genes

which mentioned above were detected by using real time Interpretation of the results was performed

the CT valueswere normalized to the expression

. All reactions were performed in triplicate and negative control included in

and then quantified as a view of


EGF pathway candidate TP53 as

and a tumor suppressorMay, P. and May, E.




revealed significantgenes in both type of



of cell viability. the indicated concentration of CBX (50




SE of at least five


which mentioned above were detected by using real time was performed

the CT valueswere normalized to the expression behavior



a quantitative PCR approach to assess the on the expression of

EGF pathway candidate as crucial

and a tumor suppressor geneMay, P. and May, E.







of cell viability. the indicated concentration of CBX (50




SE of at least five



the CT valuesbehavior



a quantitative PCR approach to assess the of apoptosis

EGF pathway candidate crucialgene

May, P. and May, E. expression of these genes versus

illustrated in Figure 5. The respective ratio of expressed gene over GAPDHexpression was used to represent gene expression

quantitatively in Fig. 5Normalization of our data to the expression rate of



of cell viability. Cthe indicated concentration of CBX (50


, CBX in 150 µM of suppress the production of

formazan as reductive metabolite of MTT (3-(4, 5diphenyltetrazolium bromide) in

SE of at least five



the CT valuesbehavior


and then quantified as a view of SYBR

a quantitative PCR approach to assess the apoptosis

EGF pathway candidate crucial genegene which

May, P. and May, E. expression of these genes versus

illustrated in Figure 5. The GAPDH

expression was used to represent gene expression in Fig. 5

Normalization of our data to the expression rate of revealed significant

genes in both type of significant changes among these

Cells

the indicated concentration of CBX (50-♦) and 48 h (□) and also are

repeated in the case of BT20 for mentioned concentrations and M of

suppress the production of , 5-

diphenyltetrazolium bromide) in both SE of at least five



the CT values of behavior of


SYBR


EGF pathway candidate gene

whichMay, P. and May, E.


GAPDHexpression was used to represent gene expression

in Fig. 5. Normalization of our data to the expression rate of



ells -

♦) and 48 h (□) and also are repeated in the case of BT20 for mentioned concentrations and

M of suppress the production of

-both

SE of at least five



of of


SYBR


EGF pathway candidate gene

which May, P. and May, E.


GAPDH expression was used to represent gene expression

. Normalization of our data to the expression rate of

revealed significant genes in both type of


Fig. MCF7relative expressions intensity ratio of the genes upon the expression of housekeeping expressions arewere intensity in triplicate experiments statistically (mean ±

DiscussionAlthough, various drugs have been proposed for the treatment of breast cancer, cancer biology andanticancer drugs are obstacles of complete Consequently, many efforts are in progress to find new approaches to overcome cancer.junctions is one of these efforts and CBX is a prototypic inhibitor of them.amount of both typetheIt should be highlighted that MCF7 cells have more proliferative and progressive behaviortheirassay revealed significant reduction in cell viability BT20 cellseffectscells

Fig. 5MCF7relative expressions intensity ratio of the genes upon the expression of housekeeping expressions arewere intensity in triplicate experiments statistically (mean ±

DiscussionAlthough, various drugs have been proposed for the treatment of breast cancer, cancer biology andanticancer drugs are obstacles of complete Consequently, many efforts are in progress to find new approaches to overcome cancer.junctions is one of these efforts and CBX is a prototypic inhibitor of them.amount of both typethe reductionIt should be highlighted that MCF7 cells have more proliferative and progressive behaviortheir assay revealed significant reduction in cell viability BT20 cellseffectscells

Ratio

of G

ene

Expr

essio

n Ra

tio o

f Gen

e Ex

pres

sion

5. Quantitative real time PCR MCF7 cells (Panel A) and BT20 cells relative expressions intensity ratio of the genes upon the expression of housekeeping expressions arewere obtained as a intensity in triplicate experiments statistically (mean ±

DiscussionAlthough, various drugs have been proposed for the treatment of breast cancer, cancer biology andanticancer drugs are obstacles of complete Consequently, many efforts are in progress to find new approaches to overcome cancer.junctions is one of these efforts and CBX is a prototypic inhibitor of them.amount of both type

reductionIt should be highlighted that MCF7 cells have more proliferative and progressive behavior

EGF, progesterone and estrogen receptors.assay revealed significant reduction in cell viability BT20 cellseffects due to mentioned supportive receptors in MCF7 cells (Rulli, Antognelli

0.10.20.30.40.50.60.70.8

Ratio

of G

ene

Expr

essio

n 0.10.20.30.40.50.60.7

Ratio

of G

ene

Expr

essio

n

Quantitative real time PCR cells (Panel A) and BT20 cells

relative expressions intensity ratio of the genes upon the expression of housekeeping expressions are

obtained as a intensity in triplicate experiments statistically (mean ±

Discussion Although, various drugs have been proposed for the treatment of breast cancer, cancer biology andanticancer drugs are obstacles of complete Consequently, many efforts are in progress to find new approaches to overcome cancer.junctions is one of these efforts and CBX is a prototypic inhibitor of them.amount of extracted both types of cells (data not shown) which could indicate

reductionIt should be highlighted that MCF7 cells have more proliferative and progressive behavior

EGF, progesterone and estrogen receptors.assay revealed significant reduction in cell viability BT20 cells

due to mentioned supportive receptors in MCF7 (Rulli, Antognelli

00.10.20.30.40.50.60.70.8

00.10.20.30.40.50.60.7


relative expressions intensity ratio of the genes upon the expression of housekeeping expressions are significant statistically

obtained as a intensity in triplicate experiments statistically (mean ±

Although, various drugs have been proposed for the treatment of breast cancer, cancer biology andanticancer drugs are obstacles of complete Consequently, many efforts are in progress to find new approaches to overcome cancer.junctions is one of these efforts and CBX is a prototypic inhibitor of them.

extracted of cells (data not shown) which could indicate

reduction of cell numbersIt should be highlighted that MCF7 cells have more proliferative and progressive behavior

EGF, progesterone and estrogen receptors.assay revealed significant reduction in cell viability

(Fig. 4), while MCF7 did not show due to mentioned supportive receptors in MCF7

(Rulli, Antognelli

TP

TP


relative expressions intensity ratio of the genes upon the expression of housekeeping

significant statisticallyobtained as a

intensity in triplicate experiments statistically (mean ±

Although, various drugs have been proposed for the treatment of breast cancer, cancer biology andanticancer drugs are obstacles of complete Consequently, many efforts are in progress to find new approaches to overcome cancer.junctions is one of these efforts and CBX is a prototypic inhibitor of them.

extracted of cells (data not shown) which could indicate

of cell numbersIt should be highlighted that MCF7 cells have more proliferative and progressive behavior



(Rulli, Antognelli

TP53

TP53

BioImpacts



significant statisticallyobtained as a view of


Although, various drugs have been proposed for the treatment of breast cancer, cancer biology and anticancer drugs are obstacles of complete Consequently, many efforts are in progress to find new approaches to overcome cancer.junctions is one of these efforts and CBX is a prototypic

However, in the case of CBX,extracted RNA decreased in treated group in of cells (data not shown) which could indicate

of cell numbersIt should be highlighted that MCF7 cells have more proliferative and progressive behavior



(Rulli, Antognelli

53 STAT

MCF

53 STAT

BT

ioImpacts



significant statisticallyview of


Although, various drugs have been proposed for the treatment of breast cancer,

adverse side effects of routine anticancer drugs are obstacles of complete Consequently, many efforts are in progress to find new approaches to overcome cancer.junctions is one of these efforts and CBX is a prototypic

However, in the case of CBX,RNA decreased in treated group in

of cells (data not shown) which could indicate of cell numbers

It should be highlighted that MCF7 cells have more proliferative and progressive behavior



(Rulli, Antognelli et al

STAT

MCF

STAT

BT20

ioImpacts


relative expressions intensity ratio of the genes upon the expression of housekeeping GAPDH

significant statistically SYBR Green emitted fluorescent


Although, various drugs have been proposed for the treatment of breast cancer, lack of deep knowledge about



of cells (data not shown) which could indicate of cell numbers




et al

STAT5

MCF7

STAT5

20 Cells

ioImpacts, 2011, 1(2),


relative expressions intensity ratio of the genes upon the GAPDH

significant statisticallySYBR Green emitted fluorescent


Although, various drugs have been proposed for the lack of deep knowledge about



of cells (data not shown) which could indicate after incubation with drug




et al. 2006)

CYCS

MCF7 Cells

CYCS

Cells

, 2011, 1(2),

Quantitative real time PCR assessments of CBX cells (Panel A) and BT20 cells (Panel B)

relative expressions intensity ratio of the genes upon the GAPDH gene.

significant statistically upon SYBR Green emitted fluorescent



adverse side effects of routine anticancer drugs are obstacles of complete Consequently, many efforts are in progress to find new approaches to overcome cancer. junctions is one of these efforts and CBX is a prototypic


of cells (data not shown) which could indicate fter incubation with drug




. 2006)

CYCS

Cells

CYCS

Cells

, 2011, 1(2),

assessments of CBX (Panel B)

relative expressions intensity ratio of the genes upon the gene.

upon GAPDH.SYBR Green emitted fluorescent



adverse side effects of routine anticancer drugs are obstacles of complete Consequently, many efforts are in progress to find new

Inhibitionjunctions is one of these efforts and CBX is a prototypic






. 2006). According to the

BCL

Cells

BCL

Cells

, 2011, 1(2), 113-

assessments of CBX (Panel B)

relative expressions intensity ratio of the genes upon the gene. All of the genes

GAPDH.SYBR Green emitted fluorescent



adverse side effects of routine anticancer drugs are obstacles of complete Consequently, many efforts are in progress to find new




It should be highlighted that MCF7 cells have more proliferative and progressive behavior, depend



According to the

BCL2

BCL2

-119

assessments of CBX (Panel B). Normalized

relative expressions intensity ratio of the genes upon the All of the genes

GAPDH. The values SYBR Green emitted fluorescent

intensity in triplicate experiments statistically (mean ± SEM)


adverse side effects of routine anticancer drugs are obstacles of complete treatmentConsequently, many efforts are in progress to find new




It should be highlighted that MCF7 cells have more depend



According to the

2

2

assessments of CBX . Normalized


The values SYBR Green emitted fluorescent

SEM)


adverse side effects of routine treatment

Consequently, many efforts are in progress to find new Inhibition of

junctions is one of these efforts and CBX is a prototypic However, in the case of CBX,

RNA decreased in treated group in of cells (data not shown) which could indicate

fter incubation with drugIt should be highlighted that MCF7 cells have more

dependentEGF, progesterone and estrogen receptors.

assay revealed significant reduction in cell viability (Fig. 4), while MCF7 did not show

due to mentioned supportive receptors in MCF7 According to the

AKT

AKT

| 117

assessments of CBX . Normalized


The values SYBR Green emitted fluorescent

SEM).


adverse side effects of routine treatment

Consequently, many efforts are in progress to find new of gap

junctions is one of these efforts and CBX is a prototypic However, in the case of CBX, total


fter incubation with drugIt should be highlighted that MCF7 cells have more

ent MTT

assay revealed significant reduction in cell viability (Fig. 4), while MCF7 did not show such


AKT1

AKT1

117

assessments of CBX on

. Normalized relative expressions intensity ratio of the genes upon the

All of the genes The values

SYBR Green emitted fluorescent


adverse side effects of routine treatment.

Consequently, many efforts are in progress to find new gap

junctions is one of these efforts and CBX is a prototypic otal


fter incubation with drug. It should be highlighted that MCF7 cells have more

on MTT

assay revealed significant reduction in cell viability in such


Asadi-Khiavi et al.

118 | BioImpacts, 2011, 1(2), 113-119 Copyright © 2011 by Tabriz University of Medical Sciences

results, CBX inhibits MCF7 and BT20 cells growth and viability just in a dose dependent manner with IC50 values of 150 μM after 24 h of exposure. The anti-ploriferative effects of CBX have been reported in other cancer cells (Kawashima et al. 2009). Apoptotic effects of CBX have been also reported in some types of cells (Pivato et al. 2006; Waddell et al. 2000). Among several mechanisms of action which have been proposed for pharmacological activity of CBX, induction of Mitochondrial Permeability Transition (MPT) and release of cytochrome c is prominent (Salvi et al. 2005; Pivato et al. 2006). Therefore, it can be considered as an apoptosis stimulating drug (Isbrucker et al. 2006; Salvi et al. 2005). Due to structural similarity to glucocorticoids, CBX inhibits Hydroxysteroid dehydrogenases (HSD) in cancer cells and induces apoptosis via interaction with glucocorticoid and mineralocorticoid receptors (Greenstein et al. 2002; Voutsas et al. 2007). It seems that TP53 and CYCS genes as well as STAT1 gene down regulation are compensatory responses against anti-apoptotic genes down regulation which totally arise from stress oxidative effect of Carbenoxolone (Farczadi, Kaszas et al. 2002). AKT1 and BCL2 genes are anti-apoptotic down regulated genes with similar effect on cancer cells. Of these down regulated genes, the BCL2 gene encodes the bcl2 protein that involved in a wide variety of cellular activities such as homeostasis and tumorigenesis. The encoded protein is able to reduce the release of pro-apoptotic cytochrome c from mitochondria and block caspase activation. This suggests a cytoprotective and cell survival functionality for this gene as reported previously ( Karsan et al. 1996; Choi et al. 1995) but as it mentioned, cytochrome c has been down regulated in CBX group, probably due to carbenoxolone stress oxidative effect (Salvi et al. 2005; Pivato et al. 2006) and BCL2 counter regulatory gene, was not able to be compensated. In the view of transcryptomics, it seems that Carbenoxolone affects cancer cell viability despite some ambiguous findings in cell viability and cytotoxicity assays. Lewenstein and his co-workers provided the “Homologous Growth Control (HGC)” theory approximately forty years ago which talks about gap junctions' delirious role in carcinogenesis particularly in the case of gap junction intercellular communication(GJIC) between normal and cancer cells (Cronier, Crespin et al. 2009) and CBX has confirmed inhibitory effects on gap junction-mediated intercellular communication (GJIC) particularly in attached cells as well (Winmill et al. 2003; Paraguassu-Braga et al. 2003). Therefore we cannot establish a precise mechanism for CBX activity.

Conclusion

Breast cancer has emerged as a leading cause of cancer death in the world particularly in women. Unfortunately,

the current therapeutic strategies are ineffective in some cases; hence, there exists an increasing demand for more effective therapies. We examined the CBX in this matter. In conclusion, based on the results obtained in this study, we suggest that CBX be favourable for in vivo applications; nevertheless further investigations are yet to be fulfilled to authenticate its in vivo usefulness. This obviously means that there is a novel relationship between cell-cell communications and inter-cellular cross talking, perhaps via gap junctions, at whom we propose that interestingly orchestrated biochemical machinery of cells may be related to some downstream cell signalling which may play a key role in development of cancer. On the other hand, the main question is remained: Are gap junctions friend or enemy? Therefore we propose evaluation of CBX effects on genetically modified cancer cell lines particularly in transcriptomics and functional genomics level using DNA chip technology.

Ethical issues None to be declared. Conflict of interests The authors declare no conflict of interests. Acknowledgement Authors would like to thank Research Center for Pharmaceutical Nanotechnology (RCPN), Tabriz University of Medical Sciences, Tabriz, Iran for the financial support of this project (grant No. 87011) that is a part of PhD thesis number 32 Also authors are thankful to Dr Y. Omidi for his kind support.

References Afaq F, Zaman N, Khan N, Syed D. N, Sarfaraz S, Zaid M. A and Mukhtar H. 2008. Inhibition of epidermal growth factor receptor signaling pathway by delphinidin, an anthocyanidin in pigmented fruits and vegetables. Int. J. Cancer. 123, 1508

Agelaki S, Spiliotaki M, Markomanolaki H, Kallergi G, Mavroudis D, Georgoulias V and Stournaras C. 2009. Caveolin-1 regulates EGFR signalling in MCF-7 breast cancer cells and enhances gefitinib-induced tumor cell inhibition. Cancer Biol. Ther, 8(15), 1470-1477.

Cameron SJ, Malik S, Akaike M, Lerner-Marmarosh N, Yan C, Lee JD, Abe J, Yang J. 2003. Regulation of epidermal growth factor-induced connexin 43 gap junction communication by big mitogen-activated protein kinase1/ERK5 but not ERK1/2 kinase activation. J Biol Chem, 278(20), 18682-18688.

Camp E. R, Summy J, Bauer T. W, Liu W, Gallick G. E and Ellis L. M. 2005. Molecular mechanisms of resistance to therapies targeting the epidermal growth factor receptor. Clin. Cancer Res. 11, 397.


Copyright © 2011 by Tabriz University of Medical Sciences BioImpacts, 2011, 1(2), 113-119 | 119

Cronier, L., S. Crespin, et al. 2009. Gap junctions and cancer: new functions for an old story. Antioxid Redox Signal. 11(2): 323-338.

Dong J and Wiley HS. 2000. Trafficking and proteolytic release of epidermal growth factor receptor ligands are modulated by their membrane-anchoring domains. J Biol Chem. 275(1), 557-64.

Farczadi, E., I. Kaszas, et al. 2002. Changes in apoptosis, mitosis, Her-2, p53 and Bcl2 expression in breast carcinomas after short-term tamoxifen treatment. Neoplasma 49(2), 101-103.

Gialeli C, Kletsas D, Mavroudis D, Kalofonos H. P, Tzanakakis G. N and Karamanos N. K. 2009. Targeting epidermal growth factor receptor in solid tumors: Critical evaluation of the biological importance of therapeutic monoclonal antibodies. Curr. Med. Chem. 16, 3797.

Greenstein S, Ghias K, Krett NL. and Rosen ST. 2002. Mechanisms of glucocorticoid-mediated apoptosis in hematological malignancies. Clin Cancer Res. 8, 1681-94.

Isbrucker RA, Burdock GA. 2006. Risk and safety assessment on the consumption of Licorice root (Glycyrrhiza sp), its extract and powder as a food ingredient, with emphasis on the pharmacology and toxicology of glycyrrhizin. Regul Toxicol Pharmacol. 46, 167–92.

Kawashima D, Asai M, Katagiri K, Takeuchi R, Ohtsuka K. 2009. Reinvestigation of the effect of carbenoxolone on the induction of heat shock proteins. Cell Stress and Chaperones. 14: 535-43.

Leithe E, Sirnes S, Omori Y, Rivedal E. 2006. Downregulation of gap junctions in cancer cells. Crit Rev Oncog, 12(4), 225-256.

Li, J., et al. 2001. Upregulation of gap junction connexin 32 with epileptiform activity in the isolated mouse hippocampus. Neuroscience. 105(3), 589-598.

Loew S, Schmidt U, Unterberg A and Halatsch M. E. 2009. The epidermal growth factor receptor as a therapeutic target in glioblastoma multiforme and other malignant neoplasms. Anticancer Agents Med. Chem. 9, 703.

Mamot C and Rochlitz C. 2006. Targeting the epidermal growth factor receptor (EGFR)–a new therapeutic option in oncology. Swiss. Med. Wkly. 136, 4.

May, P. and May, E. 1999. Twenty years of p53 research: structural and functional aspects of the p53 protein. Oncogene. 18, 7621–36.

Nicholson BJ. 2003. Gap junctions: from cell to molecule. J. Cell Sci. 116(22), 4479-81.

Paraguassu-Braga FH, Borojevic R, Bouzas LF, Barcinski MA, Bonomo A. 2003. Bon marrow stroma inhibits proliferation and apoptosis in leukemic cells through gap junction-mediated cell communication, Cell Death Differ. 10: 1101–8.

Pfaffl MW. 2001.A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29(9), 45.

Pivato LS, Constantin RP, Ishii-Iwamoto EL, Yamamoto NS, Constantin J, Bracht A. 2006. Metabolic effects of carbenoxolone in the rat liver. J Biochem Mol Toxicol. 20:230-40.

Rulli, A., C. Antognelli, et al. 2006. A possible regulatory role of 17beta-estradiol and tamoxifen on glyoxalase I and glyoxalase II genes expression in MCF7 and BT20 human breast cancer cells. Breast Cancer Res Treat. 96(2): 187-196.

Salvi M, Fiore C, Battaglia V, Palermo M, Armanini D, Toninello A. 2005. Carbenoxolone induces oxidative stress in Liver mitochondria, which is responsible for transition pore opening. Endocrinol. 146, 2306-12.

Voutsas IF, Gritzapis AD, Alexis MN, Katsanou ES, Perez S, Baxevanis CN, Papamichail M. 2007. A novel quantitative flow cytometric method for measuring glucocorticoid receptor (GR) in cell lines: Correlation with the biochemical determination of GR. J Immunol Methods. 324: 110-19.

Waddell BJ, Susan Hisheh S, Dharmarajan AM, Burton PJ. 2000. Apoptosis in rat placenta is zone-dependent and stimulated by glucocorticoids. BOR. 63: 1913-17.

Winmill RE, Hedrick MS. 2003. Gap junction blockade with Carbenoxolone differentially affects fictive breathing in larval and adult bullfrogs. Respir Physiol Neurobiol. 138: 239-/51.

Ye, Z. C., et al. 2003. Functional hemichannels in astrocytes: a novel mechanism of glutamate release. J. Neurosci. 23(9), 3588-3596.

Gap Junctions: The Claymore for Cancerous Cells · Gap Junctions: The Claymore for Cancerous Cells...

Documents

Transcript of Gap Junctions: The Claymore for Cancerous Cells · Gap Junctions: The Claymore for Cancerous Cells...