FurA and FurB–the impact of two transcriptional metalloregulators ...

University of Veterinary Medicine Hannover

Institute for Microbiology

Department of Infectious Diseases

FurA and FurB – the impact of two transcriptional

metalloregulators on Mycobacterium avium ssp.

paratuberculosis stress response and metal homeostasis

Thesis

Submitted in partial fulfilment of the requirements for the degree

- Doctor rerum naturalium -

(Dr. rer. nat.)

awarded by the University of Veterinary Medicine Hannover

by

Elke Eckelt

Minden, Westf.

Hannover, Germany 2014

Supervisor: Prof. Dr. med. vet. Ralph Goethe

Supervision Group: Prof. Dr. med. vet. Gerald-F. Gerlach

Prof. Dr. med. vet. Paul Becher

1st Evaluation: Prof. Dr. med. vet. Ralph Goethe

Institute for Microbiology



Prof. Dr. med. vet. Gerald-F. Gerlach

Innovative Veterinary Diagnostics (IVD) Laboratory

Hannover

Prof. Dr. med. vet. Paul Becher

Institute for Virology



2nd Evaluation: Prof. Dr. rer. nat. Ulrich E. Schaible

Cellular Microbiology

Research Center Borstel

Date of final exam: 5. November 2014

This work was financially supported by the Deutsche Forschungsgemeinschaft (DFG,

Ge522/6-1), Bonn, Germany

“Everyone deserves the chance to fly”

Stephen Schwartz

Parts of the thesis have been published previously at scientific meetings,

conferences or journals:

Oral presentation

Eckelt E, Jarek M, Laarmann K, Meissner T, Meens J, Gerlach G-F, Goethe R.

“Metal-dependent regulation of a Mycobacterium avium ssp. paratuberculosis

specific pathogenecity island”, Seminar on Infection Biology, Centre for Infection

Medicine, University of Veterinary Medicine Hannover, Hannover 2013

Eckelt E, Meissner T, Meens J, Laarmann K, Nerlich A, Jarek M, Gerlach G-F,

Goethe R. "FurA contributes to the oxidative stress response regulation of

Mycobacterium avium ssp. paratuberculosis", 12th International Colloquium on

Paratuberculosis, International Association for Paratuberculosis, Parma 2014

Poster presentations

Eckelt E, Meissner T, Meens J, Goethe R. "Heterologous expression of predicted

Mycobacterium avium subsp. paratuberculosis transporter proteins", Graduate

School Day of the University for Veterinary Medicine Hannover, Bad Salzdethfurth

2011

Eckelt E, Meissner T, Meens J, Goethe R. "Characterization of predicted

Mycobacterium avium subsp. paratuberculosis transporter proteins", Annual

Conference of the Association for General and Applied Microbiology (VAAM),

Tübingen 2012

Eckelt E, Meissner T, Meens J, Goethe R. "Analysis of predicted ECF- and ABC-

transporter of Mycobacterium avium subsp. paratuberculosis", 112th General

Meeting of the American Society for Microbiology (ASM), San Francisco 2012

Publications (manuscripts see Results part I+II)

Eckelt E, Meissner T, Meens J, Laarmann K, Nerlich A, Jarek M, Weiss S, Gerlach

G-F and Goethe R. "FurA contributes to the oxidative stress response regulation of

Mycobacterium avium ssp. paratuberculosis", submitted

Eckelt E, Jarek M, Meens J, Goethe R. „Identification of a lineage specific zinc

responsive genomic island in Mycobacterium avium ssp. paratuberculosis“, BMC

Genomics, accepted

Contributions to other publications

Roderfeld R, Koc A, Rath T, Blöcher S, Tschuschner A, Akineden Ö, Fischer M, von

Gerlach S, Goethe R, Eckelt E, Meens J, Bülte M, Basler T, Roeb E (2012).

"Induction of matrix metalloproteinases and TLR2 and 6 in murine colon after oral

exposure to Mycobacterium avium subsp. paratuberculosis", Microbes and Infection

Vol. 14(6): 545-53. doi: 10.1016/j.micinf.2012.01.004

Meissner T, Eckelt E, Basler T, Meens J, Heinzmann J, Suwandi A, Oelemann

MWR, Trenkamp S, Holst O, Weiss S, Bunk B, Spöer C, Gerlach G-F, Goethe R

(2014). "The Mycobacterium avium ssp. paratuberculosis specific mptD gene

contributes to lipid metabolism and is essential for full virulence in mouse infections",

Frontiers in Cellular and Infection Microbiology 4:110. doi:10.3389/fcimb.2014.00110

Table of content

Chapter 1 General Introduction ............................................................................. 17

1.1 Mycobacterium avium ssp. paratuberculosis (MAP) .................................. 18

1.1.1 MAP genetics ............................................................................................ 19

1.2 Paratuberculosis ........................................................................................ 20

1.2.1 Course of infection and clinical symptoms................................................. 20

1.2.2 Pathogenesis of paratuberculosis ............................................................. 20

1.3 Host cell defence mechanisms against invading bacteria ......................... 21

1.3.1 Macrophages – phagosome-lysosome fusion ........................................... 21

1.3.2 Pathomechanisms and intracellular survival of MAP in macrophages ...... 22

1.4 Metal homeostasis at the host-pathogen interface .................................... 24

1.5 Bacterial strategies counteracting nutritional immunity .............................. 26

1.6 Relevance of iron and zinc in the host ....................................................... 27

1.7 Relevance of iron and zinc in virulence and pathogenesis of bacteria ...... 28

1.8 Metal transport and -storage in gram positive bacteria .............................. 29

1.9 Regulation of metal homeostasis in bacteria and mycobacteria ................ 31

1.9.1 Regulators of iron and zinc homeostasis ................................................... 32

1.9.2 Ferric uptake family (FUR) regulators ....................................................... 32

1.10 Aims of the study ....................................................................................... 34

Chapter 2 Materials and Methods ......................................................................... 35

2.1 Materials .................................................................................................... 36

2.2 Bacterial strains and growth conditions ..................................................... 41

2.2.1 Escherichia coli ......................................................................................... 41

2.2.2 Mycobacterium avium ssp. paratuberculosis ............................................. 41

2.2.3 Mycobacterium smegmatis ........................................................................ 42

2.3 Construction of mutant strains ................................................................... 43

2.3.1 Construction of a M. avium ssp. paratuberculosis∆furA deletion strain and

complementation of the mutant strain ....................................................... 43

2.3.2 Construction and selection of a M. smegmatis∆furB mutant ..................... 43

2.4 Cell culture and animal experiments ......................................................... 44

2.4.1 Cell culture of macrophages and survival assay of intracellular

mycobacteria ............................................................................................. 44

2.4.2 Determination of reactive oxygen species in macrophage infection

experiments ............................................................................................... 45

2.4.3 Determination of adhesion and invasion by immunofluorescence and

confocal microscopy .................................................................................. 45

2.4.4 Mouse infection experiments ..................................................................... 46

2.5 Molecular methods .................................................................................... 47

2.5.1 Extraction of nucleic acids ......................................................................... 47

2.5.2 cDNA synthesis and quantitative real-time PCR (qRT-PCR) ..................... 47

2.5.3 Rapid amplification of 5‟-cDNA ends (5‟RACE®) ....................................... 48

2.5.4 Inverse site directed mutagenesis PCR .................................................... 48

2.5.5 Construction of plasmids for β-galactosidase activity assays .................... 49

2.5.6 β-galactosidase activity assay ................................................................... 49

2.6 RNA deep sequencing and analysis .......................................................... 50

2.7 Bioinformatics and statistics ...................................................................... 51

2.7.1 Protein analysis ......................................................................................... 51

2.7.2 Analysis of Fur binding sites ...................................................................... 51

2.7.3 Cluster analysis ......................................................................................... 52

2.7.4 Statistical tests .......................................................................................... 52

Chapter 3 Results part I: FurA contributes to the oxidative stress

response regulation of Mycobacterium avium ssp.

paratuberculosis ................................................................................... 53

Chapter 4 Results part II: Identification of a lineage specific zinc

responsive genomic island in Mycobacterium avium ssp.

paratuberculosis ................................................................................... 79

Chapter 5 General discussion ............................................................................. 107

5.1 Mycobacterial evolution and adaptation .................................................. 108

5.2 Struggle for nutrients at the host-pathogen interface ............................... 109

5.3 The complex nature of FurA regulation ................................................... 110

5.4 The impact of FurA in stress response and survival ................................ 112

5.5 The impact of FurB in MAP zinc homeostasis and host adaptation ......... 113

5.6 Conclusion ............................................................................................... 116

Chapter 6 Summary .............................................................................................. 119

Chapter 7 Zusammenfassung ............................................................................. 123

Chapter 8 References ........................................................................................... 127

List of Figures

Figure 1: Characterization of a MAP∆furA mutant. ................................................... 60

Figure 2: Functional complementation of FurA regulated genes. ............................. 66

Figure 3: Iron- and stress dependent expression of furA and FurA regulated

genes. ....................................................................................................... 67

Figure 4: Induction of oxidative burst in macrophages and survival of MAP

strains in macrophages. ............................................................................ 71

Figure 5: Biological fitness of MAP and MAP∆furA in infected mice. ........................ 72

Figure 6: Putative regulatory mechanisms of FurA in MAP. ..................................... 75

Figure 7: Metal dependent regulation of a M. avium ssp. paratuberculosis

specific gene locus. ................................................................................... 86

Figure 8: TPEN-Zn titration experiment. ................................................................... 86

Figure 9: Organisation and FurB dependent regulation of a MAP specific ABC

transporter. ................................................................................................ 89

Figure 10: Analysis of mptA regulation by FurB after heterologous expression in

M. smegmatis∆furB (MSMEG∆furB). ......................................................... 92

Figure 11: Organisation of a M. avium ssp. paratuberculosis specific zinc

responsive genomic island (ZnGI). .......................................................... 101

Figure 12: Regulation model of mptABC by FurB in MAP. ..................................... 103

List of Tables

Table 1: Bacterial strains used in this study.............................................................. 36

Table 2: Oligonucleotides used in this study............................................................. 36

Table 3: Plasmids and phages used in this study ..................................................... 39

Table 4: Genes higher expressed in MAP∆furA compared to MAPwt ...................... 62

Table 5: Genes lower expressed in MAP∆furA compared to MAPwt ........................ 63

Table 6: Zinc dependent differentially expressed genes ........................................... 95

Table 7: Zur boxes of the MAP zinc regulon as predicted by FIMO analyses .......... 99

Table 8: Data of β-galactosidase assays. ............................................................... 152

Table 9: Raw data of RNA-Sequencing MAP∆furA/MAPwt. ................................... 153

Table 10: Raw data of RNA-Sequencing MAPwt TPEN/control. ............................ 153

Table 11: Raw data of survival of MAPwt, MAP∆furA and MAP∆furAC after

macrophage infection in colony forming units [Cfu]. ................................ 153


mouse infection. ...................................................................................... 153

Table 13: Sequences used to generate a FurA consenus sequence. .................... 153

Table 14: Sequences used to generate a FurB consenus sequence ..................... 154

Table 15: Predicted binding sites FurA (Fur boxes) obtained by FIMO analysis. ... 154

Table 16: Predicted binding sites FurB (Zur boxes) obtained by FIMO analysis. ... 157

Table 17: Homologue zinc responsive genes in mycobacteria. .............................. 158

List of Abbreviations

α Alpha

β Beta

∆ Delta

γ Gamma

% Percent

Ahp/ahp Alkyl hydroperoxide reductase

ANOVA Analysis Of Variance

ABC ATP binding cassette

approx. Approximately

ATP AdenosinTriPhosphate

bp Base pair(s)

°C Degree Celsius

CD Crohn‟s disease

Cfu Colony forming units

Cu Cuprum

Da Dalton

DIP 2,2-dipyridyl

DMEM Dulbecco‟s Modified Eagle‟s Medium

DNA DeoxyriboNucleic Acid

dNTP Deoxynucleotide triphosphates

DPBS Dulbecco‟s Phosphate-Buffered Saline

DtxR Diphtheria toxin repressor

e.g. Exampli gratia

ESX Early secretory antigenic target 6 system

et al. Et alii

Fe Ferrum

fep Ferric enterochelin protein

Fig. Figure

Fur Ferric uptake regulator

GC Guanine Cytosine

GTP GuanosinTriPhosphate

H2O2 Hydrogen peroxide

HE Hematoxylin and Eosin staining

IdeR Iron dependent regulator

IL Interleukine

IFN Interferone

i.p. Intraperitoneal

IrtA/B Iron responsive transporter A/B

JD Johne‟s disease

Kat/kat Catalase peroxidase

kb Kilo base pair(s)

LB Luria Bertani

LSP Large sequence polymorphism

LSPP Large sequence polymorphism present

LSPA Large sequence polymorphism absent

MAV M. avium ssp. avium

MAC M. avium complex

MAH M. avium ssp. hominissuis

MAP M. avium ssp. paratuberculosis

MAS M. avium ssp. silvaticum

MB Middlebrook

Mb Mega base pair(s)

mbt Mycobactin

M-cells Microfold epithelial cells

Mn Manganese

Mø Macrophage

MOI Multiplicity of infection

mpt Mycobacterium transporter

MSMEG Mycobacterium smegmatis

MTB Mycobacterium tuberculosis

MTBC Mycobacterium tuberculosis complex

NADPH Nicotinamide Adenine Dinucleotide Phosphate

NaCl Natrium Chloride

NCBI National Centre for Biotechnology Information

NO Nitric Oxide

NOS Nitric Oxide Synthase

NRAMP Natural resistance associated membrane protein

NTA Nitrilotriacetic acid trisodium salt

O2- Superoxide anion

OH- Hydroxyl anion

OADC Oleic acid, Albumin fraction V, Dextrose, Catalase

ODxxx Optical density at xxx nanometers

ORF Open reading frame

OxyR Oxygen dependent regulator

PBS Phosphate buffered saline

PCR Polymerase Chain Reaction

PE Prolin-Glutamin

PerR Peroxide dependent Regulator

pH Power of Hydrogen

PPE Prolin-Prolin-Glutamin

qRT-PCR quantitative Realtime PCR

RACE Rapid amplification of cDNA ends

RBS Ribosome binding site

RNA RiboNucleic Acid

RNS Reactive Nitrogen Species

ROS Reactive Oxygen Species

rpm Rounds per minute

® Registered trademark

SDS Sodium Dodecyl Sulfate

SEM Standard error of the mean

sid Siderophore

Sod/sod Superoxide dismutase

TLR Toll Like Receptor

TLS Translation start

TNF Tumor necrosis factor

TPEN N,N,N',N'-tetrakis (2-pyridylmethyl) ethylenediamine

TSS Transcription start

U Unit

UTR Untranslated region

wt wildtype

Zn Zinc

ZnGI Zinc responsive genomic island

ZnuABC Zinc uptake transporter A/B/C

Zur Zinc uptake regulator

General Introduction Chapter 1

17

Chapter 1

General Introduction

Chapter 1 General Introduction

18

1.1 Mycobacterium avium ssp. paratuberculosis (MAP)

Mycobacterium avium ssp. paratuberculosis (MAP) belongs to the genus

Mycobacterium of the family Mycobacteriaceae, the phylum Actinobacteria and the

order Actinomycetales [1]. Systematically MAP is classified as a member of the

M. avium complex (MAC), which comprises of 9 different slow growing species: M.

intracellulare, M. colombiense, M. chimaera, M. marseillense, M. timonense, M.

boucherdurhonense, M. vulneris, M. arosiense and M. avium [2]. M. avium is divided

in four subspecies, including MAP and the closely related species M. avium ssp.

hominissuis (MAH), M. avium ssp. avium (MAV) and M. avium ssp. silvaticum (MAS)

[3].

MAP was first isolated and suggested as the causative agent of paratuberculosis in

ruminants in 1912 by Twort and Ingram [4]. MAP is an acid-fast, aerobic, gram

positive rod shaped bacillus, nonmotile and nonsporing. The acid-fast phenotype

derives from a thick, waxy cell wall, which is typical to all mycobacteria [5-7] and

protects them from host cell mediated microbial killing and antimicrobial treatments

(e.g. low pH, antibiotics, host cell defence mechanisms). MAP belongs to the group

of slow growing mycobacteria, which encompasses the majority of pathogenic

mycobacteria, e.g. M. tuberculosis (MTB) and M. leprae. This characteristic

separates pathogenic from nonpathogenic fast growing species. MAP exhibits an

extremely slow growth with a generation time of 24-48 h [8]. Moreover, in contrast to

the other members of MAC, MAP is fastidious in culture and requires specific media

and supplements, such as the iron loaded mycobactin when grown on egg yolk

containing media [9]. Mycobactin dependence is exclusively found in MAP strains but

lost after several passages in laboratory media, due to adequate iron concentrations

[10].

In the host, MAP shows an exceptional tropism to the gastrointestinal tract [11-14].

This is in contrast to other pathogenic mycobacteria such as species of the

MTB complex (MTBC) and the remaining members of the MAC. They primarily infect

the respiratory tract but may also cause infection of the intestinal tract with

consecutive dissemination and systemic infection. However, MAP infection is local

for long times, suggesting that MAP executes a completely different strategy of

infection.


19

1.1.1 MAP genetics

Mycobacteria are microorganisms with a high content of guanine (G) and cytosine

(C). The MAP genome has a size of 4.83 Mb, displays a GC-content of 69.3% and

contains 4,350 open reading frames (ORF) [3,15]. MAV with a genome size of 5.48

Mb is the most closely related subspecies to MAP. Both genomes share 98 to 99%

identity when comparing gene homologies [3]. However, despite the close

phylogenetic resemblance the M. avium subspecies (MAV, MAH, MAS and MAP)

display important genetic differences. Recombination, deletion and re-arrangement

events during evolution of the different subspecies resulted in the presence or

absence of genomic islands, which might explain phenotypical differences as well as

differences in pathogenesis and host tropism [16,17]. Until now, 25 characteristic

inter- and intrasubspecies large sequence polymorphisms (LSPs) were discovered in

M. avium ssp. [17-20]. Sixteen of these LSPs are lineage specific for MAP. Of these,

8 are present (LSPP) or absent (LSPA) in all tested MAP isolates and thus constitute

the core LSPs. LSPA8, present in other M. avium ssp., was lost in MAP, whereas

LSPP2, 4, 11, 12, 14, 15, 16 (insertions) are exclusively found in MAP. LSPP14 and

LSPP15 are predicted to be involved in metal dependent regulation, transport and

homeostasis. LSPP14 (map3725-3764) includes an earlier identified 38kb

pathogenicity island [19], comprised of three gene clusters: fepABCD (map3726-

3729) for siderophore uptake, mptABCDEF (mycobacterium paratuberculosis

transporter map3731c-3736c) encoding for two putative ABC-transporters (mptABC,

mptDEF) and sidABCDEFG which shows homologies to proteins for siderophore

biosynthesis (map3739c-45). Some of the genes were very recently shown to be

associated to virulence [21,22]. In addition, mptABC was proposed to represent an

iron-uptake transporter similar to the iron transporter IrtAB in MTB [23].

Furthermore, MAP exhibits a subspecies specific genetic diversity, which is partly

displayed by the presence and absence of the remaining 8 MAP specific insertions

LSPA9-I, LSPA4-II, MAV-14, LSPA18, LSPA20, LSPP9, VA15 and LSPA11 [17]. In

addition, different MAP subtypes have been described, depending on their host

preference. Hence, they have been classified as type S (sheep / type I), type C

(cattle / type II), type B (bison) and an intermediate type III [24,25]. Strains of the

sheep lineage (type S) are missing LSPA20 and LSPP9, whereas MAV-14, LSPA18,

LSPA4-II and LSPA9-I are absent from cattle strains (type C) [17].


20

1.2 Paratuberculosis

1.2.1 Course of infection and clinical symptoms

MAP is the causative agent of paratuberculosis - or Johne‟s disease (JD) - first

described by Johne & Frontingham in 1895 [26]. Infection leads to a chronic,

incurable granulomatous enteritis, primarily affecting the distal jejunum of the small

intestine of domestic and wildlife ruminants, with cattle, sheep and deer being the

most common hosts [27-29]. However, the host spectrum has recently been

extended to omnivores, carnivores, aves [30], rodents [31], camelides [32] and non-

human primates [33]. In addition to that, MAP was proposed to be involved in the

development of unclear immunological disorders in humans, such as Crohn's disease

(CD) [34-36]), diabetes type I [37,38], multiple sclerosis [39] and autoimmune

thyroiditis [40].

In cattle, MAP infection occurs in neonates or typically during the first 6 month of life.

Young calves are highly susceptible to infection, due to their incompletely developed

immune system [14,41]. The disease is then characterized by different stages. A long

subclinical phase of approx. 2-5 years is subdivided in a silent infection without

bacterial shedding, followed by intermitting bacterial shedding by inapparent carriers.

Leading symptoms of the following clinical phase are weight loss and intermittent

diarrhoea with high bacterial load. The advanced state of disease is characterized by

ceaseless diarrhoea, rapid weight loss, decreased milk production and general

wasting. Pathological changes such as a thickened gut wall [42] and non-caeseous

granulomatous inflammation in the submucosal tissue are found preferentially in the

terminal part of the small intestine [43]. Since there is no effective treatment

available, infected animals finally decease from cachexia or dehydration [44-46].

1.2.2 Pathogenesis of paratuberculosis

Infection with MAP occurs typically via the fecal-oral route, mainly during the

neonatal period by MAP contaminated milk, water or pasture [45]. Also, horizontal

transmission has been suggested [47,48]. After ingestion, MAP passes the gastric

tract. During the passage, expression of surface proteins such as fibronectin

attachment protein (FAP) is activated [49], allowing opsonization of MAP by


21

fibronectin and, upon arrival at the intestinal target tissue, subsequent binding to

fibronectin receptors (integrins) of the host cell [50]. MAP then enters the epithelium

by invasion of enterocytes or of microfold M-cells in the Peyer‟s Patches [51-54].

More recently, the entry of MAP via goblet cells was suggested [55]. After breaching

the enterocyte layer the bacterium is taken up by phagocytes, in particular naïve

subepithelial macrophages, in which MAP is able to persist and replicate inside the

phagosome [56]. Later in infection MAP spreads through the mucosal tissue and

causes inflammation which leads to the typical picture of a diffuse granulomatous

inflammation with high numbers of infected macrophages and giant cells [27].

1.3 Host cell defence mechanisms against invading bacteria

1.3.1 Macrophages – phagosome-lysosome fusion

Invading bacteria constitute a potential thread to the host as they might cause

infection. Thus, the immediate recognition and elimination of bacilli by the innate

immune system is of major importance. Professional phagocytes such as neutrophils,

macrophages and dendritic cells represent the first line of defence. They recognize

foreign microbial structures (pathogen-associated molecular patterns [PAMP],

microbial-associated molecular patterns [MAMP]) such as cell wall proteins,

lipoproteins, carbohydrates (e.g. mannose) or bacterial DNA by either surface

exposed or intracellular receptors, collectively referred to as pattern recognition

receptors (PRR) and promote phagocytosis or activate downstream signaling

processes [57-59].

Usually, bacilli recognized and internalized by resident macrophages (amongst

others) are enclosed in a phagosome which matures to the phagolysosome. During

the maturing process from early to late phagosome and lastly phagolysosome, the

phagosomal microenvironment is drastically altered. A continuous acidification is

generated by the vacuolar-type V-ATPase. Surface exposed molecules such as

small Rab GTPases, regulators of distinct steps in membrane traffic pathways [60],

and lipid second messengers are acquired or lost in the stepwise fusion process with

endosomal compartments. The phagolysosome is then enriched with various

antimicrobial effectors such as degrading enzymes and toxic peptides as well as

hydrolases, which are activated at low pH and lead to degradation of the pathogen


22

[61-63]. Peptide fragments are then presented on the host cell surface to T-cells and

B-cells which in turn increase the humoral and cellular immune response by

secreting cytokines such as interferones (IFN), interleukins (IL) or antibodies [64].

These signals result in the recruitment of periphery macrophages and other immune

cells and amplification of the immune response.

In addition to the above described processes, the contemporarily production of toxic

reactive nitrogen (RNS) or oxygen species (ROS, oxidative burst) [65] is another

major strategy of macrophages and other phagocytes to combat intracellular

bacteria. RNS and ROS are comprised of highly reactive molecules such as nitric

oxide NO, superoxide anion O2- and the hydroxyl radical OH- as well as more stable

oxidants like hydrogen peroxide (H2O2). Products of both groups (RNS/ROS) are

normally generated during metabolism and play an important role in homeostasis and

cell signaling [66-68]. However, enriched in the phagosome they represent effective

anti-microbial measures [69]. Upon infection, macrophages exhibit elevated levels of

RNS and ROS. This is achieved by enzymes such as nitric oxide synthase 2

(NOS2/iNOS) and NADPH oxidase 2 (NOX2), located in the phagosomal membrane

[70] or by the NADPH-dependent NOX2 phagocyte oxidase complex [71]. Expression

of these enzymes is further enhanced by various growth factors or cytokines such as

IFN-γ, tumor necrosis factors TNFα/β and/or bacterial compounds [67,72,73].

Intracellularly, O2- is in general rapidly converted to H2O2 or reacts with NO to

peroxinitride, which is highly toxic to bacteria.

Toxicity derives e.g. from inactivation of enzymes via oxidation of iron sulfur clusters

[4Fe–4S] or structural iron which may then lead to crucial impairment of biological

processes. Moreover, H2O2 can damage DNA as it also reacts with loosely

associated free ferrous iron (Fe2+) [74]. Overall, macrophages display a variety of

mechanisms to fight invading bacteria and especially RNS and ROS can cause

severe damage in bacteria if they are not equipped with appropriate defence

mechanisms.

1.3.2 Pathomechanisms and intracellular survival of MAP in

macrophages

Mycobacteria are taken up by subepithelial macrophages and intracellular

persistence is a major characteristic of all pathogenic mycobacteria. Thus, they are


23

able to circumvent microbial killing mechanisms of phagocytic cells. The mechanisms

behind this ability have been extensively analysed in MTB and MAV [75-80].

However, they are not completely resolved and only some of these evasion

mechanisms have been investigated in MAP [81,82]. Nevertheless, it can be

assumed, that these evasion mechanisms can be transferred to MAP.

The uptake of mycobacteria by macrophages is mediated by different ways. They are

internalized after binding to receptors such as immunoglobulin receptors (FcR),

mannose receptors, scavenger receptors or complement receptors CR1, CR3, CR4

[83,84]. Depending on the route of entry, different immune response patterns are

activated. For instance, the uptake of bacteria by CR3 results in a reduced

macrophage activation, including a reduced production of reactive nitrogen (RNS)

and oxygen (ROX) species [85-87]. It has been shown, that mycobacteria

preferentially enter macrophages by the complement receptor CR3 [88,89].

Consequently, favouring this type of entry seems to enhance mycobacterial and thus

MAP survival in macrophages, possibly by the prevention of high RNS/ROX

production.

The oxidative burst in macrophages is also inducible by IFN-γ. However, IFN-γ

induced stimulation of MAP infected macrophages is strongly impaired by so far not

completely resolved mechanisms [90] and thus also contributes to intracellular

survival of MAP. A possible mechanism was described for MAH: infection of

macrophages caused down-regulation of the IFN-γ receptor and thereby impaired

STAT (Signal Transducer and Activator of Transcription) signaling pathways and

downstream gene transcription [91].

However, even if exposed to RNS and ROX, mycobacteria are equipped with

defence systems that prevent damage. Oxidative DNA damage in MTB is supposed

to be avoided by the histone like protein Lsr2 by binding to the DNA and acting as a

physical barrier by reducing the accessibility of DNA to RNS/ROX [92]. As

neutralizing components against oxygen intermediates, MTB and MAP express two

superoxide dismutase proteins (SodA/C), as well as catalase peroxidase KatG, alkyl

hydroperoxid reductases AhpC/D and the thioredoxin proteins TrxA/B [93-97].

SodA/C, KatG and AhpC/D are metal dependent, either on structural level or the

expression of the corresponding genes is controlled by metal dependent regulatory

proteins such as the ferric uptake regulator (FUR) family members FurA and PerR as

well as the LysR-family regulator OxyR [98-100]. A more detailed picture of stress


24

response regulators is given in the introduction of Chapter 3. In addition,

mycobacteria produce mycothiol, which is oxidized and prevents oxidation of other

molecules [101].

Mycobacteria are able to arrest phagosome maturation [102-107]. They are able to

circumvent acidification, indicated by the lack of recruitment of V-ATPases to the

phagosome. Furthermore, the arrest of phagosomal maturation is indicated by

prevention of the acquisition of important phagosome-lysosome fusion markers such

as lysosome-associated membrane protein LAMP2 [56] and decreased levels of

LAMP1 [108]. Moreover, it was found that pathogenic mycobacteria inhibited

phagosome-lysosome maturation by secretion of a eukaryotic-like serine/threonine

protein kinase (PknG) by a yet unknown mechanism [109,110]. Also, the

mycobacteria specific cell wall component lipoarrabinomannan (LAM) was proposed

to inhibit calcium and Rab dependent recruitment of the phosphatidylinositol 3-kinase

(PI3-kinase) and subsequent activation of the phosphatidylinositol 3-phosphate

(PI3P). Both proteins are essential for the formation of phagolysosomes [111-113].

Interestingly, inhibition of the proinflammatory response and arrest of phagosome

maturation is supposed to be zinc dependent in MTB, as the lack of the zinc

dependent metalloprotease Zmt1 resulted in increased phagosome maturation [114].

Furthermore, Kelley and Schorey (2003) demonstrated that an adequate

intraphagosomal iron concentration is required for mycobacteria to maintain the block

of phagosome maturation [115]. Thus, the availability of intracellular iron or zinc is

crucial in mycobacterial pathogenicity.

1.4 Metal homeostasis at the host-pathogen interface

Metabolic adaptation to nutrients provided by the host is an essential skill for

pathogenic microorganisms. Therefore, limitation and accumulation of nutrients by

the host are decisive processes in host-pathogen interaction and successful

infection. Hence, pathogenic bacteria are equipped with systems to either acquire

necessary nutrients or to counteract intoxication.

The process of active limitation or accumulation of important cellular or intracellular

nutrients as a host cell defence mechanism is referred to as nutritional immunity.

Initially, this term was only used for iron starvation [116] but following it was further


25

extended for zinc (Zn2+), manganese (Mn2+) [117] and other transition metals as well

as other nutrients [118-121].

Nutritional immunity is best established for iron. Thus in the host, extracellular iron is

depleted by sequestration to host cell proteins such as haem, the cofactor of

haemoglobin, transferrin or lactoferrin [122] (see section 1.6). Depletion is triggered

after host infection by a cascade of signals, e.g. IL-6 secretion in response to

infection. IL-6 activates immune effector cells and leads to increased expression of

hepatocytic acute phase proteins, such as the hormone hepcidin [123,124]. IL-6

triggers induction of STAT3 (signal transducer and activator of transcription 3), which

subsequently binds to the promoter region of hepcidin and induces its transcription.

Hepcidin in turn reduces the expression of the iron exporter ferroportin-1 (Fpn-1)

[125], commonly found in the cell membrane, causing withdrawal of iron from

extracellular bacteria. In addition, bacterial iron scavenging mechanisms, such as the

high affinity iron chelating siderophores (see section 1.8), are antagonised by the

host cell protein lipocalin-2 which can bind different types of siderophores [126,127].

Intracellularly, iron can be bound by the storage protein ferritin [128].

Intraphagosomal depletion of iron and other metals is achieved by natural resistance

associated membrane protein NRAMP1 transporters [118]. Furthermore, the afore

mentioned transporter Fpn-1 was also found to be induced and translocated to the

phagosomal membrane upon mycobacterial infection [129], thus diminishing

intraphagosomal iron concentration.

Zinc restriction has been observed in infected host cells and it is now clear, that this

mechanism adds to nutritional immunity. However, only few mechanisms are known.

The antimicrobial protein calprotectin is produced mainly by neutrophils and able to

extracellularly bind Zn2+ and Mn2+ upon dimerization [130,131]. It was found to create

metal starvation during infection, thereby controlling bacterial survival and replication

[117]. Intraphagosomal zinc depletion is supposed to be mediated by the increased

expression of transporter ZIP8, which transports zinc from the phagosome to the

cytosol [132,133]. Recently, an active zinc shuttle from the phagosome to the Golgi-

apparatus upon macrophage infection with Histoplasma capsulatum was observed. It

was linked to downstream regulation of NADPH, which resulted in an increased

production of ROS and thus acidification of the phagosome [134].

Apart from metal restriction, intoxication of intracellular bacteria is the other strategy

of nutritional immunity, an intriguingly new field of host cell defence which has


26

emerged only recently. Accumulation of phagosomal metal ions is mediated either by

transporters such as copper transport 1 (CTR1) [135] or by mobilization of storage

proteins. In this context, the role of NRAMP1 was extended by an importer function,

thereby contributing to an increased intraphagosomal metal concentration [136]. In

the case of Zn2+, importers of the ZnT-family are proposed to support the toxification

of microorganisms [137].

The consequences of higher metal ion concentrations are tremendous for the

bacterial cell. Increased levels of reactive transition metals such as iron or copper

bear a great toxic potential. Superoxide anions (O2-), which are released during the

oxidative burst, are rapidly converted to H2O2 by superoxide dismutases (Sod). H2O2

then can further react with ferrous iron (Fe2+) or copper (Cu+) to even more toxic

radicals ·HO + OH− by the Fenton and Haber-Weiss reaction [138]. Zinc per se is not

as reactive as Fe2+ or Cu2+; however, it can be highly toxic at elevated

concentrations, as it tends to interact with thiols, perturbs enzyme function and thus

inhibits pivotal biological reactions [139]. Toxicity can also be mediated by

competitive binding of transition metals to proteins. For instance, Cu2+ possesses,

according to Irving and Williams, the highest binding affinity to proteins [140]. Excess

of this metal and also Zn2+ and Mn2+ [118,141] leads to inappropriate binding,

associated with nonfunctional proteins and finally perturbation to bacterial physiology.

Therefore, bacteria have developed mechanisms to counteract nutritional immunity.

1.5 Bacterial strategies counteracting nutritional immunity

Examples for counteracting nutritional immunity within intraphagosomal persisting

mycobacteria was shown for MAP [142,143], MTB and MAV [144]. Weigoldt and

colleagues identified the adaptation of MAP to the host cell nutritional environment by

an altered metabolism. Wagner et al. found, that iron, zinc and other transition metals

were depleted from the phagosome early during infection [144,145]. In fact,

pathogenic mycobacteria have evolved several mechanisms to maintain a balanced

metal concentration and overcome nutritional immunity. In contrast, non-pathogenic

mycobacteria are not able to restore homeostasis in macrophages, as shown for

M. smegmatis (MSMEG) [144]. Mechanisms to counteract nutritional immunity are for

instance manipulation of host cell gene expression, e.g. of the divalent metal


27

transporter-1 (DMT-1/NRAMP2), which increases the availability of intracellular metal

ions [146]. In addition to the manipulation of host cell iron acquisition systems,

mycobacteria are able to utilize iron bound to host cell proteins lactoferrin [147],

cytoplasmatic iron pools [148], haemoglobin [149,150] and intraphagosomal

transferrin [151,152]. Moreover, they express own metal importer and systems to

counteract starvation or intoxification [153,154], as described in section 1.8.

Especially during starvation events, inducible specific metal transporters and

scavenging systems such as high-affinity chelators, which are tightly regulated by

metal sensing proteins, are utilized [155,156]. The mechanisms concerning

intracellular metal concentration are addressed in section 1.8 and 1.9.

1.6 Relevance of iron and zinc in the host

Iron and zinc are the most abundant and most important transition metals in the cell

[157,158]. Both ions are essential for many fundamental biological processes such

as enzymatic reactions, respiration, gene expression, oxygen transport and synthesis

of nucleic acids (DNA/RNA). Therefore, they are crucial for survival of both, the host

cell and the invading bacterium and therefore for successful infection [159,160].

Two chemical conditions are common for iron; it occurs either in the reduced ferrous

(Fe2+) or oxidized ferric (Fe3+) form. The biological active Fe2+ is, due to its reactive

potential, unstable under aerobic conditions. Therefore, free cytosolic iron can be

highly toxic, as it can catalyze the formation of ROS via the Fenton and Haber-Weiss

reaction [161]. For this reason, iron is mainly sequestered into host proteins. Fe2+ can

be sequestered extracellularly by haem. However, the majority of Fe2+ molecules is

oxidized at physiological pH to Fe3+ and bound extracellularly by transferrin,

lactoferrin and intracellularly by the storage protein ferritin [128]. Sequestration

reduces the accessibility of iron in the host to a minimum. To make use of the iron

sequestered in extracellular proteins, cells have developed receptors and uptake

systems. For instance macrophages express the transferrin receptor-1 (TfR1) to

bind, internalize and intracellularly utilize transferrin [162].

Zinc (Zn2+) is an exceptional transition metal, as it, other than iron, manganese,

copper or nickel, is redox stable and does not prone to reactivity. Therefore, it is a

structural component in numerous proteins and a cofactor for catalytic and regulatory

mechanisms. Approximately 8.8% of the eukaryotic proteins contain Zn2+ binding


28

sites [163]. Of these, approx. 50% constitute Zn2+ containing enzymes and approx.

44% Zn2+ dependent transcription factors [164]. This high number of important Zn2+

dependent proteins illustrates the essentiality of this particular ion. However, Zn2+

exhibits a high tendency to build complexes and bind proteins with a very strong

affinity. Referred to Irving and Williams, this affinity is only exceeded by Cu2+ [140].

Thus, to prevent inappropriate binding, the intracellular pool of free Zn2+ is

maintained particularly low. Several studies demonstrated free levels of Zn2+ in a

nano- to picomolar range, even though the total concentration of Zn2+ in eukaryotic

and prokaryotic cells is in the submillimolar range [165]. Similar to iron binding

proteins, Zn2+ can also be sequestered by host derived proteins such as the earlier

mentioned calprotectin. In addition, the presence of zinc storage vesicles was

proposed and designated as “zincosomes” [166,167].

1.7 Relevance of iron and zinc in virulence and pathogenesis

of bacteria

As stated above, iron and zinc are essential for pathogenic bacteria to survive in the

host [159,160,168,169].

Iron is important in many fundamental bacterial metabolic processes such as

enzymatic reactions, respiration, gene expression, oxygen transport and synthesis of

nucleic acids (DNA/RNA). Also important virulence associated enzymes such as

SodA, KatG, AhpC and TrxA/B of MTB and MAP for the detoxification of radicals

released during oxidative burst (see above section 1.3) are iron dependent.

Also for bacteria zinc is an essential cofactor of a large number of proteins. For

instance >3% of the E. coli proteome contains Zn2+ [170] and 5% of all bacterial

proteins harbour Zn2+ binding sites [163]. Many bacterial enzymes are

metalloenzymes which either contain metals as structural components or catalyze

reactions as metal cofactors. Interestingly, the Zn2+ associated proteome of

prokaryotes consists of approx. 80% Zn2+ dependent enzymes, which by far exceeds

the number of Zn2+ dependent enzymes in the host [164]. Thus, in comparison to

eukaryotes, the role of Zn2+ in prokaryotic gene regulation seems to be considerably

lower but more important in enzymatic reactions.


29

Moreover, Zn2+ in bacteria is involved in several other crucial processes, such as

oxidative stress response, antibiotic resistance and DNA repair [171-173]. For

instance, detoxification of ROS and ROX released during oxidative burst is not only

mediated by iron dependent enzymes but also by a Cu2+/Zn2+ dependent superoxide

dismutase (SodC), important in the neutralization of superoxide anions in E. coli and

MTB [94,174].

These mechanisms point out the relevance of iron and zinc in microbial survival. In

consequence, pathogenic bacteria had to develop mechanisms to control and

regulate metal homeostasis.

1.8 Metal transport and -storage in gram positive bacteria

As stated above, during infection bacteria are confronted with a hostile environment.

Due to its toxic and reactive nature, free iron in host cells is exceptionally rare and

also zinc is mainly incorporated in proteins to avoid inappropriate binding by

competitive effects. Moreover, during bacterial infection the concentration of available

ions is even lower, as host cells actively alter metal homeostasis, thereby creating

nutritional immunity [117-121]. On the other hand, also metal excess has to be

prevented. Hence, especially pathogenic bacteria have developed mechanisms to

efficiently regulate metal homeostasis, to overcome metal starvation, to maintain

continuous supply [175] or to avoid toxification.

To facilitate iron uptake especially in times of starvation, most bacteria are able to

produce at least one type of low molecular weight molecules (200 – 2,000 Da),

termed siderophores [176]. Even though identified in environmental and pathogenic

microorganisms, siderophores were found to contribute to virulence in several

bacterial species [177]. The chemical structures of siderophores are greatly different;

however, almost all components are soluble and exhibit an extremely high affinity for

Fe3+ with a stability constant of approx. 1030 M-1 [178]. The most prominent candidate

is the enterobactin of Enterobacteriaceae [179]. Other examples for siderophores are

desferroxamines, which are also applied for therapy of several diseases, e.g. iron

intoxication, and coelibactins of Streptomyces spp. [180].

Three types of siderophores are described for mycobacteria: the lipophilic and cell

wall associated mycobactins, as well as the soluble carboxymycobactin (released by

pathogenic mycobacteria) and exochelins (released by non-pathogenic


30

mycobacteria) [181,182]. Carboxymycobactin captures free iron or iron from host cell

proteins and is directly taken up by the transporter IrtA/B or transferred to mycobactin

[183]. In addition, the mycobacterial typeVII-secretion system ESX-3 is proposed to

be important in mycobactin depenent iron acquisition [184].

Maximum biosynthesis of mycobactins in MTB occurs by induction of the

corresponding gene cluster mbt1 and mbt2 under iron deprived conditions [15].

Proteins encoded by mbt1 (mbtA-J) are involved in siderophore synthesis, whereas

mbt2 encodes for enzymes for siderophore modification and transport [185].

Recently, the presence of monodeoxy forms was discovered by Madigan et al. 2012

and the role of mbtG was proposed to contribute to converting deoxymycobactins to

mycobactin [186]. Mycobactins were found to be essential for full virulence and

intracellular growth of MTB [156,187,188] as they allow accessibility of iron bound to

host cell proteins such as transferrin and lactoferrin [189]. This iron scavenging

mechanism is however not applicable for MAP (see Introduction Chapter 3).

Other transporters involved in mycobacterial iron uptake are Fe-transporting ATP

binding cassette (ABC) complexes FecB and FecB2 [190] as well as Mramp, a

protein similar to NRAMP1 in host cells [191].

To control iron excess, mycobacteria generally utilize storage proteins such as

bacterioferritin like proteins (bfrA/B) [128]. In addition, siderophore export by

mycobacterial membrane protein MmpS4/5, the earlier mentioned IrtA/B and

Rv2895c in MTB [188,192] has been described and might contribute to detoxification

during infection.

Zinc homeostasis is maintained by a variety of different transporter systems,

including importers, exporters and permeases. Passive zinc uptake is mediated

mainly by unspecific channels, but can also be an active process by constitutively

expressed low affinity membrane potential-dependent transporters of the zinc

importer (ZIP)-family [173,193], supported by ZupT and P-type ATPases [154]. In

addition to these unspecific and unregulated permeases, starvation inducible high

affinity Zn2+ importers are expressed by many bacteria. The best characterized Zn2+

importer is the ZnuABC transporter. This ABC-transporter was first described for E.

coli (Patzer and Hantke 1998) and later also for cyanobacteria and streptococci

[194]. ZnuABC is an important virulence factor in E. coli [195], Salmonella enterica

[196], Acinetobacter baumanii [197] and Campylobacter jejuni [198] and others [199].


31

The ABC-transporter TroABCD of Treponema palladium [200] is another example for

a high affinity Zn2+ uptake system in pathogenic bacteria. Maçiag et al. 2007 reported

the presence of homologues to the low-affinity zinc transporter YciC, ZnuAB and

TroA [201] and their regulation by the FUR-like regulator Zur (FurB) in MTB. In

addition, recently the ESX-3 system important in iron homeostasis was also found to

be necessary in zinc uptake in MTB [202].

Similar to siderophores for iron uptake, the presence of zinc scavenging systems was

described for Candida albicans and S. coelicolor. Other than siderophores these

“zincophores” are complex proteins that are able to bind Zn2+ with a high specificity

and affinity [199,203]. However, to date no additional zincophore was identified. Due

to the importance of zinc in bacterial survival and the low availability, it is likely that

other bacteria utilize so far unknown molecules for zinc scavenging.

Proteins for zinc storage have been described for only very few species, e.g. the

metallothionein SmtA in cyanobacteria [204]. Obviously, an excess of cytosolic zinc

is rather counteracted by the expression of exporter systems. Zinc exporters

expressed by bacteria are subdivided in three categories: the cation diffusion

facilitators (CDF) family, the superfamily of resistance–nodulation–cell division (HME-

RND) and the P-type ATPase family [154]. The P1-type ATPase ZntA of E. coli was

found to be critical for zinc tolerance [205]. In mycobacteria, so far only few zinc

transporter systems have been described. However, several P-type ATPases

including CtpC, metallothioneins and the zinc exporter ZnT1 of MTB were found to be

induced upon infection [141,206] and contribute to circumvent Zn2+ intoxification.

ZitA, a CDF member in MSMEG [207] was found to be crucial in zinc resistance and

induced at elevated zinc concentrations in MTB [208].

1.9 Regulation of metal homeostasis in bacteria and

mycobacteria

The expression of high affinity metal systems such as transporters or scavenging

systems is generally tightly regulated by metal sensing proteins, so called

metalloregulators - proteins which bind metal cofactors to regulate gene expression

[209,210].


32

1.9.1 Regulators of iron and zinc homeostasis

Regulation of iron homeostasis in bacteria is maintained by family members of

different metalloregulators; such as DtxR (Diphteria toxin Repressor), SirR

(Staphylococcal iron regulatory Repressor) or the FUR (Ferric Uptake Regulator)

family [211]. Zinc homeostasis is mainly controlled by MerR-like (Metal responsive

Regulator) such as ZntR of E. coli [212] and ZccR of Bordetella pertussis [213],

ArsR-like repressors (Arsenite sensitive Regulator) such as SmtB and CzrA [214] or

by another member of the FUR family. Detailed information about the latter regulator

family is given in the section below.

In mycobacteria IdeR as a member of the DtxR family [215] seems to be of major

importance as it is essential for mycobacterial survival [216]. IdeR is a global iron

dependent regulator involved in iron metabolism but also in metabolic processes. It

controls the expression of genes encoding for metal uptake (IrtA/B, mbt) and storage

proteins (bfr) as well as genes for biosynthesis of cell wall components (acpP, murB)

[217], virulence (Esx-5, antigen-85) and ribosomal genes [218]. In addition, it has

been shown to be involved in virulence and oxidative stress [219]. The role of a

mycobacterial homologue to the SirR regulator, which controls an iron-uptake

transporter in Staphylococcus epidermidis [220], is unknown. At present, two different

FUR-like proteins are described for mycobacteria, FurA and FurB (see section 1.9.2).

1.9.2 Ferric uptake family (FUR) regulators

Proteins of the ferric uptake regulator (FUR) family are distributed in more than 4000

bacterial species [221]. The best characterized FUR-like regulator is the iron

dependent Fur, which was first described in E. coli [222] as a regulator of approx.

100 genes involved in iron homeostasis, general metabolism [211,223] and which

possibly operates mechanisms beyond regulation [221]. In addition to Fur, other

members of this family have been identified in recent years. They include Mur

(manganese uptake), Nur (nickel uptake), Irr (haem-dependent iron responsive

regulator), PerR (peroxide stress response) and Zur, which is involved in regulation

of zinc uptake.

All FUR-like proteins share a similar size of 120 amino acids in average and are

characterized by a common histidine-rich motif. Moreover, all FUR-like proteins


33

exhibit a similarity in folding and two to three metal binding sites with either structural

or regulatory character [221]. Each FUR monomer consists of a winged-helix DNA

binding domain (DB) at the N-terminus, a dimerization (D) domain at the C-terminus

and a hinge loop in between. Dimerization is a characteristic of FUR family members,

as shown in crystallization experiments [224-226], and is mediated by the structural

metals. Binding of homodimers to the DNA occurs by interaction with a certain metal

at the regulatory binding site and triggers regulatory mechanisms (see below).

Despite these similarities among FUR-like proteins, the associated metal cofactors

for regulation, as well as the regulated genes are different. Fur (in many cases)

requires Fe2+ for functional binding [227], Mur is activated by Mn2+ [228], whereas

Nur requires Ni2+ as a cofactor [229]. The iron responsive regulator Irr is common in

α-proteobacteria and interacts with haem rather than Fe2+ [230]. PerR was first

described in B. subtilis and is an iron dependent sensor of peroxides [231]. Finally,

Zur is a Zn2+ dependent regulator in many bacteria, important in zinc homeostasis

(see also Introduction of Chapter 4). Apart from the regulatory function in Zur, Zn2+ is

the metal which is used as a structural component in many FUR-like proteins. For

instance, Fur in E. coli and Vibrio cholera and PerR in B. subtilis require one

structural zinc atom per monomer [226,232,233]. Zur in MTB, B. subtilis and

S. coelicolor possesses two structural zinc binding sites in addition to the regulatory

zinc atom [225,234,235].

As stated above, the regulatory metal cofactor is required for protein-DNA interaction,

even though DNA binding of apoforms has been described. It has been shown, that

the presence of the metal ion causes conformational changes of the protein, allowing

dimer formation and binding to the DNA. DNA-binding sites have been identified for

FurA, Zur and PerR [201,236-238]. In general these binding sites are palindromic

sequences which can vary between species. For instance, the Fur box of E. coli is a

19-bp consensus sequence GATAATGATAATCATTATC [239] which is different to

the 15-bp Fur binding site of B. subtilis TGATAATNATTATCA [236,237]. However,

DNA binding sites of different FUR-like proteins in one species are often conserved

and show only small but sufficient differences, as shown for B. subtilis Fur, PerR and

Zur [237].

Several modes of action have been described for FUR regulators. The classical

mechanism is repression of gene transcription upon binding of a FUR dimer to a

conserved motive in the operator regions of target genes, thereby blocking RNA-


34

polymerase binding [238,240]. However, also activation of gene transcription by

FUR-like regulators has been described, e.g. for V. cholerae or Neisseria

meningitidis [241,242]. Furthermore, recently it has been found that not only metal

loaded proteins but also apo-proteins can fulfill both ways of regulatory function,

activation or repression [243,244]. Interestingly, also an indirect regulation of genes

by FUR-like regulators has been described. Hence, activation of genes can be

mediated by a small untranslated RNA (sRNA), which is directly repressed by Fur

and post-transcriptionally controls the expression of proteins by binding to and

degradation of target messenger RNA (mRNA). An example for this is the sRNA rhyB

in E. coli, which controls the expression of proteins involved in metabolism [245].

As mentioned earlier, the mycobacterial genome harbours two genes for FUR

homologues, namely FurA and FurB. The role of the FurB is clearly defined. In MTB,

FurB (Zur) was shown to be responsible for the control of zinc homeostasis in

concert with the cotranscribed regulator SmtB. Both regulators are zinc dependent,

act antagonistically and regulate the expression of zinc transporters

[201,208,221,246-249]. Moreover, a conserved consensus sequence for Zur binding

was identified [201]. However, the role of FurA in mycobacteria is unclear. Yet, the

co-transcription of furA with katG implies a possible role in oxidative stress response.

Nevertheless, no evidence for this hypothesis was given so far (see Introduction

Chapter 3).

1.10 Aims of the study

As stated above, two FUR-like proteins are present in mycobacteria. FurA and FurB

share only 25% sequence identity and seem to execute completely different

functions. FurB in MTB was identified as the major regulator in zinc homeostasis. In

contrast, the role of FurA in mycobacteria has not yet been identified. A role in stress

response is suggested. At present, no studies on the role of these two regulators in

MAP have been conducted. Since maintenance of physiological metal concentration

is a crucial step in bacterial survival and virulence, the aim of this thesis was to clarify

the impact of FurA and FurB on MAP stress response and metal homeostasis.

Material and Methods Chapter 2

35

Chapter 2

Materials and Methods

Chapter 2 Materials and Methods

36

2.1 Materials

All chemicals were purchased from Sigma-Aldrich (Munich, Germany) if not stated

otherwise. Bacterial strains, oligonucleotides (Eurofins Genomics, Ebersberg,

Germany), plasmids and phages are listed in Tables 1-3.

Table 1: Bacterial strains used in this study

Bacterial strains Description Source/ reference

E. coli DH5aF' F'/endA1 hsdR17 (rk- mk- supE44 thi-1 recA1 gyrA (Nalr relA1 D(lacZYA-argF)U169 deoR [f80dlacD(lacZ)M15]

[250]

E. coli HB101 K-12 derivative, supE44, hsd20, rBmB, recA13, ara-14, proA2, lacY1, galK2, rpsL20, xyl-5, mtl-1

[251]

M. smegmatis mc2155 Transformable strain of the isolate

M. smegmatis ATCC 607 [252]

M. smegmatis∆furB markerless furB (msmeg4487c) deletion mutant

of M. smegmatis mc2155

this work

M. avium ssp. paratuberculosis DSM44135

clinical isolate of a decontaminated dung sample of a paratuberculosis infected cow, DSM44135

[253]

M. avium ssp. paratuberculosis ΔfurA

furA (map1669ca) deletion mutant of

M.avium ssp.paratuberculosis DSM44135 Eckelt et al. subm.

M. avium ssp. paratuberculosis ΔfurA/pMAP-furA1101

furA (map1669ca) deletion mutant of

M.avium ssp.paratuberculosis DSM44135 with integrated pMAP-furA1101

Eckelt et al. subm.

Table 2: Oligonucleotides used in this study

Oligonucleotides Description or sequence (5’ to 3’) Source/ reference

oFurA1 AGTCTTAAGCCGCAACTACACGCTGACGA (forward primer situated at position 1824986-1825005

a,

AflII restriction site underlined)

[254]

oFurA2 AATTCTAGAGTCGATGACACCGCACCAGA (reverse primer situated at position 1823983-1824002

a,

XbaI restriction site underlined)

[254]

oFurA3 AGTCTCGAGGCTCGACGGCAGGTTCTTGA (forward primer situated at position 1823553-1823572

a,

XhoI restriction site underlined)

[254]

oFurA4 ATTACTAGTGTACAGGGTCTCCAGGAAGG (reverse primer situated at position 1822479-1822498

a,

SpeI restriction site underlined)

[254]


37


oMAP-furA K1 GATCAAGCTTGTGACGCAGCTCATTGGACATCCG (reverse primer situated at position 1824058-1824081

a,

HindIII restriction site underlined)

[254]

oMAP-furA K2 TCGATCTAGATCAAGAACCTGCCGTCGAGCAC (reverse primer situated at position 1823553-1823574

a,

XbaI restriction site underlined)

[254]

oGapDHfw ATCGGGCGCAACTTCTACC (forward primer situated at position 1221936-1221954

c)

[255]

oGapDHrev GTCGAATTTCAGCAGGTGAGC (reverse primer situated at position 1222038-1222058

c)

[255]

oTKfurAKatGfw GAAGGGATTGCTGGGTTTTC (forward primer situated at position 1823428-1823447

a)

[254]

oRTlppsrev GTCTACACCGTGCTCGACAA (reverse primer situated at position 1824427-1824446

a)

[254]

oRTmbtB fw GCCGGTAGGTGTAGCTCAGT (forward primer situated at position 2420653-2420672

a)

[254]

oRTmbtB rev CAAATCGCACCAGCAACTC (reverse primer situated at position 2420825-2420843

a)

[254]

oRTmap1588c fw CCAATCTCGGTGAGTACCTG (forward primer situated at position 1746822-1746841

a)

This work

oRTmap1588c rev TCGAGAATCTCAAGGAAGCA (reverse primer situated at position 1746962-1746981

a)

This work

oRTmap1589c fw GAACTGGATCTCGTTGTTCG (forward primer situated at position 1747178-1747197

a)

This work

oRTmap1589c rev ACAGCGAGTTCGTCCACTT (reverse primer situated at position 1747335-1747353

a)

This work

oRTmap0847 fw GGCAGAACCCAATACATGAG (forward primer situated at position 868303-868322

a)

This work

oRTmap0847 rev GGTAGATGTAGCCGTCGTTG (reverse primer situated at position 868518-868537

a)

This work

oRTmap0047c fw GCATTCGACGAGTAGATGCT (forward primer situated at position 51833-51852

a)

This work

oRTmap0047c rev GGAATTCCTGCAGTCCAAG (reverse primer situated at position 51991-52009

a)

This work

oRTfurA1 fw GCACAGGCCCCAGTAGAT (forward primer situated at position 1823580-1823597

a)

This work

oRTfurA1 rev AATCACCACCACGTCGTCT (reverse primer situated at position 1823714-1823832

a)

This work


38


oKatG fw AAGGTCTCACGGATGTCGAT (forward primer situated at position 1822735-1822754

a)

[254]

oKatG rev GGAGTCGATGGGATTCAAGA (reverse primer situated at position 1823714-1823832

a)

[254]

oHygfw GGCTCATCACCAGGTAGGG [254]

oHygrev GATTCGGATGATTCCTACGC [254]

oRep-JEM fw GATCAGTACTCTCGGGCAAGGTGGGCATGG (forward primer situated at position 4159819-4159838, ScaI restriction site underlined)

a

this work

oRep-JEM rev2 CATGGATCCGCGCTCAAACCGAGCCATCG (reverse primer situated at position 4158855-4158874, BamHI restriction site underlined)

a

this work

oRep-JEM rev3 CATGGATCCTACCTCCACGCAAGGGATGG (reverse primer situated at position 4158907-4158926, BamHI restriction site underlined)

a

this work

oRep-JEM fw6 GATCAGTACTTCCGATGCGCGCTTGACCGC (reverse primer situated at position 4159182-4159201, ScaI restriction site underlined)

a

this work

omptA2-JEM-Mut fw TGGAGGTATGTTATCTATAACGATTTTGATTATCGGT (forward primer situated at position 4158878-4158914, mutated bases underlined)

a

this work

omptA2-JEM-Mut rev GATAACATACCTCCACGCAAGGGATGGATCAGTGG (reverse primer situated at position 4158900-4158934)

a

this work

ocDNAmptA CGTCTTCAACGGTCTTCTTG (gene specific cDNA primer for 5' RACE situated at position 4158469-4158488)

a

this work

oGSP1mptA CTCAGCTTCACGAGCAAATC (nested gene specific primer for 5' RACE situated at position 4158534-4158553)

a

this work

5‟ RACE® Abridged Anchor Primer (AAP)

GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG (primer binding to the oligo-dC tail in the 5‟ RACE® System)

Invitrogen GmbH

oRTMbtBfw GCCGGTAGGTGTAGCTCAGT (forward primer situated at position 2420653-2420672)

a

this work

oRTMbtBrev CAAATCGCACCAGCAACTC (reverse primer situated at position 2420825-2420843)

a

this work

oRTMptAfw AGTGGCAGTTTGCTCAGCTT (forward primer situated at position 4158522-4158541)

a

this work

oRTMptArev CTGGTGACACTGCTGTTTGG (reverse primer situated at position 4158665-4158684)

a

this work

oRTSidA for CCGACATGTCACTGCTGTTC (forward primer situated at position 4171729-4171748)

a

this work


39


oRTSidA rev ATAGCGTGACGTTGATGCAG (reverse primer situated at position 4171910-4171929)

a

this work

oRT_MSMEG_3084 fw GTGCCAAGAAGGTCATCATC (forward primer situated at position 3157638-3157657)

b

this work

oRT_MSMEG_3084 rev ACTCGTCATTGAGCACCTTG (reverse primer situated at position 3157780-3157799)

b

this work

oMSMEG_4487-A fw GATCAAGCTTGGTGTAGGCGTCGACCAGGAACGCCATG (forward primer situated at position 4568045-4568072)

b,

HindIII restriction site underlined

this work

oMSMEG_4487-A rev CATGAAGACCGCCCGTCACCTGCGGTCCTCGCTGGCGT (reverse primer situated at position 4569522-4569550)

b,

BbsI restriction site underlined

this work

oMSMEG_4487-B fw GATCGGATCCGAAGACATCGGGCACGTGAATCAGGTGA (forward primer situated at position 4569946-4569960)

b,

BbsI restriction site underlined

this work

oMSMEG_4487-B rev CATGGTACCGGCACAAGATGGGTGAGGCGGTGCTCATC (reverse primer situated at position 4571423-4571451)

b,

KpnI restriction site underlined

this work

oMSMEG_4487-Del fw ATCGCGATCGTTTTGCAG (forward primer situated at position 4569317-4569334)

b

this work

oMSMEG_4487-Del rev GTGAGGTCGTCGAGGAGTTG (reverse primer situated at position 4570202-4570221)

b

this work

Table 3: Plasmids and phages used in this study

Plasmids/ phages

Description Source/ reference

pYUB854 cosmid vector containing a λ cos site and a PacI site [256]

phAE87 conditionally replicating shuttle phasmid-derivative of TM4 carrying a resident cosmid pYUB328 flanked by PacI sites

[257]

pCR2.1® TOPO® TA subcloning vector with 15 convenient restriction sites Life Technologies, Darmstadt, Germany

pMV306 integrative E.coli - mycobacterial shuttle vector, kan or hyg

[258]

pMFur920 PCR product obtained using primers oFurA1 / oFurA2 cloned into the pCR2.1

® TOPO vector

[254]


40

Plasmids/ phages

Description Source/ reference

pMFur930 PCR product obtained using primers oFurA3 / oFurA4 cloned into the pCR2.1

® TOPO vector

[254]

pMFur1510 AflII/XbaI fragment of pMFur920 ligated into pMFur1501

[254]

phAE111 PacI restricted and self-ligated phAE87 concatamers ligated into pMFur1510

[254]

pJEM15 promoterless E. coli - mycobacterium shuttle vector for lacZ-fusion, kan

[259]

pJETTM

1.2 subcloning blunt end suicide vector ThermoFisher Scientific, Waltham, MA, USA

p2NIL E. coli - mycobacterium shuttle vector for gene manipulation, kan

[260]

pGOAL19 hyg, PAG85-lacZ, Phsp60-sacB, PacI cassette vector, amp

[260]

p2NIL_MSMEG4487_AB p2NIL containing 1500 bp up- and downstream fragments of msmeg4487

b

this work

p2NIL_MSMEG4487_Del p2NIL containing PacI restricted selection marker gene cassette of pGOAL19 and 1500 bp up- and downstream fragments of msmeg4487

b

this work

pJEM-mptA2 pJEM15 containing -941/+42 bp relative to the TSS of mptA (position 4158855 to 4159838

a), spanning all

three Zur boxes

this work

pJEM-mptA2MUT pJEM-mptA2 with two single point mutations in Zur box3 TGTTATCGTATAACGATTTTCGATTA

this work

pJEM-mptA8 pJEM15 containing -304/+42 bp relative to the TSS of mptA (position 4158855 to 4159201

a), containing Zur

box3 only

this work

pJEM-mptA3 pJEM15 containing 932 bp of the 5'UTR of mptA, (position 4158907 to 4159838

a), lacking Zur box3 and

parts of the putative -10 box

pMP1102 pMV306 hyg containing a 8438 bp fragment with the whole mpt operon (position 4151401 to 4159838

a)

[261]

aThe position numbers given related to GenBank accession no. NC_002944

bThe position numbers given related to GenBank accession no. NC_008596

cThe position numbers given related to GenBank accession no. AE016958


41

2.2 Bacterial strains and growth conditions

2.2.1 Escherichia coli

Escherichia coli strains were cultivated at 37°C in Luria-Bertani (LB) broth or on LB-

agar supplemented with 100 µg/ml ampicillin, 100 µg/ml hygromycin or 50 µg/ml

kanamycin, as required. Liquid cultures were incubated at 37°C in a shaking

incubator at 200 rpm. E. coli cells were used for the construction of plasmids and

cosmids. Competent cells were prepared as described earlier [262].

2.2.2 Mycobacterium avium ssp. paratuberculosis

M. avium ssp. paratuberculosis (MAP) DSM44135 wildtype (wt), MAP∆furA and the

complemented strain MAP∆furAC were grown in DifcoTM Middlebrook 7H9 medium or

on solid Middlebrook 7H10 (Beckton Dickinson, Franklin Lakes, NJ, USA)

supplemented with mycobactin J (2 mg/l, Allied Monitor, Fayette, MO, USA), 2.5%

glycerol and 10% OADC (0.06% oleic acid, 5% albumin, 2% dextrose, 0.085% NaCl,

0.003% catalase) (MB-complete) and 50 µg/ml hygromycin and/or 50 µg/ml

kanamycin, as required. Agar plates were sealed in plastic bags after inoculation and

incubated at 37°C for 8 – 10 weeks. Liquid cultures were grown in bottle stirring

cultures (100 rpm) at 37°C until they reached an OD600 of 1.0 and used for further

experiments.

2.2.2.1 Growth experiments

For growth kinetics a starter culture was grown to an OD600 of 1.0 in MB-complete.

Bacteria were harvested by centrifugation at 3,800 x g for 15 min at 4°C,

resuspended in MB-complete, singularized with glass beads (Ø 3 mm) by vortexing

and inoculated into fresh medium to obtain an initial OD600 of 0.2. The OD600 of

cultures was measured twice a week and bacteria were grown until they entered the

stationary phase.

2.2.2.2 Metal starvation experiments

To determine the influence of metal starvation MAPwt was cultivated in MB-complete

as described above to an OD600 of 1.0, divided and either treated with final

concentrations of 10/100/200 µM 2,2‟-bipyridyl (DIP), 14 mM Nitrilotriacetic acid


42

trisodium salt (NTA) or 10 µM N,N,N',N'-tetrakis (2-pyridylmethyl) ethylenediamine

(TPEN) with mild agitation (100 rpm). If appropriate, cultures were supplemented with

ZnSO4, FeSO4, MgCl2, CaCl2, CuSO4, CoCl2 or MnSO4 to a final concentration of

1 mM for NTA treated cultures or of 7.5 µM for TPEN treated cultures. Cells were

harvested at different time points (2/8/24 h) and subjected to RNA extraction and

qRT-PCR analysis.

2.2.2.3 Stress experiments

The response of MAPwt to oxygen stress was examined upon exposure of bacteria

to H2O2. Cells were grown in MB-complete and harvested at an OD600 of 1.0 as

described above. The bacterial pellet was washed twice with 1x PBS and cells

singularized by vortexing with glass beads (3 mm) were transferred to 50 ml

Middlebrook 7H9 supplemented with 2 mg/l mycobactin, 2.5% glycerol and 10% ADC

lacking catalase (5% albumin, 2% dextrose, 0.085% NaCl) (MB-cat) to obtain an

OD600 of 1.0. H2O2 was added to a final concentration of 20 mM and cultures

(including a control without H2O2) were exposed for 2 h at 37°C with gentle shaking

(100 rpm). Following, bacteria were harvested and immediately subjected to RNA-

extraction and qRT-PCR analysis.

2.2.3 Mycobacterium smegmatis

Mycobacterium smegmatis mc2 155 (MSMEGwt) strains were grown under different

conditions. MSMEGwt competent cells were prepared according to Parish & Stoker

[263].

2.2.3.1 Construction of mycobacteriophages

For the construction of mycobacteriophages, LB medium or Middlebrook phage

(MBP) agar was used (detailed method see Meissner 2014 [254]) and supplemented

with 100 µg/ml hygromycin if necessary. Liquid cultures were incubated at 37°C in a

shaking incubator at 100 rpm.

2.2.3.2 Starvation experiments and β-galactosidase assays

For metal starvation experiments and β-galactosidase assays, MSMEGwt,

MSMEG∆furB and transformed strains were grown in MB-complete supplemented

with 0.025% Tyloxapol (to avoid clumping) and with 50 µg/ml kanamycin or 50 µg/ml


43

hygromycin, if necessary. Liquid cultures were incubated at 37°C with shaking at

150 rpm to an OD600 of 1.0. Cultures were split and incubated 2 h with or without

10 µM TPEN in a shaking incubator at 37°C and 150 rpm. Subsequently, cells were

harvested and either subjected to RNA extraction and qRT-PCR analysis or protein

extraction and subsequent β-galactosidase assay.

2.3 Construction of mutant strains

2.3.1 Construction of a M. avium ssp. paratuberculosis∆furA

deletion strain and complementation of the mutant strain

Construction of a furA (map1669c) deletion mutant of MAPwt was performed by

specialized transduction according to Park and colleagues [264] with minor

modifications [254]. A detailed protocol is given in the doctoral thesis of Thorsten

Meissner [254]. For complementation of the mutant strain, the furA gene, including

88 bp of the 5‟UTR, was amplified by PCR using primers oMAP-furA-K1/oMAP-furA-

K2. The PCR product was digested with XbaI and HindIII and ligated into the

corresponding sites of the mycobacterial integrative vector pMV306 [258], carrying a

kanamycin resistance. The resulting plasmid pMAP-furA1101 was transformed into

electro-competent MAP∆furA cells and plated on MB-complete agar with 50 µg/ml

hygromycin and kanamycin. Successful integration of furA was confirmed by PCR

with primers oRTfurA1 fw/rev and hygromycin with primers oTKfurAKatGfw/

oRTlppsrev.

2.3.2 Construction and selection of a M. smegmatis∆furB mutant

Construction of a markerless M. smegmatis∆furB mutant was accomplished

according to Parish and Stoker (2000), by using the two-step system with p2NIL and

pGOAL19 plasmids (Addgene plasmids 20188 and 20190). Flanking regions up- and

downstream of furB (msmeg4487) [NCBI:NC_008596] were amplified from genomic

DNA of MSMEG (size 1500 bp), using primer pairs oMSMEG4487-A fw/rev and

oMSMEG4487-B fw/rev by standard PCR with Phusion® High-Fidelity DNA

polymerase (New England Biolabs, Beverly, MA, USA), cloned into pJETTM1.2

(ThermoFisher Scientific, Waltham, MA, USA) and sequenced for correct


44

amplification to exclude mutations in adjacent genes. Plasmids harbouring the up-

and downstream fragments were restriction digested with HindIII/BbsI (A) or

BbsI/KpnI (B) and subsequently ligated to HindIII/KpnI digested p2NIL, resulting in

p2NIL-MSMEG4487-AB. PacI digested marker gene cassette from pGOAL19 was

ligated into p2NIL-MSMEG4487-AB resulting in p2NIL-MSMEG4487-Del. 500 ng of

plasmid, pretreated with 100 mJ UV light cm−2, was electroporated into MSMEG

electro-competent cells and selection of mutants was performed according to Parish

and Stoker (2000) with minor modifications. In brief, blue kanamycin (kan) resistant

colonies were inoculated in 3 ml LB without antibiotic and incubated for 24 h. 2%

sucrose was added and cultures were allowed to grow for 3 h under selection

pressure. Aliquots of sucrose treated cells were plated on LB with 2% sucrose and X-

Gal (50 µg/ml). White colonies were replica plated on LB and LB-kan. Kanamycin

sensitive clones were screened by PCR with primers oMSMEG_4487-Del fw/rev.

2.4 Cell culture and animal experiments

2.4.1 Cell culture of macrophages and survival assay of intracellular

mycobacteria

The intracellular survival of MAPwt, MAP∆furA and MAP∆furAC was determined in

the mouse macrophage cell line J774A.1 [265]. Macrophage cells were seeded in

tissue culture dishes and were maintained in Dulbecco's modified Eagle medium

(DMEM) supplemented with 10% fetal calf serum (FCS), 1% glutamine, 100 units/ml

penicillin, 100 mg/ml streptomycin at 37°C and 8% CO2. Twentyfour hours prior to

infection, medium was changed to antibiotic-free DMEM. For infection experiments,

MAP cells were grown to an OD600 of 1.0, harvested, singularized and stored in MB-

complete containing 10% glycerol at -80°C until further usage. For infection, MAP

cells were thawn on ice, diluted in antibiotic-free DMEM to an OD600 of 0.15 and

incubated with the macrophages as described earlier [56]. At indicated time points,

infected macrophages were washed twice with phosphate buffered saline (PBS) and

scraped off the plates in 1 ml PBS containing 0.1% SDS. J774A.1 cells were

disrupted by passage through a 24-gauge needle. The homogenates were tenfold

serial diluted in PBS and 25 µl of the 10-4 and 10-5 dilution were plated on


45

supplemented MB-complete agar plates in duplicate. Colony forming units (Cfu) were

counted after incubation for up to 10 weeks at 37°C and the survival rate was

normalized to the initial inoculum (Table 11).

2.4.2 Determination of reactive oxygen species in macrophage

infection experiments

Induction of reactive oxygen production by macrophages upon infection with MAPwt,

MAP∆furA and MAP∆furAC was determined by use of CellRox® Deep Red (Life

Technologies, Darmstadt, Germany), according to the manufacturer‟s protocol. In

brief, macrophages were cultured and infected as described above and incubated for

2 h at 37°C and 8% CO2 or treated with the chemical menadione as a positive control

at a final concentration of 100 µM [266]. CellRox® Deep Red was added to a final

concentration of 2.5 µM 30 min before harvesting and detection. Signals were

measured at 660 nm by flow cytometry (Guava® easyCyte 8HT, Millipore, Billerica,

MA, USA) and shown as mean fluorescence intensity (MFI) of four independent

experiments.

2.4.3 Determination of adhesion and invasion by

immunofluorescence and confocal microscopy

Macrophages were seeded on coverslips and infected as described above. After 2 h

of infection cells were fixed with 3% formaldehyde in PBS for 10 min, washed twice

with PBS and blocked in blocking buffer (PBS/1% bovine serum albumine/10% FCS)

for 20 min at room temperature. For staining of extracellular mycobacteria, coverslips

were incubated with a 1:100 dilution of a polyclonal rabbit anti-MAP-HBHA serum in

blocking buffer at room temperature in a humid chamber for 45 min. After washing

with PBS, coverslips were incubated with goat anti-rabbit IgG coupled to Alexa

Fluor® 488 (Life Technologies, Darmstadt, Germany) for 30 min and subsequently

washed with PBS. To label intracellular mycobacteria, cells were permeabilized with

Triton X-100 (0.1%) for 5 min at room temperature, washed in PBS, followed by

incubation with a 1:100 dilution of polyclonal rabbit anti-MAP-HBHA serum in

blocking buffer for 45 min at room temperature. After washing, coverslips were

treated with goat anti-rabbit IgG coupled to Alexa Fluor® 568 (Life Technologies,


46

Darmstadt, Germany) for 30 min. Coverslips were washed three times in PBS and

after one brief washing step with ddH2O samples were mounted using ProLong®

Gold with DAPI (Life Technologies, Darmstadt, Germany). Mounted samples were

examined using a TCS SP5 confocal laser scanning microscope equipped with a

63×/1.4-0.6 NA HCX PL APO objective (Leica, Wetzlar, Germany). Image stacks

were acquired using 1 Airy unit pinhole diameter in sequential imaging mode to avoid

bleed through. Image stacks were deconvolved using Huygens® Essential (Scientific

Volume Imaging, Hilversum, The Netherlands), maximum intensity projections were

calculated for display purposes and adjusted for brightness and contrast using

ImageJ/Fiji. After this labelling procedure, extracellular mycobacteria appear yellow

whereas intracellular mycobacteria are stained red.

2.4.4 Mouse infection experiments

Mouse infection experiments were approved by the Lower Saxony Federal State

Office for Consumer Protection and Food Safety, Germany (reference number

08/1504). In each group, 9-10 female C57BL/6 mice aged eight weeks (Charles

River, Erkrath, Germany) were challenged intraperitoneally with an infection dose of

1x108 bacteria of MAPwt and MAP∆furA in 200 µl Dulbecco's Phosphate-Buffered

Saline (DPBS, Life Technologies, Darmstadt, Germany). DPBS was used as

negative control. Mice were sacrificed after 4 weeks and liver and spleen were

weighted. Bacteria were quantified by plating of homogenized tissue on MB-complete

agar plates. Cfu were counted after incubation for up to 10 weeks at 37°C and the

survival rate was normalized to the initial inoculum (Table 12).

Histology was performed as described earlier [267] in the Mouse Pathology Platform

at HZI Braunschweig. The number and size of granuloma was determined in

hematoxylin-eosin stained slices of the liver with a 400-fold magnification.


47

2.5 Molecular methods

2.5.1 Extraction of nucleic acids

2.5.1.1 Genomic DNA

Genomic DNA was prepared as previously described [19]. Plasmids were prepared

using NucleoBond® AX kit (Macherey Nagel GmbH, Düren, Germany) according to

the manufacturer‟s protocol.

2.5.1.2 RNA extraction

Total RNA from bacteria was isolated according to Rustad et al. [268] with minor

modifications. In brief, bacterial pellets were resuspended in TRIzol® reagent,

mechanically disrupted in a FastPrep® instrument (ThermoSavant, Carlsbad, CA) and

RNA was separated by chloroform, chloroform-isoamylalcohol (49:1 v/v) extraction

and precipitation with 2-propanol. Total RNA was treated twice with 50 U DNase I

(Roche, Mannheim, Germany) according to the manufacturer‟s protocol. Integrity and

quality of RNA was determined by gel electrophoresis and spectrophotometric

analysis using an Epoch instrument (Biotek, Bad Friedrichshall, Germany) at 260 nm.

2.5.2 cDNA synthesis and quantitative real-time PCR (qRT-PCR)

For cDNA synthesis 4 µg of DNA-depleted RNA was diluted with RNase free water

up to a volume of 20 µl and incubated for 10 min at 70°C with 0.4 µg random primers

(Promega, Madison, WI, USA). After 5 min cooling on ice, samples were split in two

and mixed with 5x RT buffer, 10 mM dNTP‟s and either 200 U MMLV-superscript

transcriptase (Promega) or buffer without transcriptase as a negative control. The

mix was incubated for 1 h at 42°C, following incubation for 5 min at 85°C. Samples

were diluted with 90 μl ddH2O and stored at -20°C for further analysis. Quantitative

real-time PCR (qRT-PCR) experiments were performed using a Mx3005P qPCR

system (Agilent Technologies, Santa Clara, CA, USA) with a thermal cycling profile

as follows: segment 1, 20 min at 95°C, 1 cycle; segment 2, 45 sec at 95°C, 1 min at

58°C, 1 min at 72°C, 45 cycles; segment 3, 1 min 95°C, 30 sec 55°C, 30 sec 95°C, 1

cycle. 2.5 µl of each cDNA sample was mixed with 0.4 µM primer and 10 µl SYBR-

Green Mix (Qiagen, Düsseldorf, Germany) in a total volume of 20 µl. Each sample


48

was analysed in duplicate. Cyclethreshold (Ct) values were shown either as absolute

data or normalised to the housekeeping gene gap (map1164 or msmeg3084) and

expressed as fold change to the untreated control (∆∆Ct). All oligonucleotide primer

pairs (Table 2) were tested for efficacy with a serial dilution of genomic DNA.

2.5.3 Rapid amplification of 5’-cDNA ends (5’RACE®)

Determination of transcriptional start point of mptA was performed by 5‟RACE® (Life

Technologies, Darmstadt, Germany), using cDNA synthesized from RNA of TPEN

treated cultures with gene specific primer ocDNAmptA. Briefly, RNA was treated with

Terminator 5‟-Phosphate-Dependent Exonuclease (TEX, Epicentre, Madison WI,

USA) prior cDNA synthesis, to digest degraded mRNA transcripts. Following, an

oligo-dC tail was attached by using terminal deoxynucleotidyl transferase (TdT, Life

Technologies, Darmstadt, Germany). The tailed cDNA was amplified by use of a

nested gene specific primer (oGSP1mptA) and 5‟ RACE® Abridged Anchor primer

(AAP). PCR products were cloned into pJetTM1.2 (ThermoFisher Scientific, Waltham,

MA, USA) and plasmids of three transformants were submitted to sequencing

(Seqlab, Göttingen, Germany).

2.5.4 Inverse site directed mutagenesis PCR

The exchange of single nucleotides was performed by inverse site directed

mutagenesis PCR. Plasmid DNA of pJEM-mptA2 was used as a template and

amplified using proofreading Phusion® polymerase and primers omptA2-JEM-Mut

fw/rev with two single point mutations in the forward primer

TGGAGGTATGTTATCTATAACGATTTTGATTATCGGT (mutated bases underlined).

In detail, a mastermix (total volume 50 µl) was prepared containing 10 mM dNTP,

15 pmol of each primer, 10 µl 5x Phusion Buffer HF, 1.5 µl DMSO and 1 U Phusion®

polymerase. 14 ng plasmid DNA was used as a template and PCR reaction was set

up with the following protocol in an Eppendorf Mastercycler:


49

Cycle step Temperature Time Cycles

Initial denaturation 98°C 30 sec 1

Denaturation 98°C 10 sec

25 Annealing 64°C 30 sec

Extension 72°C 5 min

Final Extension 72°C 10 min 1

Hold 4°C

The PCR product was subsequently treated with 4 U DpnI (New England Biolabs,

Ipswich MA, USA) for 1 h at 37°C to digest remaining template plasmid.

2.5.5 Construction of plasmids for β-galactosidase activity assays

Genomic DNA of MAP DSM44135 was used to amplify full and truncated 5‟UTR of

mptA with Phusion® polymerase using primer pairs oRep-JEM-fw/-rev2, oRep-JEM-

fw6/-rev2, oRep-JEM-fw/-rev3, respectively (restriction enzyme sites underlined,

Table 2). Fragments were digested with ScaI/BamHI and cloned into pJEM15 [259],

resulting in plasmids pJEM-mptA2, harbouring the whole 5‟UTR of mptA without the

ribosome binding site (RBS), pJEM-mptA8 with Zur box3 only and 295 bp upstream

this box and pJEM-mptA3 lacking Zur box3 and putative promoter elements.

Mutation of Zur box3 was achieved by inverse site directed mutagenesis PCR on

plasmid pJEM-mptA2 using Phusion® polymerase and primers omptA2-JEM-Mut-

fw/rev with two single point mutations in the forward primer (mutated bases

underlined, Table 2) resulting in vector pJEM-mptA2MUT (see section 2.5.4). Correct

construction of plasmids was determined by restriction enzyme digestion and

sequencing. All plasmids were transformed into MSMEGwt and/or MSMEG∆furB.

Functionality of promoter and putative FurB binding sites were analysed by β-

galactosidase activity assay.

2.5.6 β-galactosidase activity assay

M. smegmatis strains harbouring the indicated reporter plasmids were grown in MB-

complete to an OD600 of 1.0 and treated with 10 µM TPEN as described above.

Subsequently, protein extraction was conducted as follows: 100 mg of wet cell pellet

was resuspended in 50 mM Tris-HCl buffer (pH 7.5); protease inhibitor (AEBSF) was


50

added to a final concentration of 500 µM. Suspension was transferred to a tube

containing 300 mg circonium beads and cells were disrupted in a bead beater (level

6) 3 times for 30 sec with 5 min intermediate cooling steps. Lysates were then

transferred to reaction tubes and subsequently sonicated at 4°C for 20 min (duty

cycle 50%). Cell debris was removed by centrifugation (11,000 x g / 5 min / 4°C).

Protein concentration of lysates was determined with MicroBCA Protein Kit

(Interchim, Montluçon, France). Lysates were diluted in Z-buffer (0.2 M Na2HPO4,

20 mM KCl, 2 mM MgSO4, 50 mM β-mercaptoethanol, pH 7.5) to appropriate

concentrations and incubated with 40 µM o-nitrophenyl-β-D-galactopyranoside

(ONPG, Sigma-Aldrich) for 45 min at 37°C. Absorption was measured at 405 nm in a

fluorescence reader (Tecan GENios Pro, Männedorf, Swiss) and activity was

calculated as absorbance at 405 nm / protein mg/ml (Table 8).

2.6 RNA deep sequencing and analysis

RNA deep sequencing was used to determine the regulon of FurA and the general

response to zinc starvation in MAP. Sequencing libraries of MAPwt and MAPΔfurA

RNA of three independent samples were prepared and sequenced using 36 bp

single-ends sequencing on a Genome Analyzer IIx (Illumina, San Diego, CA, USA) or

50 bp single-ends sequencing on a HiSeq2500 (Illumina), respectively. For zinc

starvation experiments two independent replicates of TPEN treated and untreated

MAPwt cells were sequenced by 50 bp single-ends sequencing method. In brief,

libraries of 300 bp were prepared according the manufacturer‟s instructions

“Preparing Samples for Sequencing of mRNA” (Illumina) and “Protocol for

ScriptSeq™ v2 RNA-Seq Library Preparation” (Epicentre Biotechnologies, Madison,

WI, USA). Quality of the libraries was validated using Agilent Bioanalyzer (Agilent

Technologies) following the manufacturer‟s instruction. Cluster generation was

performed using the Illumina cluster station; sequencing on the Genome Analyzer IIx

or HiSeq2500 followed a standard protocol. The fluorescent images were processed

to sequences and transformed to FastQ format using the Genome Analyzer Pipeline

Analysis software 1.8.2 (Illumina). The sequence output was controlled for general

quality features using the fastq-mcf tool of ea-utils and was mapped against the

genome sequence of the reference strain MAP-K10 [NCBI:AE016958 and


51

[NCBI:NC_002944] using BWA v. 0.7.5 and SAMtools [269] for storing nucleotide

sequence alignments. For comparable data analyses in case of MAP∆furA

sequencing, reads of the 50 bp sequencing were clipped to 36 bp reads. Following,

all sequences were computed with Rockhopper tool [270]. Genes with a q-Value

≤0.01 were considered as significantly differentially expressed and genes with raw

counts or no counts in all replicates were included for further analysis (Tables 9+10).

The fold change was calculated as the expression value of MAP∆furA/MAPwt and

MAPwt TPEN/control. In some cases inconsistent expression values in the

Rockhopper analyses were confirmed by qRT-PCR as described above.

2.7 Bioinformatics and statistics

2.7.1 Protein analysis

Differentially expressed genes identified by Rockhopper analysis were further

processed with Blast2Go tool [271] and NCBI blastx (http://blast.ncbi.nlm.nih.

gov/Blast.cgi) as well as tuberculosis database (http://tbdb.org) to investigate

functions of putative proteins. Additionally, the putative proteins were clustered into

orthologous groups (COG), based on the genome of MAP-K10

(http://www.ncbi.nlm.nih.gov/sutils/coxik. cgi?gi=380).

Comparison of different FurB amino acid sequences was performed with Clustal

Omega [272].

2.7.2 Analysis of Fur binding sites

To analyse putative FurA and FurB binding sites in MAP [NCBI:NC_002944], MEME-

SUITE [273] and FIMO analyses were performed.

We generated a consensus sequence of FurA by comparison of sequences located -

70/+30 bp up-/downstream of predicted FurA translation start sites (Table 13) in MTB

[NCBI:NC_000962, Rv1909c], M. bovis BCG pasteur [NCBI:NC_008769,

BCG_1948c], M. avium ssp. avium 104 [NCBI:NC_008595, MAV_2752], MAP

[NCBI:NC_002944, MAP_1669c] and MSMEG [NCBI:NC_008596, MSMEG_6383] in


52

MEME SUITE with the resulting consensus sequence

T[CT]TTGACT[CG][AG]TTCCA[GA]A[AT]AA[GT][GT][GC][ACG][GC][TG]CAT[AT].

Published MTB-Zur binding sites of rv0106, rv2069, rpmB2, rpmB1, rv3017c and

rv3019c (Table 14) were used to generate the consensus sequence of FurB

[CG]C[TCG]T[AG][TA][TC]GA[AT]AA[TC][ACG][AG]TT[TG][TC]C[AG][TA][TC]A

(Fig. 9D).

These consensus sequences were subsequently submitted to FIMO analysis [273].

Nucleotides in brackets are variable, single nucleotides are conserved. The genomic

location of detected binding sites was determined and considered as putative Fur box

within +10/-600 nucleotides relative to predicted translation start sites (TLS).

2.7.3 Cluster analysis

Homologous genes to the MAP zinc regulon and to Zur regulated genes of MTB of

different mycobacterial species were analysed for clustering. Genomes of MSMEG

[NCBI:NC_008596], MTB [NCBI:NC_000962], MAV [NCBI:NC_008595], M. bovis

BCG Pasteur [NCBI:NC_008769], M. marinum [NCBI:NC_010612], M. leprae

[NCBI:NC_011896] and M. vanbaalenii [NCBI:NC_008726] were compared to MAP

[NCBI:NC_002944] or MTB [NCBI:NC_000962] with the tool “Genome Genes Best

Homologues” of Integrated Microbial Genomes Expert Review (IMG/ER)

(https://img.jgi.doe.gov/cgi-bin/er/main.cgi) or analysed by single gene comparison

via NCBI blastx analysis (min. 60% coverage and 40% identity on protein level).

Following, the species specific genomic distribution of the gene homologues was

evaluated by their locus tags (Table 17).

2.7.4 Statistical tests

Data are expressed as mean±SEM and statistical analyses were performed using

GraphPad Prism 5.03 (GraphPad, San Diego, CA, USA). Depending on the

experiment, either the nonparametric t-test (Mann-Whitney) or 1way ANOVA test

(Kruskal Wallis) was used. A p-value of at least <0.05 between samples and controls

was considered as statistically significant.

Results part I Chapter 3

53

Chapter 3

Results part I:

FurA contributes to the oxidative stress response regulation of

Mycobacterium avium ssp. paratuberculosis

A manuscript based on Chapter 3 has been submitted for publication with following

co-authors: Thorsten Meissner, Jochen Meens, Kristin Laarmann, Andreas Nerlich,

Michael Jarek, Siegfried Weiss, Gerald-F. Gerlach and Ralph Goethe

Own contributions are specified on page 78.

Chapter 3 Results part I

54

Abstract

The ferric uptake regulator FurA is known to be involved in iron homeostasis and

stress response in many bacteria. In mycobacteria the role of FurA is still unclear.

In the presented study we addressed the functional role of FurA in the ruminant

pathogen Mycobacterium avium ssp. paratuberculosis (MAP) by construction of a

furA deletion strain (MAP∆furA). RNA deep sequencing revealed that the FurA

regulon consists of repressed and activated genes associated to stress response or

intracellular survival. Not a single gene related to metal homeostasis was affected by

furA deletion. Exposure of MAP to iron starvation or peroxide stress revealed that

FurA repressor function is iron- and peroxide-dependent. Gene activation seems to

occur in its apoform. A decisive role of FurA during intracellular survival in

macrophages was shown by significantly enhanced survival rates of MAP∆furA

compared to the wildtype. This resistance was not associated with altered survival of

mice after long term infection with MAP, indicating that the principal task of

mycobacterial FurA is oxidative stress response regulation. Our results demonstrate

for the first time that mycobacterial FurA is not involved in the regulation of iron

homeostasis. They provide clear evidence that FurA contributes to intracellular

survival as a metal-dependent peroxide sensor.


55

Introduction

For efficient infection and colonization pathogenic bacteria need to adapt their

metabolism to the host environment and to combat unspecific antimicrobial host

defence mechanisms such as exposure to oxygen radicals and iron limitation.

Accordingly, intracellularly persisting mycobacteria have developed host defence

escape mechanisms and the regulation of these is often linked to the expression of

virulence factors. Like other pathogenic mycobacteria, Mycobacterium avium ssp.

paratuberculosis (MAP), the causative agent of Johne‟s disease, a chronic, non-

curable granulomatous inflammation of the intestine [274-276], is able to persist and

multiply intracellularly in the phagosome of macrophages [56]. Specifically, MAP

adapts to the intestinal environment by adjusting its metabolism to the host and

responding to the antimicrobial defence mechanisms indicated by enhanced

expression of KatG and SodA [142,143,277]. Hence, MAP is clearly able to withstand

innate defence mechanisms of the host, but the enabling mechanisms are still

unclear.

In general, oxidative stress response in bacteria is regulated by the major

transcription factors OxyR and PerR [278,279]. OxyR belongs to the family of LysR-

regulators and is mainly found in gram negative bacteria but also in some gram

positive bacteria [280]. OxyR is a transcriptional activator under oxidizing conditions

that acts through direct interaction with the RNA polymerase -subunit [281,282].

PerR is a member of the FUR family of metalloregulators and functions as a

peroxide-responsive repressor [279]. PerR is found mostly in gram positive bacteria

where it seems to substitute for OxyR [283]. Nevertheless, in some bacterial species

PerR is present together with OxyR [99,100,284]. To prevent damage by reactive

oxygen species (ROS) OxyR and/or PerR regulate, amongst others, the expression

of a catalase-peroxidase (kat) and an alkyl hydroperoxidase reductase (ahp) in many

bacteria [231,285-288].

Iron plays a particular role in bacterial metabolism. On the one hand iron is an

essential structural and catalytic cofactor for many metabolic enzymes. On the other

hand iron excess in the cell is harmful, due to the release of reactive oxidative

species by the Fenton and Haber-Weiss reaction. Therefore, the bacterial


56

intracellular iron homeostasis must be tightly regulated and often is closely linked to

the response to oxygen stresses [161].

In M. tuberculosis (MTB), three genes encoding putative iron-dependent regulator

proteins have been described [289]: IdeR [215] and SirR [220] both belonging to the

Diptheria-toxin Repressor (DtxR) family, as well as FurA a member of the ferric

uptake regulator (FUR) family [221,247].

IdeR is the global iron-dependent regulator in mycobacteria. As an iron-loaded

homodimer it controls the expression of about 50 genes in MTB, mostly involved in

iron homeostasis, but also a number of virulence factors [216]. The ideR gene is

essential in pathogenic mycobacteria like MTB [216] or MAP [290], but not in

saprophytic species such as M. smegmatis (MSMEG) [291]. Using a conditional ideR

mutant, Pandey and Rodriguez recently demonstrated that IdeR is an important

factor for the survival of MTB in macrophages as well as for the infection of mice

[292]. SirR was originally identified in Staphylococcus epidermidis with a sequence

identity to MTB IdeR of 33% [220]. The biological role of SirR homologues in

pathogenic mycobacteria is still unclear.

The FUR family of transcriptional metalloregulator proteins is widespread in bacteria

and archaea [221]. The best characterized member of the FUR family, the

Escherichia coli Fur protein, employs Fe2+ as co-repressor and acts as global

regulator, influencing the expression of more than 100 genes involved in iron

homeostasis, intermediary metabolism and oxidative stress response [222]. The

classical mechanism of Fur regulation includes binding of Fe2+, formation of a metal-

containing dimer which subsequently binds to a specific Fur box found in the

promoter sequences of the corresponding target genes [227]. Recent studies

indicated that the regulatory mechanisms governed by Fur exceed this classical

repressor model. Thus, Fur homologues in different bacterial species can also act as

metal-dependent positive regulators or even repress gene expression in the absence

of the iron cofactor (apo-Fur repression) [see recent review by [293]]. In addition, a

metal-independent activation of genes by apo-Fur was recently described [243].

In all mycobacterial species sequenced so far, furA is located upstream of katG.

Furthermore, for some mycobacteria species co-expression of both genes was

shown, indicating an involvement of FurA in the mycobacterial oxidative stress

response. Indeed it was proposed that in mycobacteria FurA could functionally


57

replace the peroxide repressor PerR [294]. Nevertheless, the precise regulatory role

of FurA and the regulation of stress response in mycobacteria is still not completely

clear. One explanation for this might be the absence of a functional OxyR regulator in

some mycobacteria species like those of the M. tuberculosis complex and MSMEG.

In these species it was found that FurA is involved in the oxidative stress response

by regulating katG [98,295]. Noteworthy there was no contribution of FurA to ahpC

expression. In contrast, many other mycobacterial species, including the pathogens

M. avium and M. marinum, harbour a functional oxyR gene [93,296]. In these

species it was shown that ahpC but not katG is under control of OxyR [297,298].

However the regulation of katG in these species has not been addressed. Overall

these data suggest a more complex regulatory network of oxidative stress response

regulation in mycobacteria.

In the present work we aimed to analyse the relevance of mycobacterial FurA in iron

homeostasis and stress response. We characterized the FurA regulon in MAP

constructing an isogenic MAP∆furA mutant. By this we were able to clarify the

influence of MAPFurA in iron metabolism, stress response and intracellular survival.


58

Results

Characterization of a MAP∆furA deletion mutant

FurA has been described as a global regulator in E. coli and was proposed to be

involved in oxidative stress response and regulation of iron homeostasis [278]. In

mycobacteria, iron homeostasis is maintained by IdeR and FurA is assumed to take

part in general stress response due to its genomic co-localization and it‟s (partly) co-

transcription with katG. However, the regulatory role of FurA and its own

transcriptional regulation has not yet been fully understood.

To gain insight into the role of FurA in MAP, we generated a furA (map1669c)

deletion mutant MAP∆furA by specialized transduction. In addition, a complemented

strain was constructed by introducing the integrative plasmid pFurA-MAP1101,

harbouring the wildtype furA gene under control of its own promoter, into the ∆furA

mutant strain, resulting in strain MAP∆furAC. Deletion of the furA gene in MAP∆furA

and complementation of MAP∆furAC was confirmed by PCR (Fig. 1A). Expression of

furA and the adjacent gene katG was analysed by qRT-PCR. furA transcripts were

detected in the MAP wildtype (MAPwt) and MAP∆furAC but not in MAP∆furA. The

expression levels of katG were similar in all strains (Fig. 1B), indicating that the

genetic manipulation had no polar effect on the expression of downstream located

genes. Next we compared growth of MAPwt, MAP∆furA and MAP∆furAC in MB-

complete medium. As shown in Figure 1C, all strains exhibited similar growth

kinetics. Growth of MAP∆furA and MAP∆furAC was slightly reduced in comparison to

MAPwt and both strains reached stationary growth phase at lower OD600 than

MAPwt. These effects might be due to the antibiotic supplements in the growth

media.

Determination of the FurA regulon of MAP

To analyse the regulatory role of FurA in MAP we prepared RNA from MAPwt and

MAP∆furA grown to an OD600 of 1.0 in MB-complete medium and performed RNA

deep sequencing. Gene expression profiles of three independent replicates of each

strain were analysed with the Rockhopper analysis tool [270] and genes with a


59

A

B

0 10 20 30 40 50

wt

furA

CfurA

wt

furA

CfurA

furA

katG

Ct value

C

0 20 40 600

2

4

6

8

10

wt

furA

furAC

time [days]

OD

60

0

M1 1 2 3 4 M2 1 2 3 4

153

1018

2563


60

Figure 1: Characterization of a MAP∆furA mutant.

(A) Confirmation of successful deletion and complementation of furA. Chromosomal DNA was

prepared from MAP wildtype (wt) (lanes 1), MAP∆furA (lanes 2) and the complemented strain

MAP∆furAC (lanes 3) grown in MB-complete to an OD600 of 1.0 and was subsequently tested in PCR

for the presence of furA (left panel) and hygromycin (right panel). A negative control with water only is

shown in lanes 4. M1 = 100 bp DNA ladder, M

2 =1kb plus DNA ladder. Samples were run on a 1.5%

agarose gel. (B) Total RNA was extracted from all strains grown to an OD600 of 1.0 in MB-complete.

Expression of furA (black bars) and the adjacent gene katG (white bars) was analysed by qRT-PCR.

Results are expressed as mean Ct values of three independent experiments. The level of the

housekeeping gene gap for all samples was 19.27 ± 0.4060 (SEM). (B) Growth of MAPwt (filled

triangles), MAP∆furA (open rectangle) and MAP∆furAC (filled rectangle) was monitored for 60 days by

measurement of the optical density (OD600) in MB-complete. Each growth experiment was conducted

in triplicate for each strain. Shown are representative results of one out of two independent

experiments.


61

q-value of ≤0.01 were considered as significantly differentially expressed. Differences

in gene expression were calculated as fold change (MAP∆furA/MAPwt, Table 9).

In total, we found 48 differentially expressed genes in the mutant strain. Compared to

the wildtype strain 13 genes were higher (Table 4) and 35 lower (Table 5) expressed

in MAP∆furA.

Clustering of the putative proteins of the differentially expressed genes into

orthologous groups (COG, cluster of orthologous groups) revealed that almost 40%

of the differentially expressed genes were assigned to metabolism (C,G,E,F,H,I,P,Q),

20.75% to cellular processes and signalling (D,Y,V,T,M,N,Z,W,U,O), 9.43% belong to

the group of poorly characterized proteins (R,S) and 30.19% were not assigned to

any COG. Interestingly, no genes related to iron homeostasis were affected by the

furA deletion.

Among the 13 higher expressed genes, 11 were organized in 4 putative operons.

The majority of these genes encode for proteins predicted to be involved in stress

response or redox processes. Within this group, the gene cluster map1589c-1587c,

encoding for alkyl hydroperoxide reductases (ahp) involved in oxidative and drug

resistance as well as intracellular survival in MTB [96,299], exhibited the most

significant expression changes (Table 4).

The group of lower expressed genes is comprised of 35 genes. Aside from furA, this

group consists of two putative transporters, five genes predicted to be involved in

metabolism, three stress response-associated genes and 13 genes were of unknown

function. The remaining 11 genes can be associated to virulence which is

represented by two putative invasion proteins (map1203/1204), two antigens

(map0047c/map2168c), one Pro-Pro-Glu protein (PPE) (map1003c), one PE-PGRS

glycin-rich protein (map3868), one nlpc p60 protein (map1272c), and one

mammalian cell entry (mce) family protein (map2114c) as well as three other

enzymes (map1706, map1967c, map3421c) for cell entry and persistence.

Altogether, map0047c, the conserved protein map0847 and the putative efflux ABC

transporter map4206c showed the most significant differences in expression

compared to the wildtype (Table 5). In addition, the 5' UTR of map1589c (ahpC),

map0081 (putative oxidoreductase), map0847 and map3421c (putative diguanylate

cyclase phosphodiesterase) featured a predicted FurA binding site (Tables 4, 5, 15).

Altogether, these analyses indicated a considerable involvement of MAP FurA in the

adaptation of MAP to the host cell environment and general stress response.

Table 4: Genes higher expressed in MAP∆furA compared to MAPwt

Orthologue genes (similarity)

RCNa Annotation MTB MAV q-Value

b Fold change

c Putative function

d COG

e

- MAP0771 - MAV_0960 (93.8) <0.0001 8.23 membrane protein -

- MAP0772 - MAV_0961 (100) <0.0001 7.00 membrane protein -

- MAP0773 Rv2193 (45.88) MAV_0962 (93.22) <0.0001 11.63 cytochrome c oxidase subunit iii C

- MAP1587c Rv2471 (45.07) MAV_2842 (91.81) <0.0001 21.34 alpha-amylase G

ahpD MAP1588c Rv2429 (84.57) MAV_2840 (99.43) <0.0001 21.70 alkyl hydroperoxide reductase S

ahpC MAP1589c* Rv2428 (93.33) MAV_2839 (100) <0.0001 29.87 alkyl hydroperoxide reductase c protein ahpc O

- MAP1741c Rv2026c (68.58) MAV_2507 (94.21) 0.00145 4.11 universal stress protein T

- MAP1742c Rv2026c (84.49) MAV_2506 (74.4) <0.0001 8.33 universal stress protein T

- MAP1743c Rv2032 (64.64) MAV_2505 (90.09) <0.0001 24.33 NAD(P)H nitroreductase -

cysH_1 MAP2036 Rv2392 (83.85) MAV_2153 (98.78) 0.00058 6.43 phosphoadenosine phosphosulfate reductase EH

- MAP2037 Rv2393 (73.24) MAV_2152 (91.19) <0.0001 6.74 cobalamin (vitamin B12) biosynthesis CbiX protein S

fdxC_1 MAP2039 Rv1177 (89.62) MAV_2150 (99.07) <0.0001 7.72 ferredoxin C

- MAP3677 Rv2242 (51.28) MAV_4933 (81.93) 0.00069 4.75 PucR family transcriptional regulator TQ aReference Common Name

bq-value of differentially expressed genes MAP∆furA vs. wildtype calculated by Rockhopper analysis. A q-value ≤0.01 is considered as significant.

cgene expression values of MAP∆furA divided by gene expression values of the wildtype from RNA-sequencing.

dPutative function based on Blast2Go or NCBI Blast analysis.

e Functional classification of proteins has been performed by use of COG database with MAP-K10 as a reference (http://www.ncbi.nlm.nih.gov/sutils/coxik.cgi?gi=380). (C)

Energy production and conversion, (E) Amino acid transport and metabolism, (G) Carbohydrate transport and metabolism, (H) Coenzyme transport and metabolism, (I) Lipid transport and metabolism, (M) Cell wall/membrane/envelope biogenesis, (N) Cell motility, (O) Posttranslational modification, protein turnover, chaperones, (P) Inorganic ion transport and metabolism, (Q) Secondary metabolites biosynthesis, transport and catabolism, (R) General function prediction only, (S) Function unknown, (T) Signal transduction mechanisms. *predicted FurA binding sites present in the promoter region, identified by MEME Suite.

62

Chapte

r 3

Results

part I

63

Table 5: Genes lower expressed in MAP∆furA compared to MAPwt



b Fold change

c Putative function

d COG

e

- MAP0047c Rv0040c (90.9) MAV_0054 (73.79) <0.0001 -12.91 proline-rich 28 kda antigen -

- MAP0079 Rv2002 (50.81) MAV_0087 (95.12) <0.0001 -8.00 oxidoreductase IQR

- MAP0081* Rv0063 (76.76) MAV_0089 (85.61) <0.0001 -7.67 oxidoreductase C

- MAP0130 - MAV_0124 (91.48) <0.0001 -8.37 hypothetical protein MAP0130 T

- MAP0337 Rv1648 (52.83) MAV_0364 (89.63) <0.0001 -6.00 membrane protein -

- MAP0847* Rv1754c (83.96) MAV_1035 (100) <0.0001 -19.77 conserved protein -

PE MAP1003c Rv1040c (75.55) MAV_1179 (54.03) <0.0001 -12.40 ppe family protein N

- MAP1203 Rv1477 (76.48) MAV_3301 (91.13) <0.0001 -11.63 invasion protein M

- MAP1204 Rv1478 (72.76) MAV_3300 (86.88) <0.0001 -9.58 invasin 1 M

- MAP1272c Rv1566c (83.58) MAV_3208 (76.04) 0.00059 -6.19 nlpc p60 family protein M

- MAP1388 - MAV_3090 (74.19) <0.0001 -4.67 hypothetical protein MAP1388 -

- MAP1418c Rv3821 (56.25) MAV_3059 (84.67) 0.00950 -4.00 hypothetical protein MAP1418c -

- MAP1570 Rv1861 (50.49) MAV_2858 (65.16) <0.0001 -5.52 membrane protein -

- MAP1639c Rv0854 (75.86) MAV_2785 (99.32) 0.00074 -4.21 cyclase/dehydratase I

furA MAP1669c* Rv1909c (88.02) MAV_2752 (100) <0.0001 -52.80 FurA P

- MAP1706 Rv1987 (73.1) MAV_2710 (100) <0.0001 -10.38 chitinase G

- MAP1967c Rv2223c (78.81) MAV_2243 (88.43) 0.00014 -5.86 exported protease -

- MAP2114c Rv1968 (61.83) MAV_2063 (90.27) <0.0001 -6.67 virulence factor mce family protein Q

- MAP2117c Rv3501c (66.0) MAV_0946 (66.53) 0.00103 -4.69 abc transporter permease Q

- MAP2168c Rv2376c (55.82) MAV_2017 (90.35) <0.0001 -11.59 low molecular weight antigen mtb12 -

fdxC_2 MAP2607c Rv1177 (96.22) MAV_1316 (100) <0.0001 -11.90 ferredoxin C

63

Results

part I

Chapte

r 3



b Fold change

c Putative function

d COG

e

- MAP2642 Rv1660 (64.75) MAV_1280 (96.27) <0.0001 -11.50 polyketide synthase Q

- MAP3123c - MAV_3943 (74.1) <0.0001 -5.20 protein -

- MAP3310 Rv3209 (80.68) MAV_4157 (100) 0.00471 -4.73 membrane protein -

- MAP3421c* - MAV_4276 (99) 0.00114 -4.00 diguanylate cyclase phosphodiesterase -

- MAP3796 Rv0309 (78.99) MAV_4853 (96.95) <0.0001 -9.24 conserved exported protein S

- MAP3800 Rv0312 (68.43) MAV_2177 (52.59) <0.0001 -10.89 molecular partial O

- MAP3812c Rv0116c (80.39) MAV_4834 (100) 0.00030 -4.60 hypothetical protein MAP3812c S

- MAP3868 Rv0754 (64.7) MAV_4778 (91.69) 0.00011 -4.40 PE-PGRS family protein G

- MAP4204 Rv1888c (68.75) MAV_4428 (88.82) 0.00382 -3.78 transmembrane protein -

- MAP4206c - MAV_4427 (75.39) <0.0001 -24.00 efflux ABC transporter, permease protein M

- MAP4208 Rv3003c (40.8) MAV_4424 (88.85) <0.0001 -6.71 acetolactate synthase EH

- MAP4209 - MAV_4423 (100) <0.0001 -6.73 hypothetical protein MAP4209 -

- MAP4210 - MAV_4422 (99.37) <0.0001 -10.00 3-oxoacyl-acp synthase I

- MAP4211 Rv3772 (46.15) MAV_4421 (89.77) <0.0001 -8.75 histidinol-phosphate aminotransferase E a

Reference Common Name b

q-value of differentially expressed genes MAP∆furA vs. wildtype calculated by Rockhopper analysis. A q-value ≤0.01 is considered as significant. c gene expression values of MAP∆furA divided by gene expression values of the wildtype from RNA-sequencing.

d Putative function based on Blast2Go or NCBI Blast analysis.

e Functional classification of proteins has been performed by use of COG database with MAP-K10 as a reference (http://www.ncbi.nlm.nih.gov/sutils/coxik.cgi?gi=380).

(C) Energy production and conversion, (E) Amino acid transport and metabolism, (G) Carbohydrate transport and metabolism, (H) Coenzyme transport and metabolism, (I) Lipid transport and metabolism, (M) Cell wall/membrane/envelope biogenesis, (N) Cell motility, (O) Posttranslational modification, protein turnover, chaperones, (P) Inorganic ion transport and metabolism, (Q) Secondary metabolites biosynthesis, transport and catabolism, (R) General function prediction only, (S) Function unknown, (T) Signal transduction mechanisms. *predicted FurA binding sites present in the promoter region, identified by MEME Suite.

64

Chapte

r 3

Results

part I


65

To confirm our transcriptomic analyses and to further specify the involvement of FurA

in regulation, we analysed expression of ahpC and ahpD (map1589c/1588c), higher

expressed in MAP∆furA, and the lower expressed genes map0847 and map0047c by

qRT-PCR. MAPwt, MAP∆furA and the complemented strain MAP∆furAC were grown

in MB-complete medium to an OD600 of 1.0, RNA was extracted and analysed by

qRT-PCR. As a control we included the mbtB gene (map2177c), which has been

shown to be regulated iron dependently by IdeR in MTB [217] and MAP [290]. As

expected the expression of mbtB was similar in all strains (Fig. 2). In agreement with

our RNA sequencing analyses, ahpC, ahpD, map0847 and map0047c were up- and

down-regulated in the mutant, respectively. Compared to MAP∆furA the gene

expression levels were mostly restored to wildtype levels in the complemented

mutant MAP∆furAC. These small differences to the wildtype strain might be due to the

slightly lower expression level of furA in MAP∆furAC compared to MAPwt (Fig. 1B).

Overall, these results confirm the regulatory influence of FurA on expression of ahpC,

ahpD, map0847 and map0047c.

Iron starvation and oxidative stress induce FurA-repressed genes but

not FurA-activated genes

FurA has been shown to require Fe2+ for executing its regulatory role in many

bacterial species [300]. Furthermore, auto-repression and induction by oxidative

stress of furA has been shown in MTB [293,294,301]. To evaluate the regulation of

furA and the function of FurA in MAP, we initially exposed MAPwt to different iron

starvation conditions by addition of 10, 100 or 200 µM 2,2-dipyridyl (DIP) for 8 h and

analysed gene expression by qRT-PCR. As a positive control for iron limitation we

included mbtB in our experiments. Compared to the untreated control, DIP treatment

resulted in a dose dependent induction of mbtB with a maximum fold change (81-

fold) at a concentration of 200 µM DIP. In contrast, expression of furA was almost

uninfluenced even at highest concentrations of DIP (Fig. 3A). These data indicated

that iron is of minor relevance for furA regulation in MAP.

Next we examined expression of FurA-regulated genes in MAPwt exposed to

oxidative stress or iron starvation. For this, bacterial cultures were exposed to 20 mM

hydrogen peroxide (H2O2) or 200 µM DIP for 2 h and gene expression was analysed

by qRT-PCR. As shown in Figure 3B, furA was strongly induced (34.5-fold) by H2O2


66

mbtB ahpC ahpD 0847 0047c-60

-40

-20

20

40

furA

furAC

1

** * *n.s. *re

lativ

e f

old

chang

e

Figure 2: Functional complementation of FurA regulated genes.

MAP wildtype (wt), MAP∆furA and the complemented strain MAP∆furAc were grown in MB-complete to

an OD600 of 1.0. Total RNA was extracted, followed by cDNA synthesis and qRT-PCR analysis.

Expression of genes mbtB, ahpC (map1589c), ahpD (map1588c), map0847 and map0047c in

MAP∆furA (white bars) and MAP∆furAc (black bars) was compared to transcription levels of MAPwt.

Samples of three independent experiments were analysed by qRT-PCR, normalized to the

housekeeping gene gap and expressed as fold change compared to the MAPwt (mean±SEM).

Statistical analysis was performed using Mann-Whitney test with * p<0.05 and ** p<0.005.


67

A

mbtB furA

50

100

150

200

10 µM

100 µM

200 µM

1

rela

tive

fo

ld c

hang

e

B

mbtB furA katG ahpC ahpD 0847 0047c

50

100

150

20020 mM H2O2

1

200 µM DIP

rela

tive

fo

ld c

hang

e

Figure 3: Iron- and stress dependent expression of furA and FurA regulated

genes.

(A) MAP wildtype (wt) cultures were grown in MB-complete to an OD600 of 1.0. Cultures were divided

and treated with 10/100/200 µM 2,2-bipyridyl (DIP) for 8 h for iron depletion. Total RNA was extracted,

used for cDNA synthesis and analysed for changes in gene expression by qRT-PCR. (B) MAPwt

cultures were grown in MB-complete to an OD600 of 1.0. Cultures for DIP treatment were divided and

incubated without (untreated control) or with 200 µM DIP for 2 h. Cultures for H2O2 treatment were

harvested at OD600 of 1.0, washed, transferred to MB-cat and incubated for 2 h with or without 20 mM

hydrogen peroxide. Total RNA of all samples was extracted, followed by cDNA synthesis. Gene

expression analysis by qRT-PCR was performed for the genes mbtB, furA, katG, ahpC (map1589c),

ahpD (map1588c), map0847 and map0047c. Results were normalized to the housekeeping gene gap

and are expressed as fold change compared to untreated controls (mean±SEM, n=3).


68

treatment and only weakly (3.4-fold) by DIP. Similarly the expression of katG was

clearly induced by H2O2 and weakly induced by DIP. In contrast, the expression of the

FurA repressed genes ahpC, ahpD as well as mbtB was induced by both of the

treatments (Fig. 3B). Interestingly, the FurA activated genes map0847 and

map0047c did not show any change in expression after both of the treatments.

Overall these findings indicated an iron- and peroxide-dependent repression of genes

by FurA, whereas activation seems to occur most probably by a FurA apoform.

MAP∆furA exhibits higher resistance to intracellular killing in

macrophages but FurA is dispensable during chronical infection

After uptake by macrophages, bacteria are exposed to macrophage defence

mechanisms, such as reactive oxygen species in the phagosome. Pathogenic

mycobacteria are able to survive within macrophages by adapting their metabolism to

the phagosomal compartment. The above data showed that FurA is involved in the

regulation of MAP response to oxygen stress. Therefore, we aimed to address the

role of FurA for intracellular survival of MAPwt, MAP∆furA and MAP∆furAC in

macrophages. First we analysed whether the MAP strains are exposed to reactive

oxygen species after being taken up by the macrophages. For this, J774A.1

macrophages were infected with MAPwt, MAP∆furA and MAP∆furAC or treated with

menadione (+) which is known to induce the generation of reactive oxygen species in

eukaryotic cells [266]. After 1.5 h infection, cells were treated with the reagent

CellROX Deep Red for 30 min. This dye fluoresces upon oxidation and allows the

detection of reactive oxygen species. As shown in Figure 4A, the mean fluorescence

intensity (MFI) measured by FACS analysis in macrophages infected with MAPwt,

MAP∆furA and MAP∆furAC was higher than in untreated macrophages (-), indicating

the generation of reactive oxygen species induced by MAP. Next, cells were infected

with MAPwt, MAP∆furA and MAP∆furAC as described above and bacterial survival

was determined after 2 h, 2 and 7 days by Cfu counting after serial dilution plating. At

each time point we found significantly higher survival rates of MAP∆furA compared to

MAPwt (Fig. 4B). Complementation of MAP∆furA almost completely restored the

phenotype to wildtype level. Confocal analyses of macrophages infected with the

different MAP strains and inside-outside staining of bacteria showed no considerable

differences in mycobacterial up-take by and adhesion to the macrophages. These


69

findings clearly exclude a better phagocytosis of MAP∆furA which could account for

the higher percentage of MAP∆furA in the macrophages at 2 h (Fig. 4B).

Interestingly, the percentage of MAP∆furA viable cells decreased over time from

~70% at 2 h to ~45% at day 2 and to ~20% at day 7 whereas no change in survival

was visible in the wildtype and complement strain, indicating that the mutant also was

being killed. These data indicate that MAP∆furA can better resist the initial killing by

the macrophage, most probably caused by oxidative stress, but is susceptible to

macrophage defence mechanisms present at later time points of infection. Hence, we

analysed the role of FurA for survival in the host. For this C57BL/6 mice were

infected intraperitoneally with 1x108 bacteria of exponentially grown cultures (OD600

of 1.0) and animals were sacrificed 4 weeks post infection. As shown in Figure 5, no

significant differences in weight of liver and spleen, as well as number of bacteria or

granuloma in the liver upon infection with MAPwt and MAP∆furA were detected.

However, as a trend we observed lower Cfu numbers in the livers of MAP∆furA

infected cells. Overall, the lack of FurA in MAP did not alter survival rates compared

to the wildtype and suggests that FurA might be dispensable for MAP infection in the

mouse model.


70

A

0

100

200

300wt

furA

furAC

- + infection

MF

I

B

2h 2d 7d

0

2

4

50

100 wt

furA

furAC

**

**

**

surv

ival i

n %

MAP∆furA MAP∆furAC

MAPwt

unstained

wt

∆FurA

∆FurAC

Menadione

unstimulated

CellROX

Co

un

t


71

Figure 4: Induction of oxidative burst in macrophages and survival of MAP

strains in macrophages.

J774 macrophages (Mø) were grown in DMEM and infected with an MOI of 1:10 with MAP wildtype

(wt) (black bars), MAP∆furA (white bars) and the complemented strain MAP∆furAC (grey bars) grown

in MB-complete to an OD600 of 1.0. (A) Mø were infected as described above for 1.5 h or treated with

100 µM menadion (+). CellROX Deep Red was added to a final concentration of 2.5 mM for 30 min.

Fluorescence of harvested cells was determined by FACS analysis. Shown are the results of four

independent experiments (right panel, mean fluorescence intensity MFI ± SEM). Histograms showing

the production of ROS measured by CellROX Deep Red staining of unstimulated cells (grey dashed-

line histogram) or infected Mø with MAPwt (dark grey histogram), MAP∆furA (light grey histogram),

and the complemented strain MAP∆furAC (grey histogram) are depicted in the left panel. Mø treated

with 100 µM menadion were used as a positive control (black dashed-line histogram). Unstained cells

are shown in the shadowed histogram. One representative experiment out of four is shown. (B) Mø

were infected as described above and incubated for 2 h, 2 and 7 days. Shown are the results of three

independent experiments. Cfu was determined, normalized to the inoculum and survival was

expressed in percent to the inoculum. Statistical analysis was performed using 1way ANOVA (Kruskal-

Wallis) with with * p<0.05 and ** p<0.005. Confocal maximum intensity projections of a double

immunofluorescence staining of J774 macrophages infected with MAPwt, MAP∆furA and MAP∆furAC

(2 h). Extracellular mycobacteria were labelled with anti-MAP-HBHA and green fluorescent Alexa

Fluor® 488, intracellular bacteria with anti-MAP-HBHA and orange fluorescent Alexa Fluor

® 568.

Nuclei were stained blue with DAPI. Extracellular bacteria appear yellow and intracellular appear red.

Bar represents 15 µm.


72

ctrl wt furA0.00

0.05

0.10

0.15

0.20W

eig

ht o

f sp

lee

n

[g]

ctrl wt furA0.8

1.0

1.2

1.4

1.6

1.8

We

ight o

f liv

er

[g]

wt furA0

2x104

4x104

6x104

Cfu

/g li

ver

wt furA0

10

20

30

Num

be

r o

f

gra

nulo

ma / 0

.2 c

m2

Figure 5: Biological fitness of MAP and MAP∆furA in infected mice.

Eight weeks old female C57BL/6 mice were challenged for 4 weeks with MAP wildtype (wt) (circles)

and MAP∆furA (triangle), grown to an OD600 of 1.0 with an infection dose of 1x108 cells. The control

group was treated with DPBS buffer (squares). Weight of spleen (A), liver (B), Cfu detection of

bacteria from liver (C) and the amount of granuloma in the liver per cm2 (D) were chosen as read out

parameters. The results represent the mean ± standard error (SEM) of one animal experiment with 9-

10 mice in each group. Statistical analysis was performed using 1way ANOVA analysis (Kruskal-

Wallis) test with with * p<0.05 and ** p<0.005.

A B

C D


73

Discussion

Bacterial iron homeostasis is tightly regulated and closely linked to the cellular

response against cytotoxic effects due to the generation of reactive oxygen species

(ROS) by free iron ions via the Fenton and Haber-Weiss reaction [161]. Accordingly,

FurA was first identified in E. coli as global transcriptional regulator influencing

expression of genes associated with iron acquisition and storage, but was later also

shown to be involved in the regulation of genes activated by cellular stress [302]. In

mycobacteria furA is located immediately upstream of katG encoding a catalase-

peroxidase. Both genes are co-induced by peroxide treatment [303-305]. From this

and the higher resistance of a furA mutant of the fast growing MSMEG to peroxide

stress [98], it was proposed that in mycobacterial species FurA is involved in the

oxidative stress response regulation [294]. However, the precise role of FurA in

pathogenic mycobacteria has not yet been elucidated.

In the present study, we characterized regulation, expression and function of furA in

MAP. By RNAseq analyses, we were able to dissect a specific involvement of FurA in

the regulation of the MAP response to reactive oxygen radicals, intracellular survival

and the expression of predicted virulence-associated genes. Most interestingly,

unlike in many other bacterial species, FurA did not participate in the regulation of

iron homeostasis in MAP. The involvement of FurA in modulating stress response

and mechanisms for evading host cell defence as well as for invasion and infection is

emphasized by works of other groups as 30 of the 48 regulated genes have been

shown to be differentially expressed in MAP after infection of macrophages or in vivo

infection of cattle (9 M/O, 21 in vivo) [306-308] and 26 of these genes have been

found to be involved in stress response, as they were significantly regulated when

MAP was exposed to acidic pH, nitrosamine, hydrogen peroxide or heat

[306,307,309].

Our transcriptomic data revealed that the FurA regulon includes genes with

repressed and with activated transcription. A defined group of 13 genes encoding for

proteins of general stress response and enzymes necessary for the generation of

reductive activity to detoxify oxygen radicals was induced in MAP∆furA and is

therefore repressed by FurA. For instance map1589c (ahpC) and map1588c (ahpD)

were found to be induced in MAP upon oxygen stress [309] and during macrophage


74

infection [308]. The alkyl hydroperoxide reductases AhpC and AhpD form an

antioxidant system that is necessary for reducing organic peroxides to protect

structures particularly sensitive to peroxide-mediated damage, such as lipids and

nucleic acids [310]. A regulation of ahp genes by the Fur-like regulator PerR has

been described for other bacteria, e.g. Bacillus subtilis and Campylobacter jejuni

[100,311] and supports our finding of a FurA dependent ahp regulation in MAP. The

adenosinephosphosulphate reductase CysH has been shown to contribute to

protection against oxidative and nitrosative stress in MTB [312] and many other

FurA-repressed genes encode for enzymes involved in reactions liberating reducing

activity in form of H+ ions.

Beyond this, FurA actively contributes to the expression of a subset of 35 genes

many of which are suggested to be involved in virulence or intracellular survival. A

major group of FurA-activated genes comprises genes encoding for invasins

(MAP1204/1204), antigens (MAP2168c, [313]), proteins of the Pro-Pro-Glu (PPE)

family (MAP1003c, [314]), PE-PGRS glycine-rich proteins, (MAP3868, [315]), nlpc

p60 (MAP1272c, [316]) and a mce family protein (MAP2114c, [317]) as well as

several enzymes for cell entry, and it has been demonstrated for other bacteria, that

homologues to these genes are important virulence factors [318,319]. Interestingly,

also some proteins involved in electron transfer were affected which suggest that

FurA contributes to the maintenance of the canonical endogenous redox balance.

Different modes of regulation by FurA have been described for other bacteria

[247,320]. Our iron starvation and peroxide stress experiments revealed that FurA

exerts its regulatory functions in different conditions. Repressor binding of FurA to

cis-regulatory elements upstream of its target genes is assumed to occur in its Fe2+

bound form as a homodimer ([300], Fig. 6A). Accordingly, the depletion of

intracellular Fe2+ with DIP or the oxidation of Fe2+ to Fe3+ by peroxide treatment

enhanced the expression of FurA repressed ahpC and ahpD (Fig. 6B). This indicates

that FurA executes its repressive role in its Fe2+ bound form. Moreover, these

experiments for the first time support the involvement of FurA in ahp regulation in

mycobacteria.

Gene activation by FurA on the other hand seems to operate iron independently,

indicated by the expression of map0847 and map0047c. Activation of both genes

was FurA dependent but was not influenced by either oxidative stress or iron

starvation (Fig. 6A+B). This ability of FurA is in agreement with studies in


75

Figure 6: Putative regulatory mechanisms of FurA in MAP.

(A) Regulation of genes by FurA in the presence of iron in MAP wildtype (wt). Formation of

homodimers upon Fe2+

incorporation, subsequent binding to cis-regulatory elements (Fur box) and

repression (ahpC/D). Transcriptional activation of genes such as map0847 by FurA is independent of

iron or oxidation. (B) Regulation of genes by FurA in the absence of iron or upon oxidative stress in

MAPwt. Relieve of homodimer formation and derepression of ahpC/D expression. (C) Transcription of

genes in MAP∆furA in the presence of iron. Absence of FurA allows transcription of ahpC/D, but

abolished transcription of map0847.


76

Helicobacter pylori and C. jejuni which showed that even an apoform of FurA

contributes to activation of gene expression [243,321,322]. The deletion of furA

resulted in a constitutive expression of ahpC/D and a reduced expression of

map0847 (Fig. 6C). Together these experiments strongly suggest that in pathogenic

mycobacteria FurA as a repressor functions as an iron-based sensor of peroxides,

whereas FurA as a transcriptional activator most likely operates in its apoform.

In MTB FurA is supposed to be autoregulative [301]. Despite the presence of a

predicted Fur binding site upstream MAPfurA our study revealed that iron depletion

only slightly affected furA expression in MAP. Therefore the biological relevance of

other predicted putative canonical FurA binding sites in the operator sites of ahpC,

map0847 as well as two other genes remains to be elucidated.

Expression of furA was highly induced upon exposure to oxygen stress. This is also

known for other mycobacteria and suggests that regulation of FurA might occur by

other stress regulators. Accordingly, furA transcription was found to be regulated by

SigB in MTB [323]. Therefore, besides the FurA regulon, the co-expression of furA

and katG in response to oxidative stress emphasizes the hypotheses that FurA is a

major regulator of the mycobacterial response to peroxide stress.

The particular role of FurA for virulence in mycobacteria has not been shown yet.

Like other pathogenic mycobacteria MAP is able to infect and survive in

macrophages. Therefore, MAP must be able to react to the antimicrobial

macrophage response such as reactive oxygen radicals. Indeed, our macrophage

infection experiments with MAPwt, MAP∆furA and MAP∆furAC showed the induction

of oxygen species formation in the host cell. When monitoring the intracellular fate of

MAPwt, MAP∆furA and MAP∆furAC we observed a significantly higher percentage of

viable MAP∆furA cells compared to the wildtype and MAP∆furAC at all analysed time

points after infection. The higher percentage resulted from higher survival most

probably given by an enhanced resistance of MAP∆furA to oxidative stress mediated

by the expression of FurA repressed genes of the mycobacterial stress response. A

similar mechanism was described for C. jejuni and MSMEG: In these species,

deletion of perR and furA, respectively, resulted in a hyperresistancy to peroxide

stress [100,295]. In contrast the long term survival rate of MAP∆furA was

considerably lower compared to the wildtype and MAP∆furAC. This indicates that

genes activated by FurA are needed for the adaptation of MAP to the macrophage

phagosomal microenvironment.


77

In the intestinal tissue of the infected host metabolic adaptation and oxidative stress

defence dominate the metabolism of MAP [142,143]. In contrast to the macrophage

infections the furA deletion did not affect MAP survival in a mouse model of

intraperitoneal MAP infection. Thus the phenotype of MAP∆furA is not advantageous

when MAP has to counteract a complex immune response or has to metabolically

adapt the host environment. This suggests in the mouse infection model the

biological fitness of MAP seems to depend on a complex array of adaptive

processes.

Conclusion

In conclusion, in the presented study, we determined for the first time the regulon of

FurA in a pathogenic mycobacterial species. Our data provide novel insights into the

function of FurA in mycobacteria. They suggest two different physiological roles

executed by FurA in two different functional conditions. When iron loaded, FurA acts

as a repressor for a selective group of genes involved in the response to oxidative

stresses. In this condition, it operates as an iron-based sensor of peroxides and

therefore might be functionally closely related to PerR. Simultaneously but

independent from this role, in its apoform, FurA contributes to gene activation of a

second group of genes, many of which are suggested to contribute to MAP virulence.

Overall the role of FurA is more defined in mycobacteria than in other bacteria. Thus,

maintenance of iron homeostasis is independent of FurA. Instead, FurA is involved in

redox regulation and intracellular survival.

Acknowledgements

We are grateful to Nina Janze (TiHo Hannover) for excellent technical assistance and

Abdulhadi Suwandi (HZI Braunschweig) for the help in the mouse infection

experiments. This work was supported by a grant from the German Research

Foundation (DFG, Ge522/6-1). RG and GFG were additionally supported by the

German Federal Ministry of Education and Research (BMBF, ZooMAPII: 01KI1003A,

01KI1003B).


78

Conflict of Interest Statement:

The authors declare that the research was conducted in the absence of any

commercial or financial relationships that could be construed as a potential conflict of

interest.

Authors and Contributors

RG, GFG and JM designed the experiments; TM constructed the mutant, MJ

performed RNA sequencing; TM, EE and KL characterized the mutant and the

complemented strain; EE analysed iron- and stress dependent regulation, AN and KL

performed the macrophage experiments, RG and SW designed the mouse infection

experiments, TM performed the mouse infections. TM, EE, JM, RG analysed data;

and EE, RG and JM wrote the paper.

Results part II Chapter 4

79

Chapter 4

Results part II:

Identification of a lineage specific zinc responsive genomic island

in Mycobacterium avium ssp. paratuberculosis

Chapter 4 has been submitted for publication with following co-authors: Michael

Jarek, Jochen Meens and Ralph Goethe.

Own contributions are specified on page 105.

Chapter 4 Results part II

80

Abstract

Maintenance of metal homeostasis is crucial in bacterial pathogenicity as metal

starvation is the most important mechanism in the nutritional immunity strategy of

host cells. Thus, pathogenic bacteria have evolved sensitive metal scavenging

systems to overcome this particular host defence mechanism. The ruminant

pathogen Mycobacterium avium ssp. paratuberculosis (MAP) displays a unique gut

tropism and causes a chronic progressive intestinal inflammation. MAP possesses

eight conserved large specific genomic polymorphisms (LSP), which distinguish MAP

from its ancestral M. avium ssp. hominissuis or other M. avium subspecies. LSP14

and LSP15 harbour many genes proposed to be involved in metal homeostasis and

have been suggested to substitute for a MAP specific, impaired mycobactin

synthesis.

In the present study, we found that a LSP14 located putative IrtAB-like iron

transporter encoded by mptABC was induced by zinc but not by iron starvation.

Heterologous reporter gene assays with the lacZ gene under control of the mptABC

promoter in M. smegmatis (MSMEG) and in a MSMEG∆furB deletion mutant

revealed a zinc dependent, metalloregulator FurB mediated expression of mptABC

via a conserved mycobacterial FurB recognition site. Deep sequencing of RNA from

MAP cultures treated with the zinc chelator TPEN revealed that 70 genes responded

to zinc limitation. Remarkably, 45 of these genes were located on a large genomic

island of approximately 90 kb which harboured LSP14 and LSP15. Thirty-five of

these genes were predicted to be controlled by FurB, due to the presence of putative

binding sites. This clustering of zinc responsive genes was exclusively found in MAP

and not in other mycobacteria.

Our data revealed a particular genomic signature for MAP given by a unique zinc

specific locus, thereby suggesting an exceptional relevance of zinc for the

metabolism of MAP. MAP seems to be well adapted to maintain zinc homeostasis

which might contribute to the peculiarity of MAP pathogenicity.


81

Introduction

Transition metals such as iron and zinc are key factors in numerous biological

processes as both, structural and catalytic cofactors for proteins. Therefore, they are

important for the metabolic homeostasis and viability of eukaryotic and prokaryotic

cells [168,197]. However, high intracellular amounts of free iron and zinc also bear a

great toxic potential. Consequently, cells have established sensitively regulated

processes for maintaining a balanced intracellular metal homeostasis.

In mycobacteria, several importer, exporter and scavenger proteins as wells as

different regulator proteins have been described to contribute to metal homeostasis

[324,325]. The most important regulator of iron homeostasis in mycobacteria is the

iron dependent repressor protein IdeR, a metal binding transcriptional regulator of the

Diptheria-toxin Repressor (DtxR) family [215]. IdeR is a regulator with complex

functions, on the one hand side acting as a repressor of mycobactin synthesis and

iron siderophore uptake transporters [185]. On the other hand side, it activates the

synthesis of iron storage proteins. In addition, IdeR is involved in virulence and in the

regulation of stress response and central metabolism [218]. The role of another

regulator, the staphylococcal iron regulator repressor SirR in mycobacterial iron

metabolism has been suggested, but has not been confirmed yet [220].

The maintenance of zinc homeostasis in mycobacteria is regulated by the

metalloregulator system SmtB-FurB. Both regulators are co-transcribed from one

operon, but work antagonistically. SmtB is a metal sensor of the ArsR-family, which

senses free zinc ions and regulates the majority of zinc export systems [326],

whereas the FUR family protein FurB, also known as Zur, is a zinc dependent

repressor of zinc uptake systems [201,221,247].

Mycobacterium avium ssp. paratuberculosis (MAP) is the causative agent of

paratuberculosis (Johne‟s disease), a chronic, incurable enteritis in ruminants. MAP

belongs to the M. avium complex (MAC). The MAC comprises genetically closely

related subspecies with different extents of environmental adaptation and virulence.

For instance, the MAC ancestral M. avium ssp. hominissuis (MAH) retained genes for

environmental lifestyle, but can also cause opportunistic infections in humans, pigs

and ruminants [327]. In contrast, MAP, as an obligatory pathogen, is unable to

multiply in the environment [328] and needs the host for multiplication. Hence, MAP


82

developed a particular tropism to the intestine [27], characterized by strong metabolic

adaptations [142,143], allowing massive MAP proliferation in the host at late stages

of disease. The phenotypical differences in the MAC are associated with irreversible

insertions and deletions of genomic fragments, so called large sequence

polymorphisms (LSP) [17]. Thus, the MAP genome comprises seven exclusive

lineage specific LSP insertions (LSP2, LSP4, LSP11, LSP12, LSP14, LSP15, LSP16)

and one deletion (LSP8). Interestingly, several genes located on these LSPs have

recently been found to be associated with virulence [21,22].

A common feature of the pathogenicity of MAP and other pathogenic mycobacteria is

the ability to persist intracellularly in macrophages by inhibiting the phagosomal

maturation [56], thereby evading or contemporarily modulating host cell defence

mechanisms [329-331]. Additionally, mycobacteria are able to overcome the so

called nutritional immunity, a process induced by host cells and characterized by

microbial nutrient starvation or intoxication [117,119,197]. Thus, macrophages are

able to deplete essential iron ions by secreting scavenging chelating compounds

such as haem, lactoferrin and ferritin or express metal transporters such as Fpn-1

[129]. Furthermore, they are able to create an iron depleted environment in the

phagosome by the activity of the natural resistance associated membrane protein

(NRAMP) transporter [332,333]. Most pathogenic mycobacteria are able to

counteract iron starvation by inducible expression of the iron chelating siderophores

mycobactin and carboxymycobactin, the expression of which is controlled by IdeR

[291].

MAP is unable to produce functional mycobactins. Even though the gene cluster for

mycobactin synthesis is present in the genome, the genes mbtA and mbtE are

truncated [15] which disturbs mycobactin production. Hence, MAP requires

substituting systems. The mycobacterium paratuberculosis transporter gene cluster

(mpt) is a promising candidate as it is predicted to encode two putative transporters

(mptABC and mptDEF) involved in metal transport [19,23]. It is located on the MAP

specific LSP14 along with two clusters encoding a putative siderophore synthesis

system (sid, map3739c-3745) and a putative siderophore uptake system (fep,

map3726-3728). In addition, the mptABC operon shows homologies to the iron

uptake transporter IrtAB of M. tuberculosis (MTB) [23]. In MTB, IrtAB was shown to

contribute to virulence and maintenance of iron homeostasis by mediating

mycobactin uptake [23,185].


83

Despite the need of MAP for an iron substituting system, the function and the

regulation of the genes of LSP14 and LSP15 is unclear. Regulation by IdeR is

unlikely as no binding site for this regulator could be found in the promoter region

[334]. Furthermore, the ferric uptake regulator FurA has recently been shown to be

not involved in the regulation of the genes of LSP14 and LSP15 (Eckelt et al.,

submitted).

Since the maintenance of metal homeostasis is crucial for survival of MAP in the

host, we were interested to elucidate the role of LSP14 and LSP15 in metal

homeostasis. In the presented work, we found that the mptABC transporter is

regulated by zinc and that the transcriptional regulator FurB is directly involved in the

zinc dependent regulation of mptABC. Furthermore, we analysed the global response

of MAP to zinc starvation and were able to identify a unique zinc responsive genomic

island in MAP.


84

Results

Metal dependent regulation of a MAP specific genome region

The MAP specific LSP14 and LSP15 harbour many genes proposed to be involved in

metal homeostasis [17,19]. Amongst these map3736c-3734c (mptABC) encode for

an IrtAB like transporter [23,185], the gene cluster map3739c-3745 (sid) for a

siderophore synthesis system and map3726-3728 (fep) for another predicted

siderophore uptake system. Therefore, we were interested whether these genes

were regulated metal dependently. To investigate this, we exposed MAP to different

metal starvation conditions and analysed changes in gene expression by qRT-PCR.

Iron starvation was achieved by addition of the cell membrane permeable iron

chelator 2,2-bipyridyl (DIP) by depleting intracellular Fe2+ ions. In these experiments,

the mbtB gene (map2177c) of the mycobactin cluster, which is known to be induced

by iron starvation in MTB and MAP [216,217], was included as positive control.

As shown in Figure 7A, compared to the untreated control, expression of mbtB was

strongly induced upon DIP treatment (200 µM final), indicating successful iron

chelation. Expression of mptA and sidA, representing the mptABC and sid-operon,

respectively, was also enhanced after DIP treatment, however to a considerably

lower extent than mbtB. To dissect whether this induction was due to iron starvation

or DIP chelation of other metal ions, we analysed the expression of these genes in

cultures treated with nitrilotriacetic acid (NTA) at a final concentration of 14 mM. NTA

is a less selective non permeable chelator which binds Fe3+ and many other metal

ions. As shown in Figure 7B, treatment of MAP cultures with NTA, even over

extended time, did not affect mbtB expression, whereas mptA and sidA were still

induced. The fep cluster responded neither to DIP nor to NTA treatment (data not

shown). These results suggested that metal ions other than iron are involved in the

regulation of the mptABC and sid-operon. To prove this, we supplemented NTA

cultures (14 mM final) with ZnSO4, FeSO4, MgCl2, CaCl2, CuSO4, CoCl2 or MnSO4

each to a final concentration of 1 mM [335]. Compared to cultures treated with NTA

only, induction of mptA (Fig. 7C) and sidA (data not shown) were significantly

repressed only upon supplementation with ZnSO4, indicating a zinc dependent

regulation of the mptABC and sid-operon.


85

A B

mbtB mptA sidA

20

40

120

160

200

1

rela

tive

fo

ld c

hang

e

mbtB mptA sidA

10

20

30

1

rela

tive

fo

ld c

hang

e

C

- Zn2+

Fe3+

Mg2+

Ca2+

Cu2+

Co2+

Mn2+

10

20

30

*

1

rela

tive

fo

ld c

hang

e

D E

mbtB mptA sidA

20

40

60

80

100

120

1

rela

tive

fo

ld c

hang

e

- Zn2+

Fe3+

20

40

60

80

100

120

***

1

n.s.

rela

tive

fo

ld c

hang

e


86

Figure 7: Metal dependent regulation of a M. avium ssp. paratuberculosis

specific gene locus.

MAPwt was grown in MB-complete to an OD600 of 1.0 and treated with different chelating agents and

supplements as described in Methods. After RNA extraction, changes in gene expression levels of

mbtB (black bars), mptA (white bars) and sidA (grey bars) were analysed by qRT-PCR. (A) 200 µM

2,2-bipyridyl (DIP) for 2 h. (B) 14 mM nitrilotriacetic acid (NTA) for 24 h. (C) NTA treated cultures

(14 mM, 24 h) supplemented with 1 mM ZnSO4, FeSO4, MgCl2, CaCl2, CuSO4, CoCl2 or MnSO4. (D)

10 µM N,N,N′,N′-tetrakis (2-pyridylmethyl) ethylenediamine (TPEN) for 2 h. (E) TPEN treated cultures

(10 µM, 2 h) supplemented with ZnSO4 or FeSO4 both in a final concentration of 7.5 µM. Shown are

the results of at least three independent experiments (mean±SEM). Results were normalized to the

housekeeping gene gap and are expressed as fold change compared to the untreated controls.

Statistical analyses were performed using Kruskal-Wallis test (C) with * p<0.01 and *** p<0.0001 or

Mann-Whitney test (E) with *** p<0.0001.

Figure 8: TPEN-Zn titration experiment.

MAPwt was grown in MB-complete to an OD600 of 1.0, treated with 10 µM N,N,N′,N′-tetrakis (2-

pyridylmethyl) ethylenediamine (TPEN) for 2 h and supplemented with increasing concentrations of

ZnSO4. (-) indicates the control with TPEN only. Expression of mptA was analysed by qRT-PCR.

Shown are the results of three independent experiments, expressed as fold change (mean±SEM)

compared to the untreated control and normalized to the houskeeping gene gap.

- 1 µM 2.5 µM 5 µM 7.5 µM10 µM

-20

20

40

60

80

100

1rela

tive

fo

ld c

hang

e


87

The specificity of a zinc dependent regulation was further investigated by exposure of

MAP cultures to 10 µM N,N,N′,N′-tetrakis (2-pyridylmethyl) ethylenediamine (TPEN),

a cell permeable chelating agent, which specifically binds intracellular zinc with high

affinity. As expected, TPEN treatment resulted in a strong induction of mptA and

sidA, whereas expression of mbtB was only very slightly affected (Fig. 7D). Vice

versa, supplementation of TPEN treated cultures (10 µM final) with ZnSO4 but not

FeSO4 (both in a final concentration of 7.5 µM) completely abolished mptA induction

(Fig. 7E). In fact, titration experiments for the determination of the optimal

concentration showed that the addition of 1 µM ZnSO4 (final concentration) was

already sufficient to reduce induction of mptA to approx. 50%, which emphasizes the

high sensitivity of the regulation of mptA by zinc (Fig. 8). Together these results

demonstrated the zinc dependent regulation of the mptABC- and sid-operon.

A functional FurB binding site is necessary for mptABC operon

expression

Next, we were interested to elucidate the mechanisms of zinc dependent regulation

of the mptABC operon. First, we determined the transcriptional start site (TSS) of

mptA by 5‟RACE from TPEN treated cultures and defined the promoter-operator

elements as shown in Figure 9A. The TSS was located at nucleotide 4158897

[NCBI:NC_002944] and a putative translation start (TLS) codon [ATG] of mptA was

found +56 bp downstream (position 4158839 to 4158841), preceded by a putative

ribosome binding site (RBS) GAAGGATTGAG (position 4158843 to 4158853). A

putative -10 promoter element (TATGTTAT) could be identified -8 bp from the TSS

(position 4158901 to 4158908). Furthermore, we could identify three sequence motifs

in the 5‟ proximal promoter-operator region with high homology to the binding site of

the zinc dependent metalloregulator FurB (Zur) of MTB [201], hereafter designated

as Zur box 1-3.

Following, we tested the ability of MSMEGwt to serve as a heterologous expression

system by transforming MSMEGwt with the plasmid pMP1102 [261], harbouring the

complete mpt cluster and 941 bp upstream the TSS of mptA. Then, cultures were left

untreated (pMP-) or treated (pMP+) with TPEN (final concentration 10 µM) for 2 h

Expression of mptA was analysed by qRT-PCR. As shown in Figure 9B, we observed

88

A B

pMP- pMP+

20

40

60

80

100

1

**

rela

tive

fo

ld c

hang

e

C D

AAACACCCCCGTAATGAAAATCATTTTCATTACGGACGGGGACCCTACG Zur box1

GCACTGAGACCTTTAATGAAAGTCATTTTCAATAACCCAGATGTGACGG Zur box2

AG GTGGAGGTATGTTATCGATAACGATTTTCATTATCGGTT Zur box3

CACGATGGCTCGGTTTGAGCGCGGAAGGATTGAGCATGGACCCGAATA RBS M D P N

325 bp

TLS MptA (RACE)

TLS MptA (NCBI)

TSS mptA -10

88

Chapte

r 4

Results

part II

89

Figure 9: Organisation and FurB dependent regulation of a MAP specific ABC transporter.

(A) Analysis of the mptABC operon by 5‟RACE. MAPwt was grown in MB-complete to an OD600 of 1 and treated 2 h with 10 µM TPEN. Transcription start

sites (TSS) were determined by 5‟RACE. Depicted is the putative organisation of the mptABC promoter region [NCBI:NC_002944] (position 4158368 to

4158826). TSS and putative translation start sites (TLS) according to NCBI (NCBI) and 5‟RACE results (RACE) are indicated in bold. A putative -10

promoter site is highlighted grey, putative Zur boxes and a ribosome binding site (RBS) are underlined. (B) Heterologous expression and regulation of the

mptABC operon in MSMEG. MSMEG was transformed with pMP1102, cultured in MB-complete to an OD600 of 1.0 and treated 2 h with 10 µM TPEN.

Gene expression of mptA was analysed by qRT-PCR. Bars represent the relative fold change of the treated MSMEGwt pMP1102 transformant (pMP+) to

the untreated control (pMP-) of three independent experiments (mean±SEM). Statistical analysis was performed using Mann-Whitney test with

** p<0.005. (C) Analysis of Zur binding sites in MAP by FIMO analysis. Upper panel: consensus sequence of MTB-Zur [201] used for FIMO. Middle panel:

Zur box3 of mptA. Lower panel: mutated mptA Zur box3, black arrows indicate mutated nucleotides. (D) Zur box analysis of the mptABC operon by β-

galactosidase assay. MSMEGwt was transformed with the indicated lacZ-reporter plasmids: mptA2, mptA8, mptA3 and mptA2-MUT. Strains were grown

in MB-complete to an OD600 of 1.0 and either incubated 2 h with (black bars) or without (white bars) 10 µM TPEN. Proteins were extracted and promoter

activity was analysed by β-galactosidase assay. Shown are the results of three independent experiments (mean±SEM). Activity was measured at a

wavelength of 405 nm and related to mg protein per ml. Statistical analysis was performed by using the Kruskal-Wallis-Test with * p <0.01 and

*** p <0.0001.

89

Results

part II

Chapte

r 4


90

a clear induction of expression upon zinc starvation compared to the untreated

control. This indicated that the regulation of mptABC in MSMEG was similar to that in

MAP, thereby demonstrating the suitability of the system. To elucidate the relevance

of the Zur boxes we cloned 984 bp from -941 to +42 relative to the TSS of mptA,

harbouring all three putative Zur boxes but lacking the RBS, into the lacZ-reporter

plasmid pJEM15. Next, we introduced the resulting plasmid pJEM-mptA2 and the

promoter-less pJEM15 vector into MSMEG and analysed β-galactosidase activity of

untreated or TPEN treated cultures. As shown in Figure 9C, without TPEN treatment,

both MSMEG transformants showed only low β-galactosidase activity similar to the

insert-free pJEM15 transformants. Treatment with TPEN significantly increased β-

galactosidase activity of MSMEG transformed with pJEM-mptA2. Deletion of the two

proximal Zur boxes (pJEM-mptA8) could not reverse TPEN induced reporter activity,

suggesting that additional upstream promoter elements are necessary for full mptA

regulation. As expected, deletion of the putative promoter elements including Zur

box3 (pJEM-mptA3) resulted in a loss of repression. To dissect the relevance of Zur

box3, we generated pJEM-mptA2MUT with two point mutations in Zur box3 (Fig. 9D).

By site directed mutagenesis we exchanged nucleotides GT and CG at positions

4158899 and 4158887 in pJEM-mptA2 [TGTTATCGTATAACGATTTTCGATTA].

These mutations resulted in a complete loss of TPEN induced mptA repression (Fig.

9C), clearly showing a direct involvement of Zur box3 in regulation of the mptABC

operon.

The mptABC operon of MAP is regulated by FurB

The above analysis showed that Zur box3 mediated FurB repression of mptA.

Comparison of amino acid sequences of FurB of MAP [NCBI:NP_961073] and

MSMEG [NCBI:YP_888759] to MTB [NCBI:NP_216875] by blastp and Clustal

Omega analyses revealed high homologies of 90% and 80%, respectively, indicating

a strong conservation within mycobacterial FurB proteins. Moreover, all catalytic and

structural important amino acids [225] were highly conserved among the species

(Fig. 10A). To prove FurB as the responsible regulator of mptA, we deleted furB

(msmeg4487) in MSMEG and transformed the resulting mutant MSMEG∆furB with

pMP1102, harbouring the complete mpt cluster and the 5‟UTR of mptA. qRT-PCR

analyses revealed that the expression level of mptA in MSMEG∆furB (∆pMP) was

91

A B

pMP pMP

10

20

30

40

50

1

**

rela

tive

fo

ld c

hang

e

C

0 4 8 12 100 200

LV

mptA2

n.s.

n.s.

***

OD405 / protein mg/ml

5„ 3„ mptA2 1 2 3

pJEM15 pJEM-15

mptA2

91

Results

part II

Chapte

r 4

Figure 10: Analysis of mptA regulation by FurB after heterologous expression in M. smegmatis∆furB (MSMEG∆furB).

(A) FurB amino acid sequences of MAP, MTB and M. smegmatis (MSMEG) were compared using ClustalOmega multiple sequence alignment. Asterices

indicate homologue amino acids, grey arrows show highly conserved catalytic sites, black arrows structural binding sites (according to [225]). (B)

MSMEG∆furB was transformed with pMP1102, grown in MB-complete to an OD600 of 1.0 and gene expression of mptA compared to MSMEG wildtype (wt)

was analysed by qRT-PCR. Shown are the results of three independent experiments expressed as the relative fold change of gene expression of the ∆furB

mutant (∆pMP) to the wildtype (pMP), normalized to the housekeeping gene gap. Statistical analysis was performed using Mann-Whitney test with

** p<0.005. (C) MSMEG∆furB was transformed with pJEM15 or pJEM-mptA2, grown in MB-complete to an OD600 of 1.0 treated with 10 µM TPEN for 2 h,

proteins were extracted, concentration was determined and promoter activity of TPEN treated (black bars) and untreated cultures (white bars) was

analysed by β-galactosidase assay. Results of at least three independent experiments (mean±SEM) are shown. Absorption was measured at a wavelength

of 405 nm and related to mg protein per ml. Statistical analysis was performed by using the Kruskal-Wallis-Test with *** p <0.0001.

92

Chapte

r 4

Results

part II


93

significantly higher compared to MSMEGwt (pMP) at standard culture conditions

(Fig. 10B), suggesting a loss of repression by FurB. In addition, analysis of β-

galactosidase activity in MSMEG∆furB transformed with pJEM-mptA2, harbouring the

functional Zur box3, showed a complete derepression of promoter activity (Fig. 10C).

Addition of TPEN did not increase mptA promoter activity in the β-galactosidase

assay (Fig. 10C) or gene expression in the MSMEG∆furB pMP1102 transformant,

analysed by qRT-PCR (data not shown). Thus, these data strongly suggest a FurB-

dependent regulation of the mptABC operon in MAP.

Transcriptional response of MAP to zinc starvation

Since the mptABC and sid-operon are part of the MAP specific genomic insertion

LSP14, we were interested to investigate the overall response of genes of this and

other LSPs to zinc starvation. For this purpose, we performed RNA deep sequencing

of RNA from untreated and TPEN treated MAP cultures and dissected differential

gene expression by Rockhopper analysis (Table 10). In total, 70 genes were found to

be at least >3-fold differentially expressed in the TPEN culture compared to the

untreated control (Table 6).

Clustering of the differentially expressed genes into orthologous groups (COG)

revealed that 35% of the TPEN responsive genes are involved in inorganic ion

transport and metabolism (P) as well as secondary metabolites biosynthesis,

transport and catabolism (Q) and defence mechanisms (V).

A high number of genes (54) was organized in 16 operons and most interestingly, 28

differentially expressed genes were located on LSP14 and LSP15. All genes except

one were higher expressed in the TPEN treated culture. The single lower expressed

gene was smtB (map2138), a zinc-sensing repressor de-repressed by free Zn2+

[325]. The group of higher expressed genes was comprised of ABC-type metal

transporters and systems, including the mpt cluster and parts of the sid operon

(map4065, map3774c-3776c, map3731c-3736c, map3739c-3741, map2414c,

map0487c-0489c), as well as an ESX-typeVII secretion system and PE-/PPE-family

proteins (map3778-3788, map3765, map3737). Also, the mycobactin clusters mbt1

(map2172c-2177c) and mbt2 (map1553c-1555c) were slightly induced by TPEN-

treatment. Furthermore, induction of genes encoding for ribosomal proteins


94

(map3771, map3767c-3769c) and cobW-like chaperons (map3772c, map3770c,

map3747c) was observed.

FIMO analysis based on the Zur box motif of MTB revealed the presence of 19

putative Zur boxes (Table 7) in the 5‟UTR of 12 regulated genes or gene clusters

(Table 6 asterisks) of the MAP zinc regulon, in toto comprising 38 genes (Table 6

underlined).

Remarkably, with the exception of one gene cluster, all genes preceded by a putative

Zur box were clustered on a single 90 kb gene locus from map3725 to map3788

spanning LSP14 and LSP15 (Fig. 11), hereafter designated as MAP specific zinc

responsive genomic island (ZnGI). Only the operon with MAP homologues to the well

described zinc transporter ZnuABC (map0487c-0489c) harboured a Zur box in the 5‟

region and was encoded elsewhere in the genome.

Apart from putative Zur-regulated genes, we also found a number of zinc dependent

but Zur-independent genes, either distributed over the genome (22 genes) or located

on the 90 kb gene locus (10 genes).

Finally we analysed the genomic distribution of the homologues of the zinc

responsive genes of MAP and additional Zur dependent genes of MTB in other

mycobacteria species (MTB, MSMEG, MAV, M. bovis BCG Pasteur, M. marinum,

M. leprae, M. vanbaalenii) (Table 17). Interestingly, in contrast to MAP, we found no

evidence for a locus specific clustering of these genes in the other mycobacterial

species, demonstrating the specificity of the ZnGI for MAP.

95

Table 6: Zinc dependent differentially expressed genes

Orthologue genes (% similarity) Fold

RCNa Locus tag MTB MAV q-value

b change

c Putative function

d COG

e

- MAP4069c - MAV_4568 (99.3) <0.0001 9.5 unknown function S

- MAP4065 Rv0924c (43.62) MAV_4571 (99.8) 0.0044 3.16 putative NRAMP family membrane protein P

- MAP3788 Rv0292 (61.6) MAV_4860 (98.3) <0.0001 25.48 ESX type VII secretion protein EccE -

- MAP3787 Rv0291 (69.9) MAV_4862 (98.9) <0.0001 30.43 type VII secretion-associated serine protease MycP3 -

- MAP3786 Rv0290 (80.1) MAV_4863 (99.4) <0.0001 15.38 type VII secretion integral membrane protein EccD -

- MAP3785 Rv0289 (77.0) MAV_4864 (99.7) <0.0001 22.69 putative ESX-3 secretion-associated protein -

- MAP3784 Rv0288 (79.0) MAV_4865 (100) <0.0001 22.09 Esat-6 like protein EsxH S

- MAP3783 Rv0287 (84.5) MAV_4866 (100) <0.0001 20.81 Esat-6 like protein EsxG -

- MAP3782 Rv0286 (41.85) MAV_4867 (98.6) <0.0001 22.37 PPE-family protein N

- MAP3781 Rv0285 (85.1) MAV_4868 (99.0) <0.0001 29.76 PE-family protein -

- MAP3780 Rv0284 (84.9) MAV_4869 (93.47) <0.0001 23.91 ESX type VII secretion protein EccCa/EccCb D

- MAP3779 Rv0283 (72.6) MAV_4870 (87.5) <0.0001 37.19 ESX type VII secretion protein EccB -

- *MAP3778 Rv0282 (86.5) MAV_4871 (91.5) <0.0001 28.87 ESX-3 type VII secretion system protein EccA O

- MAP3776c Rv2059 (51.45) MAV_0583 (46.3) <0.0001 13.81 hypothetical protein, putative permease P

- MAP3775c Rv2397c (52.38) MAV_0582 (55.5) <0.0001 15.26 ATPase component of Mn/Zn ABC-type transporter P

- MAP3774c Rv2060 (37.0) MAV_0581 (51.89) <0.0001 17.58 ABC-type Mn2+/Zn2+ transport permease component P

- MAP3773c Rv2359 (56.8) MAV_2036 (58.06) <0.0001 16.92 Fe2+/Zn2+ uptake regulation protein, Fur family protein P

- *MAP3772c - - <0.0001 140.73 cobW-like cobalamin synthesis, metal chaperone R

rpmE2 MAP3771 - - <0.0001 183.4 50S ribosomal protein L31 J

95

Results

part II

Chapte

r 4



b change

c Putative function

d COG

e

- *MAP3770 Rv0106 (66.1) MAV_4874 (73.5) <0.0001 218.07 cobW-like cobalamin synthesis, metal chaperone R

rpmG *MAP3769c Rv2057c (85.2) MAV_4876 (93.5) <0.0001 191.92 50s ribosomal protein L33 J

rpsN2 MAP3768c Rv2056c (81.2) - <0.0001 194.0 30S ribosomal protein S14 RpsN2 J

rpsR2 MAP3767c Rv2055c (77.2) MAV_0076 (84.61) 1.0 22.32# 30S ribosomal protein S18 J

- MAP3766 - MAV_4878 (85.1) <0.0001 6.83 hypothetical protein, putative permease R

- *MAP3765 Rv3738c (80.43) MAV_4879 (76.1) <0.0001 24.43 PPE-family protein N

pks2 *MAP3764c Rv1180 (78.67) MAV_2370 (68.0) <0.0001 23.31 polyketide synthase Pks2 Q

papA3_2 MAP3763c Rv1182 (68.24) MAV_2723 (66.35) <0.0001 21.0 polyketide synthase associated protein papA3 -

- MAP3762c Rv1524 (67.83) MAV_3994 (70.74) <0.0001 35.58 putative glycosyl hydrolase GC

- MAP3761c Rv1517 (50.86) MAV_1758 (50.58) <0.0001 5.03 unknown function -

- MAP3760c Rv2952 (72.0) MAV_3877 (50.58) <0.0001 4.02 unknown function H

fadD28 MAP3752 Rv3826 (61.4) MAV_2374 (67.1) <0.0001 3.4 acyl-CoA synthetase IQ

mmpL4_5 MAP3751 Rv0507 (64.9) MAV_3863 (65.4) <0.0001 26.35 MmpL-family protein, MmpL4_5 R

mmpS1 MAP3750 Rv0451c (69.49) MAV_3864 (68.37) <0.0001 67.0 putative membrane protein -

- MAP3749 Rv2750 (49.46) MAV_2946 (60.0) <0.0001 163.04 3-ketoacyl-ACP reductase, caRveol dehydrogenase IQR

IS1110 MAP3748c Rv2177c (50.0) MAV_1059 (43.31) 0.00012 4.42 IS1110 transposase L

cobW *MAP3747c Rv0106 (59.53) MAV_4874 (58.39) <0.0001 41.47 putative cobalamin synthesis protein R

sidB MAP3741 Rv2383c (45.86) MAV_2009 (66.47) 0.0 150.4# putative thioester reductase -

sidA *MAP3740 Rv2383c (45.86) MAV_2013 (47.41) <0.0001 237.0 putative non-ribosomal peptide synthase Q

96

Chapte

r 4

Results

part II

97



b change

c Putative function

d COG

e

sidG *MAP3739c Rv2333c (44.2) - <0.0001 270.0 MFS transporter permease G

- MAP3738c - - <0.0001 121.73 type12 methyltransferase R

- *MAP3737 Rv0280 (63.9) MAV_4872 (59.37) <0.0001 75.65# PPE-family protein N

mptA *MAP3736c Rv1348 (50.0) MAV_1566 (51.37) <0.0001 39.4 hypothetical protein, ABC-transporter ATPase V

mptB MAP3735c Rv1348 (54.48) MAV_1566 (54.16) <0.0001 78.18 ABC transporter ATP-binding protein V

mptC MAP3734c Rv1348 (59.33) MAV_1566 (58.36) <0.0001 19.0 putative ABC transporter ATPase and permease V

mptD MAP3733c - - <0.0001 5.77 unknown function -

mptE MAP3732c - - <0.0001 13.14 ABC-type cobalt transport system, permease P

mptF MAP3731c Rv3663c (44.93) - <0.0001 4.11 ABC-type cobalt transport system, ATP binding P

- MAP3632 Rv0190 (89.6) MAV_4988 (100) <0.0001 5.23 unknown function S

- MAP3626c - MAV_4993 (100) <0.0001 29.25 metallothionein -

- MAP3492 Rv3401 (86.0) MAV_4352 (99.7) <0.0001 10.27 putative glycosyl hydrolase G

- MAP3491 Rv3400 (77.3) MAV_4350 (98.9) <0.0001 22.04 hypothetical beta-phosphoglucomutase hydrolase R

- MAP3047 Rv3013 (88.0) MAV_3861 (100) <0.0001 16.0 ACT domain-containing protein TK

- MAP2999 Rv2963 (80.7) MAV_3787 (99.2) <0.0001 16.82 hypothetical protein R

- MAP2414c Rv1348 (79.6) MAV_1566 (97.7) <0.0001 5.0 iron ABC transporter permease V

- MAP2412c - MAV_1568 (98.6) <0.0001 6.0 phosphotransferase enzyme family protein R

trpE2 MAP2205c Rv2386c (74.0) MAV_1792 (99.6) <0.0001 4.54 salicylate synthase MbtI EH

mbtB MAP2177c Rv2383c (72.1) MAV_2009 (98.6) <0.0001 10.0 Phenyloxazoline synthase Q

- MAP2176c Rv2383c (58.02) MAV_2010 (98.6) <0.0001 10.0 phenyloxazoline synthase, thioesterase Q

97

R

esults

part II

Chap

ter 4



b change

c Putative function

d COG

e

mbtC MAP2175c Rv2382c (71.9) MAV_2011 (99.1) <0.0001 5.75 polyketide synthase, erythronolide synthase Q

mbtD MAP2174c Rv2381c (53.08) MAV_2012 (98.2) <0.0001 4.43 MbtD, polyketide synthase Q

mbtE MAP2173c Rv2380c (74.38) MAV_2013 (96.8) <0.0001 4.35 MbtE, partial linear gramicidin synthetase subunit D Q

- MAP2172c Rv2380c (51.11) MAV_2013 (99.3) <0.0001 5.58 fmnh2-utilizing oxygenase Q

smtB MAP2138 Rv2358 (74.4) MAV_2037 (99.3) 0.00034 - 7.5 ArsR family transcriptional regulator K

- MAP1977c Rv0560c (43.04) MAV_2216 (98.6) <0.0001 12.5 CheR methyltransferase, SAM binding domain R

- MAP1555c Rv1344 (77.8) MAV_2873 (100.0) <0.0001 7.81 acyl carrier protein IQ

fadD33_2 MAP1554c Rv1345 (70.0) MAV_2874 (99.2) <0.0001 3.67 acyl-CoA synthetase IQ

fadE14 MAP1553c Rv1346 (81.9) MAV_2876 (99.2) <0.0001 3.99 acyl-CoA dehydrogenase FadE14 I

- *MAP0489c Rv2059 (63.1) MAV_0583 (99.0) <0.0001 27.14 putative Zinc ABC transporter, periplasmic ZnuA P

- MAP0488c - MAV_0582 (99.3) <0.0001 30.0 putative Zinc ABC transporter, ATP-binding ZnuC P

- MAP0487c Rv2060 (84.2) MAV_0581 (99.7) <0.0001 10.07 putative Zinc ABC transporter, transmembrane ZnuB P

aReference Common Name

bq-value of differentially expressed genes MAPwt standard culture vs. MAPwt TPEN culture calculated by Rockhopper analysis. A q-value < 0.01 is

considered as significant. cgene expression values of MAPwt TPEN culture divided by gene expression values of MAPwt standard culture from RNA-sequencing.

dPutative function based on Blast2Go or NCBI blastx analysis.

eFunctional classification of proteins has been performed by use of COG database with MAP-K10 as a reference

(http://www.ncbi.nlm.nih.gov/sutils/coxik.cgi?gi=380). (C) Energy production and conversion, (D) Cell cycle control, (E) Amino acid transport and metabolism, (G) Carbohydrate transport and metabolism, (H) Coenzyme transport and metabolism, (I) Lipid transport and metabolism, (J) Translation, (K) Transcription, (L) Replication, recombination and repair, (N) Cell motility, (O) Posttranslational modification, protein turnover, chaperones, (P) Inorganic ion transport and metabolism, (Q) Secondary metabolites biosynthesis, transport and catabolism, (R) General function prediction only, (S) Function unknown, (T) Signal transduction mechanisms, (V) Defence mechanisms. *genes preceded by predicted FurB binding sites from FIMO analysis. #zinc dependent expression was confirmed by qRT-PCR

98

Chapte

r 4

Results

part II

99

Table 7: Zur boxes of the MAP zinc regulon as predicted by FIMO analyses

Locus tag RCNa Position

b Zur box

c

MAP3778 -236 TGATAATGAAAATGATTTTCGTTA

MAP3772c -30 CGTTAATGAAAATGATTATCATTA

MAP3770 -88 GCTTATTGAAAATGATTTTCGACA

-33 TCGAGATGAAAATGATTCCCAATA

MAP3769c rpmG -283 TCTTGTCGAAAATCATTTTCAATA

-338 CCTTATTGGGAATCATTTTCATCT

MAP3765 -270 GCTTACTGAAAATGATTGTTATTA

-139 TGTTAACGAAAATCGTTTTCAGTA

MAP3764c pks2 -307 GTTTACTGAAAACGATTTTCGTTA

MAP3747c cobW -88 GCTTATTGAAAACGATTTTCGACA

-33 GCTAGATGAAAACGATTGTCGATA

MAP3740 sidA -118 CGACAATGAAAATCGTTTTCAGTA

MAP3739c sidG -21 CCTTACTGAAAACGATTTTCATTG

MAP3737 -197 CCGTAATGAAAATGATTTTCATTA

-248 GGTTATTGAAAATGACTTTCATTA

MAP3736c mptA -65d TGTTATCGATAACGATTTTCATTA

-440d CTTTAATGAAAGTCATTTTCAATA

-491d CCGTAATGAAAATCATTTTCATTA

MAP0489c -66 TTGTAATGGAAACGATTTTCATTA

aReference Common Name

bPosition of the first base relative to the annotated translation start site [NCBI:NC_002944]

cPutative Zur binding sites according to MEME-SUITE and FIMO analysis on the basis of MAP K-10 genome [NCBI:NC_002944]

dPosition of the first base relative to the transcription start site determined by RACE experiments

99

Results

part II

Chapte

r 4


100

Discussion

In contrast to other mycobacteria, MAP exhibits a strong tropism to the gut, but the

molecular mechanisms which enable MAP to fill this niche are only poorly

understood. The large sequence polymorphism (LSP) lineage specific genomic

insertions LSP14 and LSP15, unique to MAP and acquired during evolution, are

suggested to be involved in metal homeostasis and have been found to be

associated with virulence [17,19,21,22]. Since acquisition of metals is a crucial

pathomechanism, in the present study we intended to analyse the metal dependent

regulation of the LSP14-15 gene locus. Initially, our particular interest was drawn to

the mpt (mycobacterium transporter protein) cluster, comprised of two predicted

transporters (mptABC and mptDEF), as it might represent an alternative iron

scavenging system which possibly compensates for MAP defects to produce

mycobactins [15]. In fact, mptABC was hypothesised to represent the iron regulated

transporter IrtAB in MAP [336]. However, our starvation experiments clearly showed

a sensitive regulation of the mptABC operon by zinc but not by iron.

Zinc homeostasis is tightly regulated by the FUR family regulator FurB (Zur) in many

bacteria [201,337,338], as zinc starvation as well as zinc excess ultimately lead to

cell death. Despite this, only little is known about zinc homeostasis in mycobacteria.

Analyses in MTB indicated the regulation of zinc transporters and storage systems by

Zur [201]. Yet, functional studies are missing so far and no research has been

conducted on MAP.

Our in silico analyses revealed that FurB of MSMEG, MTB and MAP are almost

identical and share the same structural and catalytic amino acids. In addition, by

FIMO analysis we found a conserved homology of MAP Zur boxes to Zur boxes of

MTB and other bacteria (Table 7 [201,339]). In fact, by site directed mutagenesis, we

could demonstrate the specificity of these boxes. Mutation of two single, highly

conserved nucleotides [GANAANNNTTTTC] in the FurB binding site located in the

5‟ UTR of the mptABC operon (Zur box3) resulted in the loss of gene repression in

MSMEG. Using MSMEG as a heterologous model, we showed a highly sensitive

transcriptional response of the mptABC operon to zinc starvation (Fig. 12 A+B). In

addition, by generating a MSMEG∆furB mutant, we were able to show that FurB is

involved in mptABC regulation. Deletion of FurB in MSMEG led to a complete loss of

101

Figure 11: Organisation of a M. avium ssp. paratuberculosis specific zinc responsive genomic island (ZnGI).

Depicted are the genes map3725 to map3788. Genes responsive to zinc starvation are colored either blue (no Zur box) or green (Zur box). Location of

Zur boxes and genes under their control are marked by black arrows. LSP14, LSP15 and two other gene clusters are marked by white bold arrows at the

bottom.

101

Results

part II

Chapte

r 4


102

mptA gene repression (Fig. 12C). This clearly demonstrated the importance of FurB

in mptABC regulation and implies a putative role of mptABC as zinc importer.

RNAseq allowed us to assess the global response of MAP to zinc limitation and

provided an interesting insight in MAP zinc homeostasis. Overall the majority of the

70 differentially expressed genes could be assigned to metal homeostasis. Notably,

45 zinc responsive genes were clustered on a single 90 kb locus in the genome,

spanning the region from map3725 to map3788 (Fig. 11). Therefore, we specified

this locus as MAP specific zinc responsive genomic island (ZnGI). 11 predicted Zur

box containing promoter-operator elements located on the ZnGI suggest the control

of in toto 35 genes by MAPZur. The ZnGI comprises LSP14 (map3725-3764c), an

intermediate cluster with a high number of genes for ribosomal proteins (map3765-

3770), LSP15 (map3771-3776c) and the adjacent gene cluster map3778-3788

(Fig. 11). The latter is preceded by a Zur box and encodes for an ESX-typeVII

secretion system, which mediates the transport of PE and PPE proteins [340]. In

addition, it was shown to be necessary for iron and zinc metabolism in MTB [202] as

well as host-pathogen interaction [341]. Also the ZnGI genes map3771, map3769c,

map3768c, and map3767c encoding for the ribosomal proteins rpmE2, rpmG2,

rpsN2 and rpsR2, respectively, were dramatically induced upon zinc starvation. The

presence of Zur binding sites upstream of the ribosomal genes in MAP suggested

suppression by MAPZur. These genes are paralogues of the genes rpmE1, rpmG1,

rpsN1 and rpsR1 (map2463c, map4106, map4180, map0069) which are localised

beyond the ZnGI in the MAP genome and were not induced by zinc depletion.

Interestingly, in contrast to the latter, the corresponding proteins encoded by rpmE2,

rpmG, rpsN2 and rpsR2 do not bear zinc binding CXXC motifs, suggesting that they

are functional substitutes of the others in the absence of zinc as it has been

described for MTB, Streptomyces coelicolor and Bacillus subtilis [201,342,343].

Moreover, the ZnGI harboured three putative Zur regulated genes of CobW-like

proteins, induced to a very high extend. Proteins of this family (COG0523) are linked

to zinc homeostasis in all kingdoms of life [339] and have been found to be Zur-

regulated in other bacteria [201,344,345]. These proteins possibly constitute low-

affinity zinc transporters or chaperones, which are utilized to direct Zn2+ ions to the

proper protein.

Interestingly, contrary to so far described genes, the gene cluster map3761c-3764c

on the ZnGI, most probably regulated by MAPZur, was predicted to be involved in lipid


103

Figure 12: Regulation model of mptABC by FurB in MAP.

(A) When zinc is present smtB (map2138) and furB (map2139) expression is allowed, subsequently

suppressing gene transcription of putative zinc importer mptABC (map3736c-3731c) by binding of zinc

loaded FurB to the promotor region. (B) Upon zinc starvation, apo-SmtB binds to the promotor region

and inhibits expression of smtB and furB. Apo-FurB is released and transcription of mptABC is

possible. (C) Block of transcription even at standard zinc concentration is abolished upon furB

deletion.


104

and carbohydrate metabolism. Furthermore, two gene clusters lacking a predicted

Zur binding site located on the ZnGI were highly induced by zinc: a group of virulence

associated membrane proteins (MmpL4/MmpS1), and an enzyme involved in fatty

acid biosynthesis (map3749-3751). Together with the zinc induced expression of the

paralogous ribosomal genes, the regulation of the above groups of genes suggests

that MAP to some extent changes its metabolism to adapt to zinc starvation.

Comparison of the MAP zinc regulon and the Zur regulon of MTB [201] revealed a

high congruency. Orthologues of 23 MTB Zur regulated genes were found on the

MAP ZnGI which however is in striking contrast to MTB where the Zur regulon is

organized in small clusters scattered over the genome. In addition, 9 genes of the

MTB regulon were either not present (4) or regulated (5) in MAP, indicating that other

genes of the ZnGI may substitute their functions. Analysis of homologue genes to

zinc responsive and Zur regulated genes of MAP and MTB and subsequent cluster

analysis in other pathogenic and apathogenic mycobacteria also confirmed the

unique clustering of zinc regulated genes on the ZnGI of MAP.

Only one predicted Zur binding site was located outside the ZnGI, preceding MAP

homologues (map0487c-0489c) to the well described high-affinity zinc importer

ZnuABC of E. coli [155,193] and Salmonella Typhimurium [196]. Thus, MAP

possesses three putative zinc responsive transporters: the ZnuABC transporter and

two ZnGI located transporters, namely mptABC (map3736c-3734c) and an ABC-type

Mn2+/Zn2+ transporter (map3773c-3776c). All were induced by zinc starvation

(Table 6), however only the first two systems seem to be regulated by MAPZur.

Furthermore the ABC-type Mn2+/Zn2+ transporter and the mptABC transporter have

no homologues in other mycobacteria and in concert with the above described data

might enable MAP to more efficiently circumvent zinc starvation. Together these data

point to a very particular relevance of zinc in MAP.

Beyond the ZnGI, zinc responsive genes mainly showed a weak reaction to zinc

starvation, including the mycobactin cluster mbt1 (map2172c-2177c) and mbt2

(map1553c-1555c). Gene expression was slightly increased but compared to the

specific iron dependent response (Fig. 7) we consider this induction as a secondary

effect of metal chelation. This might also hold true for other weakly induced genes.


105

Conclusions

In summary, our data confirmed the initial assumption of an involvement of the

lineage specific gene loci LSP14 and LSP15 in metal homeostasis. But other than

previously assumed, they were highly responsive to zinc starvation. Moreover, we

found a striking particularity for MAP zinc homeostasis, given by the clustering of zinc

regulated genes on a large 90 kb spanning zinc specific locus (ZnGI), which was not

found in other mycobacteria, and the presence of MAP specific zinc transporters. In

general, MAP seems to be well adapted to maintain zinc homeostasis. The

importance of zinc transporters in the gut for colonisation and survival in the mucosal

environment has been shown for S. Typhimurium, Acinetobacter baumanii and

Campylobacter jejuni [197,198,346]. Thus, presumably the MAP specific ZnGI point

to particular processes of adaptation, enabling MAP to develop its unique gut

tropism. However, this assumption has to be addressed in future studies.

Competing interests

The authors declare that they have no competing interests.

Author’s contributions

RG, JM and EE designed the experiments; EE constructed and characterized the

mutant, constructed plasmids, performed β-galactosidase assays, depletion

experiments and qRT-analyses. MJ performed RNA sequencing; EE analysed zinc

dependent regulation and performed cluster analysis. RG, JM and EE analysed data

and wrote the paper.

Acknowledgements

We thank Prof. Brigitte Gicquel (Institute Pasteur, Paris, France), who kindly provided

the β-galactosidase plasmid pJEM15. This work was supported by a grant from the

German Research Foundation (DFG, Ge522/6-1). RG was additionally supported by

the German Federal Ministry of Education and Research (BMBF, ZooMAPII:

01KI1003A, 01KI1003B).

General discussion Chapter 5

107

Chapter 5

General discussion

Chapter 5 General discussion

108

5.1 Mycobacterial evolution and adaptation

The genus Mycobacterium comprises a large number of different species with very

different lifestyles. They can be devided in three subcategories, starting with fast

growing, non-pathogenic, widespread environmental species, e.g. M. smegmatis

(MSMEG), followed by facultative pathogenic species such as M. avium ssp. avium

(MAV) [347] and finally the slow growing, obligatory pathogenic mycobacteria, with

M. tuberculosis (MTB) and M. leprae as the most prominent members. The varying

mycobacterial lifestyles are reflected by an enormous metabolic adaptation to the

respective environments and are accompanied by a rearrangement and reduction of

genome sizes. For instance, the saprophytic MSMEG possesses a genome of

approx. 6.7 Mb with 6,938 open reading frames (ORF), providing essential genes

that allow growing with scarce nutrient supply. On the other hand, the obligate

intracellular persisting human pathogens MTB (4.4 Mb, 3,924 ORF) and M. leprae

(3.3. Mb, 2,713 ORF) reduced their genome sizes due to coevolution and nutrient

adaptation within the host, thus reflecting a more and more specified lifestyle.

Interestingly, the three mentioned species share only 1001 gene orthologues,

strongly suggesting a radical intra- or intergenomic rearrangement and a specialised

adaptation to their specific environment [348].

This genomic variation is also visible within the M. avium complex (MAC). The MAC

comprises subspecies of M. avium with different extents of environmental adaptation

and virulence. For instance the MAC ancestral M. avium ssp. hominissuis (MAH) is

able to both survive and replicate in the environment or cause opportunistic infections

in mammalian hosts [327,349]. In contrast to this, the causative agent of

paratuberculosis in ruminants - M. avium ssp. paratuberculosis (MAP) - is an

obligatory pathogen and missing important genes for the environmental lifestyle.

Thus MAP is dependent on the host for multiplication and moreover most probably

developed a unique tropism to the intestine [27,328,350]. Genomic deletion and

insertion events have been investigated within the MAC (MAV, MAH, MAS and

MAP), allowing a differentiation between the subspecies by the presence or absence

of lineage specific large sequence polymorphisms (LSP). The uniqueness of MAP is

represented by 8 conserved LSPs (insertions LSP2, LSP4, LSP11, LSP12, LSP14,

LSP15, LSP16 and deletion LSP8), comprising 82 ORF, which are not found in other


109

members of the MAC. Homology analyses suggested that the majority of these

genes were acquired horizontally from other Actinomycetales [17].

Recently, some genes of the MAP specific LSPs have been found to be important for

host adaptation and associated with virulence. More precisely, 26 genes were found

to be crucial for MAP survival in mouse experiments [21,22]. Of these, 6 genes were

part of an earlier identified 38kb pathogenicity island, which was proposed to be

involved in metal homeostasis and suggested to be regulated by the ferric uptake

regulator FurA [19,351].

5.2 Struggle for nutrients at the host-pathogen interface

The availability of essential nutrients for the bacterium during the passage or

persistence in a eukaryotic host is of major importance for bacterial survival or

successful infection. Bacteria occupy different niches inside the host, e.g. blood,

tissue or immune cells, and each habitate provides different nutrients. Thus,

especially pathogenic bacteria have developed the ability to adapt their metabolism

to the given conditions [352-354]. For instance mycobacteria show a strong

adaptation by metabolizing host cell membrane lipids [142,143,355]. Also, the

availability of metals plays an important role, as they constitute important cofactors in

many biological processes

Host cells take advantage of this fact and combat invading bacteria either by creating

nutrient starvation or by intoxication of the intruder. The underlying mechanisms to

these host cell defence mechanisms are referred to as nutritional immunity [117-121].

Nutritional immunity encompasses the withdrawl of all available nutrients, however it

is best established for metals [116]. To overcome nutritional immunity, especially

pathogenic bacteria have evolved counter mechanisms to maintain physiological

concentrations of essential metals inside the host by the expression of metal

scavenging or detoxifying systems (see section 1.5). Thus, the outcome of host-

microbe interactions greatly depends on the capability of both sides to regulate and

express suitable systems to balance metal concentrations.

Maintenance of a balanced metal homeostasis is mainly controlled by

metalloregulators; proteins which are able to sense concentrations of certain ions in

the environment [209,210] and subsequently mediate downstream regulation of

genes for counter mechanisms.


110

An important family of metalloregulators is the ferric uptake family (FUR), which is

widely distributed in bacteria. Fur in other bacteria has been described as a global

regulator in iron homeostasis and oxidative stress response [211,223], but not in

mycobacteria. Mycobacteria possess two FUR-like regulators, FurA and FurB, the

latter also referred to as Zur. FurA was suggested to be involved in stress response,

but has not been investigated to date. The role of FurB has recently been specified to

contribute to zinc homeostasis in MTB and other microbes [201,337,338], but not yet

for MAP. Thus, since maintenance of metal homeostasis and the ability to counteract

stress is of major importance in bacterial survival, we intended to elucidate the

impact of these two metal dependent transcriptional regulators in MAP.

5.3 The complex nature of FurA regulation

The regulatory mechanisms executed by Fur have recently been extended from the

classical iron dependent gene repression to additional mechanisms. Hence, in other

bacteria, Fur homologues were found to act as a metal-dependent activator of gene

transcription. Moreover, some mechanisms were also observed independent of the

iron cofactor (apo-Fur repression / activation) [243,244,293].

For MAP FurA (MAPFurA), no study concerning the function or regulatory mechanisms

has been conducted until very recently. By characterization of a MAP∆furA deletion

mutant, Meissner [254] provided evidence that FurA was not involved in

mycobacterial iron homeostasis but might contribute to intracellular survival.

However, the regulatory mechanisms of MAPFurA remained unclear. By further

analysing the transcriptome of FurA as well as the transcriptional response of

MAPwt, MAP∆furA and a complemented strain to iron starvation and peroxide stress

we were able to unravel the molecular mechanisms of FurA regulation and gained

insight in furA expression.

Interestingly, we found that in MAP FurA regulation of target genes seems to function

in two opposed ways. The presence of higher and lower expressed genes in the

MAP∆furA mutant implied both, gene repression and activation by MAPFurA. Iron

starvation and peroxide stress experiments clearly revealed, that repression of gene

expression was iron- and peroxide dependent, whereas transcription activation was

independent from these stimuli, suggesting a function of apo-MAPFurA as an activator.

To our knowledge, this is the first report on Fur executing both functions. However,


111

activation and repression by the FUR-like regulator Zur have been reported for

Acinetobacter baumanii [248].

The genomic co-localisation of furA and katG, encoding for a catalase peroxidase, is

highly conserved in mycobacteria and suggested an involvement of MAPFurA in

oxidative stress response. Auto-regulation by iron dependent Fur repression of fur

expression is the most common mechanism of fur regulation in bacteria [293,294].

This regulatory mechanism was also proposed for mycobacteria [301] including MAP,

due to the presence of a FurA binding site upstream the furA gene. However, when

we analysed furA-katG regulation upon iron starvation or peroxide stress, we found,

that furA and katG expression was unaffected by low iron concentrations, whereas

gene expression was significantly induced upon oxidative stress. Thus, iron

independent regulation of furA-katG renders an auto-regulation unlikely. Instead, the

peroxide sensitive regulation is more reasonable, considering the putative role of

FurA in MAP stress response.

In fact furA regulation, if not auto-regulatory, could also be controlled by other

regulators. For instance furA expression was found to be controlled by catabolite

activator protein (CAP), OxyR or SoxRS in E. coli [236,278], RNA polymerase

sigma S (RpoS) in Vibrio vulnificus [356] or nickel responsive regulator (NikR) in

Helicobacter pylori [357].

Regulated genes are mainly recognised by the responsible regulator via a conserved

binding motif. As mentioned above, a distinct binding motif for FurA (Fur box) in

mycobacteria was found in the promoter-operator site of furA, published by Sala et

al. (2003) [301]. According to our analysis the specificity of this Fur box is

questionable. This is emphasized as analysis of the MAP genome for putative Fur

boxes predicted 86 motifs (Table 15), however, only 5 could be assigned to genes of

the MAPFurA regulon. It is conceivable, that MAPFurA recognizes different motifs other

than the so far known Fur box. Similar cases of multiple recognition sites were shown

for the regulator CcpA in Streptococcus suis [358] and for CodY in B. subtilis [359].

This hypothesis is also supported by the fact, that we could not generate a

convincing binding motif when subjecting 5‟UTR of putative FurA regulated genes to

MEME-SUITE. It is also possible, that FurA interacts with other regulators such as

OxyR by binding to the same operator, as seen in E. coli [360]. Our findings also

imply that genes without Fur box might possibly be not directly regulated by FurA but

by downstream regulated regulators, such as the FurA repressed PucR family


112

regulator (Table 4). Indirect regulation of genes by FurA is also possible

posttranscriptionally by small RNAs, which are regulated by Fur, e.g. RyhB in E. coli

and S. Typhimurium [245,361]. Thus, the specificity and functionality of so far

identified binding sites are of unknown relevance. To clarify the DNA binding

characteristics of FurA, further studies are indispensable.

Altogether, the organization and regulation of furA-katG in MAP, or mycobacteria in

general, seems to be very complex and could not completely be resolved. Thus,

future studies have to be conducted to clearly define the regulatory mechanism of

furA-katG expression.

5.4 The impact of FurA in stress response and survival

During infection MAP has to counteract host cell defence mechanisms such as the

damage by intracellular reactive oxygen (ROS) and nitrogen species (RNS) [65].

Hence, MAP and other mycobacteria express alkyl hydroperoxid reductases AhpC,

AhpD, superoxide dismutases SodA, SodC and catalase peroxidase KatG upon

infection or artificially induced oxygen or nitrogen stress to neutralize these

hazardous molecules [143,255,307,309,362,363]. However, the regulation of

expression of these antioxidants in mycobacteria is not fully understood.

As stated above transcriptome analyses of a MAP∆furA mutant by Meissner [254]

and additional data from this study revealed the influence of MAPFurA in regulation of

general stress response and intracellular survival. More precisely, genes for oxidative

stress response were induced and thus repressed by MAPFurA, whereas genes

involved in virulence and intracellular survival were lower expressed and MAPFurA

activated.

The general regulator of stress response is the LysR-family protein OxyR [285]. It is

non-functional in MTB and MSMEG [98] but functional in M. marinum and controls

important stress response genes including Ahp [298,364]. Furthermore, it was

suggested that transcription of ahpC/D in MAP is regulated by OxyR, too [308]. In

contrast the presented studies provide strong evidence, that these genes are

regulated by FurA in MAP. Expression of ahpC/D in MAP was induced upon iron

depletion and peroxide stress, suggesting that MAPFurA to a greater extend

functionally resembles the peroxide sensitive FUR-family member PerR.

Interestingly, transcription of ahp and kat genes under the control of PerR was shown


113

for B. subtilis and C. jejunii [311,365]. Thus, from our findings we suggest that

MAPFurA might act as an additional regulatory element in mycobacterial stress

response, supporting or substituting the function of OxyR and for the first time

demonstrated the involvement of MAPFurA in regulation of stress response.

Transcriptional analysis gave evidence for the role of MAPFurA in virulence and

intracellular survival. This question was further assessed by in vitro and in vivo

infection experiments. Our initial findings were contradictory: MAP∆furA showed a

hyperresistant phenotype upon infection of macrophages, indicating a better

resistance to in vitro induced oxidative burst during the first 7 days of infection. Data

of in vivo experiments in mice performed by Meissner [254] suggested by trend a

better survival of the wildtype. Reevaluation of the data did not confirm a significant

difference in survival. Thus, the lack of FurA within the first 4 weeks of infection did

not positively effect the survival of the bacteria within the murine host. It seems that

the hyperresistant phenotype of MAP∆furA is not advantageous when MAP has to

counteract a complex immune response or has to metabolically adapt to the host

environment. Thus, it implies that i) a furA deletion in MAP has no impact on the

biological fitness in the host, ii) the impact of a furA deletion might become apparent

only upon long-term infection in mice or iii) the mouse model is not suited for the

investigation of FurA in MAP infection. Indeed, the mutant was being killed over time

in the macrophage infection experiment, thus it might be, that the level of viable

bacteria after 4 weeks infection in mice is even lower compared to the wildtype level.

To conclusively investigate the role of furA in virulence, it might be nessecary to

establish long-term infection of mice and/or infection experiments in animals

developing clinical disease.

5.5 The impact of FurB in MAP zinc homeostasis and host

adaptation

Until recently, iron was supposed to be the major ion in the battle for metals between

host cells and pathogens [366]. However, in the last years it became more and more

evident, that zinc seems to be just as important, as it constitutes a basic component

in many biological processes. In fact, it has been shown that the host actively alters

zinc concentrations by chelation of Zn2+ ions by proteins of the S100 family

(calprotectin) and thereby impairs bacterial growth [130,131].


114

The most important feature of mycobacterial pathogenicity is the ability to persist

intracellularly in the phagosome of macrophages. Wagner et al. (2005) observed that

during mycobacterial infection, the intraphagosomal concentration of zinc was also

dramatically reduced after 1 h of invasion. However, pathogenic mycobacteria were

able to replenish zinc concentration after 24 h [144], indicating that they must

express mechanisms to counteract starvation. Contrary to this, Botella et al. (2011)

found that macrophages encounter MTB infection by increased and thus toxic

concentrations of zinc [141]. MTB was able to reduce intraphagosomal zinc

concentrations by the expression of heavy metal efflux P-type ATPase CtpC [141].

Thus, mycobacteria seem to be able to evade both, starvation and intoxication, by so

far not completely resolved mechanisms.

The reconstitution of zinc homeostasis is of relevance not only because this transition

metal plays a major role in a number of processes and as a structural component of

many proteins (see sections 1.6-1.7). It appears to be also important in the major

strategy of mycobacterial intraphagosomal persistence - the block of phagosome

maturation. Recently, the involvement of the mycobacterium specific typeVII

secretion system ESX-3 and the appendant PE-/PPE-proteins in zinc homeostasis

was demonstrated for MTB [367]. Interestingly, it has been shown for M. avium ssp.

hominissuis (MAH) that a PPE deficient mutant was not able to prevent acidification

of the phagosome or to maintain a proper zinc concentration. Thus, it was suggested

that zinc constitutes an important factor to arrest phagosome maturation [368,369].

However, despite the importance of this transition metal in mycobacterial

pathogenesis, there is only little information available for mycobacteria in general and

scarcely anything known about regulatory mechanisms of zinc homeostasis in MAP.

To get insight in MAP response to zinc starvation, we analysed zinc depleted MAP

cultures and the FurB dependent regulation of a putative metal transporter. By

transcriptome analysis we were able to identify a subset of 70 zinc responsive genes

involved in zinc transport, storage, zinc associated virulence or overall metal

homeostasis, including the formerly mentioned ESX-3 system. The localization of

zinc dependent regulated genes in MAP was outstanding, as they were clustered on

a clearly defined genomic locus (zinc responsive genomic island ZnGI). This cluster

was regionally restricted to MAP lineage specific genomic insertions LSP14 and

LSP15 and was not found in other mycobacteria.


115

Regulation of zinc homeostasis has been found to be executed by FurB (Zur), a zinc

specific regulator in many bacteria, including MTB [201,337,338]. Analysis of the

MAP genome for Zur binding sites revealed a high congruence to zinc responsive

genes. Of 45 found motifs (Table 16), 24 were located in the 5‟UTR of putative ORF.

Remarkably, 19 of them were found within the zinc regulon, controlling the

expression of 50% of the zinc responsive genes. In addition, the Zur box seems to be

highly conserved, at least in mycobacteria, as the motif used for Zur box analysis

was the MTB Zur binding motif [201] and MAP FurB binding sites exhibited a highly

similar pattern. The motif contains two highly conserved nucleotides in MAP, MTB

and also many other bacteria, e.g. α-, -β and γ-proteobacteria [339]. The exchange of

these two nucleotides in a Zur box of MAP led to a complete loss of function in

transcriptional repression. Due to the similarity of Zur boxes, these two nucleotides

presumably also represent the core nucleotides in other bacteria.

The high specificity of Zur boxes is in contrast to FurA, where the proposed binding

site could not be found in the 5‟UTR of many FurA regulated genes and no consistent

motif could be generated by analysing the FurA regulon. Thus, the FurB binding site

in MAP and other mycobacteria seems to be highly specific for the regulation of zinc

responsive genes and moreover, the role of FurB is clearly defined.

Interestingly, the 5‟UTR of some genes or gene clusters harboured more than one

Zur box. This might hint at a graded expression mechanism as described for

Streptomyces coelicolor [235]. It could enable MAP to react even more sensitive to

environmental changes, thus providing a system to maintain a highly balanced zinc

homeostasis.

Zinc limitation highly affected the expression of a putative non-ribosomal peptide

synthase system with siderophore characteristics (sidA/B map3740-3741, sidG

map3739c). Recently, a novel zinc scavenging system similar to iron binding

siderophores, termed “zinkophore”, was discovered. So far this zinkophore was only

discovered in Candida albicans (Pra1, [370]) and S. coelicolor (coelibactin, [342]).

For S. coelicolor a Zur dependent regulation of the corresponding gene cluster

SCO7676-7692 could be shown [203]. Interestingly, SidA shows 35% identity to

SCO7682 and SidB 38% identity to SCO7683, suggesting the Sid proteins might

execute a similar function.

Moreover, we found three zinc dependent transporter systems, of which two were

exclusively found in MAP and not in other mycobacteria. They were located on the


116

ZnGI and seem to be MAP specific. Also, one of two paralogue ribosomal gene sets

(map3771, map3767c-3769c) was affected by zinc starvation, which is proposed to

facilitate the adaptation to zinc starvation events [343].

Thus, by the presence of a ribosomal zinc depot, two additional putative zinc

transporter systems, and a putative zinc scavenging system on the ZnGI MAP is

particularly well equipped for zinc uptake. This circumstance might be linked to the

ecological niche of MAP. MAP exhibits a unique gut tropism and is able to persist

intracellularly in subepithelial macrophages of the small intestine. As mentioned

above, the ability to maintain intraphagosomal zinc homeostasis is supposed to be

important for intracellular survival. Hence, possessing additional systems for zinc

uptake circumvents intraphagosomal zinc depletion and thereby perturbance of

biological processes in the bacterium and phagosome maturation in the host.

Interestingly, zinc absorption in cattle occurs primarily in this section of the ruminant

gut [371,372]. Also in humans zinc homeostasis is primarily maintained via the

gastrointestinal system and the major site of zinc absorption was found to be the

small intestine [373-375]. Thus, MAP might have adapted to the host cell

environment by the ability to utilize available zinc even better than other bacteria,

which is reflected in its particular genetic elements and might explain its preference

for intestinal colonisation.

5.6 Conclusion

The presented work indicates that MAP responses to host cell defence mechanisms

such as oxidative burst and nutritional immunity which might be essential for MAP to

establish successful infection. This ability is reflected in the presence and regulation

of efficient counter mechanisms, which are controlled by the ferric uptake regulator

proteins FurA and FurB. The role of FurA and FurB of MAP was so far almost

unstudied. The presented study confirmed and extended the findings for FurA,

thereby presenting for the first time an impact of this regulator in controlling gene

expression of important stress response genes such as ahp and genes for

intracellular survival of MAP. Also, in this context the function of MAP FurA as an

iron- and peroxide-dependent repressor and independent activator became evident,

which may apply for many oxyR positive mycobacteria.


117

On the other hand, zinc metabolism seems to be very particular for MAP. Thus, the

role of the zinc dependent regulator FurB was of interest, as MAP exhibits a unique

gut tropism and this organ is the major site of zinc absorption in mammalian hosts.

Zinc responsive genes in MAP were located at a condensed genomic locus (ZnGI),

with a number of MAP specific genes. Hence, these unique genes might be acquired

during adaptation to the host. They might provide advantage in zinc acquisition,

thereby enabling MAP to occupy this particular niche and causing or contributing to

intestinal disorders in ruminants and men.

Summary Chapter 6

119

Chapter 6

Summary

Chapter 6 Summary

120

Elke Eckelt

FurA and FurB – the impact of two transcriptional metalloregulators on

Mycobacterium avium ssp. paratuberculosis stress response and metal

homeostasis

Summary

The pathogen Mycobacterium avium ssp. paratuberculosis (MAP) causes

paratuberculosis in ruminants and is additionally discussed to be involved in the

development of unclear immunological disorders in humans, such as Crohn's disease

and diabetes type I, amongst others. In the host, MAP exhibits a unique gut tropism

and is able to persist in the phagosome of macrophages. This tropism is associated

with the presence of eight unique large sequence polymorphisms (LSPs) and an

impaired synthesis of the siderophore mycobactin. The MAP specific LSP14 and

LSP15 were supposed to be involved in metal homeostasis and a regulation of their

genes by FUR-like proteins (ferric uptake regulator) was suggested.

To date, only few molecular pathomechanisms of MAP have been investigated and

scarce information about the maintenance of metal homeostasis is available.

However, it is getting more and more clear that the ability of MAP to adapt to the

encountered host milieu and to counteract host cell defense mechanisms is most

important for the outcome of infection.

Therefore, the presented study was aimed to analyse the relevance of the two FUR-

like transcriptional regulators of MAP, namely FurA and FurB, in stress response and

metal homeostasis.

In other bacteria, FurA is a global regulator of iron homeostasis and stress response.

Even though FurA in mycobacteria was predicted to be involved in stress response,

but evidence for this hypothesis is still missing. Transcriptome analysis of a furA

deletion strain (MAP∆furA) revealed that the FurA regulon consists of repressed and

activated genes associated to stress response or intracellular survival. Interestingly,

not a single gene related to metal homeostasis was affected by furA deletion.

Exposure of MAP to iron starvation or peroxide stress revealed that FurA repressor

function is iron-dependent and gene activation seems to occur in its apoform.

Furthermore, a decisive role of FurA in intracellular survival was indicated by a

hyperresistant phenotype of MAP∆furA in macrophages. Nevertheless, no obvious

effect could be observed in mouse experiments, indicating that the principal task of

Summary Chapter 6

121

mycobacterial FurA is oxidative stress response regulation. These results

demonstrate for the first time that mycobacterial FurA is not involved in the regulation

of iron homeostasis, but provide clear evidence that FurA contributes to intracellular

survival as a metal-dependent peroxide sensor.

Furthermore, this study indicated a particular relevance of zinc and FurB dependent

gene expression for MAP. FurB is a major regulator of zinc homeostasis in bacteria.

By zinc and iron depletion experiments, we found that a LSP14 located putative

IrtAB-like iron transporter, encoded by mptABC, was induced by zinc but not by iron

starvation. Moreover, heterologous reporter gene assays with the lacZ gene under

control of the mptABC promoter in M. smegmatis (MSMEG) and in a MSMEG∆furB

deletion mutant revealed a FurB mediated expression of mptABC via a conserved

mycobacterial FurB recognition site. The impact of FurB in controlling gene

expression of LSP14 and LSP15 became obvious after deep sequencing of RNA

from MAP cultures treated with the zinc chelator TPEN. In total, 70 genes responded

to zinc limitation, including two additional putative zinc uptake systems and a zinc

scavenging zincophore, which seem to be unique for MAP. Remarkably, 45 of these

genes were located on an approx. 90 kb large zinc responsive genomic island (ZnGI)

which harboured LSP14 and LSP15. Thirty-five of these genes were predicted to be

controlled by FurB, due to the presence of putative binding sites. This clustering of

zinc responsive genes was exclusively found in MAP and not in other mycobacteria.

Overall, our data imply that FurA and FurB contribute to the adaptation of MAP to

intracellular survival in host cells by regulating important adaptation mechanisms.

This ability is particularly emphasised by the unique zinc specific locus in the MAP

genome, thereby suggesting an exceptional relevance of zinc for the metabolism of

MAP. MAP seems to be well adapted to maintain zinc homeostasis which might

contribute to the peculiarity of MAP pathogenicity.

Zusammenfassung Chapter 7

123

Chapter 7

Zusammenfassung

Chapter 7 Zusammenfassung

124

Elke Eckelt

FurA und FurB – der Einfluss zweier transkriptioneller Metalloregulatoren auf

die Stressantwort und Metallhomöostase von Mycobacterium avium ssp.

paratuberculosis

Zusammenfassung

Mycobacterium avium ssp. paratuberculosis (MAP) ist der Erreger der

Paratuberkulose, einer chronisch granulomatösen Enteritis bei Wiederkäuern. Eine

Beteiligung des Erregers an der Entstehung von humanen Autoimmunerkrankungen

wie Morbus Crohn und Diabetes Typ I (u.a.) wird diskutiert. MAP weist einen

einzigartigen Gewebetropismus für den Darm auf und ist in der Lage im Phagosom

subepithelialer Makrophagen zu überleben. Der Darmtropismus geht mit langen

Sequenzpolymorphismen (LSPs) im Genom und einer gestörten Eisenaufnahme-

fähigkeit über das Siderophor Mykobaktin einher. Es wird vermutet, dass die MAP

spezifischen LSP14 und LSP15 zur Erhaltung der Metallhomöostase beitragen und

eine Regulation der auf ihnen liegenden Gene durch metallabhängige Regulatoren

der FUR-Familie (ferric uptake regulator) erfolgt. Bisher sind die Pathomechanismen

von MAP weitgehend unbekannt. Zudem weiß man generell nur sehr wenig über den

Metallstoffwechsel von MAP. Es wird jedoch immer deutlicher, dass die

Metallhomöostase und die Fähigkeit von MAP zur Anpassung an das Wirtsmilieu

maßgeblich für den Erfolg einer Infektion sind. Aus diesem Grund wurde in der

vorliegenden Arbeit die Bedeutung der zwei Transkriptionsregulatoren der FUR-

Familie, FurA und FurB, von MAP für die Adaptation an das antimikrobielle

Wirtsmilieu und für ihre Bedeutung für die Metallhomöostase untersucht.

FurA ist ein globaler Regulator der Eisenhomöostase und Stressantwort in vielen

Bakterien. Die Rolle von FurA in Mykobakterien ist noch weitgehend ungeklärt, es

wird jedoch eine Beteiligung an der Regulation der oxidativen Stressantwort

vermutet. Ein direkter Nachweis hierfür und für seine konkrete Bedeutung für den

Eisenhaushalt fehlte jedoch bisher. Transkriptom-Analysen einer MAP∆furA

Deletionsmutante zeigten eine deutliche Divergenz im Regulationsmuster. Das FurA

Regulon besteht aus reprimierten Genen, hauptsächlich der oxidativen Stressanwort,

und aktivierten Genen, die mit intrazellulärem Überleben assoziiert sind.

Bemerkenswert war, dass durch die furA Deletion kein Gen beeinflusst wurde, das

mit Metallhomöostase in Zusammenhang steht. Eisenmangel- bzw.

Zusammenfassung Chapter 7

125

Peroxidexposition von MAP zeigten eine eisenabhängige Repressorfunktion von

FurA, während die Aktivierung von Gentranskription wahrscheinlich durch das Apo-

FurA vermittelt wird. Eine entscheidende Rolle von FurA für intrazelluläres Überleben

wurde durch einen hyperresistenten Phänotyp der ∆furA Mutante im Makrophagen

deutlich. Infektionsversuche mit Mäusen zeigten jedoch keinen sichtbaren

Unterschied zwischen Wildtyp und Mutante, was darauf hindeutet, dass die

prinzipielle Aufgabe von FurA die Regulation der oxidativen Stressantwort ist. Die

Untersuchungen dieser Arbeit zeigen zum ersten Mal, dass FurA in Mykobakterien

nicht an der Regulation der Eisenhomöostase beteiligt ist und geben Hinweis darauf,

dass FurA als metallabhängiger Peroxidsensor für das intrazelluläre Überleben

wichtig ist.

FurB ist ein wichtiger Regulator der Zinkhomöostase in Bakterien. Durch Zink- und

Eisenmangelversuche konnte nachgewiesen werden, dass der IrtAB-ähnliche

putative Eisentransporter mptABC, der auf dem LSP14 lokalisiert ist, zink- aber nicht

eisenabhängig reguliert wird. Zudem konnte eine FurB-abhängige Regulation des

mptABC Transporters mittels Reportergenstudien mit dem lacZ-Gen unter Kontrolle

des Promotorbereichs von mptABC heterolog in M. smegmatis (MSMEG) sowie in

einer MSMEG∆furB Deletionsmutante gezeigt werden. Des Weiteren konnte eine in

Mykobakterien konservierte Bindestelle von FurB identifiziert werden.

Transkriptomanalysen von Zinkmangelkulturen verdeutlichten die Relevanz von FurB

für die Expression von LSP14 und LSP15 lokalisierten Genen. Von insgesamt 70

zinkabhängig regulierten Genen, inklusive MAP spezifischer zusätzlicher

Zinkaufnahme-Systeme, lagen 45 Gene auf einem begrenzten Genomabschnitt von

ca. 90 kb, der LSP14 and LSP15 beinhaltet. Auf dieser zinkabhängig regulierten

genomischen Insel (ZnGI) kann für 35 dieser Gene eine FurB abhängige Expression

auf Grund vorhandener putativer FurB Bindestellen angenommen werden. Die

Häufung zinkabhängiger Gene auf einen bestimmten Genlokus wurde ausschließlich

in MAP und nicht in anderen Mykobakterien gefunden.

Zusammenfassend zeigen die Untersuchungen dieser Arbeit, dass FurA und FurB

durch die Regulation wichtiger Adaptationsmechanismen zur Anpassung von MAP

an das intrazelluläre Überleben in Wirtszellen beitragen. Die besondere Relevanz

von Zink im Metabolismus von MAP wird durch einen einzigartigen Zinklokus im

Genom unterstrichen und ist möglicherweise ein wichtiger Faktor für die besondere

MAP Pathogenität.

References Chapter 8

127

Chapter 8

References

Chapter 8 References

128

References

1. Ventura M, Canchaya C, Tauch A, Chandra G, Fitzgerald GF, Chater KF et al.: Genomics of

Actinobacteria: tracing the evolutionary history of an ancient phylum. Microbiol Mol Biol Rev 2007, 71: 495-548.

2. Rindi L, Garzelli C: Genetic diversity and phylogeny of Mycobacterium avium. Infect Genet Evol 2014, 21C: 375-383.

3. Turenne CY, Wallace R, Jr., Behr MA: Mycobacterium avium in the postgenomic era. Clin Microbiol Rev 2007, 20: 205-229.

4. Twort FW, Ingram GLY: A method for isolating and cultivating the Mycobacterium enterididis chronicae pseudotuberculosae johne and some experiments on the preparation of a diagnostic vaccine for pseudotuberculous enteritis of bovines. Proc Roy Soc London 1912, 84: 517-43.

5. Brennan PJ, Nikaido H: The envelope of mycobacteria. Annu Rev Biochem 1995, 64: 29-63.

6. Zuber B, Chami M, Houssin C, Dubochet J, Griffiths G, Daffe M: Direct visualization of the outer membrane of mycobacteria and corynebacteria in their native state. J Bacteriol 2008, 190: 5672-5680.

7. Niederweis M, Danilchanka O, Huff J, Hoffmann C, Engelhardt H: Mycobacterial outer membranes: in search of proteins. Trends Microbiol 2010, 18: 109-116.

8. Elguezabal N, Bastida F, Sevilla IA, Gonzalez N, Molina E, Garrido JM et al.: Estimation of Mycobacterium avium subsp. paratuberculosis growth parameters: strain characterization and comparison of methods. Appl Environ Microbiol 2011, 77: 8615-8624.

9. Merkal RS, Curran BJ: Growth and metabolic characteristics of Mycobacterium paratuberculosis. Appl Microbiol 1974, 28: 276-279.

10. Lambrecht RS, Collins MT: Mycobacterium paratuberculosis. Factors that influence mycobactin dependence. Diagn Microbiol Infect Dis 1992, 15: 239-246.

11. Bannantine JP, Bermudez LE: No holes barred: invasion of the intestinal mucosa by Mycobacterium avium subsp. paratuberculosis. Infect Immun 2013, 81: 3960-3965.

12. Valentin-Weigand P: [Pathogenesis and immune reactions of paratuberculosis]. Dtsch Tierarztl Wochenschr 2002, 109: 507-509.

13. Valentin-Weigand P: Intracellular invasion and persistence: survival strategies of Streptococcus suis and Mycobacterium avium ssp. paratuberculosis. Berl Munch Tierarztl Wochenschr 2004, 117: 459-463.

14. Valentin-Weigand P, Goethe R: Pathogenesis of Mycobacterium avium subspecies paratuberculosis infections in ruminants: still more questions than answers. Microbes Infect 1999, 1: 1121-1127.

15. Li L, Bannantine JP, Zhang Q, Amonsin A, May BJ, Alt D et al.: The complete genome sequence of Mycobacterium avium subspecies paratuberculosis. Proc Natl Acad Sci U S A 2005, 102: 12344-12349.

16. Turenne CY, Collins DM, Alexander DC, Behr MA: Mycobacterium avium subsp. paratuberculosis and M. avium subsp. avium are independently evolved pathogenic clones of a much broader group of M. avium organisms. J Bacteriol 2008, 190: 2479-2487.


129

17. Alexander DC, Turenne CY, Behr MA: Insertion and deletion events that define the pathogen Mycobacterium avium subsp. paratuberculosis. J Bacteriol 2009, 191: 1018-1025.

18. Wu CW, Glasner J, Collins M, Naser S, Talaat AM: Whole-genome plasticity among Mycobacterium avium subspecies: insights from comparative genomic hybridizations. J Bacteriol 2006, 188: 711-723.

19. Stratmann J, Strommenger B, Goethe R, Dohmann K, Gerlach GF, Stevenson K et al.: A 38-kilobase pathogenicity island specific for Mycobacterium avium subsp. paratuberculosis encodes cell surface proteins expressed in the host. Infect Immun 2004, 72: 1265-1274.

20. Semret M, Zhai G, Mostowy S, Cleto C, Alexander D, Cangelosi G et al.: Extensive genomic polymorphism within Mycobacterium avium. J Bacteriol 2004, 186: 6332-6334.

21. Meissner T, Eckelt E, Basler T, Meens J, Heinzmann J, Suwandi A et al.: The Mycobacterium avium ssp. paratuberculosis specific mptD gene is required for maintaince of the metabolic homeostasis necessary for full virulence in mouse infections. Frontiers in Cellular and Infection Microbiology 2014, in press.

22. Wang J, Pritchard JR, Kreitmann L, Montpetit A, Behr MA: Disruption of Mycobacterium avium subsp. paratuberculosis-specific genes impairs in vivo fitness. BMC Genomics 2014, 15: 415.

23. Lamont EA, Xu WW, Sreevatsan S: Host-Mycobacterium avium subsp. paratuberculosis interactome reveals a novel iron assimilation mechanism linked to nitric oxide stress during early infection. BMC Genomics 2013, 14: 694.

24. Collins DM, Gabric DM, De Lisle GW: Identification of two groups of Mycobacterium paratuberculosis strains by restriction endonuclease analysis and DNA hybridization. J Clin Microbiol 1990, 28: 1591-1596.

25. Whittington RJ, Marsh IB, Whitlock RH: Typing of IS 1311 polymorphisms confirms that bison (Bison bison) with paratuberculosis in Montana are infected with a strain of Mycobacterium avium subsp. paratuberculosis distinct from that occurring in cattle and other domesticated livestock. Mol Cell Probes 2001, 15: 139-145.

26. Johne HA, Frothingham L: Ein eigentümlicher Fall von Tuberkulose beim Rind. Deutsche Z Thiermed Vergl Path 1895, 438-454.

27. Clarke CJ: The pathology and pathogenesis of paratuberculosis in ruminants and other species. J Comp Pathol 1997, 116: 217-261.

28. Buergelt CD, Hall C, McEntee K, Duncan JR: Pathological evaluation of paratuberculosis in naturally infected cattle. Vet Pathol 1978, 15: 196-207.

29. Stevenson K, Alvarez J, Bakker D, Biet F, de Juan L, Denham S et al.: Occurrence of Mycobacterium avium subspecies paratuberculosis across host species and European countries with evidence for transmission between wildlife and domestic ruminants. BMC Microbiol 2009, 9: 212.

30. Miranda A, Pires MA, Pinto ML, Sousa L, Sargo R, Rodrigues J et al.: Mycobacterium avium subspecies paratuberculosis in a diamant sparrow. Vet Rec 2009, 165: 184.

31. Beard PM, Rhind SM, Buxton D, Daniels MJ, Henderson D, Pirie A et al.: Natural paratuberculosis infection in rabbits in Scotland. J Comp Pathol 2001, 124: 290-299.


130

32. Fecteau ME, Bedenice D, Cebra CK, Pinn TL, McAdams SC, Fyock TL et al.: Prevalence of Mycobacterium avium subsp. paratuberculosis fecal shedding in alpacas presented to veterinary hospitals in the United States. J Vet Intern Med 2013, 27: 1228-1233.

33. Singh S, Gopinath K: Mycobacterium avium subspecies Paratuberculosis and Crohn's Regional Ileitis: How Strong is Association? J Lab Physicians 2011, 3: 69-74.

34. Mendoza JL, San Pedro A, Culebras E, Cies R, Taxonera C, Lana R et al.: High prevalence of viable Mycobacterium avium subspecies paratuberculosis in Crohn's disease. World J Gastroenterol 2010, 16: 4558-4563.

35. Momotani E, Romona NM, Yoshihara K, Momotani Y, Hori M, Ozaki H et al.: Molecular pathogenesis of bovine paratuberculosis and human inflammatory bowel diseases. Vet Immunol Immunopathol 2012.

36. Verdier J, Deroche L, Allez M, Loy C, Biet F, Bodier CC et al.: Specific IgG Response against Mycobacterium avium paratuberculosis in Children and Adults with Crohn's Disease. PLoS ONE 2013, 8: e62780.

37. Paccagnini D, Sieswerda L, Rosu V, Masala S, Pacifico A, Gazouli M et al.: Linking chronic infection and autoimmune diseases: Mycobacterium avium subspecies paratuberculosis, SLC11A1 polymorphisms and type-1 diabetes mellitus. PLoS ONE 2009, 4: e7109.

38. Naser SA, Thanigachalam S, Dow CT, Collins MT: Exploring the role of Mycobacterium avium subspecies paratuberculosis in the pathogenesis of type 1 diabetes mellitus: a pilot study. Gut Pathog 2013, 5: 14.

39. Cossu D, Cocco E, Paccagnini D, Masala S, Ahmed N, Frau J et al.: Association of Mycobacterium avium subsp. paratuberculosis with multiple sclerosis in Sardinian patients. PLoS ONE 2011, 6: e18482.

40. Sisto M, Cucci L, D'Amore M, Dow TC, Mitolo V, Lisi S: Proposing a relationship between Mycobacterium avium subspecies paratuberculosis infection and Hashimoto's thyroiditis. Scand J Infect Dis 2010, 42: 787-790.

41. Cocito C, Gilot P, Coene M, de Kesel M, Poupart P, Vannuffel P: Paratuberculosis. Clin Microbiol Rev 1994, 7: 328-345.

42. Seitz SE, Heider LE, Heuston WD, Bech-Nielsen S, Rings DM, Spangler L: Bovine fetal infection with Mycobacterium paratuberculosis. J Am Vet Med Assoc 1989, 194: 1423-1426.

43. Hines ME, Kreeger JM, Herron AJ: Mycobacterial infections of animals: pathology and pathogenesis. Lab Anim Sci 1995, 45: 334-351.

44. Whitlock RH, Buergelt C: Preclinical and clinical manifestations of paratuberculosis (including pathology). Vet Clin North Am Food Anim Pract 1996, 12: 345-356.

45. Sweeney RW: Pathogenesis of paratuberculosis. Vet Clin North Am Food Anim Pract 2011, 27: 537-46, v.

46. Ayele W, Fekadu M, Zewdie B, Beyene M, Bogale Y, Mocha K et al.: Immunogenicity and efficacy of Fermi-type nerve tissue rabies vaccine in mice and in humans undergoing post-exposure prophylaxis for rabies in Ethiopia. Ethiop Med J 2001, 39: 313-321.

47. Ayele WY, Bartos M, Svastova P, Pavlik I: Distribution of Mycobacterium avium subsp. paratuberculosis in organs of naturally infected bull-calves and breeding bulls. Vet Microbiol 2004, 103: 209-217.


131

48. Whittington RJ, Windsor PA: In utero infection of cattle with Mycobacterium avium subsp. paratuberculosis: a critical review and meta-analysis. Vet J 2009, 179: 60-69.

49. Valentin-Weigand P, Moriarty KM: Mycobacterium paratuberculosis binds fibronectin. Res Microbiol 1992, 143: 75-79.

50. Secott TE, Lin TL, Wu CC: Mycobacterium avium subsp. paratuberculosis fibronectin attachment protein facilitates M-cell targeting and invasion through a fibronectin bridge with host integrins. Infect Immun 2004, 72: 3724-3732.

51. Momotani E, Whipple DL, Thiermann AB, Cheville NF: Role of M cells and macrophages in the entrance of Mycobacterium paratuberculosis into domes of ileal Peyer's patches in calves. Vet Pathol 1988, 25: 131-137.

52. Pott J, Basler T, Duerr CU, Rohde M, Goethe R, Hornef MW: Internalization-dependent recognition of Mycobacterium avium ssp. paratuberculosis by intestinal epithelial cells. Cell Microbiol 2009, 11: 1802-1815.

53. Bermudez LE, Petrofsky M, Sommer S, Barletta RG: Peyer's patch-deficient mice demonstrate that Mycobacterium avium subsp. paratuberculosis translocates across the mucosal barrier via both M cells and enterocytes but has inefficient dissemination. Infect Immun 2010, 78: 3570-3577.

54. Ponnusamy D, Periasamy S, Tripathi BN, Pal A: Mycobacterium avium subsp. paratuberculosis invades through M cells and enterocytes across ileal and jejunal mucosa of lambs. Res Vet Sci 2013, 94: 306-312.

55. Golan L, Livneh-Kol A, Gonen E, Yagel S, Rosenshine I, Shpigel NY: Mycobacterium avium paratuberculosis invades human small-intestinal goblet cells and elicits inflammation. J Infect Dis 2009, 199: 350-354.

56. Kuehnel MP, Goethe R, Habermann A, Mueller E, Rohde M, Griffiths G et al.: Characterization of the intracellular survival of Mycobacterium avium ssp. paratuberculosis: phagosomal pH and fusogenicity in J774 macrophages compared with other mycobacteria. Cell Microbiol 2001, 3: 551-566.

57. Druszczynska M, Wlodarczyk M, Fol M, Rudnicka W: [Recognition of mycobacterial antigens by phagocytes]. Postepy Hig Med Dosw (Online ) 2011, 65: 28-39.

58. Brown J, Wang H, Hajishengallis GN, Martin M: TLR-signaling networks: an integration of adaptor molecules, kinases, and cross-talk. J Dent Res 2011, 90: 417-427.

59. Mogensen TH: Pathogen recognition and inflammatory signaling in innate immune defenses. Clin Microbiol Rev 2009, 22: 240-73, Table.

60. Stenmark H, Olkkonen VM: The Rab GTPase family. Genome Biol 2001, 2: REVIEWS3007.

61. Garin J, Diez R, Kieffer S, Dermine JF, Duclos S, Gagnon E et al.: The phagosome proteome: insight into phagosome functions. J Cell Biol 2001, 152: 165-180.

62. Vieira OV, Botelho RJ, Grinstein S: Phagosome maturation: aging gracefully. Biochem J 2002, 366: 689-704.

63. Lu N, Zhou Z: Membrane trafficking and phagosome maturation during the clearance of apoptotic cells. Int Rev Cell Mol Biol 2012, 293: 269-309.

64. Murtaugh MP, Foss DL: Inflammatory cytokines and antigen presenting cell activation. Vet Immunol Immunopathol 2002, 87: 109-121.


132

65. Forman HJ, Torres M: Reactive oxygen species and cell signaling: respiratory burst in macrophage signaling. Am J Respir Crit Care Med 2002, 166: S4-S8.

66. Yoshikawa T, Naito Y: The role of neutrophils and inflammation in gastric mucosal injury. Free Radic Res 2000, 33: 785-794.

67. Gough DR, Cotter TG: Hydrogen peroxide: a Jekyll and Hyde signalling molecule. Cell Death Dis 2011, 2: e213.

68. Devasagayam TP, Tilak JC, Boloor KK, Sane KS, Ghaskadbi SS, Lele RD: Free radicals and antioxidants in human health: current status and future prospects. J Assoc Physicians India 2004, 52: 794-804.

69. Chan J, Xing Y, Magliozzo RS, Bloom BR: Killing of virulent Mycobacterium tuberculosis by reactive nitrogen intermediates produced by activated murine macrophages. J Exp Med 1992, 175: 1111-1122.

70. Nathan C, Shiloh MU: Reactive oxygen and nitrogen intermediates in the relationship between mammalian hosts and microbial pathogens. Proc Natl Acad Sci U S A 2000, 97: 8841-8848.

71. Nauseef WM: Assembly of the phagocyte NADPH oxidase. Histochem Cell Biol 2004, 122: 277-291.

72. Green SJ, Scheller LF, Marletta MA, Seguin MC, Klotz FW, Slayter M et al.: Nitric oxide: cytokine-regulation of nitric oxide in host resistance to intracellular pathogens. Immunol Lett 1994, 43: 87-94.

73. Ding AH, Nathan CF, Stuehr DJ: Release of reactive nitrogen intermediates and reactive oxygen intermediates from mouse peritoneal macrophages. Comparison of activating cytokines and evidence for independent production. J Immunol 1988, 141: 2407-2412.

74. Valko M, Morris H, Cronin MT: Metals, toxicity and oxidative stress. Curr Med Chem 2005, 12: 1161-1208.

75. Schnappinger D, Ehrt S, Voskuil MI, Liu Y, Mangan JA, Monahan IM et al.: Transcriptional Adaptation of Mycobacterium tuberculosis within Macrophages: Insights into the Phagosomal Environment. J Exp Med 2003, 198: 693-704.

76. de Chastellier C, Thilo L: Cholesterol depletion in Mycobacterium avium-infected macrophages overcomes the block in phagosome maturation and leads to the reversible sequestration of viable mycobacteria in phagolysosome-derived autophagic vacuoles. Cell Microbiol 2006, 8: 242-256.

77. de Chastellier C: The many niches and strategies used by pathogenic mycobacteria for survival within host macrophages. Immunobiology 2009, 214: 526-542.

78. Pieters J: Mycobacterium tuberculosis and the macrophage: maintaining a balance. Cell Host Microbe 2008, 3: 399-407.

79. Nguyen L, Chinnapapagari S, Thompson CJ: FbpA-Dependent biosynthesis of trehalose dimycolate is required for the intrinsic multidrug resistance, cell wall structure, and colonial morphology of Mycobacterium smegmatis. J Bacteriol 2005, 187: 6603-6611.

80. Ehrt S, Schnappinger D: Mycobacterial survival strategies in the phagosome: defence against host stresses. Cell Microbiol 2009, 11: 1170-1178.

81. Singh SV, Singh AV, Kumar A, Singh PK, Deb R, Verma AK et al.: Survival mechanisms of Mycobacterium avium subspecies paratuberculosis within host species and in the environment-A review. Natural Science 2013, 5: 710-723.


133

82. Arsenault RJ, Maattanen P, Daigle J, Potter A, Griebel P, Napper S: From mouth to macrophage: mechanisms of innate immune subversion by Mycobacterium avium subsp. paratuberculosis. Vet Res 2014, 45: 54.

83. Roecklein JA, Swartz RP, Yeager H, Jr.: Nonopsonic uptake of Mycobacterium avium complex by human monocytes and alveolar macrophages. J Lab Clin Med 1992, 119: 772-781.

84. Guirado E, Schlesinger LS, Kaplan G: Macrophages in tuberculosis: friend or foe. Semin Immunopathol 2013, 35: 563-583.

85. Premanandan C, Storozuk CA, Clay CD, Lairmore MD, Schlesinger LS, Phipps AJ: Complement protein C3 binding to Bacillus anthracis spores enhances phagocytosis by human macrophages. Microb Pathog 2009, 46: 306-314.

86. Zhou MJ, Brown EJ: CR3 (Mac-1, alpha M beta 2, CD11b/CD18) and Fc gamma RIII cooperate in generation of a neutrophil respiratory burst: requirement for Fc gamma RIII and tyrosine phosphorylation. J Cell Biol 1994, 125: 1407-1416.

87. Wright SD, Silverstein SC: Receptors for C3b and C3bi promote phagocytosis but not the release of toxic oxygen from human phagocytes. J Exp Med 1983, 158: 2016-2023.

88. Schlesinger LS, Bellinger-Kawahara CG, Payne NR, Horwitz MA: Phagocytosis of Mycobacterium tuberculosis is mediated by human monocyte complement receptors and complement component C3. J Immunol 1990, 144: 2771-2780.

89. Schlesinger LS, Horwitz MA: Phagocytosis of leprosy bacilli is mediated by complement receptors CR1 and CR3 on human monocytes and complement component C3 in serum. J Clin Invest 1990, 85: 1304-1314.

90. Arsenault RJ, Li Y, Bell K, Doig K, Potter A, Griebel PJ et al.: Mycobacterium avium subsp. paratuberculosis inhibits gamma interferon-induced signaling in bovine monocytes: insights into the cellular mechanisms of Johne's disease. Infect Immun 2012, 80: 3039-3048.

91. Hussain S, Zwilling BS, Lafuse WP: Mycobacterium avium infection of mouse macrophages inhibits IFN-gamma Janus kinase-STAT signaling and gene induction by down-regulation of the IFN-gamma receptor. J Immunol 1999, 163: 2041-2048.

92. Colangeli R, Haq A, Arcus VL, Summers E, Magliozzo RS, McBride A et al.: The multifunctional histone-like protein Lsr2 protects mycobacteria against reactive oxygen intermediates. Proc Natl Acad Sci U S A 2009, 106: 4414-4418.

93. Sherman DR, Sabo PJ, Hickey MJ, Arain TM, Mahairas GG, Yuan Y et al.: Disparate responses to oxidative stress in saprophytic and pathogenic mycobacteria. Proc Natl Acad Sci U S A 1995, 92: 6625-6629.

94. Wu CH, Tsai-Wu JJ, Huang YT, Lin CY, Lioua GG, Lee FJ: Identification and subcellular localization of a novel Cu,Zn superoxide dismutase of Mycobacterium tuberculosis. FEBS Lett 1998, 439: 192-196.

95. Tullius MV, Harth G, Horwitz MA: High extracellular levels of Mycobacterium tuberculosis glutamine synthetase and superoxide dismutase in actively growing cultures are due to high expression and extracellular stability rather than to a protein-specific export mechanism. Infect Immun 2001, 69: 6348-6363.

96. Master SS, Springer B, Sander P, Boettger EC, Deretic V, Timmins GS: Oxidative stress response genes in Mycobacterium tuberculosis: role of ahpC in resistance to peroxynitrite and stage-specific survival in macrophages. Microbiology 2002, 148: 3139-3144.


134

97. Liao D, Fan Q, Bao L: The role of superoxide dismutase in the survival of Mycobacterium tuberculosis in macrophages. Jpn J Infect Dis 2013, 66: 480-488.

98. Zahrt TC, Song J, Siple J, Deretic V: Mycobacterial FurA is a negative regulator of catalase-peroxidase gene katG. Mol Microbiol 2001, 39: 1174-1185.

99. Hahn JS, Oh SY, Roe JH: Role of OxyR as a peroxide-sensing positive regulator in Streptomyces coelicolor A3(2). J Bacteriol 2002, 184: 5214-5222.

100. van Vliet AH, Baillon ML, Penn CW, Ketley JM: Campylobacter jejuni contains two fur homologs: characterization of iron-responsive regulation of peroxide stress defense genes by the PerR repressor. J Bacteriol 1999, 181: 6371-6376.

101. Buchmeier NA, Newton GL, Koledin T, Fahey RC: Association of mycothiol with protection of Mycobacterium tuberculosis from toxic oxidants and antibiotics. Mol Microbiol 2003, 47: 1723-1732.

102. Armstrong JA, Hart PD: Response of cultured macrophages to Mycobacterium tuberculosis, with observations on fusion of lysosomes with phagosomes. J Exp Med 1971, 134: 713-740.

103. Frehel C, de Chastellier C, Lang T, Rastogi N: Evidence for inhibition of fusion of lysosomal and prelysosomal compartments with phagosomes in macrophages infected with pathogenic Mycobacterium avium. Infect Immun 1986, 52: 252-262.

104. Crowle AJ, Dahl R, Ross E, May MH: Evidence that vesicles containing living, virulent Mycobacterium tuberculosis or Mycobacterium avium in cultured human macrophages are not acidic. Infect Immun 1991, 59: 1823-1831.

105. Xu S, Cooper A, Sturgill-Koszycki S, van Heyningen T, Chatterjee D, Orme I et al.: Intracellular trafficking in Mycobacterium tuberculosis and Mycobacterium avium-infected macrophages. J Immunol 1994, 153: 2568-2578.

106. Clemens DL, Horwitz MA: Characterization of the Mycobacterium tuberculosis phagosome and evidence that phagosomal maturation is inhibited. J Exp Med 1995, 181: 257-270.

107. Deretic V, Via LE, Fratti RA, Deretic D: Mycobacterial phagosome maturation, rab proteins, and intracellular trafficking. Electrophoresis 1997, 18: 2542-2547.

108. Hostetter J, Steadham E, Haynes J, Bailey T, Cheville N: Phagosomal maturation and intracellular survival of Mycobacterium avium subspecies paratuberculosis in J774 cells. Comp Immunol Microbiol Infect Dis 2003, 26: 269-283.

109. Walburger A, Koul A, Ferrari G, Nguyen L, Prescianotto-Baschong C, Huygen K et al.: Protein kinase G from pathogenic mycobacteria promotes survival within macrophages. Science 2004, 304: 1800-1804.

110. Scherr N, Muller P, Perisa D, Combaluzier B, Jeno P, Pieters J: Survival of pathogenic mycobacteria in macrophages is mediated through autophosphorylation of protein kinase G. J Bacteriol 2009, 191: 4546-4554.

111. Roth U, Curth K, Unterman TG, Kietzmann T: The transcription factors HIF-1 and HNF-4 and the coactivator p300 are involved in insulin-regulated glucokinase gene expression via the phosphatidylinositol 3-kinase/protein kinase B pathway. J Biol Chem 2004, 279: 2623-2631.

112. Vergne I, Chua J, Deretic V: Tuberculosis toxin blocking phagosome maturation inhibits a novel Ca2+/calmodulin-PI3K hVPS34 cascade. J Exp Med 2003, 198: 653-659.


135

113. Fratti RA, Backer JM, Gruenberg J, Corvera S, Deretic V: Role of phosphatidylinositol 3-kinase and Rab5 effectors in phagosomal biogenesis and mycobacterial phagosome maturation arrest. J Cell Biol 2001, 154: 631-644.

114. Master SS, Rampini SK, Davis AS, Keller C, Ehlers S, Springer B et al.: Mycobacterium tuberculosis prevents inflammasome activation. Cell Host Microbe 2008, 3: 224-232.

115. Kelley VA, Schorey JS: Mycobacterium's arrest of phagosome maturation in macrophages requires Rab5 activity and accessibility to iron. Mol Biol Cell 2003, 14: 3366-3377.

116. Weinberg ED: Nutritional immunity. Host's attempt to withold iron from microbial invaders. JAMA 1975, 231: 39-41.

117. Kehl-Fie TE, Skaar EP: Nutritional immunity beyond iron: a role for manganese and zinc. Curr Opin Chem Biol 2010, 14: 218-224.

118. Hood MI, Skaar EP: Nutritional immunity: transition metals at the pathogen-host interface. Nat Rev Microbiol 2013, 10: 525-537.

119. Neyrolles O, Mintz E, Catty P: Zinc and copper toxicity in host defense against pathogens: Mycobacterium tuberculosis as a model example of an emerging paradigm. Front Cell Infect Microbiol 2013, 3: 89.

120. Botella H, Stadthagen G, Lugo-Villarino G, de Chastellier C, Neyrolles O: Metallobiology of host-pathogen interactions: an intoxicating new insight. Trends Microbiol 2012, 20: 106-112.

121. Stafford SL, Bokil NJ, Achard ME, Kapetanovic R, Schembri MA, McEwan AG et al.: Metal ions in macrophage antimicrobial pathways: emerging roles for zinc and copper. Biosci Rep 2013, 33.

122. Bullen JJ, Rogers HJ, Griffiths E: Role of iron in bacterial infection. Curr Top Microbiol Immunol 1978, 80: 1-35.

123. Lee P, Peng H, Gelbart T, Wang L, Beutler E: Regulation of hepcidin transcription by interleukin-1 and interleukin-6. Proc Natl Acad Sci U S A 2005, 102: 1906-1910.

124. Wrighting DM, Andrews NC: Interleukin-6 induces hepcidin expression through STAT3. Blood 2006, 108: 3204-3209.

125. de Domenico I, Ward DM, Langelier C, Vaughn MB, Nemeth E, Sundquist WI et al.: The molecular mechanism of hepcidin-mediated ferroportin down-regulation. Mol Biol Cell 2007, 18: 2569-2578.

126. Goetz DH, Holmes MA, Borregaard N, Bluhm ME, Raymond KN, Strong RK: The neutrophil lipocalin NGAL is a bacteriostatic agent that interferes with siderophore-mediated iron acquisition. Mol Cell 2002, 10: 1033-1043.

127. Holmes MA, Paulsene W, Jide X, Ratledge C, Strong RK: Siderocalin (Lcn 2) also binds carboxymycobactins, potentially defending against mycobacterial infections through iron sequestration. Structure 2005, 13: 29-41.

128. Andrews SC: Iron storage in bacteria. Adv Microb Physiol 1998, 40: 281-351.

129. Van Zandt KE, Sow FB, Florence WC, Zwilling BS, Satoskar AR, Schlesinger LS et al.: The iron export protein ferroportin 1 is differentially expressed in mouse macrophage populations and is present in the mycobacterial-containing phagosome. J Leukoc Biol 2008, 84: 689-700.


136

130. Corbin BD, Seeley EH, Raab A, Feldmann J, Miller MR, Torres VJ et al.: Metal chelation and inhibition of bacterial growth in tissue abscesses. Science 2008, 319: 962-965.

131. Kehl-Fie TE, Chitayat S, Hood MI, Damo S, Restrepo N, Garcia C et al.: Nutrient metal sequestration by calprotectin inhibits bacterial superoxide defense, enhancing neutrophil killing of Staphylococcus aureus. Cell Host Microbe 2011, 10: 158-164.

132. Begum NA, Kobayashi M, Moriwaki Y, Matsumoto M, Toyoshima K, Seya T: Mycobacterium bovis BCG cell wall and lipopolysaccharide induce a novel gene, BIGM103, encoding a 7-TM protein: identification of a new protein family having Zn-transporter and Zn-metalloprotease signatures. Genomics 2002, 80: 630-645.

133. Aydemir TB, Liuzzi JP, McClellan S, Cousins RJ: Zinc transporter ZIP8 (SLC39A8) and zinc influence IFN-gamma expression in activated human T cells. J Leukoc Biol 2009, 86: 337-348.

134. Subramanian Vignesh K, Landero Figueroa JA, Porollo A, Caruso JA, Deppe GS: Granulocyte macrophage-colony stimulating factor induced Zn sequestration enhances macrophage superoxide and limits intracellular pathogen survival. Immunity 2013, 39: 697-710.

135. White C, Lee J, Kambe T, Fritsche K, Petris MJ: A role for the ATP7A copper-transporting ATPase in macrophage bactericidal activity. J Biol Chem 2009, 284: 33949-33956.

136. Soldati T, Neyrolles O: Mycobacteria and the intraphagosomal environment: take it with a pinch of salt(s)! Traffic 2012, 13: 1042-1052.

137. Trost M, English L, Lemieux S, Courcelles M, Desjardins M, Thibault P: The phagosomal proteome in interferon-gamma-activated macrophages. Immunity 2009, 30: 143-154.

138. Galaris D, Pantopoulos K: Oxidative stress and iron homeostasis: mechanistic and health aspects. Crit Rev Clin Lab Sci 2008, 45: 1-23.

139. Gazaryan IG, Krasnikov BF, Ashby GA, Thorneley RN, Kristal BS, Brown AM: Zinc is a potent inhibitor of thiol oxidoreductase activity and stimulates reactive oxygen species production by lipoamide dehydrogenase. J Biol Chem 2002, 277: 10064-10072.

140. Irving H, Williams RJP: Order of stability of metal complexes. Nature 1948, 162: 746-747.

141. Botella H, Peyron P, Levillain F, Poincloux R, Poquet Y, Brandli I et al.: Mycobacterial p(1)-type ATPases mediate resistance to zinc poisoning in human macrophages. Cell Host Microbe 2011, 10: 248-259.

142. Weigoldt M, Meens J, Doll K, Fritsch I, Mobius P, Goethe R et al.: Differential proteome analysis of Mycobacterium avium subsp. paratuberculosis grown in vitro and isolated from cases of clinical Johne's disease. Microbiology 2011, 157: 557-565.

143. Weigoldt M, Meens J, Bange FC, Pich A, Gerlach GF, Goethe R: Metabolic adaptation of Mycobacterium avium subsp. paratuberculosis to the gut environment. Microbiology 2013, 159: 380-391.

144. Wagner D, Maser J, Lai B, Cai Z, Barry CE, III, Honer zu BK et al.: Elemental analysis of Mycobacterium avium-, Mycobacterium tuberculosis-, and Mycobacterium smegmatis-containing phagosomes indicates pathogen-induced microenvironments within the host cell's endosomal system. J Immunol 2005, 174: 1491-1500.

145. Wagner D, Maser J, Moric I, Boechat N, Vogt S, Gicquel B et al.: Changes of the phagosomal elemental concentrations by Mycobacterium tuberculosis Mramp. Microbiology 2005, 151: 323-332.


137

146. Zhong W, Lafuse WP, Zwilling BS: Infection with Mycobacterium avium differentially regulates the expression of iron transport protein mRNA in murine peritoneal macrophages. Infect Immun 2001, 69: 6618-6624.

147. Olakanmi O, Schlesinger LS, Ahmed A, Britigan BE: The nature of extracellular iron influences iron acquisition by Mycobacterium tuberculosis residing within human macrophages. Infect Immun 2004, 72: 2022-2028.

148. Olakanmi O, Schlesinger LS, Ahmed A, Britigan BE: Intraphagosomal Mycobacterium tuberculosis acquires iron from both extracellular transferrin and intracellular iron pools. Impact of interferon-gamma and hemochromatosis. J Biol Chem 2002, 277: 49727-49734.

149. Jones CM, Niederweis M: Mycobacterium tuberculosis can utilize heme as an iron source. J Bacteriol 2011, 193: 1767-1770.

150. Tullius MV, Harmston CA, Owens CP, Chim N, Morse RP, McMath LM et al.: Discovery and characterization of a unique mycobacterial heme acquisition system. Proc Natl Acad Sci U S A 2011, 108: 5051-5056.

151. Clemens DL, Horwitz MA: The Mycobacterium tuberculosis phagosome interacts with early endosomes and is accessible to exogenously administered transferrin. J Exp Med 1996, 184: 1349-1355.

152. Halaas O, Steigedal M, Haug M, Awuh JA, Ryan L, Brech A et al.: Intracellular Mycobacterium avium intersect transferrin in the Rab11(+) recycling endocytic pathway and avoid lipocalin 2 trafficking to the lysosomal pathway. J Infect Dis 2010, 201: 783-792.

153. Paulsen IT, Saier MH, Jr.: A novel family of ubiquitous heavy metal ion transport proteins. J Membr Biol 1997, 156: 99-103.

154. Nies DH: Efflux-mediated heavy metal resistance in prokaryotes. FEMS Microbiol Rev 2003, 27: 313-339.

155. Patzer SI, Hantke K: The ZnuABC high-affinity zinc uptake system and its regulator Zur in Escherichia coli. Mol Microbiol 1998, 28: 1199-1210.

156. De Voss JJ, Rutter K, Schroeder BG, Su H, Zhu Y, Barry CE, III: The salicylate-derived mycobactin siderophores of Mycobacterium tuberculosis are essential for growth in macrophages. Proc Natl Acad Sci U S A 2000, 97: 1252-1257.

157. Schaible UE, Kaufmann SH: Iron and microbial infection. Nat Rev Microbiol 2004, 2: 946-953.

158. Hentze MW, Muckenthaler MU, Galy B, Camaschella C: Two to tango: regulation of Mammalian iron metabolism. Cell 2010, 142: 24-38.

159. Lounis N, Truffot-Pernot C, Grosset J, Gordeuk VR, Boelaert JR: Iron and Mycobacterium tuberculosis infection. J Clin Virol 2001, 20: 123-126.

160. Collins HL: The role of iron in infections with intracellular bacteria. Immunol Lett 2003, 85: 193-195.

161. Cornelis P, Wei Q, Andrews SC, Vinckx T: Iron homeostasis and management of oxidative stress response in bacteria. Metallomics 2011, 3: 540-549.

162. Correnti C, Strong RK: Mammalian siderophores, siderophore-binding lipocalins, and the labile iron pool. J Biol Chem 2012, 287: 13524-13531.


138

163. Andreini C, Banci L, Bertini I, Rosato A: Zinc through the three domains of life. J Proteome Res 2006, 5: 3173-3178.

164. Andreini C, Bertini I, Rosato A: Metalloproteomes: a bioinformatic approach. Acc Chem Res 2009, 42: 1471-1479.

165. Eide DJ: Zinc transporters and the cellular trafficking of zinc. Biochim Biophys Acta 2006, 1763: 711-722.

166. Haase H, Beyersmann D: Uptake and intracellular distribution of labile and total Zn(II) in C6 rat glioma cells investigated with fluorescent probes and atomic absorption. Biometals 1999, 12: 247-254.

167. Haase H, Beyersmann D: Intracellular zinc distribution and transport in C6 rat glioma cells. Biochem Biophys Res Commun 2002, 296: 923-928.

168. Rodriguez GM: Control of iron metabolism in Mycobacterium tuberculosis. Trends Microbiol 2006, 14: 320-327.

169. Forbes JR, Gros P: Iron, manganese, and cobalt transport by Nramp1 (Slc11a1) and Nramp2 (Slc11a2) expressed at the plasma membrane. Blood 2003, 102: 1884-1892.

170. Katayama A, Tsujii A, Wada A, Nishino T, Ishihama A: Systematic search for zinc-binding proteins in Escherichia coli. Eur J Biochem 2002, 269: 2403-2413.

171. Meini MR, Gonzalez LJ, Vila AJ: Antibiotic resistance in Zn(II)-deficient environments: metallo-beta-lactamase activation in the periplasm. Future Microbiol 2013, 8: 947-979.

172. Kropachev KY, Zharkov DO, Grollman AP: Catalytic mechanism of Escherichia coli endonuclease VIII: roles of the intercalation loop and the zinc finger. Biochemistry 2006, 45: 12039-12049.

173. Hantke K: Bacterial zinc uptake and regulators. Curr Opin Microbiol 2005, 8: 196-202.

174. Imlay KR, Imlay JA: Cloning and analysis of sodC, encoding the copper-zinc superoxide dismutase of Escherichia coli. J Bacteriol 1996, 178: 2564-2571.

175. Outten CE, O'Halloran TV: Femtomolar sensitivity of metalloregulatory proteins controlling zinc homeostasis. Science 2001, 292: 2488-2492.

176. Schalk IJ, Hannauer M, Braud A: New roles for bacterial siderophores in metal transport and tolerance. Environ Microbiol 2011, 13: 2844-2854.

177. Saha R, Saha N, Donofrio RS, Bestervelt LL: Microbial siderophores: a mini review. J Basic Microbiol 2013, 53: 303-317.

178. Wang W, Qiu Z, Tan H, Cao L: Siderophore production by actinobacteria. Biometals 2014, 27: 623-631.

179. Garenaux A, Caza M, Dozois CM: The Ins and Outs of siderophore mediated iron uptake by extra-intestinal pathogenic Escherichia coli. Vet Microbiol 2011, 153: 89-98.

180. Challis GL, Hopwood DA: Synergy and contingency as driving forces for the evolution of multiple secondary metabolite production by Streptomyces species. Proc Natl Acad Sci U S A 2003, 100 Suppl 2: 14555-14561.

181. Gobin J, Moore CH, Reeve JR, Jr., Wong DK, Gibson BW, Horwitz MA: Iron acquisition by Mycobacterium tuberculosis: isolation and characterization of a family of iron-binding exochelins. Proc Natl Acad Sci U S A 1995, 92: 5189-5193.


139

182. De Voss JJ, Rutter K, Schroeder BG, Barry CE, III: Iron acquisition and metabolism by mycobacteria. J Bacteriol 1999, 181: 4443-4451.

183. Ratledge C: Iron, mycobacteria and tuberculosis. Tuberculosis (Edinb ) 2004, 84: 110-130.

184. Siegrist MS, Unnikrishnan M, McConnell MJ, Borowsky M, Cheng TY, Siddiqi N et al.: Mycobacterial Esx-3 is required for mycobactin-mediated iron acquisition. Proc Natl Acad Sci U S A 2009, 106: 18792-18797.

185. Rodriguez GM, Smith I: Identification of an ABC transporter required for iron acquisition and virulence in Mycobacterium tuberculosis. J Bacteriol 2006, 188: 424-430.

186. Madigan CA, Cheng TY, Layre E, Young DC, McConnell MJ, Debono CA et al.: Lipidomic discovery of deoxysiderophores reveals a revised mycobactin biosynthesis pathway in Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 2012, 109: 1257-1262.

187. Reddy PV, Puri RV, Chauhan P, Kar R, Rohilla A, Khera A et al.: Disruption of Mycobactin Biosynthesis Leads to Attenuation of Mycobacterium tuberculosis for Growth and Virulence. J Infect Dis 2013.

188. Wells RM, Jones CM, Xi Z, Speer A, Danilchanka O, Doornbos KS et al.: Discovery of a siderophore export system essential for virulence of Mycobacterium tuberculosis. PLoS Pathog 2013, 9: e1003120.

189. Gobin J, Horwitz MA: Exochelins of Mycobacterium tuberculosis remove iron from human iron-binding proteins and donate iron to mycobactins in the M. tuberculosis cell wall. J Exp Med 1996, 183: 1527-1532.

190. Agranoff D, Krishna S: Metal ion transport and regulation in Mycobacterium tuberculosis. Front Biosci 2004, 9: 2996-3006.

191. Agranoff D, Monahan IM, Mangan JA, Butcher PD, Krishna S: Mycobacterium tuberculosis expresses a novel pH-dependent divalent cation transporter belonging to the Nramp family. J Exp Med 1999, 190: 717-724.

192. Farhana A, Kumar S, Rathore SS, Ghosh PC, Ehtesham NZ, Tyagi AK et al.: Mechanistic insights into a novel exporter-importer system of Mycobacterium tuberculosis unravel its role in trafficking of iron. PLoS ONE 2008, 3: e2087.

193. Lee SM, Grass G, Haney CJ, Fan B, Rosen BP, Anton A et al.: Functional analysis of the Escherichia coli zinc transporter ZitB. FEMS Microbiol Lett 2002, 215: 273-278.

194. Claverys JP: A new family of high-affinity ABC manganese and zinc permeases. Res Microbiol 2001, 152: 231-243.

195. Gabbianelli R, Scotti R, Ammendola S, Petrarca P, Nicolini L, Battistoni A: Role of ZnuABC and ZinT in Escherichia coli O157:H7 zinc acquisition and interaction with epithelial cells. BMC Microbiol 2011, 11: 36.

196. Ammendola S, Pasquali P, Pistoia C, Petrucci P, Petrarca P, Rotilio G et al.: High-affinity Zn2+ uptake system ZnuABC is required for bacterial zinc homeostasis in intracellular environments and contributes to the virulence of Salmonella enterica. Infect Immun 2007, 75: 5867-5876.

197. Hood MI, Mortensen BL, Moore JL, Zhang Y, Kehl-Fie TE, Sugitani N et al.: Identification of an Acinetobacter baumannii zinc acquisition system that facilitates resistance to calprotectin-mediated zinc sequestration. PLoS Pathog 2012, 8: e1003068.


140

198. Davis LM, Kakuda T, DiRita VJ: A Campylobacter jejuni znuA orthologue is essential for growth in low-zinc environments and chick colonization. J Bacteriol 2009, 191: 1631-1640.

199. Cerasi M, Ammendola S, Battistoni A: Competition for zinc binding in the host-pathogen interaction. Front Cell Infect Microbiol 2013, 3: 108.

200. Lee YH, Dorwart MR, Hazlett KR, Deka RK, Norgard MV, Radolf JD et al.: The crystal structure of Zn(II)-free Treponema pallidum TroA, a periplasmic metal-binding protein, reveals a closed conformation. J Bacteriol 2002, 184: 2300-2304.

201. Maciag A, Dainese E, Rodriguez GM, Milano A, Provvedi R, Pasca MR et al.: Global analysis of the Mycobacterium tuberculosis Zur (FurB) regulon. J Bacteriol 2007, 189: 730-740.

202. Serafini A, Pisu D, Palu G, Rodriguez GM, Manganelli R: The ESX-3 secretion system is necessary for iron and zinc homeostasis in Mycobacterium tuberculosis. PLoS ONE 2013, 8: e78351.

203. Kallifidas D, Pascoe B, Owen GA, Strain-Damerell CM, Hong HJ, Paget MS: The zinc-responsive regulator Zur controls expression of the coelibactin gene cluster in Streptomyces coelicolor. J Bacteriol 2010, 192: 608-611.

204. Blindauer CA, Harrison MD, Robinson AK, Parkinson JA, Bowness PW, Sadler PJ et al.: Multiple bacteria encode metallothioneins and SmtA-like zinc fingers. Mol Microbiol 2002, 45: 1421-1432.

205. Beard SJ, Hashim R, Membrillo-Hernandez J, Hughes MN, Poole RK: Zinc(II) tolerance in Escherichia coli K-12: evidence that the zntA gene (o732) encodes a cation transport ATPase. Mol Microbiol 1997, 25: 883-891.

206. Palmiter RD: Protection against zinc toxicity by metallothionein and zinc transporter 1. Proc Natl Acad Sci U S A 2004, 101: 4918-4923.

207. Grover A, Sharma R: Identification and characterization of a major Zn(II) resistance determinant of Mycobacterium smegmatis. J Bacteriol 2006, 188: 7026-7032.

208. Canneva F, Branzoni M, Riccardi G, Provvedi R, Milano A: Rv2358 and FurB: two transcriptional regulators from Mycobacterium tuberculosis which respond to zinc. J Bacteriol 2005, 187: 5837-5840.

209. Waldron KJ, Rutherford JC, Ford D, Robinson NJ: Metalloproteins and metal sensing. Nature 2009, 460: 823-830.

210. Reyes-Caballero H, Campanello GC, Giedroc DP: Metalloregulatory proteins: metal selectivity and allosteric switching. Biophys Chem 2011, 156: 103-114.

211. Hantke K: Iron and metal regulation in bacteria. Curr Opin Microbiol 2001, 4: 172-177.

212. Brocklehurst KR, Hobman JL, Lawley B, Blank L, Marshall SJ, Brown NL et al.: ZntR is a Zn(II)-responsive MerR-like transcriptional regulator of zntA in Escherichia coli. Mol Microbiol 1999, 31: 893-902.

213. Kidd SP, Brown NL: ZccR--a MerR-like regulator from Bordetella pertussis which responds to zinc, cadmium, and cobalt. Biochem Biophys Res Commun 2003, 302: 697-702.

214. Busenlehner LS, Pennella MA, Giedroc DP: The SmtB/ArsR family of metalloregulatory transcriptional repressors: Structural insights into prokaryotic metal resistance. FEMS Microbiol Rev 2003, 27: 131-143.


141

215. Schmitt MP, Predich M, Doukhan L, Smith I, Holmes RK: Characterization of an iron-dependent regulatory protein (IdeR) of Mycobacterium tuberculosis as a functional homolog of the diphtheria toxin repressor (DtxR) from Corynebacterium diphtheriae. Infect Immun 1995, 63: 4284-4289.

216. Rodriguez GM, Voskuil MI, Gold B, Schoolnik GK, Smith I: ideR, An essential gene in mycobacterium tuberculosis: role of IdeR in iron-dependent gene expression, iron metabolism, and oxidative stress response. Infect Immun 2002, 70: 3371-3381.

217. Gold B, Rodriguez GM, Marras SA, Pentecost M, Smith I: The Mycobacterium tuberculosis IdeR is a dual functional regulator that controls transcription of genes involved in iron acquisition, iron storage and survival in macrophages. Mol Microbiol 2001, 42: 851-865.

218. Janagama HK, Lamont EA, George S, Bannantine JP, Xu WW, Tu ZJ et al.: Primary transcriptomes of Mycobacterium avium subsp. paratuberculosis reveal proprietary pathways in tissue and macrophages. BMC Genomics 2010, 11: 561.

219. Pandey R, Rodriguez GM: IdeR is required for iron homeostasis and virulence in Mycobacterium tuberculosis. Mol Microbiol 2014, 91: 98-109.

220. Hill PJ, Cockayne A, Landers P, Morrissey JA, Sims CM, Williams P: SirR, a novel iron-dependent repressor in Staphylococcus epidermidis. Infect Immun 1998, 66: 4123-4129.

221. Fillat MF: The FUR (ferric uptake regulator) superfamily: Diversity and versatility of key transcriptional regulators. Arch Biochem Biophys 2014, 546C: 41-52.

222. McHugh JP, Rodriguez-Quinones F, Abdul-Tehrani H, Svistunenko DA, Poole RK, Cooper CE et al.: Global iron-dependent gene regulation in Escherichia coli. A new mechanism for iron homeostasis. J Biol Chem 2003, 278: 29478-29486.

223. Hantke K: Regulation of ferric iron transport in Escherichia coli K12: isolation of a constitutive mutant. Mol Gen Genet 1981, 182: 288-292.

224. Pohl E, Haller JC, Mijovilovich A, Meyer-Klaucke W, Garman E, Vasil ML: Architecture of a protein central to iron homeostasis: crystal structure and spectroscopic analysis of the ferric uptake regulator. Mol Microbiol 2003, 47: 903-915.

225. Lucarelli D, Russo S, Garman E, Milano A, Meyer-Klaucke W, Pohl E: Crystal structure and function of the zinc uptake regulator FurB from Mycobacterium tuberculosis. J Biol Chem 2007, 282: 9914-9922.

226. Jacquamet L, Traore DA, Ferrer JL, Proux O, Testemale D, Hazemann JL et al.: Structural characterization of the active form of PerR: insights into the metal-induced activation of PerR and Fur proteins for DNA binding. Mol Microbiol 2009, 73: 20-31.

227. Bagg A, Neilands JB: Ferric uptake regulation protein acts as a repressor, employing iron (II) as a cofactor to bind the operator of an iron transport operon in Escherichia coli. Biochemistry 1987, 26: 5471-5477.

228. Diaz-Mireles E, Wexler M, Sawers G, Bellini D, Todd JD, Johnston AW: The Fur-like protein Mur of Rhizobium leguminosarum is a Mn(2+)-responsive transcriptional regulator. Microbiology 2004, 150: 1447-1456.

229. Ahn BE, Cha J, Lee EJ, Han AR, Thompson CJ, Roe JH: Nur, a nickel-responsive regulator of the Fur family, regulates superoxide dismutases and nickel transport in Streptomyces coelicolor. Mol Microbiol 2006, 59: 1848-1858.

230. White GF, Singleton C, Todd JD, Cheesman MR, Johnston AW, Le Brun NE: Heme binding to the second, lower-affinity site of the global iron regulator Irr from Rhizobium leguminosarum promotes oligomerization. FEBS J 2011, 278: 2011-2021.


142

231. Bsat N, Herbig A, Casillas-Martinez L, Setlow P, Helmann JD: Bacillus subtilis contains multiple Fur homologues: identification of the iron uptake (Fur) and peroxide regulon (PerR) repressors. Mol Microbiol 1998, 29: 189-198.

232. Pecqueur L, D'Autreaux B, Dupuy J, Nicolet Y, Jacquamet L, Brutscher B et al.: Structural changes of Escherichia coli ferric uptake regulator during metal-dependent dimerization and activation explored by NMR and X-ray crystallography. J Biol Chem 2006, 281: 21286-21295.

233. Sheikh MA, Taylor GL: Crystal structure of the Vibrio cholerae ferric uptake regulator (Fur) reveals insights into metal co-ordination. Mol Microbiol 2009, 72: 1208-1220.

234. Ma Z, Gabriel SE, Helmann JD: Sequential binding and sensing of Zn(II) by Bacillus subtilis Zur. Nucleic Acids Res 2011, 39: 9130-9138.

235. Shin JH, Jung HJ, An YJ, Cho YB, Cha SS, Roe JH: Graded expression of zinc-responsive genes through two regulatory zinc-binding sites in Zur. Proc Natl Acad Sci U S A 2011, 108: 5045-5050.

236. de L, V, Giovannini F, Herrero M, Neilands JB: Metal ion regulation of gene expression. Fur repressor-operator interaction at the promoter region of the aerobactin system of pColV-K30. J Mol Biol 1988, 203: 875-884.

237. Fuangthong M, Helmann JD: Recognition of DNA by three ferric uptake regulator (Fur) homologs in Bacillus subtilis. J Bacteriol 2003, 185: 6348-6357.

238. Baichoo N, Helmann JD: Recognition of DNA by Fur: a reinterpretation of the Fur box consensus sequence. J Bacteriol 2002, 184: 5826-5832.

239. Escolar L, Perez-Martin J, de L, V: Binding of the fur (ferric uptake regulator) repressor of Escherichia coli to arrays of the GATAAT sequence. J Mol Biol 1998, 283: 537-547.

240. Lavrrar JL, Christoffersen CA, McIntosh MA: Fur-DNA interactions at the bidirectional fepDGC-entS promoter region in Escherichia coli. J Mol Biol 2002, 322: 983-995.

241. Litwin CM, Calderwood SB: Analysis of the complexity of gene regulation by fur in Vibrio cholerae. J Bacteriol 1994, 176: 240-248.

242. Delany I, Rappuoli R, Scarlato V: Fur functions as an activator and as a repressor of putative virulence genes in Neisseria meningitidis. Mol Microbiol 2004, 52: 1081-1090.

243. Butcher J, Sarvan S, Brunzelle JS, Couture JF, Stintzi A: Structure and regulon of Campylobacter jejuni ferric uptake regulator Fur define apo-Fur regulation. Proc Natl Acad Sci U S A 2012, 109: 10047-10052.

244. Carpenter BM, Gilbreath JJ, Pich OQ, McKelvey AM, Maynard EL, Li ZZ et al.: Identification and characterization of novel Helicobacter pylori apo-fur-regulated target genes. J Bacteriol 2013, 195: 5526-5539.

245. Masse E, Gottesman S: A small RNA regulates the expression of genes involved in iron metabolism in Escherichia coli. Proc Natl Acad Sci U S A 2002, 99: 4620-4625.

246. Ellison ML, Farrow JM, Parrish W, Danell AS, Pesci EC: The transcriptional regulator Np20 is the zinc uptake regulator in Pseudomonas aeruginosa. PLoS ONE 2013, 8: e75389.

247. Lee JW, Helmann JD: Functional specialization within the Fur family of metalloregulators. Biometals 2007, 20: 485-499.


143

248. Mortensen BL, Rathi S, Chazin WJ, Skaar EP: Acinetobacter baumannii Response to Host-Mediated Zinc Limitation Requires the Transcriptional Regulator Zur. J Bacteriol 2014, 196: 2616-2626.

249. Gaballa A, Helmann JD: A peroxide-induced zinc uptake system plays an important role in protection against oxidative stress in Bacillus subtilis. Mol Microbiol 2002, 45: 997-1005.

250. Raleigh FA, Lech K, Brent R: Selected topics from classical bacterial genetics. In Current protocols in molecular biology. Edited by Ausubel FM. New York, USA: Publishing Associates and Wiley Interscience; 1989:1.4.1-1.4.14.

251. Boyer HW, Roulland-Dussoix D: A complementation analysis of the restriction and modification of DNA in Escherichia coli. J Mol Biol 1969, 41: 459-472.

252. Snapper SB, Melton RE, Mustafa S, Kieser T, Jacobs WR, Jr.: Isolation and characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis. Mol Microbiol 1990, 4: 1911-1919.

253. Jark U, Ringena I, Franz B, Gerlach GF, Beyerbach M, Franz B: Development of an ELISA technique for serodiagnosis of bovine paratuberculosis. Vet Microbiol 1997, 57: 189-198.

254. Meissner T: Characterization of the metabolic adaption of Mycobacterium avium ssp. paratuberculosis to the host environment by studying isogenic mutants. Tierarztliche Hochschule Hannover, Institut fur Mikrobiologie, Zentrum fur Infektionsmedizin; 2014.

255. Granger K, Moore RJ, Davies JK, Vaughan JA, Stiles PL, Stewart DJ et al.: Recovery of Mycobacterium avium subspecies paratuberculosis from the natural host for the extraction and analysis in vivo-derived RNA. J Microbiol Methods 2004, 57: 241-249.

256. Bardarov S, Bardarov S Jr, Pavelka MS, Jr., Sambandamurthy V, Larsen M, Tufariello J et al.: Specialized transduction: an efficient method for generating marked and unmarked targeted gene disruptions in Mycobacterium tuberculosis, M. bovis BCG and M. smegmatis. Microbiology 2002, 148: 3007-3017.

257. Bardarov S, Kriakov J, Carriere C, Yu S, Vaamonde C, McAdam RA et al.: Conditionally replicating mycobacteriophages: a system for transposon delivery to Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 1997, 94: 10961-10966.

258. Stover CK, de lC, V, Fuerst TR, Burlein JE, Benson LA, Bennett LT et al.: New use of BCG for recombinant vaccines. Nature 1991, 351: 456-460.

259. Timm J, Lim EM, Gicquel B: Escherichia coli-mycobacteria shuttle vectors for operon and gene fusions to lacZ: the pJEM series. J Bacteriol 1994, 176: 6749-6753.

260. Parish T, Stoker NG: Use of a flexible cassette method to generate a double unmarked Mycobacterium tuberculosis tlyA plcABC mutant by gene replacement. Microbiology 2000, 146 ( Pt 8): 1969-1975.

261. Heinzmann J, Wilkens M, Dohmann K, Gerlach GF: Mycobacterium avium subsp. paratuberculosis-specific mpt operon expressed in M. bovis BCG as vaccine candidate. Vet Microbiol 2008, 130: 330-337.

262. Sambrook J, Russell DW: Preparation and Transformation of Competent E. coli Using Calcium Chloride. CSH Protoc 2006, 2006.

263. Parish T, Stoker NG: Electroporation of mycobacteria. Methods Mol Biol 1998, 101: 129-144.


144

264. Park KT, Dahl JL, Bannantine JP, Barletta RG, Ahn J, Allen AJ et al.: Demonstration of allelic exchange in the slow growing Mycobacterium avium subsp. paratuberculosis and generation of deletion mutants at the pknG, relA and lsr2 loci. Appl Environ Microbiol 2008.

265. Ralph P, Prichard J, Cohn M: Reticulum cell sarcoma: an effector cell in antibody-dependent cell- mediated immunity. J Immunol 1975, 114: 898-905.

266. Malorni W, Iosi F, Santini MT, Testa U: Menadione-induced oxidative stress leads to a rapid down-modulation of transferrin receptor recycling. J Cell Sci 1993, 106 ( Pt 1): 309-318.

267. Suwandi A, Bargen I, Roy B, Pils MC, Krey M, Zur LS et al.: Experimental Colitis Is Exacerbated by Concomitant Infection with Mycobacterium avium ssp. paratuberculosis. Inflamm Bowel Dis 2014.

268. Rustad TR, Roberts DM, Liao RP, Sherman DR: Isolation of mycobacterial RNA. Methods Mol Biol 2009, 465: 13-21.

269. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N et al.: The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25: 2078-2079.

270. McClure R, Balasubramanian D, Sun Y, Bobrovskyy M, Sumby P, Genco CA et al.: Computational analysis of bacterial RNA-Seq data. Nucleic Acids Res 2013, 41: e140.

271. Conesa A, Gotz S, Garcia-Gomez JM, Terol J, Talon M, Robles M: Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics 2005, 21: 3674-3676.

272. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W et al.: Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 2011, 7: 539.

273. Bailey TL, Boden M, Buske FA, Frith M, Grant CE, Clementi L et al.: MEME SUITE: tools for motif discovery and searching. Nucleic Acids Res 2009, 37: W202-W208.

274. Harris NB, Barletta RG: Mycobacterium avium subsp. paratuberculosis in Veterinary Medicine. Clin Microbiol Rev 2001, 14: 489-512.

275. Lombard JE: Epidemiology and economics of paratuberculosis. Vet Clin North Am Food Anim Pract 2011, 27: 525-35, v.

276. Naser S, Shafran I, El Zaatari F: Mycobacterium avium subsp. paratuberculosis in Crohn's disease is serologically positive. Clin Diagn Lab Immunol 1999, 6: 282.

277. Trivedi A, Singh N, Bhat SA, Gupta P, Kumar A: Redox biology of tuberculosis pathogenesis. Adv Microb Physiol 2012, 60: 263-324.

278. Zheng M, Doan B, Schneider TD, Storz G: OxyR and SoxRS regulation of fur. J Bacteriol 1999, 181: 4639-4643.

279. Herbig AF, Helmann JD: Roles of metal ions and hydrogen peroxide in modulating the interaction of the Bacillus subtilis PerR peroxide regulon repressor with operator DNA. Mol Microbiol 2001, 41: 849-859.

280. Oh SY, Shin JH, Roe JH: Dual role of OhrR as a repressor and an activator in response to organic hydroperoxides in Streptomyces coelicolor. J Bacteriol 2007, 189: 6284-6292.


145

281. Kullik I, Stevens J, Toledano MB, Storz G: Mutational analysis of the redox-sensitive transcriptional regulator OxyR: regions important for DNA binding and multimerization. J Bacteriol 1995, 177: 1285-1291.

282. Tao K, Zou C, Fujita N, Ishihama A: Mapping of the OxyR protein contact site in the C-terminal region of RNA polymerase alpha subunit. J Bacteriol 1995, 177: 6740-6744.

283. Mongkolsuk S, Helmann JD: Regulation of inducible peroxide stress responses. Mol Microbiol 2002, 45: 9-15.

284. Tseng HJ, McEwan AG, Apicella MA, Jennings MP: OxyR acts as a repressor of catalase expression in Neisseria gonorrhoeae. Infect Immun 2003, 71: 550-556.

285. Christman MF, Storz G, Ames BN: OxyR, a positive regulator of hydrogen peroxide-inducible genes in Escherichia coli and Salmonella typhimurium, is homologous to a family of bacterial regulatory proteins. Proc Natl Acad Sci U S A 1989, 86: 3484-3488.

286. Storz G, Altuvia S: OxyR regulon. Methods Enzymol 1994, 234: 217-223.

287. Bsat N, Chen L, Helmann JD: Mutation of the Bacillus subtilis alkyl hydroperoxide reductase (ahpCF) operon reveals compensatory interactions among hydrogen peroxide stress genes. J Bacteriol 1996, 178: 6579-6586.

288. Seaver LC, Imlay JA: Alkyl hydroperoxide reductase is the primary scavenger of endogenous hydrogen peroxide in Escherichia coli. J Bacteriol 2001, 183: 7173-7181.

289. Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D et al.: Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 1998, 393: 537-544.

290. Janagama HK, Senthilkumar TM, Bannantine JP, Rodriguez GM, Smith I, Paustian ML et al.: Identification and functional characterization of the iron-dependent regulator (IdeR) of Mycobacterium avium subsp. paratuberculosis. Microbiology 2009, 155: 3683-3690.

291. Dussurget O, Rodriguez M, Smith I: An ideR mutant of Mycobacterium smegmatis has derepressed siderophore production and an altered oxidative-stress response. Mol Microbiol 1996, 22: 535-544.

292. Pandey SD, Choudhury M, Yousuf S, Wheeler PR, Gordon SV, Ranjan A et al.: Iron-regulated protein HupB of Mycobacterium tuberculosis positively regulates siderophore biosynthesis and is essential for growth in macrophages. J Bacteriol 2014.

293. Carpenter BM, Whitmire JM, Merrell DS: This is not your mother's repressor: the complex role of fur in pathogenesis. Infect Immun 2009, 77: 2590-2601.

294. Lucarelli D, Vasil ML, Meyer-Klaucke W, Pohl E: The Metal-Dependent Regulators FurA and FurB from Mycobacterium Tuberculosis. Int J Mol Sci 2008, 9: 1548-1560.

295. Pym AS, Domenech P, Honore N, Song J, Deretic V, Cole ST: Regulation of catalase-peroxidase (KatG) expression, isoniazid sensitivity and virulence by furA of Mycobacterium tuberculosis. Mol Microbiol 2001, 40: 879-889.

296. Deretic V, Philipp W, Dhandayuthapani S, Mudd MH, Curcic R, Garbe T et al.: Mycobacterium tuberculosis is a natural mutant with an inactivated oxidative-stress regulatory gene: implications for sensitivity to isoniazid. Mol Microbiol 1995, 17: 889-900.

297. Dhandayuthapani S, Mudd M, Deretic V: Interactions of OxyR with the promoter region of the oxyR and ahpC genes from Mycobacterium leprae and Mycobacterium tuberculosis. J Bacteriol 1997, 179: 2401-2409.


146

298. Pagan-Ramos E, Song J, McFalone M, Mudd MH, Deretic V: Oxidative stress response and characterization of the oxyR-ahpC and furA-katG loci in Mycobacterium marinum. J Bacteriol 1998, 180: 4856-4864.

299. Sherman DR, Mdluli K, Hickey MJ, Barry CE, III, Stover CK: AhpC, oxidative stress and drug resistance in Mycobacterium tuberculosis. Biofactors 1999, 10: 211-217.

300. Coy M: The interaction of the ferric uptake regulation protein with DNA. Biochem Biophys Res Commun 1995, 212: 784-792.

301. Sala C, Forti F, Di Florio E, Canneva F, Milano A, Riccardi G et al.: Mycobacterium tuberculosis FurA autoregulates its own expression. J Bacteriol 2003, 185: 5357-5362.

302. Dubrac S, Touati D: Fur positive regulation of iron superoxide dismutase in Escherichia coli: functional analysis of the sodB promoter. J Bacteriol 2000, 182: 3802-3808.

303. Milano A, Forti F, Sala C, Riccardi G, Ghisotti D: Transcriptional regulation of furA and katG upon oxidative stress in Mycobacterium smegmatis. J Bacteriol 2001, 183: 6801-6806.

304. Master S, Zahrt TC, Song J, Deretic V: Mapping of Mycobacterium tuberculosis katG promoters and their differential expression in infected macrophages. J Bacteriol 2001, 183: 4033-4039.

305. Jang HJ, Nde C, Toghrol F, Bentley WE: Microarray analysis of Mycobacterium bovis BCG revealed induction of iron acquisition related genes in response to hydrogen peroxide. Environ Sci Technol 2009, 43: 9465-9472.

306. Wu CW, Schmoller SK, Shin SJ, Talaat AM: Defining the stressome of Mycobacterium avium subsp. paratuberculosis in vitro and in naturally infected cows. J Bacteriol 2007, 189: 7877-7886.

307. Cossu A, Sechi LA, Zanetti S, Rosu V: Gene expression profiling of Mycobacterium avium subsp. paratuberculosis in simulated multi-stress conditions and within THP-1 cells reveals a new kind of interactive intramacrophage behaviour. BMC Microbiol 2012, 12: 87.

308. Gosh A, Yamoah K, Pring D: Information shared with mothers prior to caesarean section: a national audit of compliance with recommended information. J Obstet Gynaecol 2013, 33: 471-473.

309. Kawaji S, Zhong L, Whittington RJ: Partial proteome of Mycobacterium avium subsp. paratuberculosis under oxidative and nitrosative stress. Vet Microbiol 2010, 145: 252-264.

310. Halliwell B, Gutteridge JM: Lipid peroxidation, oxygen radicals, cell damage, and antioxidant therapy. Lancet 1984, 1: 1396-1397.

311. Helmann JD, Wu MF, Gaballa A, Kobel PA, Morshedi MM, Fawcett P et al.: The global transcriptional response of Bacillus subtilis to peroxide stress is coordinated by three transcription factors. J Bacteriol 2003, 185: 243-253.

312. Senaratne RH, De Silva AD, Williams SJ, Mougous JD, Reader JR, Zhang T et al.: 5'-Adenosinephosphosulphate reductase (CysH) protects Mycobacterium tuberculosis against free radicals during chronic infection phase in mice. Mol Microbiol 2006, 59: 1744-1753.

313. Webb JR, Vedvick TS, Alderson MR, Guderian JA, Jen SS, Ovendale PJ et al.: Molecular cloning, expression, and immunogenicity of MTB12, a novel low-molecular-weight antigen secreted by Mycobacterium tuberculosis. Infect Immun 1998, 66: 4208-4214.


147

314. Akhter Y, Ehebauer MT, Mukhopadhyay S, Hasnain SE: The PE/PPE multigene family codes for virulence factors and is a possible source of mycobacterial antigenic variation: perhaps more? Biochimie 2012, 94: 110-116.

315. Iantomasi R, Sali M, Cascioferro A, Palucci I, Zumbo A, Soldini S et al.: PE_PGRS30 is required for the full virulence of Mycobacterium tuberculosis. Cell Microbiol 2012, 14: 356-367.

316. Parthasarathy G, Lun S, Guo H, Ammerman NC, Geiman DE, Bishai WR: Rv2190c, an NlpC/P60 family protein, is required for full virulence of Mycobacterium tuberculosis. PLoS ONE 2012, 7: e43429.

317. Gioffre A, Infante E, Aguilar D, Santangelo MP, Klepp L, Amadio A et al.: Mutation in mce operons attenuates Mycobacterium tuberculosis virulence. Microbes Infect 2005, 7: 325-334.

318. Kulasakara H, Lee V, Brencic A, Liberati N, Urbach J, Miyata S et al.: Analysis of Pseudomonas aeruginosa diguanylate cyclases and phosphodiesterases reveals a role for bis-(3'-5')-cyclic-GMP in virulence. Proc Natl Acad Sci U S A 2006, 103: 2839-2844.

319. Frederiksen RF, Paspaliari DK, Larsen T, Storgaard BG, Larsen MH, Ingmer H et al.: Bacterial chitinases and chitin-binding proteins as virulence factors. Microbiology 2013, 159: 833-847.

320. Troxell B, Hassan HM: Transcriptional regulation by Ferric Uptake Regulator (Fur) in pathogenic bacteria. Front Cell Infect Microbiol 2013, 3: 59.

321. Ernst FD, Bereswill S, Waidner B, Stoof J, Mader U, Kusters JG et al.: Transcriptional profiling of Helicobacter pylori Fur- and iron-regulated gene expression. Microbiology 2005, 151: 533-546.

322. Palyada K, Threadgill D, Stintzi A: Iron acquisition and regulation in Campylobacter jejuni. J Bacteriol 2004, 186: 4714-4729.

323. Fontan PA, Voskuil MI, Gomez M, Tan D, Pardini M, Manganelli R et al.: The Mycobacterium tuberculosis sigma factor sigmaB is required for full response to cell envelope stress and hypoxia in vitro, but it is dispensable for in vivo growth. J Bacteriol 2009, 191: 5628-5633.

324. Jones CM, Niederweis M: Role of porins in iron uptake by Mycobacterium smegmatis. J Bacteriol 2010, 192: 6411-6417.

325. Riccardi G, Milano A, Pasca MR, Nies DH: Genomic analysis of zinc homeostasis in Mycobacterium tuberculosis. FEMS Microbiol Lett 2008, 287: 1-7.

326. Osman D, Cavet JS: Bacterial metal-sensing proteins exemplified by ArsR-SmtB family repressors. Nat Prod Rep 2010, 27: 668-680.

327. Bruijnesteijn van Coppenraet LE, de Haas PE, Lindeboom JA, Kuijper EJ, van Soolingen D: Lymphadenitis in children is caused by Mycobacterium avium hominissuis and not related to 'bird tuberculosis'. Eur J Clin Microbiol Infect Dis 2008, 27: 293-299.

328. Whittington RJ, Marshall DJ, Nicholls PJ, Marsh IB, Reddacliff LA: Survival and dormancy of Mycobacterium avium subsp. paratuberculosis in the environment. Appl Environ Microbiol 2004, 70: 2989-3004.

329. Basler T, Holtmann H, Abel J, Eckstein T, Baumer W, Valentin-Weigand P et al.: Reduced transcript stabilization restricts TNF-alpha expression in RAW264.7 macrophages infected with pathogenic mycobacteria: evidence for an involvement of lipomannan. J Leukoc Biol 2010, 87: 173-183.


148

330. Zur Lage S, Goethe R, Darji A, Valentin-Weigand P, Weiss S: Activation of macrophages and interference with CD4+ T-cell stimulation by Mycobacterium avium subspecies paratuberculosis and Mycobacterium avium subspecies avium. Immunology 2003, 108: 62-69.

331. Stabel JR: Host responses to Mycobacterium avium subsp. paratuberculosis: a complex arsenal. Anim Health Res Rev 2006, 7: 61-70.

332. Cassat JE, Skaar EP: Iron in infection and immunity. Cell Host Microbe 2013, 13: 509-519.

333. Collins HL: Withholding iron as a cellular defence mechanism--friend or foe? Eur J Immunol 2008, 38: 1803-1806.

334. Yellaboina S, Ranjan S, Vindal V, Ranjan A: Comparative analysis of iron regulated genes in mycobacteria. FEBS Lett 2006, 580: 2567-2576.

335. Winterhoff N, Goethe R, Gruening P, Valentin-Weigand P: Response of Streptococcus suis to iron-restricted growth conditions at high and low oxygen availability. Berl Munch Tierarztl Wochenschr 2004, 117: 266-270.

336. Ryndak MB, Wang S, Smith I, Rodriguez GM: The Mycobacterium tuberculosis high-affinity iron importer, IrtA, contains an FAD-binding domain. J Bacteriol 2010, 192: 861-869.

337. Teramoto H, Inui M, Yukawa H: Corynebacterium glutamicum Zur acts as a zinc-sensing transcriptional repressor of both zinc-inducible and zinc-repressible genes involved in zinc homeostasis. FEBS J 2012, 279: 4385-4397.

338. Patzer SI, Hantke K: The zinc-responsive regulator Zur and its control of the znu gene cluster encoding the ZnuABC zinc uptake system in Escherichia coli. J Biol Chem 2000, 275: 24321-24332.

339. Haas CE, Rodionov DA, Kropat J, Malasarn D, Merchant SS, Crecy-Lagard V: A subset of the diverse COG0523 family of putative metal chaperones is linked to zinc homeostasis in all kingdoms of life. BMC Genomics 2009, 10: 470.

340. Abdallah AM, Verboom T, Weerdenburg EM, Gey van Pittius NC, Mahasha PW, Jimenez C et al.: PPE and PE_PGRS proteins of Mycobacterium marinum are transported via the type VII secretion system ESX-5. Mol Microbiol 2009, 73: 329-340.

341. Abdallah AM, Savage ND, van Zon M, Wilson L, Vandenbroucke-Grauls CM, van der Wel NN et al.: The ESX-5 secretion system of Mycobacterium marinum modulates the macrophage response. J Immunol 2008, 181: 7166-7175.

342. Shin JH, Oh SY, Kim SJ, Roe JH: The zinc-responsive regulator Zur controls a zinc uptake system and some ribosomal proteins in Streptomyces coelicolor A3(2). J Bacteriol 2007, 189: 4070-4077.

343. Gabriel SE, Helmann JD: Contributions of Zur-controlled ribosomal proteins to growth under zinc starvation conditions. J Bacteriol 2009, 191: 6116-6122.

344. Schroder J, Jochmann N, Rodionov DA, Tauch A: The Zur regulon of Corynebacterium glutamicum ATCC 13032. BMC Genomics 2010, 11: 12.

345. Lim CK, Hassan KA, Penesyan A, Loper JE, Paulsen IT: The effect of zinc limitation on the transcriptome of Pseudomonas protegens Pf-5. Environ Microbiol 2013, 15: 702-715.

346. Liu JZ, Jellbauer S, Poe AJ, Ton V, Pesciaroli M, Kehl-Fie TE et al.: Zinc sequestration by the neutrophil protein calprotectin enhances Salmonella growth in the inflamed gut. Cell Host Microbe 2012, 11: 227-239.


149

347. Oh YK, Straubinger RM: Intracellular fate of Mycobacterium avium: use of dual-label spectrofluorometry to investigate the influence of bacterial viability and opsonization on phagosomal pH and phagosome-lysosome interaction. Infect Immun 1996, 64: 319-325.

348. Akinola RO, Mazandu GK, Mulder NJ: A Systems Level Comparison of Mycobacterium tuberculosis, Mycobacterium leprae and Mycobacterium smegmatis Based on Functional Interaction Network Analysis. Journal of Bacteriology and Parasitology 2013, 4: 173-183.

349. Mobius P, Lentzsch P, Moser I, Naumann L, Martin G, Kohler H: Comparative macrorestriction and RFLP analysis of Mycobacterium avium subsp. avium and Mycobacterium avium subsp. hominissuis isolates from man, pig, and cattle. Vet Microbiol 2006, 117: 284-291.

350. Burrells C, Clarke CJ, Colston A, Kay JM, Porter J, Little D et al.: A study of immunological responses of sheep clinically-affected with paratuberculosis (Johne's disease). The relationship of blood, mesenteric lymph node and intestinal lymphocyte responses to gross and microscopic pathology. Vet Immunol Immunopathol 1998, 66: 343-358.

351. Lamont EA, Janagama HK, Ribeiro-Lima J, Vulchanova L, Seth M, Yang M et al.: Circulating Mycobacterium bovis peptides and host response proteins as biomarkers for unambiguous detection of subclinical infection. J Clin Microbiol 2014, 52: 536-543.

352. Pavkova I, Brychta M, Straskova A, Schmidt M, Macela A, Stulik J: Comparative proteome profiling of host-pathogen interactions: insights into the adaptation mechanisms of Francisella tularensis in the host cell environment. Appl Microbiol Biotechnol 2013, 97: 10103-10115.

353. Eisenreich W, Dandekar T, Heesemann J, Goebel W: Carbon metabolism of intracellular bacterial pathogens and possible links to virulence. Nat Rev Microbiol 2010, 8: 401-412.

354. Fuchs TM, Eisenreich W, Heesemann J, Goebel W: Metabolic adaptation of human pathogenic and related nonpathogenic bacteria to extra- and intracellular habitats. FEMS Microbiol Rev 2012, 36: 435-462.

355. Russell DG, VanderVen BC, Lee W, Abramovitch RB, Kim MJ, Homolka S et al.: Mycobacterium tuberculosis wears what it eats. Cell Host Microbe 2010, 8: 68-76.

356. Lee HJ, Park KJ, Lee AY, Park SG, Park BC, Lee KH et al.: Regulation of fur expression by RpoS and fur in Vibrio vulnificus. J Bacteriol 2003, 185: 5891-5896.

357. Delany I, Ieva R, Soragni A, Hilleringmann M, Rappuoli R, Scarlato V: In vitro analysis of protein-operator interactions of the NikR and fur metal-responsive regulators of coregulated genes in Helicobacter pylori. J Bacteriol 2005, 187: 7703-7715.

358. Willenborg J, de Greeff A, Jarek M, Valentin-Weigand P, Goethe R: The CcpA regulon of Streptococcus suis reveals novel insights into the regulation of the streptococcal central carbon metabolism by binding of CcpA to two distinct binding motifs. Mol Microbiol 2014, 92: 61-83.

359. Belitsky BR, Sonenshein AL: Genetic and biochemical analysis of CodY-binding sites in Bacillus subtilis. J Bacteriol 2008, 190: 1224-1236.

360. Zheng M, Wang X, Doan B, Lewis KA, Schneider TD, Storz G: Computation-directed identification of OxyR DNA binding sites in Escherichia coli. J Bacteriol 2001, 183: 4571-4579.

361. Ellermeier JR, Slauch JM: Fur regulates expression of the Salmonella pathogenicity island 1 type III secretion system through HilD. J Bacteriol 2008, 190: 476-486.


150

362. Ng VH, Cox JS, Sousa AO, MacMicking JD, McKinney JD: Role of KatG catalase-peroxidase in mycobacterial pathogenesis: countering the phagocyte oxidative burst. Molecular Microbiology 2004, 52: 1291-1302.

363. Gumber S, Taylor DL, Marsh IB, Whittington RJ: Growth pattern and partial proteome of Mycobacterium avium subsp. paratuberculosis during the stress response to hypoxia and nutrient starvation. Vet Microbiol 2009, 133: 344-357.

364. Pagan-Ramos E, Master SS, Pritchett CL, Reimschuessel R, Trucksis M, Timmins GS et al.: Molecular and physiological effects of mycobacterial oxyR inactivation. J Bacteriol 2006, 188: 2674-2680.

365. Palyada K, Sun YQ, Flint A, Butcher J, Naikare H, Stintzi A: Characterization of the oxidative stress stimulon and PerR regulon of Campylobacter jejuni. BMC Genomics 2009, 10: 481.

366. Doherty CP: Host-pathogen interactions: the role of iron. J Nutr 2007, 137: 1341-1344.

367. Serafini A, Boldrin F, Palu G, Manganelli R: Characterization of a Mycobacterium tuberculosis ESX-3 conditional mutant: essentiality and rescue by iron and zinc. J Bacteriol 2009, 191: 6340-6344.

368. Li Y, Miltner E, Wu M, Petrofsky M, Bermudez LE: A Mycobacterium avium PPE gene is associated with the ability of the bacterium to grow in macrophages and virulence in mice. Cell Microbiol 2005, 7: 539-548.

369. Jha SS, Danelishvili L, Wagner D, Maser J, Li YJ, Moric I et al.: Virulence-related Mycobacterium avium subsp hominissuis MAV_2928 gene is associated with vacuole remodeling in macrophages. BMC Microbiol 2010, 10: 100.

370. Citiulo F, Jacobsen ID, Miramon P, Schild L, Brunke S, Zipfel P et al.: Candida albicans scavenges host zinc via Pra1 during endothelial invasion. PLoS Pathog 2012, 8: e1002777.

371. Hampton DL, Miller WJ, Neathery MW, Kincaid RL, Blackmon DM, Gentry RP: Absorption of zinc from small and large intestine of calves. J Dairy Sci 1976, 59: 1963-1966.

372. Flagstad T: Lethal trait A 46 in cattle. Intestinal zinc absorption. Nord Vet Med 1976, 28: 160-169.

373. Johnson PE: Zinc absorption and excretion in humans and animals. In Copper and Zinc in Inflammation. 1989:103-131.

374. Krebs NF: Overview of zinc absorption and excretion in the human gastrointestinal tract. J Nutr 2000, 130: 1374S-1377S.

375. Roohani N, Hurrell R, Kelishadi R, Schulin R: Zinc and its importance for human health: An integrative review. J Res Med Sci 2013, 18: 144-157.

Appendix

151

Appendix

Appendix

152

Data of β-galactosidase assays

β-galactosidase activity was measured in protein extracts by addition of o-

nitrophenyl-β-D-galactopyranoside and subsequent determination of absorbance at

405 nm. Shown is the absorbance relative to protein mg/ml.

Table 8: Data of β-galactosidase assays.

Relative absorbance (405 nm) protein mg/ml. (NC) negative control, (TPEN) addition of TPEN for 2 h.

MSMEGwt pJEM15 NC

MSMEGwt pJEM15 TPEN

MSMEGwt pJEM-mptA2 NC

MSMEGwt pJEM-mptA2 TPEN

MSMEGwt pJEM-mptA2MUT NC

MSMEGwt pJEM-mptA2MUT TPEN


0.7418 0.9697 1.3097 14.0828 106.3755 119.0489 334.0528

0.7688 1.0311 1.2757 14.6126 107.5761 118.3695 314.5433

0.7742 1.0376 1.3437 14.529 110.9027 119.3886 319.2788

1.0422 1.1498 0.6182 8.6536 79.3998 91.2096 338.0332

1.0541 1.1913 0.443 8.5386 83.6533 91.7894

1.0317 1.1969 0.5696 8.3086 79.3407 90.4558

0.9235 1.0362 0.5963 9.8946 82.4423 89.0061

0.9011 1.057 0.5963 9.8131 83.1512 87.9914

0.9037 1.0597 0.6523 10.5031 84.6281 88.4843

2.7893 12.3543

2.8584 12.6065

2.8604 12.3498




MSMEG∆furB pJEM15 NC

MSMEG∆furB pJEM15 TPEN

MSMEG∆furB pJEM-mptA2 NC

MSMEG∆furB pJEM-mptA2 TPEN

376.9729 1.2457 1.8716 0.82 0.8644 103.7223 131.6354

355.825 1.4268 2.8252 0.763 1.011 105.3923 129.1634

381.3701 1.33 2.4303 0.7711 1.067 107.3408 133.9123

1.8387 2.675 1.0222 1.2 57.8883 56.9599

1.8641 2.7961 1.0354 1.1054 58.5897 57.5823

1.8945 2.7398 1.0173 1.093 62.6344 59.329

1.8745 3.3285 0.9235 1.0362 70.6882 86.1224

2.035 3.4321 0.9044 1.0334 72.2843 91.752

1.9601 3.49 0.9037 1.0597 73.33 86.4535

Appendix

153

Raw data of RNA-Sequencing

Due to the amount of raw data, the whole tables of raw data are provided in the

enclosed CD-ROM.

Table 9: Raw data of RNA-Sequencing MAP∆furA/MAPwt.

Table 10: Raw data of RNA-Sequencing MAPwt TPEN/control.

Raw data of macrophage and mouse experiments

Please find tables of raw data in the enclosed CD-ROM.


macrophage infection in colony forming units [Cfu].


mouse infection.

Supplemental data for Fur / Zur box analyses

Sequences used as input for the generation of motifs by MEME for subsequent FIMO

analysis.

Table 13: Sequences used to generate a FurA consenus sequence.

5‟UTR of fur genes of different mycobacterial species.

Strain Sequence

M. tuberculosis H37Rv CCTAGCAGACGCCTGTCACGCTAGCCAAAGTCTTGACTGATTCCAGAAAAGGGAGTCATATTGTCTAGTGTGTCCTCTATACCGGACTACGCCGAACAG

M. bovis BCG Pasteur CCTAGCAGACGCCTGTCACGCTAGCCAAAGTCTTGACTGATTCCAGAAAAGGGAGTCATATTGTCTAGTGTGTCCTCTATACCGGACTACGCCGAACAG

M. avium ssp. paratuberculosis ATCCGCTGTTGTGCTCCACTTCACAATAAACTCTTGACTCGTTCCAAATAAGTGAGTCATTCTGGTGCGGTGTCATCGACGGCCGATTACGCGGACAGG

M. avium ssp. hominissuis TGTTGTGCTCCACTTCACAATAAACTCTTGACTCGTTCCAAATAAGTGCGTCATTCTGGTGCGGTGTCATCGACGGCCGATTACGCGGACAGGTTGCGGATGGCCGATCTGCGGGTGACCCGGCCCCGG

M. smegmatis mc2 155 CACCCGCGCGACCATAATCACACTCACTCTTTTTGACTCA

TTCCAGAAAATGCGCGCATACTGGGTTTTGTGACCACAGTGCATGACCACGATCCCAAG

Appendix

154

Table 14: Sequences used to generate a FurB consenus sequence

Sequences of different known FurB regulated genes of MTB according to Maciag et al 2007 [201].

Locus tag Sequence

Rv0106 AGCCTGTTGAAAATAGTTTTCGACAACC

Rv2069 GGCTTATTGAAAATCATTTTCGACAACA

rpmB2 TCCTTATCGATAACAGTTTTCATTATTG

rpmB1 ACCTTATTGAAAATGATTGCCATTAAAC

Rv3017c AGTGTCTAAAATCATTGCCCGGAATA

Rv3019c GGTTTTAAAAAAGTCGCTGCTCGGAATG

Table 15: Predicted binding sites FurA (Fur boxes) obtained by FIMO analysis.

Fur boxes within a range of +10/-600 bp from the putative translation start site (TSL) are marked bold.

Start End p-value Matched Sequence Locus tag map

Pos. to TLS

525 554 4.02e-05 CTTCGACACGTTCGTGATCGGGGCGTCCAA 0001

80441 80470 1.25e-05 TGTTGACGGGTTGGAGAACCTGCCTTCAGA 0072c

82894 82923 4.89e-05 GCTCGAGCCATGCGAAAAAGAGGGCGCATC 0074 / 0075

90893 90922 6.23e-05 CGTCAACTGATCGCAGAGCAGGCCCGCATG 0081

455489 455518 3.29e-05 ATTTCGCTGGTTGCCGAGAAGGTAGGCGTG map_tll / 0428

517037 517066 8.68e-05 TCCTGAGCGGGTCCGACCAAGACCCGCACT 0489c

521962 521991 8.21e-05 TTTAGACACTTCCCGGACAAGCGGGACGTG 0493c

550828 550857 3.09e-05 GCTTCACGGCTTCCGGATCGGTGCGGCAGG 0524

555484 555513 1.13e-05 CTTCGTCTCGCTCCAGATCACCGCGGCCTT 0529c

596532 596561 9.04e-05 TCTGGACCCGGTCCCAATACATCGCGCCGG 0571

616080 616109 3.29e-05 ATTTCGCTGGTTGCCGAGAAGGTAGGCGTG 0589c

707238 707267 9.84e-05 TGTGGACCTCTTCGAGATCAACGAGGCCTT 0686

767473 767502 7.56e-05 TCTCGGCTCATTCGCGAACAGCACGACGTC 0744c

826848 826877 8.68e-05 GCTTGGCCGCCGCCAAAGAAGCGGGTCTGA 0807c

866790 866819 7.07e-06 TCGTGGCACACTCAAAGAGATTGGGTCATC 0846 / 0847

-559

873861 873890 3.29e-05 ATTTCGCTGGTTGCCGAGAAGGTAGGCGTG 0850c

886085 886114 1.85e-05 CGGTGGCACTTCCCGGACAAGGGCGGCATA 0864

890992 891021 3.22e-05 GCGTGACTGAGTCCAGCCAATTGCGTTCGG 0868c

904979 905008 3.03e-05 TGTGGACTGGAGCCAGAACAACGGCTCCAA 0880

938651 938680 5.18e-06 TTTTCGATGCTGCCAAAAGATGCGCTCCTA 0908c

1139961 1139990 8.33e-05 GGGTGACCCGGCCAAGAAGATGCCGGCCTT 1086

1219428 1219457 6.73e-05 CGTCGACGGGGTCGAGATAGAGCCGGCGTT 1162

1296954 1296983 1.21e-05 TTGTGATGCGTTCGACGAAAAGCCGGCATG 1234

Appendix

155


Pos. to TLS

1347372 1347401 6.19e-06 GCATGACCGGGTCCATACGATGGGGGCATG 1265

1395579 1395608 4.62e-05 TCTTCAGTCAGCGCACGCAATGCGGTCAAA 1307

1429676 1429705 8.92e-05 GCGTCGGTGATTTCAGTTGATTGGCACATT 1334

1437330 1437359 5.26e-05 TTGTCGCTGGGAACAACCGAGGCAGTCATA 1340c

1446519 1446548 1.34e-05 ATTTGTCTCGCGCCGGATCATCGACTGATA 1348c

1447312 1447341 6.43e-05 GTGTGACTCGCTCGACATGAAGGCGGTACT 1348c

1493722 1493751 3.57e-05 TTCGGCCTCATCGGAGAGAAGGAAGGCAGT 1381

1637690 1637719 3.22e-05 TCCTGGGTGCTACCCAAAAAGCCGGTCGGA 1496c / 1497c

1658618 1658647 9.04e-05 ATTCGATCCATTCCACGAACTTGCGGAACA 1510

1730038 1730067 6.23e-05 TCTTGACGGGTGTCAACATCGACGGGCTAA 1574c / 1575c

1740692 1740721 5.26e-05 TCTGGATGGTTTCCGAACACGGCGAGCACT 1583c

1747613 1747642 8.1e-05 GATTAAGTAGATCCAGATAGGAGCGACATG 1589c +3

1760007 1760036 4.02e-05 TCTTGACCGCATCCCAATCACGCCGCGACA 1602c

1781107 1781136 9.98e-05 CCGTGGCTCATCCAGTTGAAGGCCGTCATC 1626c

1824002 1824031 2.62e-16 TCTTGACTCGTTCCAAATAAGTGAGTCATT 1669c -8

1841898 1841927 7.99e-05 CTTTGGCCGGTGACGGAATACTCAGGCGTA 1684

1861526 1861555 6.94e-05 CTTTGACTCGTTCGAGGGCATACACTCGCG 1701c

1863463 1863492 5.74e-05 GCTTCCCTCGGGCCAGTTCAGTTGCGCATG 1704c

1867353 1867382 8.44e-05 TCTTGATCCGTTCCGGACGATTCACGGTCG 1709c

1894924 1894953 6.03e-05 TGTCGCCTGATATCCGCAAATGCGGAAATA 1733 / 1734

1898227 1898256 9.04e-05 TCTTGGCGAGTTCCAGCATGTTGGCGGCGT 1736

1898278 1898307 3.4e-06 TCTGGAATCGTTCCAGATCGGCGAGGAACG 1738

1943606 1943635 3.57e-05 GCCTGCCTCGATCCAGGTGATGACGTCCGA 1781

1950390 1950419 3.22e-05 ACCCGACTCATGCCAAAGACGGCATGCCCA 1787c -113

1976808 1976837 7.88e-05 TCTCGACGTGTTCGAGGCGATGCCCGCAGC 1810c

2089238 2089267 3.34e-06 CCGTCACTCCATCCAGATCAGGGAGGCCAA 1892c / 1893c

2187560 2187589 1.47e-05 CCTTGACCCGCAGCAGAATCGCCCCGCATT 1981c

2306480 2306509 9.7e-05 TTTTGTTTGGTTCAAATACCCTGTCGTATA t-RNA/ 2086c

2423358 2423387 6.03e-05 CCTTGGTTCGTTCCCGATAGATCAGGATGT 2180c

2437205 2437234 9.98e-05 CCTGTCATGGCTCCCGATATGAGTGTCATT 2191

2441443 2441472 7.35e-05 GCCTGACCAGTTCCAGCGTTGTCCCGCAGT 2196

2533901 2533930 7.56e-06 CCTTGGTTCGCTGCATGTCAGGCCGTCATT 2267c / 2268c

-167

2547183 2547212 7.35e-05 TCACTGGCGGTACCAATTATGGCACTCATT 2277c / 2278c

Appendix

156


Pos. to TLS

2548780 2548809 7.14e-05 TCGTGCCTCTTTCCGTATGGATGAAACATA 2278c / 2279

-165

2749614 2749643 9.98e-05 ACTTGCCTTATCGCTACTCATGCCTGCATT map_r03

2994728 2994757 7.99e-05 CCTTGACCCATTCCTGCGCCGTCGCGAAGT 2659

3016218 3016247 7.25e-05 TGTTGAGTTGTCCCCGATCAGGGTTCCGTA 2681c

3022485 3022514 3.95e-05 GCTCGCCTCTTTCCCACAAATTCAGCGATG 2687

3073366 3073395 8.44e-05 TCCTGGCACATCCTGATGAAGGGCGCCATC 2741c

3126603 3126632 6.73e-05 CGTCAACGGCTTCAAGATGATGCGGTCGTT 2796c

3138455 3138484 2.5e-05 GCTTGACGTATTCCAGTACCGGGCGGGTGA 2807c

3301259 3301288 5.84e-05 TCGTGCCCGCTCGCAGGAAACGCGCTGATT 2964c

3361260 3361289 2.46e-05 ACTTGGCCCGTTCCAGCAGCGGCAGCGAGT 3022

3365738 3365767 8.44e-05 TGTCGACACCGACCAGATCATTCCGGCGGT 3025c

3476724 3476753 6.84e-05 GCTGGACGGGTTCCCGCAACGGCGCGCCCG 3125c

3548568 3548597 8.33e-05 CTTGATCTCGTCGCAGATCAGGAACGGATT 3197

3705786 3705815 4.62e-05 GCTGCCCGGGTTCCCGATACGGCCGCCGTT 3336c

3712097 3712126 6.23e-05 TCTCTGCGCCGTCCGGGAAATGGCCGCAGA 3343c

3800027 3800056 5.55e-05 CCTGGAGTCGCTGCCGATCATGGCGGCCTC 3421c

3832311 3832340 9.17e-05 TATGGAGAAAATCCAGAACAGCCAGTCGAA 3452c

3835451 3835480 9.17e-05 CTGGAACTCGTCCTTGAACATGCCGTCGTA 3455c

3838823 3838852 7.14e-05 CTTTCTCTCGGTCGGAAGAAGTCGGTCGGA 3456c / 3457

3907140 3907169 7.89e-06 TCTTGACCCATTCCGGGTCGGTGGGGGTGT 3509

3942868 3942897 3.49e-05 TCTCGACCCAATCCAGCTTCGCCTGGTATT 3539c

4026268 4026297 4.71e-05 GCTTGCCGCATAACAGAAAGGTCACAAAAT 3629c / 3630

+2

4110718 4110747 1.59e-05 TCTTGAACGATTCCGGCAGCGTCACGGAGT 3694c

4204205 4204234 7.46e-05 CTTTGACCCGAGCCAGGTCGTGGAGGCCGT 3764c

4372781 4372810 1.15e-05 CCTCGACCCGTTCGAGAACCTCGACGAATA 3909c

4389474 4389503 9.98e-05 CCGTGACCGGTTCCGGCTCGGCGCGTCAAC 3928c

4600768 4600797 9.98e-05 GTTCGACCCCGTCCAGGTGATGCCGGCCGA 4128

4703022 4703051 8.56e-05 GCCCGACGGATTCCCGAACAGGGCGACGGC 4236c

4735161 4735190 3.16e-05 TCATCACTTGTTACGAGAGATCGAGTCACT 4266

4825204 4825233 7.67e-05 GGTCGCCGGGATGCAGAACAGTCGCTCGTT 4344c

Appendix

157

Table 16: Predicted binding sites FurB (Zur boxes) obtained by FIMO analysis.

Zur boxes within a range of +10/-600 bp from the putative translation start site (TSL) are marked bold.


Position to TLS/TSS

4531706 4531729 2.46e-06 GCTAAACGAAAACCGTTGCGGGCA 4067c

4338985 4339008 7.65e-06 CCTTGGCGATGATGGTCTTCATGA 3877c

4221201 4221224 8.66e-12 CCTTAACGAAAATCATTTTCATTA 3777-3778

4221198 4221221 2.11e-07 TGATAATGAAAATGATTTTCGTTA 3777-3778

-236

4216781 4216804 9.68e-10 CGTTAATGATAATCATTTTCATTA 3772c-3773c

4216784 4216807 1.35e-08 CGTTAATGAAAATGATTATCATTA 3772c-3773c

-30

4213754 4213777 3.62e-12 GCTTATTGAAAATGATTTTCGACA 3769c-3770

-88

4213757 4213780 6.17e-10 TCTTGTCGAAAATCATTTTCAATA 3769c-3770

-283

4213812 4213835 9.81e-08 CCTTATTGGGAATCATTTTCATCT 3769c-3770

-338

4213809 4213832 1.32e-06 TCGAGATGAAAATGATTCCCAATA 3769c-3770

-33

4208993 4209016 1.67e-08 GCTTACTGAAAATGATTGTTATTA 3764c-3765

-270

4209127 4209150 1.96e-08 GTTTACTGAAAACGATTTTCGTTA 3764c-3765

-307

4209124 4209147 2.8e-07 TGTTAACGAAAATCGTTTTCAGTA 3764c-3765

-139

4183510 4183533 1.74e-11 GCTTATTGAAAACGATTTTCGACA 3747c-3748c

-88

4183455 4183478 8.5e-09 GCTAGATGAAAACGATTGTCGATA 3747c-3748c

-33

4183452 4183475 9.28e-09 CCTTATCGACAATCGTTTTCATCT 3747c-3748c

4183507 4183530 2.51e-08 TGTTGTCGAAAATCGTTTTCAATA 3747c-3748c

4163375 4163398 1.04e-08 CCTTACTGAAAACGATTTTCATTG 3739c-3740

-21

4163372 4163395 1.83e-06 CGACAATGAAAATCGTTTTCAGTA 3739c-3740

-118

4159309 4159332 6.28e-12 CCGTAATGAAAATCATTTTCATTA 3736c-3737

-491a

4159306 4159329 1.49e-11 CCGTAATGAAAATGATTTTCATTA 3736c-3737

-197

4159255 4159278 8.85e-09 GGTTATTGAAAATGACTTTCATTA 3736c-3737

-248

4159258 4159281 1.35e-08 CTTTAATGAAAGTCATTTTCAATA 3736c-3737

-440a

4158883 4158906 6.29e-08 TGTTATCGATAACGATTTTCATTA 3736c-3737

-65a

4158880 4158903 2.05e-07 CGATAATGAAAATCGTTATCGATA 3736c-3737

3880227 3880250 1.99e-06 GATAAGTGAAAATGATTATCGTTA 3489c-3490

-135

3474982 3475005 3.86e-06 GCTTATCGAAAATCCCAGTCTACA 3123c-3124c

-161

2864182 2864205 3.62e-06 CCTTGACGAAAACCAGCGCGATCA 2547c

2488901 2488924 3.45e-06 CCGTATCGAAAATTACGTCCAGCA 2230c

2124264 2124287 3.01e-06 CCGTGATGAAGGTGATCGCCGACA 1923c

Appendix

158


Position to TLS/TSS

1925853 1925876 2.79e-06 CGGCGTTGATGACGGTTTCCATCA 1761c-1762c

1873361 1873384 2.09e-06 GCTCGTCGAAAACGGTGCCCAACA 1714-1715

1639160 1639183 9,00E-06 ACCTGTTCATGATGATGTTCATCA 1497c

1287728 1287751 1.62e-06 CCATGACGAAAATCGGTGCCATTC 1226-1227

1052836 1052859 7.83e-06 GACTACCGAAAACCAGTCTCGTCA 1006-1007

-47

521988 522011 9.46e-06 GCCTGACGAAAAGCACGTTCTTTA 0493c

2644432 2644455 7.65e-06 GGCCATCGAAGATCATTGGCGTTA 2352 -105

1827392 1827415 6.91e-06 ACTTGTTGAAACCCGTTGCCACGA 1672

807112 807135 6.7e-06 GCGCGTCGATGACGATTTCCGACG 0787

692364 692387 1.73e-06 GCGTGTTGAAAGCCGTTGCCCTCG 0670

517311 517334 4.11e-08 TACTAATGAAAATCGTTTCCATTA 0490-0489c

517314 517337 8.18e-07 TTGTAATGGAAACGATTTTCATTA 0490-0489c

-66

478495 478518 4.98e-06 CCTCGTCGAACATGGTGTTCAGCA 0449

478492 478515 9.25e-06 GCGTGCTGAACACCATGTTCGACG 0450 -426

29992 30015 7.43e-06 CCCAGTTGAAGAACATTTCCGACC 0027

alocation of Zur boxes according to transcription start site determined by RACE

Supplemental data for zinc cluster analysis

Due to the amount of raw data, the whole tables of raw data are provided in the

enclosed CD-ROM.

Table 17: Homologue zinc responsive genes in mycobacteria.

Acknowledgements

Acknowledgements

Acknowledgements

Acknowledgements

First of all I would like to sincerely thank my supervisor, Prof. Dr. Ralph Goethe of the

Institute for Microbiology for his excellent support, continuous encouragement,

valuable advice and critics. His guidance greatly contributed to the success of this

thesis.

I would also like to express my deepest gratitude to Prof. Peter Valentin-Weigand for

providing the great opportunity to perform this thesis in the Institute for Microbiology.

The excellent facilities helped me on my way to gain professional skills for my future

career.

I would like to thank my co-supervisors Prof. Dr. Gerald-F. Gerlach, Prof. Dr. Paul

Becher and Dr. Jochen Meens for their interest in my work, ideas, helpful discussions

and technical advice.

Further thanks go to Michael Jarek of the Helmholtz Centre for Infection Research in

Braunschweig, for his cooperation during RNA-sequencing and for his efforts, help

and long hours on the phone during analysis of transcriptome data.

Many thanks to all my past and present amazing colleagues, especially Jana Seele,

Nicole de Buhr, Yenehiwot Berhanu Weldearegay, Anna Koczula, Maren Seitz,

Kristin Laarmann, Nina Janze, Nantaporn Ruangkiattikul and Daniela Willms for

always being cooperative and understanding, for funny “lab” dances, motivation and

mental succour during lean times, as well as long talks who saved me from going

mad. Also Jörg Willenborg, Andreas Nerlich and Matthias Stehr for their excellent

colleagueship, inspiring scientific discussions and professional competence. Jörg

Merkel, for the continuous technical assistance and liquorice supply. I also want to

thank my former colleague Thorsten Meissner for his support, preliminary work and

his inheritance.

A special thanks goes to my family for their unconditional love and infinite

providence. They kept me free from ties and supported me throughout my way.

Thank you for trusting in me, my abilities and my decisions.

I also deeply want to thank my friends, giving the balance between work and life and

interesting discussions about the sense and nonsense of everything. I would like to

thank them for their friendship which I really appreciate and hopefully won‟t miss in

the future.

pp 1-149

pp 150-298

p 299 Table 11: Raw data of survival of MAPwt, MAP∆fur A and MAP∆fur AC after macrophage infection in colony forming units [Cfu].

p 300 Table 12: Raw data of survival of MAPwt, MAP∆fur A and MAP∆fur AC after mouse infection.

pp 301-302

Table 9: Raw data of RNA-Sequencing MAP∆furA/MAPwt.

Table 10: Raw data of RNA-Sequencing MAPwt TPEN/control.

Table 15: Homologue genes in mycobacteria compared to MAP zinc responsive genes and genes of the Mtb Zur regulon not present or regulated in MAP.

RCN AnnotationRaw Counts ∆furA1

Raw Counts ∆furA2

Raw Counts ∆furA3

Expression value∆furA

Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt

p‐Value ∆furA/wt

q‐Value ∆furA/wt

‐ predicted RNA 15 82 115 167 392 2632 3016 4516 0,00E+00 0,00E+00‐ predicted RNA 63 33 0 69 2564 478 211 2244 0,00E+00 0,00E+00‐ predicted RNA 40 0 0 38 2378 0 0 1900 0,00E+00 0,00E+00furA MAP1669c 6 138 93 5 799 6361 3408 264 0,00E+00 0,00E+00‐ MAP_r02 16561145 339931219 123823444 3314982 25841471 313117203 214375853 3820188 0,00E+00 0,00E+00‐ MAP3179c 141 13280 36 173 0 300 36 4 0,00E+00 0,00E+00‐ MAP3272 31 1856 2 44 0 36 15 1 0,00E+00 0,00E+00udgA MAP3825 0 1256 1442 20 0 47 19 0 0,00E+00 0,00E+00‐ MAP0848 0 49 115 4 651 1009 1342 107 1,23E‐239 6,89E‐237‐ MAP1492 0 178 211 13 1083 3242 2373 294 7,02E‐219 3,53E‐216ahpC MAP1589c 19594 306877 110803 8095 1807 7034 4234 271 9,09E‐158 4,16E‐155‐ MAP1743c 101 7241 108 73 72 111 92 3 1,41E‐153 5,93E‐151‐ predicted RNA 4158 32155 10103 17759 405 889 336 733 2,27E‐149 8,81E‐147‐ predicted RNA 1155 0 0 1288 74 0 0 69 8,40E‐147 3,02E‐144‐ MAP4206c 64 35 119 1 1999 530 241 24 9,91E‐131 3,33E‐128‐ predicted RNA 1501 33535 15967 13880 168 1339 712 628 6,80E‐117 2,14E‐114‐ MAP2606c 0 144 158 2 604 1540 1436 41 6,26E‐99 1,86E‐96‐ predicted RNA 51 664 266 278 3173 6684 4510 5035 1,99E‐97 5,57E‐95‐ MAP1587c 4656 35955 30790 619 483 1376 1290 29 6,84E‐91 1,81E‐88‐ MAP1746c 0 7019 204 67 36 164 215 4 2,24E‐82 5,64E‐80‐ MAP0847 214 1217 1584 22 6489 25993 26702 435 1,82E‐72 4,38E‐70ahpD MAP1588c 6666 91682 52178 3082 743 3908 1884 142 2,06E‐72 4,73E‐70‐ predicted RNA 77 73 140 204 1393 1235 1108 2662 4,97E‐68 1,09E‐65‐ predicted RNA 4349 359 261 3499 377 0 0 243 3,46E‐61 7,26E‐59‐ MAP4207c 0 251 107 5 1155 286 288 53 1,26E‐44 2,54E‐42‐ predicted RNA 1460 13 0 1393 163 0 0 130 2,12E‐43 4,11E‐41‐ MAP1707 0 72 72 2 244 417 650 24 2,68E‐41 5,00E‐39‐ MAP0047c 144 317 548 11 1802 7346 5300 142 1,33E‐39 2,39E‐37‐ MAP2105 0 36 26 2 48 491 173 27 7,15E‐37 1,24E‐34‐ predicted RNA 22 89 35 176 636 97 140 1790 4,50E‐35 7,55E‐33

Table 9: Raw data of RNA-Sequencing MAP∆furA/MAPwt. (Data were analysed by Rockhopper and sorted by q-value. Genes with a q-value ≤0.01 are differentially expressed. Only genes with raw counts in all replicates were included for further analysis.)

1


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 37 996 543 534 710 10200 8025 6454 1,11E‐34 1,81E‐32‐ MAP0773 202 437 15783 314 173 526 588 27 2,86E‐31 4,50E‐29‐ predicted RNA 7355 1620 710 2176 766 131 0 183 5,04E‐30 7,69E‐28‐ MAP2642 36 127 35 2 777 144 204 23 1,83E‐28 2,71E‐26‐ MAP4210 36 122 216 4 1343 217 252 40 5,14E‐28 7,40E‐26‐ predicted RNA 8000 975 291 1685 846 60 0 146 3,45E‐27 4,82E‐25PE MAP1003c 257 2151 275 15 6264 13348 8974 186 4,11E‐27 5,60E‐25‐ MAP3800 260 530 395 9 2407 5829 6745 98 7,39E‐27 9,80E‐25‐ MAP1706 166 190 327 24 699 4487 4511 249 1,10E‐26 1,42E‐24‐ MAP4211 67 165 60 4 1235 262 158 35 2,47E‐26 3,11E‐24‐ predicted RNA 2316 6641 9431 6873 457 565 373 618 6,10E‐26 7,49E‐24‐ predicted RNA 2216 29 26 2007 287 29 34 234 2,75E‐24 3,30E‐22fdxC_2 MAP2607c 104 1772 1166 100 1223 23899 12709 1190 3,20E‐24 3,75E‐22‐ MAP1742c 72 2061 36 25 36 89 93 3 2,68E‐23 3,07E‐21‐ predicted RNA 1450 0 0 1618 207 0 0 193 2,31E‐22 2,58E‐20‐ MAP2168c 108 2148 933 63 1735 20207 14729 730 2,90E‐22 3,17E‐20‐ MAP2019c 0 36 22 2 40 313 155 23 5,77E‐22 6,19E‐20‐ MAP1203 178 1529 1307 24 4636 14513 12520 279 7,47E‐22 7,84E‐20‐ MAP1204 33 653 625 19 1421 4631 4870 182 9,52E‐21 9,79E‐19‐ predicted RNA 8 770 280 506 20 4623 4423 4341 1,51E‐18 1,53E‐16‐ MAP0771 176 420 5839 107 130 396 192 13 1,56E‐18 1,54E‐16‐ MAP0079 36 189 108 5 216 1271 1151 40 2,42E‐18 2,34E‐16‐ predicted RNA 17 51 2188 1457 50 103 118 211 4,50E‐16 4,28E‐14‐ predicted RNA 227 907 753 671 95 17280 5166 5990 7,19E‐16 6,71E‐14‐ predicted RNA 345 734 2750 2182 21 338 303 316 4,24E‐15 3,88E‐13‐ MAP0130 144 728 230 30 215 9367 2252 251 7,27E‐15 6,54E‐13‐ predicted RNA 180 422 1358 2048 45 155 108 317 4,84E‐14 4,28E‐12‐ predicted RNA 181 0 41 286 1436 43 8 1794 1,16E‐13 1,01E‐11‐ predicted RNA 1342 0 50 1256 250 0 0 194 4,70E‐13 4,01E‐11‐ MAP0772 47 36 3745 63 158 90 138 9 1,07E‐12 8,96E‐11‐ MAP0078 108 8 0 12 180 808 807 76 1,30E‐12 1,07E‐10‐ predicted RNA 1447 0 0 1337 286 7 0 223 2,73E‐11 2,22E‐09‐ MAP0337 36 216 90 4 380 971 466 24 3,79E‐11 3,03E‐09‐ MAP0081 284 142 195 9 1044 2530 3647 69 3,94E‐11 3,10E‐09

2


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3796 1048 1822 4055 144 5495 32166 39668 1330 7,21E‐11 5,59E‐09‐ MAP4209 215 215 110 15 2153 580 167 101 2,61E‐10 1,99E‐08‐ MAP1570 30 273 311 23 296 1942 1148 127 3,05E‐10 2,29E‐08‐ predicted RNA 3435 12775 7339 5123 766 1184 814 663 5,80E‐10 4,29E‐08‐ predicted RNA 121 0 0 301 767 0 0 1602 1,16E‐09 8,48E‐08‐ MAP2114c 36 241 90 3 532 735 226 20 2,23E‐09 1,60E‐07‐ MAP3178c 180 3204 0 78 206 108 30 14 1,48E‐08 1,05E‐06‐ predicted RNA 5832 0 0 4718 1015 0 0 689 2,13E‐08 1,49E‐06fdxC_1 MAP2039 11268 43115 28093 3303 2572 3823 3222 428 3,09E‐08 2,13E‐06‐ MAP4208 686 145 198 14 5844 585 534 94 3,66E‐08 2,49E‐06‐ predicted RNA 1372 0 0 1345 317 0 0 260 3,97E‐08 2,67E‐06pstB MAP0574 47 887 394 21 0 212 108 4 4,18E‐07 2,77E‐05‐ MAP2037 4410 5665 11414 580 1426 282 568 86 6,07E‐07 3,97E‐05‐ MAP3123c 72 72 85 5 396 324 366 26 7,04E‐07 4,55E‐05‐ predicted RNA 7484 36 32 4497 1414 0 0 711 9,46E‐07 6,04E‐05‐ MAP1388 72 245 255 18 303 1095 1400 84 1,15E‐06 7,23E‐05‐ predicted RNA 776 0 0 1255 201 0 0 273 1,72E‐06 1,07E‐04‐ MAP3868 36 140 217 5 108 898 935 22 1,85E‐06 1,14E‐04‐ predicted RNA 106 334 1933 1623 68 234 185 353 2,24E‐06 1,36E‐04‐ MAP1967c 216 117 358 7 640 2135 2600 41 2,30E‐06 1,38E‐04‐ MAP3812c 144 278 103 10 769 940 780 46 5,08E‐06 3,01E‐04cysH_1 MAP2036 15420 12317 26076 1208 4641 674 699 188 9,93E‐06 5,82E‐04‐ MAP1272c 72 1608 1671 37 1806 9679 7401 229 1,03E‐05 5,94E‐04‐ MAP3677 57 1429 1025 19 36 357 178 4 1,20E‐05 6,90E‐04‐ MAP1639c 72 250 178 14 57 2354 361 59 1,30E‐05 7,35E‐04‐ MAP2117c 186 288 125 13 565 2549 771 61 1,84E‐05 0,00102978‐ MAP3421c 36 215 121 11 96 1166 452 44 2,06E‐05 0,00114067‐ MAP2040c 7635 105 47 696 1599 0 0 121 2,50E‐05 0,00137054‐ MAP1741c 69 3132 108 37 108 232 283 9 2,68E‐05 0,0014539‐ MAP4204 108 72 116 9 673 114 109 34 7,13E‐05 0,0038225‐ predicted RNA 11080 19 0 8750 2181 46 35 1464 7,38E‐05 0,00391175‐ MAP3310 283 617 375 33 606 3955 3452 156 8,97E‐05 0,00470959‐ predicted RNA 934 24 0 1268 285 0 25 334 1,15E‐04 0,00597431‐ MAP3153 0 524 143 11 119 1707 449 41 1,33E‐04 0,00684955

3


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 259 10 48 428 1287 0 25 1678 1,77E‐04 0,00898763‐ MAP1418c 85 143 43 5 95 1064 385 20 1,89E‐04 0,00949716 Threshold‐ predicted RNA 2174 0 0 1901 586 0 0 430 2,17E‐04 0,01073296‐ MAP3143 555 0 27 34 180 0 12 9 2,15E‐04 0,01073296‐ predicted RNA 3410 35 6 2461 863 0 0 520 2,36E‐04 0,01156045‐ MAP0514c 173 427 406 18 72 144 70 5 2,83E‐04 0,01369459‐ MAP0455 314 833 689 28 144 229 108 7 3,52E‐04 0,01678248‐ MAP3954 67 108 104 15 430 177 152 53 3,50E‐04 0,01678248‐ predicted RNA 27017 14805 38055 8983 7859 1687 2627 1621 4,79E‐04 0,0225637lprO MAP3615c 483 871 1455 36 3022 5295 6948 187 4,95E‐04 0,02307402‐ MAP3811 127 381 262 19 222 2316 1350 75 5,67E‐04 0,02620465‐ predicted RNA 29138 1882 3197 3318 6655 238 167 615 6,21E‐04 0,02845663nirA_1 MAP2035 79132 119031 182527 3402 26209 6247 7387 509 6,57E‐04 0,02983595‐ MAP1278c 313 667 799 22 430 6896 3261 98 8,00E‐04 0,03600008‐ MAP1756c 0 72 34 3 6 336 107 16 8,26E‐04 0,03684243‐ MAP1725c 102 286 178 7 761 606 106 26 8,57E‐04 0,0378878‐ MAP3461 394 428 251 31 809 3187 2645 130 0,001104253 0,0483759‐ MAP2532 38 296 428 12 477 857 816 44 0,001191389 0,05174326‐ MAP1245 36 285 343 32 30 34 122 10 0,001276953 0,05498537‐ MAP4047 280 248 211 21 36 221 137 7 0,002015316 0,08604374‐ predicted RNA 3764 21 0 2596 1088 0 0 628 0,002801009 0,11858388‐ MAP0857c 108 105 100 17 36 53 36 5 0,002922778 0,12270798‐ MAP0343 180 777 441 48 57 5383 1548 182 0,003240865 0,13459209‐ predicted RNA 1085 20 22 1421 380 0 0 412 0,003232561 0,13459209‐ MAP0355 54 36 91 7 108 463 139 22 0,003626687 0,14854675‐ MAP3263c 72 394 213 7 295 1316 556 22 0,00364162 0,14854675‐ MAP2167c 143 345 202 19 247 1442 1257 64 0,00413846 0,16679648‐ MAP0667 0 172 0 7 89 264 24 23 0,004549608 0,18191209‐ predicted RNA 392 18835 10196 7569 788 71236 86747 40589 0,005145751 0,20412831lpqJ MAP3837c 422 1860 2320 93 744 11081 12547 429 0,005238139 0,2061699‐ MAP0620 144 998 1043 36 216 140 141 12 0,005596499 0,21831549‐ MAP1454 411 214 14 17 288 3626 1257 60 0,005590055 0,21831549‐ MAP3238 99 82 145 5 215 617 363 16 0,005690077 0,21882907‐ predicted RNA 11510 35 102 5842 3067 0 0 1301 0,006760596 0,25802943

4


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 220 18 26 582 771 8 0 1616 0,007049004 0,26701416‐ MAP2110c 36 65 218 6 143 287 424 18 0,00786065 0,29553699‐ MAP1718c 176 1477 456 54 428 6760 1465 194 0,008198775 0,30596615‐ MAP4205 191 102 212 15 977 69 102 45 0,008405318 0,31136758‐ MAP1797c 119 588 264 35 108 136 41 13 0,008926529 0,32808372entB MAP2259 72 179 176 10 71 859 539 28 0,008921689 0,32808372‐ MAP2506c 144 569 642 29 72 285 142 10 0,009082636 0,32919653‐ MAP0580c 0 142 70 8 97 143 160 23 0,009156515 0,32950375‐ predicted RNA 710 18 0 1157 303 0 16 420 0,009225239 0,32962238‐ MAP0257 480 1203 658 142 263 9883 3252 551 0,009959095 0,35333746‐ predicted RNA 2175 0 0 1955 745 30 0 569 0,010333236 0,36404784‐ MAP3564 108 829 844 21 99 249 246 8 0,01044609 0,36546807‐ predicted RNA 1212 1259 878 1292 304 18957 7327 5539 0,011215497 0,38968052‐ MAP0601c 0 682 385 16 0 283 145 6 0,011388485 0,39286782‐ predicted RNA 600 0 0 1142 268 0 0 428 0,011385213 0,39286782‐ MAP0098c 278 1146 2300 57 372 3265 2757 90 0,012549026 0,42717561‐ MAP1640c 72 832 609 41 37 214 307 15 0,013521443 0,45718812‐ MAP3738c 299 373 285 22 72 156 250 8 0,013711683 0,46052971fadE20_1 MAP1713 144 2839 840 35 134 539 428 11 0,014215639 0,47429397‐ MAP2011 586 1815 1072 137 261 15174 4422 554 0,014802606 0,49062848pfpI MAP0372 101 210 141 12 60 1236 349 29 0,016559598 0,54527616‐ MAP1726c 106 516 200 17 0 345 108 7 0,016810688 0,54994965‐ MAP0525 278 569 480 20 36 355 323 8 0,017162971 0,55785191‐ MAP2118 152 212 292 12 318 1307 751 35 0,017665152 0,57049381cobK MAP1815c 577 36 180 28 258 71 58 11 0,018111532 0,57906117‐ MAP3839c 213 620 500 30 36 264 351 11 0,018045376 0,57906117‐ MAP1759c 46 400 540 21 222 1419 1293 63 0,018578576 0,58637658‐ MAP_t32 0 136 69 24 0 31 34 7 0,018506129 0,58637658fbpC2 MAP3531c 1930 3872 3629 131 9073 19892 13407 542 0,018914407 0,59186822‐ MAP0090c 81 82 342 11 277 368 570 26 0,019625978 0,60297096‐ MAP0399c 560 1044 697 89 1211 4343 5205 327 0,01940833 0,60297096‐ predicted RNA 357 0 0 550 1259 38 11 1650 0,019593089 0,60297096‐ predicted RNA 8946 0 6 4078 2646 0 0 1012 0,019592031 0,60297096‐ MAP2828c 527 0 0 16 217 71 21 6 0,019388903 0,60297096

5


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 802 0 0 720 3124 0 0 2357 0,020639884 0,6226571mmpS5 MAP1737 1076 1061 7076 291 610 659 1180 85 0,020717813 0,6226571‐ MAP1917c 176 429 464 30 36 286 213 12 0,021660416 0,64571111‐ MAP2415c 36 504 180 21 0 1746 358 54 0,022206693 0,65810189‐ MAP2941c 462 224 159 15 1937 166 277 46 0,02273293 0,66975731‐ MAP4057c 180 929 724 18 142 233 272 7 0,023396879 0,68531091‐ MAP0616c 138 72 139 14 403 236 214 34 0,023554365 0,68593579‐ MAP1623c 36 214 141 10 169 383 281 25 0,023557265 0,68593579‐ MAP1387c 320 1448 687 43 91 6377 4242 145 0,024068027 0,69288412‐ MAP1496c 88 148 71 17 0 154 72 7 0,024196714 0,69288412lprJ MAP1397 72 725 167 29 138 1634 1161 84 0,024830715 0,70676353‐ predicted RNA 1134 0 5 1312 466 0 11 456 0,024934874 0,70676353‐ MAP_t07 277 9 37 108 206 71 36 76 0,025677211 0,72269157‐ MAP1586 837 208 213 68 191 288 293 24 0,02581324 0,72269157‐ MAP0349 128 2665 427 30 170 463 289 10 0,027575872 0,76755384‐ MAP_t23 394 697 835 330 102 355 405 121 0,028063891 0,76988351narJ MAP2618c 148 692 533 26 85 249 244 11 0,027812386 0,76988351‐ predicted RNA 999 0 52 1265 398 0 64 443 0,02785545 0,76988351‐ MAP3644 0 511 267 7 139 958 528 16 0,029131346 0,7933174‐ predicted RNA 1498 10 5 1430 614 11 0 493 0,029591397 0,80151322‐ MAP2063c 68 72 39 8 106 216 200 19 0,030148183 0,81222751‐ MAP2062 108 929 837 22 101 430 207 9 0,030742642 0,82383739‐ MAP0526 0 520 528 26 0 301 184 11 0,031921654 0,85090632fadE25_1 MAP0032c 159 549 291 9 105 2489 1179 27 0,032452717 0,85303883‐ predicted RNA 844 0 17 1527 352 18 60 577 0,032486279 0,85303883‐ MAP2223c 539 1077 1138 23 1664 5336 4323 84 0,032400789 0,85303883‐ predicted RNA 253 7593 5275 3827 198 2374 1377 1167 0,032589009 0,85303883‐ predicted RNA 203 4222 1288 1599 165 19673 4140 5994 0,032261145 0,85303883‐ predicted RNA 1577 0 2 1547 651 0 0 535 0,032170976 0,85303883‐ MAP1712 173 618 146 16 27 369 139 6 0,03419785 0,87902433mmaA2 MAP4095c 413 1943 1521 55 4662 2862 1982 201 0,034630499 0,88562668‐ MAP_t34 108 460 396 169 36 437 35 73 0,035573339 0,90514384‐ MAP3516 28 142 0 10 183 0 0 23 0,035640308 0,90514384apt MAP1046 561 928 1706 83 125 551 725 30 0,037452065 0,93027435

6


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



aroE MAP1080 266 597 581 24 107 286 307 10 0,037987725 0,93027435‐ MAP1908 250 770 399 32 166 160 244 14 0,037816519 0,93027435‐ predicted RNA 8821 201 117 2106 2868 36 0 571 0,036930304 0,93027435‐ predicted RNA 1164 21 0 996 4722 0 0 3375 0,037574463 0,93027435nadE MAP2258c 3148 16953 30195 289 2161 5999 4542 79 0,037381704 0,93027435‐ MAP2425c 36 213 175 11 180 427 213 24 0,0383664 0,93027435‐ MAP3560 1916 3311 1484 199 980 33980 6655 741 0,038561308 0,93027435‐ MAP3852c 135 93 48 9 72 671 410 21 0,037018476 0,93027435‐ MAP4015 108 36 0 12 281 0 35 25 0,036952337 0,93027435‐ MAP0729c 53 990 963 107 108 276 340 45 0,039885294 0,95686719‐ MAP3720 534 346 514 47 288 0 225 18 0,040021633 0,95686719‐ MAP0494 128 1458 1220 32 128 546 291 12 0,04030582 0,9578336lipU MAP1023 36 978 546 15 433 1628 1667 41 0,041640441 0,98490395dnaA MAP0001 4536 7561 9432 209 2414 4689 3975 99 0,816572007 1‐ predicted RNA 404 18252 10049 4852 1193 22060 13707 6279 0,536654241 1dnaN MAP0002 2387 13690 8916 253 2584 11160 8897 224 0,493643008 1recF MAP0003 750 4350 5003 103 898 2994 3179 74 0,526485995 1‐ MAP0004 845 1021 2307 123 357 1607 1875 89 0,543196699 1gyrB MAP0005 14903 66318 79169 970 11613 79269 67747 875 0,491871916 1‐ predicted RNA 2726 30 59 2345 1169 73 62 871 0,08488333 1‐ predicted RNA 4658 178 119 1067 2857 174 92 556 0,826112477 1‐ predicted RNA 1565 57 0 1421 748 0 27 572 0,085873969 1‐ predicted RNA 857 14 14 1077 676 4 17 714 0,424658629 1‐ predicted RNA 1281 0 113 1185 848 32 32 657 0,398717479 1gyrA MAP0006 11835 32276 36370 430 10486 36205 28498 367 0,513051399 1‐ MAP0007 1855 9750 11566 326 1782 10712 10397 305 0,486414841 1‐ MAP_t01 204 1423 582 357 148 1436 452 296 0,927084043 1‐ MAP_t02 29 112 172 53 0 398 119 67 0,430864222 1‐ MAP0008c 217 539 498 30 219 479 906 35 0,554159723 1‐ MAP0009 104 270 233 6 173 359 70 6 0,964621267 1‐ MAP0010c 144 178 286 21 160 430 271 25 0,336919079 1ppiA MAP0011 4261 8253 5010 493 5202 6904 5593 483 0,480029824 1‐ MAP0012c 1249 630 965 133 1712 1212 969 160 0,5180585 1‐ MAP0013c 1894 2024 1311 336 1493 1630 1736 264 0,526035934 1

7


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0014 532 1072 861 49 528 1266 681 44 0,490112781 1pabA MAP0015 822 1280 1121 74 698 1334 1238 65 0,4905583 1pknB MAP0016c 4213 6034 11324 168 4370 10390 8768 164 0,484694361 1‐ MAP0017c 513 949 1401 80 540 1474 1012 76 0,482975981 1pknA MAP0018c 1848 3448 3746 174 1994 4057 3555 170 0,489824175 1pbpA MAP0019c 3876 7738 8878 199 4292 9760 8698 203 0,477786489 1rodA MAP0020c 1938 2185 3933 89 2079 4137 4162 99 0,519088954 1ppp MAP0021c 2606 6855 8211 159 2445 8321 8301 155 0,483058178 1‐ MAP0022c 1049 2950 2420 188 669 2880 2246 147 0,524122162 1‐ MAP0023c 5392 20059 19526 353 5981 19103 17568 323 0,515127665 1‐ MAP_t03 36 950 867 236 0 1011 555 183 0,363519182 1‐ MAP0024c 36 71 36 3 142 35 120 8 0,017594399 1‐ MAP0025 72 216 216 25 108 293 357 36 0,185028549 1fadD33_1 MAP0026 687 999 810 26 593 1490 1679 30 0,521015071 1‐ MAP0027 1010 8091 6853 96 557 8218 7168 88 0,488994411 1‐ MAP0028c 1110 650 764 40 1468 1067 1076 49 0,519825545 1‐ MAP0029c 1488 9373 2842 135 1418 4666 2888 90 0,541236592 1‐ MAP0030c 189 2267 932 114 357 4369 1282 191 0,805293566 1‐ MAP0031c 232 1997 763 35 53 6441 1761 79 0,193186481 1‐ MAP0033c 42 423 204 18 108 289 87 15 0,691480763 1‐ MAP0034 3277 2216 928 112 1709 1440 1254 60 0,752516479 1‐ MAP0035 732 2692 3829 115 439 4719 4377 130 0,524299917 1‐ MAP0036 282 145 385 17 101 364 387 12 0,276421215 1‐ MAP0037 402 566 1099 83 520 1495 839 101 0,513831328 1‐ MAP0038 533 2081 1980 40 612 2412 2510 45 0,514101596 1‐ MAP0039 266 1882 674 106 408 1859 1079 125 0,515116153 1‐ MAP0040 264 173 247 41 227 227 488 43 0,917791453 1‐ MAP0041 1140 3696 2961 63 1327 3684 3283 64 0,482186431 1‐ MAP0042 792 4267 1401 251 956 2126 1408 187 0,522097456 1‐ MAP0043c 243 1117 976 37 272 1390 707 35 0,497753695 1‐ MAP0044c 375 2032 1260 35 388 1390 1072 27 0,551818187 1‐ MAP0045 1529 3062 1785 161 1641 1432 1478 121 0,529320504 1‐ MAP0046c 555 1364 1095 125 458 1395 1708 128 0,482796856 1leuS MAP0048 1798 8231 10809 87 2004 8925 8202 77 0,495502026 1

8


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0049c 464 1021 1023 53 200 1202 996 40 0,737257214 1‐ MAP0050c 757 4541 2242 167 532 3750 2467 137 0,522152056 1gluA MAP0051c 288 432 320 22 288 970 446 28 0,52115788 1glnQ MAP0052c 501 1182 1476 24 497 1394 1152 22 0,48607429 1‐ MAP0053c 996 4048 1919 123 949 3135 2362 108 0,514537116 1‐ MAP0054c 384 2012 3852 93 358 3239 3887 103 0,514700403 1‐ MAP0055c 917 1346 1540 64 1202 1451 1501 68 0,508826047 1‐ MAP0056c 180 254 327 9 216 216 299 8 0,579817438 1‐ MAP0057c 0 67 120 2 0 0 19 0 1,80E‐20 1‐ MAP0058c 258 718 1410 26 126 748 716 15 0,257070673 1‐ MAP0059c 43 787 1135 18 288 709 703 19 0,936344218 1‐ MAP0060c 7586 42645 30673 889 15485 30837 20199 833 0,495683463 1‐ MAP0061c 6209 12665 13347 859 11989 13243 11439 1052 0,528059375 1‐ predicted RNA 1238 249 270 1744 3699 319 249 4081 0,307245198 1‐ predicted RNA 892 0 0 1255 1458 0 0 1722 0,842408934 1‐ predicted RNA 945 14 0 1137 1811 0 0 1822 0,908926514 1‐ predicted RNA 4493 190 83 2598 8234 86 143 3965 0,549463281 1‐ predicted RNA 796 6 33 817 2649 0 24 2257 0,061464436 1‐ MAP0062c 300 885 605 27 461 671 961 33 0,75879874 1‐ MAP0063 967 5983 5527 355 1457 5536 3778 314 0,494661014 1ponA_1 MAP0064 4388 14110 29856 227 4219 24529 29400 250 0,516365554 1‐ MAP0065 1739 1611 3500 66 1226 2384 3084 54 0,513643764 1‐ MAP0066 177 397 937 30 384 927 818 43 0,547360248 1‐ predicted RNA 607 1652 1106 2961 435 1871 1493 2825 0,486974464 1rpsF MAP0067 2759 3074 2179 488 1496 3741 2179 338 0,521667596 1ssb MAP0068 1241 4459 3471 237 1207 4461 3025 210 0,494951877 1rpsR MAP0069 2328 9236 6651 923 3450 9194 8530 1062 0,460146866 1rplI MAP0070 945 3158 2066 181 1084 2774 1805 162 0,51161017 1‐ predicted RNA 1516 458 416 1869 1667 747 569 1881 0,494578124 1‐ predicted RNA 1095 0 0 1265 1309 0 0 1270 0,487821515 1dnaB MAP0071 13247 11652 15543 269 10160 16719 21790 254 0,50837522 1‐ predicted RNA 145 3526 4176 2786 205 4408 3537 2815 0,496055324 1‐ predicted RNA 786 4756 4572 3439 624 3460 4017 2645 0,515080576 1‐ predicted RNA 2761 464 597 1643 2427 629 1045 1363 0,516663703 1

9


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0072c 17555 198193 124904 4292 17580 132173 105434 3194 0,554873707 1‐ predicted RNA 422 32 48 1316 404 46 34 1069 0,376794426 1‐ predicted RNA 1280 114 159 1426 1289 248 136 1250 0,486615522 1‐ predicted RNA 2719 487 398 1589 2335 1673 680 1410 0,509033504 1‐ predicted RNA 3856 1347 575 1692 4805 834 861 1736 0,486161741 1‐ MAP0073c 10318 72148 35790 1740 9801 36513 27918 1116 0,564772698 1‐ predicted RNA 1390 64 20 1477 1175 26 0 1037 0,778077098 1‐ MAP0074 227 137 0 15 0 69 0 1 6,87E‐48 1‐ MAP0075 37 761 268 26 48 449 503 25 0,772270563 1mmpL4_1 MAP0076 288 859 1500 11 302 1021 1111 10 0,49345084 1‐ MAP0077 180 465 636 15 256 1265 1175 28 0,207895391 1‐ MAP0080c 36 0 36 2 170 36 28 8 0,002153315 1‐ MAP0082 127 215 297 13 108 943 361 22 0,179435017 1‐ MAP0083c 48 792 621 35 86 833 659 38 0,443743136 1‐ MAP0084c 358 1300 1402 44 840 1506 1585 61 0,522742578 1LysR MAP0085c 72 292 107 7 0 162 71 2 0,004677428 1‐ MAP0086 0 36 35 0 0 56 39 1 0,345912099 1‐ MAP0087 141 395 144 13 180 394 216 15 0,5233146 1‐ MAP0088 213 848 447 45 221 464 625 39 0,421676277 1‐ MAP0089 354 496 1299 52 216 731 938 39 0,989354366 1‐ MAP0091c 303 309 202 21 251 439 295 20 0,533430987 1‐ MAP0092 25 36 0 1 0 57 0 0 0,085407615 1‐ MAP0093 72 0 158 7 98 55 262 11 0,171536115 1‐ MAP0094 0 0 0 0 36 36 68 7 1 1nuoI_1 MAP0095c 183 1583 1413 68 261 1980 907 66 0,488133249 1‐ MAP0096c 355 144 685 60 313 854 788 74 0,814213595 1‐ MAP0097c 577 627 1364 67 233 859 1205 46 0,931971689 1‐ predicted RNA 110 1463 4782 1927 117 8980 7389 4609 0,533782192 1‐ MAP0099 921 5258 3705 690 1179 7239 7506 1036 0,542714819 1‐ MAP0100 243 1049 1221 62 211 1439 1483 70 0,506908781 1‐ MAP0101 143 357 308 18 70 319 313 13 0,224255417 1‐ predicted RNA 3344 6727 25106 9464 4182 21559 23076 11986 0,533159861 1‐ MAP0102 2096 3933 9607 415 2092 9101 9040 474 0,463717855 1‐ predicted RNA 2115 0 35 1911 2077 0 0 1567 0,50917353 1

10


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 1220 11 67 1259 942 41 0 811 0,849246964 1‐ MAP0103c 2125 22426 31652 1134 2895 54435 41120 1856 0,591017619 1‐ predicted RNA 27708 79 93 11518 23401 35 22 8157 0,552373424 1‐ predicted RNA 17978 96 329 9771 19050 232 256 8707 0,519050196 1‐ predicted RNA 575 1732 4479 2537 314 5490 5911 3740 0,545697296 1‐ predicted RNA 22004 66566 61512 9635 26080 117325 87277 13073 0,551819343 1‐ MAP0104 1599 1104 1271 61 2073 1530 1417 69 0,517431984 1‐ predicted RNA 1582 0 0 1505 1569 35 34 1273 0,491287131 1‐ predicted RNA 6804 34291 24309 8026 9094 40458 26869 9002 0,468911671 1‐ predicted RNA 5226 12 0 4127 5641 71 36 3763 0,491356201 1‐ MAP0105c 2074 2666 3000 46 1713 2664 3273 39 0,498151963 1‐ MAP0106c 931 7100 6708 165 763 7529 6809 158 0,486192031 1‐ MAP0107 108 422 392 32 219 789 578 54 0,243585346 1‐ MAP0108 169 613 678 12 144 238 589 8 0,286458839 1mce1B MAP0109 72 247 251 6 216 283 536 13 0,072039144 1‐ MAP0110 72 52 80 3 72 274 186 6 0,081606407 1‐ MAP0111 108 672 535 14 180 535 462 13 0,51849774 1‐ MAP0112 36 142 36 2 25 141 126 2 0,673421798 1‐ MAP0113 216 204 232 9 147 323 395 9 0,925655562 1‐ MAP0114 108 460 289 18 36 741 442 21 0,400137415 1‐ MAP0115 58 221 126 6 71 241 71 6 0,817470891 1‐ MAP0116 707 1422 1272 37 436 1402 1415 29 0,499856487 1‐ MAP0117 506 1250 747 161 350 638 656 100 0,59185679 1‐ MAP0118 190 163 265 28 283 323 404 40 0,282260602 1‐ predicted RNA 16 1276 452 1757 21 3236 1486 4620 0,054073874 1‐ MAP0119c 72 280 22 6 36 260 156 6 0,959694908 1‐ MAP0120c 36 309 129 13 36 69 36 4 0,00670948 1‐ MAP0121 36 108 57 5 36 72 36 3 0,337342204 1PE_1 MAP0122 69 72 17 10 26 32 48 4 0,021842747 1‐ MAP0123 36 215 90 4 44 107 36 2 0,128960147 1‐ MAP0124 0 110 71 2 0 43 65 1 0,09774388 1‐ MAP0125c 72 178 0 5 72 36 36 3 0,205654323 1‐ MAP0126 114 1117 569 48 130 1421 585 53 0,927989869 1‐ MAP0127 143 180 194 5 36 144 107 2 0,016901825 1

11


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0128c 62 177 174 6 71 347 73 6 0,780583827 1‐ MAP0129 324 785 900 26 601 740 787 30 0,502800005 1‐ MAP0131c 332 299 80 10 28 1394 423 13 0,382801228 1phoY2_1 MAP0132c 72 12 41 4 0 121 62 2 0,166412259 1‐ MAP0133c 655 566 711 22 569 1556 1033 27 0,515925798 1‐ MAP0134c 424 385 952 49 393 711 761 45 0,499456187 1cmaA1 MAP0135 4407 8512 8196 353 3975 7015 6820 278 0,508147236 1‐ predicted RNA 2300 25 0 2074 1517 0 30 1153 0,745932212 1‐ MAP0136 442 2800 1175 127 690 1732 1467 119 0,493319559 1‐ MAP0137c 207 172 149 37 371 298 136 53 0,261292049 1‐ MAP0138c 311 718 461 24 112 407 669 15 0,265210081 1‐ MAP0139c 108 144 400 14 47 438 252 12 0,540012984 1‐ MAP0140 116 1287 1321 71 142 1740 1359 81 0,505679323 1‐ MAP0141 468 2871 1961 61 559 2540 1254 49 0,504034862 1‐ MAP0142c 72 37 60 2 108 106 99 4 0,075132974 1‐ MAP0143 1627 6718 1514 418 1113 36424 7487 1389 0,073287103 1‐ MAP0144 252 504 279 20 178 1146 632 28 0,389066068 1‐ MAP0145 169 929 249 17 305 1263 883 30 0,236250336 1‐ MAP0146 107 33 66 6 36 88 108 4 0,192572789 1‐ MAP0147c 180 108 137 8 144 97 54 5 0,16883366 1‐ MAP0148c 0 0 2 0 0 41 0 1 1,40E‐41 1‐ MAP0149c 439 1065 1596 41 328 988 1220 31 0,643496816 1fadE25_2 MAP0150c 10670 51490 46039 1101 15683 40581 30654 933 0,515596633 1‐ predicted RNA 3438 0 0 3090 4920 27 0 3719 0,529856932 1‐ predicted RNA 366 0 0 789 931 0 0 1686 0,123342777 1‐ predicted RNA 426 36 12 1188 415 24 0 957 0,37472671 1‐ MAP0151c 3770 17886 18876 1097 6626 15592 13545 1038 0,51291326 1‐ predicted RNA 713 0 33 1301 1128 0 36 1724 0,892565379 1‐ MAP0152c 1252 2549 2692 423 1888 1922 1570 387 0,506871364 1‐ MAP0153 1680 2664 2932 83 1862 3266 2800 83 0,484719258 1‐ MAP0154 215 669 250 20 165 386 261 13 0,279258065 1‐ MAP0155 36 36 108 4 0 90 105 3 0,358603642 1‐ MAP0156 180 294 122 24 180 421 349 31 0,321065045 1PE_2 MAP0157 1687 7148 3524 515 2499 7562 3680 566 0,474178329 1

12


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0158 1681 6018 3420 124 1761 7171 4496 136 0,520090684 1‐ MAP0159c 5620 2954 1324 183 2753 2381 1580 93 0,842806857 1‐ MAP0160 2502 27623 11322 1541 3258 18434 12172 1285 0,523653499 1‐ MAP0161 1922 14578 6063 926 2098 11834 5517 780 0,502213533 1‐ MAP0162 425 2206 3426 86 396 3532 3214 94 0,510865023 1‐ MAP0163 2798 7869 3821 201 3359 6420 4201 190 0,483871829 1‐ MAP0164 846 6870 4682 93 968 6174 4845 88 0,49099046 1‐ MAP0165 718 2445 2032 41 639 3133 1623 38 0,501644577 1‐ MAP0166 1303 3167 3210 66 1637 3541 3097 68 0,481008046 1‐ MAP0167 1248 3907 4112 66 1483 5671 4280 75 0,522041932 1‐ MAP0168c 388 108 0 30 292 0 20 18 0,138685141 1‐ MAP0169c 0 143 36 2 36 17 0 1 0,22549507 1sigI MAP0170 126 354 396 13 139 286 281 11 0,308730607 1‐ MAP0171c 97 607 588 13 84 494 501 10 0,369788139 1‐ predicted RNA 817 4994 9164 4231 1080 7975 7120 4391 0,476699158 1gltB MAP0172 15264 47625 68296 368 16786 45859 42289 291 0,53001444 1gltD MAP0173 3441 11241 19065 288 3887 13549 13477 255 0,511491415 1‐ predicted RNA 1138 2718 1372 2771 994 1264 856 1709 0,797749122 1‐ MAP0174 786 2688 1516 449 1126 1646 1057 380 0,506749164 1‐ MAP0175c 1055 356 1288 60 657 929 897 42 0,737545837 1‐ MAP0176 72 284 455 22 0 399 307 15 0,200538705 1‐ MAP0177 313 774 943 27 180 851 642 19 0,613091919 1‐ MAP0178c 155 340 58 7 23 142 144 2 0,012709583 1‐ MAP0179c 234 411 923 33 288 1744 2138 73 0,131834412 1‐ MAP0180 2323 1649 2996 83 1802 8913 4360 120 0,538819739 1menG MAP0181c 560 682 1524 85 462 737 1056 63 0,657134431 1‐ MAP0182c 1282 4431 4329 317 991 3411 3802 242 0,50839728 1‐ MAP0183c 398 512 411 35 488 390 427 33 0,55533309 1‐ MAP0184c 1713 2526 1688 141 2041 2640 2043 147 0,48160378 1‐ MAP0185c 782 2122 2286 176 738 2195 1825 150 0,50815115 1‐ predicted RNA 111 1137 1355 2427 115 1523 1532 2817 0,502856178 1‐ MAP0186c 281 1554 362 52 188 803 252 28 0,190647496 1sodA MAP0187c 5213 156066 81859 4076 6637 153933 85427 4029 0,490083014 1‐ predicted RNA 2564 4180 3090 2299 1655 11506 5879 3144 0,544806762 1

13


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 1648 0 0 1523 1563 13 0 1216 0,492948313 1‐ predicted RNA 11322 723 528 3056 15056 981 288 3395 0,513519273 1‐ MAP0188c 1313 2045 2986 524 1614 3619 3940 667 0,532243859 1‐ MAP0189 652 3001 4878 102 690 2429 2828 71 0,534195824 1glpQ1 MAP0190 372 1102 947 40 465 950 951 38 0,493908015 1‐ MAP0191c 108 249 442 8 252 287 201 9 0,458739355 1‐ MAP0192c 108 534 204 13 108 93 92 6 0,031752133 1pheA MAP0193 499 573 572 29 708 530 424 30 0,500385472 1‐ MAP0194 514 246 1079 44 523 746 914 44 0,496251253 1‐ MAP0195c 48 405 891 42 36 696 854 47 0,43128783 1‐ MAP0196c 1288 2600 2536 69 923 2394 2397 54 0,527029431 1serS MAP0197 360 541 465 17 252 426 232 10 0,232190237 1‐ MAP0198c 32 287 250 8 121 36 251 8 0,914125012 1‐ MAP0199 78 286 156 12 0 263 98 6 0,053247191 1‐ MAP0200c 0 0 82 1 0 108 47 3 0,2481869 1‐ MAP0201 0 36 36 1 36 0 0 1 0,372080896 1‐ MAP0202 208 353 430 9 276 270 180 7 0,373441507 1‐ MAP0203c 128 358 703 45 190 487 802 54 0,397462387 1‐ MAP0204c 1373 3093 4083 76 1863 3103 2831 71 0,491134384 1‐ MAP0205 547 738 1546 54 642 1748 2388 78 0,525672476 1‐ MAP0206 1099 2245 3713 124 1393 4957 3836 160 0,533301224 1‐ MAP0207 393 1360 1399 51 438 2025 1540 60 0,519936537 1‐ MAP0208 129 294 431 14 116 594 330 14 0,836069461 1csp MAP0209c 3066 11119 8643 185 1494 5572 4899 90 0,852053241 1pirG MAP0210c 870 3898 4531 113 2236 17111 12622 350 0,098619203 1glf MAP0211 3255 4558 6547 181 2235 6377 6964 161 0,491223056 1‐ MAP0212 1475 5803 6146 89 2057 6437 5265 91 0,480358937 1‐ MAP0213 419 1251 2424 103 183 1934 1674 81 0,502511583 1‐ MAP0214 640 2575 3695 92 959 3470 3272 101 0,517758241 1‐ MAP0215 1432 4521 5703 78 884 5092 4297 61 0,50395285 1fbpA MAP0216 10398 12464 14927 591 10070 16198 13280 542 0,51253015 1fbpC1 MAP0217 2697 10899 7372 300 2967 11042 6834 283 0,485166933 1‐ MAP0218 1308 4671 5638 146 780 7168 6244 153 0,483722771 1‐ predicted RNA 53 3566 4029 2481 68 3154 3638 2204 0,510697951 1

14


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 1170 26 0 1270 1034 0 0 936 0,779995816 1‐ predicted RNA 4324 42 91 3140 3409 105 43 2089 0,531549307 1fadD32 MAP0219 7704 30660 25790 432 6256 25396 19725 325 0,54427073 1pks13 MAP0220 8045 57207 54692 262 9273 53172 40084 220 0,52178396 1accD4_1 MAP0221 4034 13447 13732 258 3993 14411 11608 232 0,506584025 1‐ MAP0222c 463 284 195 22 728 285 164 27 0,784535977 1‐ MAP0223c 36 144 196 5 144 144 87 7 0,318906809 1fadE35 MAP0224c 395 1918 1319 25 535 1576 1193 23 0,486595279 1‐ MAP0225c 0 247 145 3 36 61 72 2 0,12032077 1‐ MAP0226 173 0 35 6 99 32 0 3 0,047996538 1‐ MAP0227c 133 169 182 15 0 759 391 21 0,216273517 1embB MAP0228c 2385 2994 4513 48 1679 3918 4405 40 0,497168509 1embA MAP0229c 1074 2277 3071 26 961 2863 2831 25 0,506818556 1embR_1 MAP0230 265 888 374 18 330 269 320 13 0,318027793 1‐ MAP0231c 238 1112 789 39 539 1067 653 46 0,569072823 1embC MAP0232c 1438 4011 2733 34 1596 3450 2067 29 0,501021259 1‐ MAP0233c 450 1163 1769 21 602 1222 1838 22 0,484406878 1‐ MAP0234c 557 3010 3667 113 914 2938 3464 117 0,508651726 1‐ MAP0235c 1584 1784 2576 68 1267 1957 2570 57 0,518296559 1‐ MAP0236c 103 280 255 23 109 420 252 26 0,725128922 1‐ MAP0237c 603 2642 1705 132 827 1805 988 104 0,503561554 1‐ MAP0238c 193 499 628 20 320 664 501 22 0,558481342 1‐ MAP0239c 348 1823 2082 61 834 2643 2463 88 0,53040994 1rfbE MAP0240c 462 1955 2265 63 739 1979 2147 67 0,509433127 1‐ MAP0241c 929 1341 1790 77 987 1643 1542 72 0,499024851 1‐ MAP0242c 813 14770 9071 523 982 10678 7623 408 0,508197846 1‐ MAP0243c 2283 5636 8888 113 2001 7185 8791 109 0,485237383 1‐ MAP0244 1192 7547 5667 143 1783 4316 3908 109 0,502294882 1‐ MAP0245c 695 2583 2131 72 949 2745 2137 76 0,507430468 1‐ MAP_t04 72 34 105 43 36 140 36 30 0,280945863 1‐ MAP0246c 432 141 230 15 108 1428 642 20 0,587884973 1‐ MAP0247c 189 2350 1794 249 267 7275 3036 554 0,518596893 1lipE MAP0248c 603 855 1028 31 504 1910 1392 37 0,520793401 1echA21 MAP0249c 603 1177 989 50 837 1844 846 59 0,519837802 1

15


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0250 467 528 463 42 204 335 481 23 0,187869645 1‐ MAP0251c 1042 7538 6764 387 1048 7970 7137 388 0,479459008 1hisC2 MAP0252c 3034 10964 12312 314 3184 11864 11941 304 0,488504117 1‐ MAP_t05 273 2247 1521 525 385 1319 1361 420 0,506529776 1‐ MAP_t06 122 900 2212 500 144 1801 2721 688 0,521668417 1‐ MAP0253 958 6324 2502 99 1299 4003 3317 90 0,492096088 1‐ MAP0254c 485 708 721 96 159 567 549 49 0,164197787 1‐ MAP0255c 489 2770 1605 55 983 2573 2592 72 0,527404807 1‐ MAP0256 445 928 952 35 377 1263 1121 36 0,491400999 1‐ MAP0258 396 1039 359 170 187 6014 1558 490 0,049896817 1‐ MAP0259 432 1433 1848 64 235 1936 1562 55 0,488379182 1‐ MAP0260 320 393 471 12 443 569 773 17 0,620840077 1‐ MAP0261c 1309 18275 6304 586 1582 10477 6286 426 0,516204474 1‐ MAP0262 2151 2608 3214 68 2122 4374 3580 72 0,484380619 1‐ MAP0263c 269 333 308 15 419 346 399 19 0,387721308 1‐ MAP0264c 60 401 284 14 72 622 174 15 0,776248915 1fadE1_1 MAP0265c 286 804 845 20 133 687 644 13 0,293266835 1‐ MAP0266c 108 321 791 19 169 484 315 16 0,379116384 1‐ MAP0267c 176 754 319 15 153 671 616 16 0,66748868 1‐ MAP0268c 108 1218 633 32 71 760 604 22 0,318889623 1‐ MAP0269 61 486 211 14 0 251 60 4 0,001591406 1fadE36 MAP0270 741 1006 1227 44 901 1076 1412 47 0,514767678 1proX MAP0271 389 644 894 27 386 1478 1445 39 0,9191399 1‐ MAP0272 36 0 36 5 43 139 66 12 0,083763285 1‐ MAP0273 0 71 71 1 0 144 106 2 0,204327384 1proW MAP0274 97 36 78 6 108 288 43 8 0,25000695 1proZ MAP0275 179 69 151 11 107 133 3 5 0,058693186 1‐ MAP0276 973 4897 4126 204 967 4395 4088 185 0,494364781 1tyrA MAP0277c 896 722 641 43 970 725 867 43 0,483997599 1‐ MAP0278 428 2250 1603 100 1151 1788 1695 126 0,521797564 1‐ MAP0279 85 291 420 21 269 141 392 28 0,317920733 1celA MAP0280 441 636 1070 32 464 890 587 27 0,529996133 1‐ MAP0281 1167 2184 2736 186 868 4030 3437 206 0,521635351 1‐ MAP0282c 2770 18788 14796 541 5444 29432 20080 802 0,55565919 1

16


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 178 2516 3960 2203 369 3611 3189 2359 0,509392843 1‐ MAP0283c 309 2892 1530 105 593 2355 2157 119 0,514032471 1‐ MAP0284c 1997 13807 7566 171 2645 11956 10929 185 0,469360601 1‐ MAP0285c 1313 1398 1202 60 876 1392 1388 45 0,509405487 1‐ MAP0286 165 1574 919 116 300 1385 1113 126 0,504150039 1‐ MAP0287 210 410 261 15 186 464 327 14 0,531342902 1‐ MAP0288 0 65 88 5 21 99 27 5 0,868558672 1‐ MAP0289 0 2 16 0 36 36 91 1 4,92E‐42 1‐ MAP0290 144 179 36 13 107 107 36 8 0,170555863 1‐ MAP0291 0 147 72 4 47 72 112 6 0,284295002 1‐ MAP0292 286 385 463 15 108 531 616 12 0,376452302 1‐ MAP0293 108 465 395 13 215 395 214 12 0,521658349 1pca MAP0294c 637 6483 4221 37 1403 4352 3571 34 0,495423268 1gltA1 MAP0295c 90 394 392 9 0 182 212 3 0,006474568 1‐ MAP0296c 161 36 179 8 58 17 0 1 7,40E‐06 1‐ MAP0297c 215 503 277 9 0 72 84 1 8,94E‐28 1‐ MAP0298 180 250 394 8 144 429 485 8 0,941872262 1‐ MAP0299c 180 317 36 10 72 777 131 11 0,473604738 1‐ MAP0300 333 1359 1325 29 467 1559 1362 32 0,519323638 1‐ MAP0301 768 1718 1708 86 557 2080 1438 72 0,500321727 1‐ MAP0302c 72 294 356 7 323 323 190 12 0,200192474 1‐ MAP0303c 277 1134 1031 31 286 1112 1224 32 0,496095051 1‐ MAP0304c 294 663 500 30 288 888 566 31 0,924894211 1‐ MAP0305c 270 1143 1594 28 299 1448 1329 27 0,486470901 1gshA MAP0306c 271 1492 1019 25 330 1667 1201 28 0,513301008 1‐ MAP0307c 820 4703 3683 157 1893 5035 4064 200 0,533628822 1‐ MAP0308c 104 354 361 19 148 393 358 21 0,493294203 1‐ MAP0309c 378 213 179 16 371 106 356 14 0,433321487 1asd MAP0310c 822 2916 2859 82 951 1573 1274 52 0,593468731 1ask MAP0311c 2559 8905 7342 195 2731 6375 5467 151 0,505413619 1‐ predicted RNA 825 0 0 1160 753 0 0 889 0,78749147 1leuA MAP0312 2734 9748 10324 173 2151 8978 7067 128 0,516827377 1dnaQ MAP0313c 711 3485 1670 75 726 1503 1445 49 0,602489078 1‐ MAP0314 354 698 341 16 257 505 179 9 0,242203452 1

17


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



cobQ2 MAP0315 160 626 573 25 165 541 541 22 0,418330403 1recR MAP0316c 196 940 844 39 335 791 597 37 0,511780486 1‐ MAP0317c 275 1678 1088 104 295 1331 622 76 0,829209593 1‐ MAP0318 825 602 1567 63 1821 4422 3208 161 0,177127935 1‐ MAP0319c 481 3638 1995 164 1395 2682 2239 198 0,525461325 1‐ MAP0320 2219 3790 4606 110 2729 5166 4587 120 0,476512073 1‐ MAP0321 1435 4410 5094 109 1508 4676 5415 109 0,487961574 1dnaZX MAP0322c 755 3430 3194 49 1250 2569 2481 45 0,507460767 1‐ MAP0323c 1632 4391 3801 105 2096 3821 2874 95 0,495762556 1‐ MAP_t08 329 750 558 277 360 628 615 258 0,58867211 1‐ MAP0324 4031 14313 16168 530 3765 15459 12474 455 0,516950591 1‐ MAP0325c 373 1584 347 81 615 1007 656 87 0,504712413 1‐ MAP0326 0 35 58 1 21 35 131 4 0,076618104 1‐ MAP0327 218 1392 573 15 354 827 784 15 0,502296267 1‐ MAP0328 108 142 166 4 72 35 106 2 0,066574074 1‐ MAP0329c 0 0 12 0 36 0 0 2 2,97E‐15 1‐ MAP0330 108 1620 966 22 310 760 644 16 0,971973409 1‐ MAP0331 72 283 507 9 371 447 562 17 0,139199795 1‐ MAP0332 220 306 755 17 131 328 485 11 0,27317767 1‐ MAP0333 311 440 346 28 72 1486 504 33 0,618080029 1‐ MAP0334 460 5432 2036 89 448 5179 3338 96 0,516881942 1‐ MAP0335 220 222 239 20 72 437 279 15 0,265306418 1‐ MAP0336c 348 1046 397 21 354 502 572 17 0,845502787 1‐ MAP0338c 1400 5801 2475 76 1479 5757 3740 79 0,484674124 1‐ MAP0339c 668 1779 1699 27 325 2288 1724 23 0,497586498 1‐ MAP0340c 402 2866 2183 62 307 2690 2125 54 0,503060157 1ligC MAP0341 144 629 418 13 165 527 373 12 0,404220285 1‐ MAP0342c 208 215 212 31 224 284 216 31 0,992454602 1‐ MAP0344c 317 822 1018 23 269 1041 698 19 0,666451457 1‐ MAP0345c 180 305 451 15 264 344 136 13 0,404947254 1‐ MAP0346c 280 2397 3633 146 77 2359 2695 109 0,512888352 1‐ MAP0347c 389 2740 2273 46 452 3046 2966 53 0,515300188 1‐ MAP0348c 72 360 212 9 72 215 47 4 0,079187252 1‐ MAP0350 63 283 38 6 0 85 90 2 0,004556365 1

18


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0351 216 300 144 19 123 215 469 17 0,494499786 1‐ MAP0352c 252 548 514 19 459 734 656 26 0,547506286 1glpK MAP0353 462 1184 755 22 611 1306 694 23 0,488131615 1‐ MAP0354c 249 441 274 21 252 483 489 23 0,437476265 1‐ MAP0356c 312 1872 2066 57 396 3083 1948 69 0,51854544 1‐ MAP0357 300 1140 1187 33 322 1359 791 29 0,493459053 1‐ MAP0358c 267 178 324 10 291 235 256 9 0,440681311 1moxR2 MAP0359c 647 1376 1661 52 458 1424 1419 41 0,504031931 1‐ MAP0360c 555 888 1074 33 1046 1134 1154 45 0,522181724 1‐ MAP0361c 72 654 1001 29 231 781 837 34 0,785242331 1‐ MAP0362c 464 2037 2460 48 523 1888 1552 38 0,501495921 1‐ MAP0363 303 5393 6279 278 635 6863 5745 306 0,518097222 1‐ MAP0364c 73 177 53 2 76 0 71 1 0,13348775 1‐ MAP0365c 108 220 108 6 0 72 167 2 0,005347147 1‐ MAP_t09 0 199 120 35 36 58 50 22 0,225598396 1selD MAP0366 71 159 92 5 72 142 72 4 0,601196875 1‐ MAP0367 1576 9640 5362 345 2246 7954 5471 332 0,481828001 1‐ MAP0368 836 2602 2655 30 981 2963 3085 33 0,513857855 1‐ MAP0369 127 462 268 11 144 397 285 10 0,577933302 1‐ MAP0370 102 160 179 6 36 189 0 2 0,009872592 1‐ MAP0371 252 1516 197 25 289 3622 1266 55 0,147319657 1‐ MAP0373 937 459 275 54 492 3811 1312 90 0,778889555 1‐ MAP0374c 1251 2571 1506 116 1126 10597 4555 253 0,808216285 1‐ MAP0375c 569 1620 2549 27 909 2292 2406 32 0,5167148 1‐ MAP0376c 429 1362 868 58 540 752 948 51 0,491227087 1‐ MAP0377c 265 191 209 30 382 698 194 45 0,306895506 1‐ MAP0378c 100 360 322 26 324 255 393 39 0,241629261 1rsbR MAP0379c 1008 5118 2960 125 1700 4071 2364 120 0,487216369 1‐ MAP0380 2561 7292 7507 633 3061 8347 8901 696 0,465869129 1‐ predicted RNA 1360 0 0 1294 1432 0 0 1144 0,486566847 1‐ MAP0381 174 681 558 34 108 665 778 33 0,640153483 1‐ MAP0382c 284 71 27 15 36 1170 572 27 0,173854415 1‐ MAP0383 0 1 0 0 0 115 13 3 1 1‐ MAP0384 144 97 0 18 0 425 34 13 0,40300453 1

19


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0385 73 144 71 7 92 108 106 7 0,922149725 1‐ MAP0386c 171 388 764 25 180 422 526 21 0,386321637 1‐ MAP0387 258 1331 936 55 216 1437 1269 58 0,504732333 1‐ MAP0388 324 861 740 22 612 817 929 28 0,811662591 1‐ MAP0389 899 359 371 36 601 216 337 21 0,501567214 1‐ MAP_t10 144 439 751 229 72 325 404 126 0,128601291 1‐ MAP0390c 262 1235 1520 33 461 1562 1330 37 0,518794986 1‐ MAP0391c 1509 3836 3240 127 1333 2546 2274 88 0,530877278 1ponA_2 MAP0392c 3645 15417 18156 190 4322 16926 15426 181 0,509583454 1‐ predicted RNA 1070 15456 12735 4572 2490 16714 9979 4697 0,482425113 1whiB4 MAP0393 587 5877 4022 338 541 4701 3186 263 0,514199394 1‐ MAP0394c 1432 3819 5290 122 970 4719 4046 99 0,502172518 1‐ MAP0395c 2022 10563 9596 264 2343 13209 8042 265 0,476925705 1‐ MAP0396 879 1254 1189 111 658 729 847 70 0,997253201 1‐ MAP0397 724 933 1070 54 1230 1089 790 64 0,518422715 1‐ MAP0398c 4913 21111 18764 835 4855 26177 25633 965 0,521898183 1‐ predicted RNA 1634 7708 18584 5964 1195 19146 25728 8904 0,549260131 1nth MAP0400 318 2160 2124 67 1188 2772 2443 105 0,539362152 1‐ MAP0401 963 1599 1885 99 965 3256 1589 109 0,511484011 1‐ MAP0402 553 769 896 42 450 1356 1239 46 0,515265689 1‐ MAP0403 426 1215 1595 35 629 2106 1499 44 0,520453145 1ephE MAP0404c 237 718 604 21 470 468 532 23 0,976028538 1‐ MAP0405c 1105 2829 1257 141 944 1591 1056 95 0,539933569 1‐ MAP0406 1233 2625 1824 121 1091 2979 2849 125 0,508826721 1acs MAP0407c 736 2383 1604 32 822 3651 2483 42 0,529484632 1‐ MAP0408 180 394 370 25 205 143 285 18 0,296128873 1dppA MAP0409 574 501 372 16 507 363 608 14 0,631820086 1dppB MAP0410 160 312 285 12 330 746 398 21 0,193734466 1dppC MAP0411 72 71 323 7 72 258 270 8 0,670432239 1dppD_1 MAP0412 180 623 895 13 435 453 640 13 0,90041898 1‐ MAP0413 1021 497 319 54 2581 537 144 100 0,982824119 1‐ predicted RNA 43011 2490380 550555 161100 225816 745312 473734 93778 0,583498955 1‐ predicted RNA 1503 0 64 1333 3637 0 0 2670 0,876742521 1‐ predicted RNA 37133 6603 1544 6964 191111 2027 897 28369 0,064626414 1

20


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0414c 641 1906 2586 78 586 3017 2237 79 0,494547016 1‐ MAP0415 72 192 85 4 0 36 179 2 0,029026876 1trbB MAP0416 51 189 106 4 36 0 118 2 0,015625885 1‐ MAP0417 36 106 108 4 0 142 108 3 0,407005718 1‐ MAP0418 14 107 72 3 17 106 36 3 0,466612487 1‐ MAP0419 7 0 0 1 22 0 0 2 0,044241084 1‐ MAP0420 36 0 0 4 0 0 0 0 0 1‐ MAP0421c 646 2436 1869 62 610 2556 1940 58 0,498762488 1‐ MAP0422c 216 1075 744 10 356 1552 1031 15 0,908212395 1‐ predicted RNA 57578 189535 209395 47157 120858 377033 239816 74109 0,598548722 1cspA_1 MAP0423 18222 51469 57752 8367 33628 123138 84925 14529 0,580707719 1‐ MAP0424 800 2639 2256 127 1123 2093 2590 132 0,505124018 1‐ predicted RNA 57 18563 12499 8732 225 19526 14552 9534 0,477444332 1‐ predicted RNA 85853 1368 1981 9471 165249 2710 1342 15247 0,588510464 1topA MAP0425 2244 10667 8161 93 2495 9324 8947 89 0,484030397 1‐ MAP0426c 774 1481 1305 32 842 1442 1138 29 0,493791069 1‐ MAP0427 686 3918 3511 80 918 2325 3239 67 0,51679979 1‐ MAP_t11 36 314 85 69 0 221 193 56 0,536506122 1‐ MAP0428 516 3872 2184 65 450 4012 2617 65 0,498483924 1‐ MAP0429c 178 320 338 7 288 441 349 8 0,382671751 1rmlB2 MAP0430 927 1438 1242 59 1487 1738 1467 75 0,521777084 1‐ MAP0431c 842 1825 1436 176 796 2387 1522 175 0,495445475 1‐ MAP0432c 1086 2734 3361 139 675 4328 5222 164 0,527624069 1‐ MAP0433c 233 1640 1347 28 426 1301 1128 27 0,4863067 1‐ MAP0434 1727 1139 1823 80 1365 6011 4866 134 0,569039543 1ppa MAP0435c 1368 6357 6054 348 1664 6326 4198 304 0,494282375 1‐ predicted RNA 204 2667 2716 2928 342 3384 2223 3067 0,508977534 1‐ MAP0436 1000 2593 2435 60 662 3027 2298 51 0,516263973 1‐ MAP0437 701 1020 934 39 771 1026 1043 38 0,483473725 1mesJ MAP0438 238 488 543 18 127 382 196 9 0,082120351 1hpt MAP0439 1137 1779 1038 106 1315 1314 955 95 0,503088514 1lpqG MAP0440c 279 501 499 25 498 1765 1045 54 0,135990415 1PE_3 MAP0441 0 0 0 0 36 124 45 8 1 1‐ MAP0442 72 35 73 2 72 72 188 3 0,312299462 1

21


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0443c 235 547 598 12 252 706 598 12 0,478179495 1‐ MAP0444c 529 1673 1908 53 891 1995 1426 57 0,511166093 1‐ MAP0445c 756 4054 3174 82 1755 3225 2408 87 0,479773998 1ephA MAP0446c 524 2134 1867 58 1012 2230 1163 61 0,508627588 1‐ MAP0447 36 537 369 24 69 216 464 21 0,406976601 1‐ predicted RNA 511 1405 4077 2557 804 3285 3851 3243 0,533924026 1ftsH MAP0448 4217 23451 29760 284 4780 26214 21807 253 0,517284286 1folE MAP0449 676 2105 2177 106 1151 2199 1851 116 0,511578798 1folP MAP0450 205 3510 3063 90 422 3934 2740 95 0,507356789 1folX MAP0451 385 635 720 65 449 914 541 65 0,497154027 1folK MAP0452 134 695 709 33 286 1086 765 47 0,526595246 1‐ MAP0453 34 397 742 27 72 497 468 24 0,422962879 1‐ MAP0454 1051 4421 2624 75 1005 3743 2333 62 0,513787085 1panC MAP0456 158 2673 1672 52 107 1235 1403 31 0,604917277 1panD MAP0457 373 3882 3952 212 143 2302 1902 105 0,517417057 1‐ MAP0458 137 2950 3462 85 97 1717 1187 38 0,167153642 1lysS MAP0459 1159 2478 3917 69 1141 2937 3339 62 0,49793739 1lsr2 MAP0460 1287 12516 5570 652 1360 10599 6833 614 0,486861982 1‐ predicted RNA 1734 51 19 1578 1744 36 33 1335 0,497831759 1clpC MAP0461 12246 97434 80841 869 15793 82565 61328 731 0,503007492 1‐ predicted RNA 1607 2 51 1502 2813 4 0 2184 0,532295976 1‐ predicted RNA 559 11 0 1299 809 0 0 1569 0,650028318 1‐ MAP0462 75 266 111 28 180 182 108 35 0,437766553 1‐ MAP0463 190 215 233 14 66 262 119 7 0,078532767 1‐ MAP0464 70 35 72 6 13 0 71 2 0,01068193 1‐ MAP0465 1862 2917 2475 79 2487 2549 2585 82 0,483399591 1lpqF MAP0466c 1351 2239 3154 76 1291 2288 2149 61 0,522188046 1‐ MAP0467c 1886 7113 8567 690 2290 7075 6884 629 0,489658391 1‐ MAP0468 278 308 346 19 302 212 178 14 0,352357574 1mutY MAP0469c 179 611 405 17 142 586 446 15 0,407606524 1‐ MAP0470 1260 13066 20155 621 1351 38365 25740 1080 0,573848148 1‐ MAP0471 4298 21604 12233 572 3406 11810 10272 374 0,527241826 1‐ predicted RNA 514 0 11 1116 285 0 0 516 0,047059352 1‐ MAP0472c 1268 2370 1377 73 885 1581 1548 51 0,520886656 1

22


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



radA MAP0473c 381 840 811 20 714 498 595 21 0,501653093 1lpqE MAP0474c 1383 2239 1644 148 2378 1510 1830 173 0,528294255 1‐ MAP0475 31438 66019 133924 6339 32936 105876 119794 6492 0,502213458 1‐ predicted RNA 20061 328 612 6397 22915 457 552 6143 0,504538386 1‐ predicted RNA 6163 113 274 2451 5993 92 0 1971 0,501298179 1‐ predicted RNA 6482 84 107 1245 4550 137 47 737 0,701227452 1ispD MAP0476 888 3650 9128 229 539 7083 6642 214 0,489706983 1ispF MAP0477 108 126 54 11 0 215 178 8 0,36771525 1cysS MAP0478 1853 5921 6584 133 1976 6142 5994 124 0,485765944 1‐ MAP0479 561 2163 2156 66 502 2497 2224 65 0,496667972 1‐ MAP0480 216 1147 1719 40 251 1607 1866 46 0,518652789 1‐ MAP0481c 145 12 47 3 73 14 48 1 0,04539719 1‐ MAP0482 0 1434 580 13 50 421 569 7 0,210949043 1absR2 MAP0483 141 618 404 13 35 598 336 8 0,255207301 1arsB2 MAP0484c 144 251 379 8 160 223 240 7 0,289501008 1‐ MAP0485c 341 462 677 24 245 702 628 21 0,808796525 1‐ MAP0486c 144 642 430 20 124 428 524 17 0,388244016 1‐ MAP0487c 179 217 178 11 160 501 285 13 0,330629121 1‐ MAP0488c 136 148 35 7 135 143 252 9 0,440034103 1‐ MAP0489c 158 347 95 10 102 246 158 7 0,216620593 1‐ MAP0490 354 575 953 22 270 574 554 15 0,469804604 1‐ MAP0491c 251 1479 1166 46 495 1141 898 45 0,490656183 1fadE34 MAP0492 146 392 449 6 123 372 320 4 0,319788646 1‐ MAP0493c 144 320 398 20 72 356 215 13 0,158704279 1‐ MAP0495c 1387 1871 1563 142 2106 2285 1838 174 0,533100782 1‐ MAP0496c 132 440 562 13 194 328 213 9 0,304047624 1‐ MAP0497 386 1581 1298 35 540 1598 922 33 0,483811497 1‐ MAP0498 270 2385 3662 80 457 3392 2497 80 0,498275978 1‐ MAP0499 326 1243 1479 42 84 1304 1282 30 0,784462393 1‐ MAP0500 352 251 328 30 427 428 532 37 0,566149269 1nhoA MAP0501 0 108 328 5 60 206 239 7 0,302939917 1aspB MAP0502c 36 169 103 3 243 107 102 7 0,026264719 1fadE33 MAP0503c 164 455 406 14 144 281 287 10 0,243741803 1fadE32 MAP0504c 108 294 444 11 23 225 90 3 0,002215839 1

23


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



fadE31 MAP0505c 0 761 932 15 125 606 548 13 0,404586477 1fadD3_1 MAP0506c 40 287 125 4 281 170 29 7 0,094198679 1fadE30 MAP0507 287 1720 1231 33 355 733 662 20 0,60002952 1‐ MAP0508 0 414 261 8 108 178 162 8 0,954459399 1‐ MAP0509 466 2208 2162 97 363 2252 2393 93 0,497615752 1fadA6_1 MAP0510 189 2052 1099 32 306 1097 702 22 0,990346431 1‐ MAP0511c 78 248 279 10 143 108 154 8 0,567561369 1‐ MAP0512c 72 180 143 8 180 102 69 10 0,548938274 1‐ MAP0513c 214 579 712 18 118 567 481 12 0,285295495 1‐ MAP0515c 108 784 676 20 144 573 235 13 0,26319628 1echA20 MAP0516c 90 329 580 16 68 252 330 10 0,161495084 1‐ MAP0517 257 1080 1521 44 360 1088 1287 42 0,490386912 1‐ MAP0518 144 1207 570 24 180 653 816 21 0,777226932 1‐ MAP0519c 0 466 254 16 0 466 204 14 0,837965799 1‐ MAP0520c 0 106 52 3 36 19 113 5 0,32205394 1fadA5 MAP0521c 278 1082 492 21 252 252 232 10 0,122279217 1‐ MAP0522 286 4977 2211 64 349 3333 1545 45 0,522908936 1fadE28 MAP0523 75 1456 949 24 217 945 468 17 0,650261228 1fadE29 MAP0524 150 3664 2840 60 121 3034 1751 42 0,518798907 1ltp2_1 MAP0527 108 626 974 17 395 631 877 22 0,70804596 1‐ MAP0528 36 72 13 2 72 173 72 5 0,041835425 1ufaA2 MAP0529c 36 842 573 17 283 504 639 22 0,38550066 1‐ MAP0530c 390 1390 1163 22 231 784 999 14 0,751045161 1‐ MAP0531 217 1463 1256 44 208 1097 781 30 0,941090498 1‐ MAP0532 681 2865 3106 90 886 2093 1350 63 0,525364138 1‐ MAP0533 383 3619 2379 68 277 3287 2171 57 0,510671556 1‐ MAP0534 374 1496 1298 132 419 1265 1287 121 0,485329553 1‐ MAP0535 401 3312 2640 64 661 2492 1845 53 0,511634343 1‐ MAP0536 349 1759 1276 53 649 1698 1370 61 0,519645627 1‐ MAP0537 421 771 1148 29 324 784 1077 24 0,550913349 1‐ MAP0538c 108 177 223 17 158 71 107 13 0,56751507 1‐ MAP0539 653 71 108 23 538 72 0 15 0,289857114 1‐ MAP0540 108 679 510 29 105 426 642 26 0,410347384 1‐ MAP0541c 179 395 418 34 130 390 443 29 0,395087075 1

24


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0542c 144 711 553 14 133 693 626 14 0,060951308 1‐ MAP0543c 108 397 538 12 144 407 252 9 0,338030851 1‐ MAP0544c 192 962 569 20 516 745 408 24 0,98046494 1‐ MAP0545 511 2987 2768 72 838 2767 1832 65 0,506543495 1‐ MAP0546c 499 1955 1190 65 438 1479 953 49 0,599320679 1‐ MAP0547 115 1467 467 18 427 676 574 19 0,648112604 1‐ MAP0548c 108 179 96 7 56 142 144 5 0,23487901 1echA19 MAP0549c 703 2863 2085 89 862 2389 2217 85 0,501847586 1fadD19_1 MAP0550 406 3722 1632 40 751 2584 1293 35 0,504347703 1‐ MAP0551 0 36 79 1 36 0 0 1 0,351354379 1‐ MAP0552 180 383 263 14 252 212 262 14 0,445607821 1ilvX MAP0553 129 342 384 9 179 337 382 9 0,818345921 1‐ MAP0554c 102 320 286 12 150 293 387 14 0,344070082 1‐ MAP0555c 0 0 0 0 0 0 24 1 1 1fadD17 MAP0556c 0 0 0 0 14 0 21 0 1 1‐ MAP0557c 0 0 0 0 0 0 0 0 1 1‐ MAP0558c 57 430 280 10 74 104 125 5 0,044857676 1fadE26_1 MAP0559c 296 1294 596 24 380 929 644 21 0,498580927 1fdxD MAP0560 527 11703 6271 1024 689 8431 5139 789 0,503448107 1fabG MAP0561 1474 4956 5500 168 1916 4837 3970 152 0,492410971 1‐ MAP0562 1243 1036 995 79 1031 1927 1550 81 0,492700143 1‐ MAP0563 787 2951 2759 99 856 5251 4384 141 0,543922963 1mce4 MAP0564 1044 1835 1540 59 670 1837 2915 58 0,496876664 1‐ MAP0565 982 2943 3321 91 825 4159 3786 96 0,480780375 1‐ MAP0566 1126 2285 1937 74 559 2854 2909 68 0,507531925 1‐ MAP0567 924 2295 2099 52 947 2868 3493 63 0,527071864 1lprN MAP0568 842 1118 1576 47 541 1837 1937 45 0,494370615 1‐ MAP0569 830 966 1469 32 537 1833 1756 31 0,491015943 1‐ MAP0570 1750 815 1950 116 1528 2023 2748 123 0,511171588 1‐ predicted RNA 348 0 0 1126 314 0 10 864 0,255356491 1‐ MAP0571 792 739 848 84 577 1821 1770 104 0,521079102 1‐ MAP0572c 1516 9339 5957 350 2552 9156 6471 386 0,468547306 1otsA MAP0573c 1357 5285 3453 89 1578 4282 3114 78 0,498188047 1‐ predicted RNA 666 8547 8297 4489 1235 8001 5227 3803 0,496406778 1

25


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0575 144 546 384 17 213 429 414 18 0,952218313 1echA13 MAP0576 259 2094 1455 46 324 996 865 28 0,792274482 1‐ MAP0577 69 572 356 13 250 465 180 15 0,493793219 1‐ MAP0578 226 144 253 14 332 108 36 13 0,448125311 1cpsA MAP0579c 1296 3671 5484 87 1391 6798 6414 108 0,528311809 1‐ MAP0581c 340 713 712 17 428 569 673 16 0,502190888 1bpoA MAP0582 214 872 647 28 294 534 567 24 0,668898056 1‐ MAP0583 593 1318 1623 73 713 1631 1645 78 0,513441516 1‐ MAP0584 2143 1466 1551 212 740 12039 5065 392 0,723439088 1‐ MAP0585 1085 911 1250 55 252 8585 3327 118 0,793387298 1‐ MAP0586c 791 2838 2338 82 384 2100 1367 47 0,891739314 1‐ MAP0587 384 1020 890 67 545 732 968 67 0,49457607 1‐ MAP0588 989 2534 1813 39 581 2272 2715 34 0,50939819 1‐ MAP0589c 753 2150 1350 50 412 2462 1718 44 0,499689794 1‐ MAP_t12 0 188 171 50 0 300 266 78 0,137743619 1‐ MAP0590 344 72 11 16 467 19 89 18 0,412363831 1phoP MAP0591 939 12605 9120 346 1151 11004 7400 295 0,499356855 1phoR MAP0592 2099 4417 5705 119 1367 4298 3434 79 0,54660607 1‐ MAP0593c 1416 4855 4194 339 1878 4780 4505 355 0,485130549 1‐ MAP0594c 350 2301 2321 142 640 1641 1879 128 0,498468949 1adhB MAP0595c 1506 13968 7657 234 1859 10419 5614 183 0,507891946 1‐ predicted RNA 109 14720 7895 6038 466 13278 7478 5662 0,488375866 1‐ MAP0596c 108 5139 3494 164 474 3947 4046 169 0,489802808 1‐ MAP0597c 78 1230 768 107 96 911 645 85 0,528778968 1‐ MAP0598c 770 4187 3086 72 631 3206 2231 52 0,532654415 1‐ MAP0599c 96 1577 688 30 183 636 502 19 0,276836061 1‐ MAP0600c 144 1639 858 24 180 644 671 14 0,273771665 1aldA_1 MAP0602 287 1068 641 17 72 1106 204 9 0,177680308 1‐ MAP0603 394 2234 1559 67 250 1202 716 34 0,214545313 1‐ MAP0604 108 2637 1472 50 366 1889 1581 50 0,484999676 1‐ MAP0605 108 736 501 36 108 542 425 28 0,359331051 1purD MAP0606 71 461 649 10 283 418 418 12 0,408210984 1ggtA MAP0607c 378 1649 1515 27 446 1575 1552 26 0,484678154 1‐ MAP0608c 180 719 420 17 282 567 355 17 0,69430643 1

26


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0609 128 1675 1031 50 163 1270 1648 55 0,506301653 1‐ MAP0610c 61 54 84 4 72 18 36 3 0,40601019 1purB MAP0611 540 2916 2101 47 550 2498 1583 38 0,508772685 1‐ MAP0612 855 3811 3915 85 735 3303 3095 67 0,520412403 1‐ MAP0613c 216 63 71 13 177 108 42 10 0,33707308 1hemH MAP0614 749 1359 1007 54 1277 1545 1001 67 0,520184266 1ptrBa MAP0615 1339 3016 3471 50 893 3003 2387 35 0,532538597 1‐ MAP0617 372 239 71 26 194 142 71 13 0,060769588 1‐ MAP0618c 3900 11987 9399 212 3071 11614 9275 180 0,498409196 1‐ MAP0619c 544 812 1055 22 383 607 836 15 0,949131027 1‐ MAP0621 631 3233 2688 48 547 2963 1967 38 0,518028148 1‐ MAP0622c 216 643 485 47 107 406 266 24 0,107919822 1‐ MAP0623 144 815 1082 107 144 1494 858 119 0,6357665 1‐ MAP0624 121 409 639 20 244 591 751 27 0,319321615 1‐ MAP0625 923 4569 3221 451 1033 4178 3686 443 0,484825628 1purQ MAP0626 925 672 1207 73 659 1240 1120 61 0,489482388 1‐ MAP0627c 502 767 1926 85 481 1186 999 67 0,534629538 1‐ MAP0628c 1340 2510 1570 102 1671 1937 1640 98 0,502799909 1‐ MAP0629c 717 763 761 82 745 854 760 77 0,485640296 1‐ MAP0630c 1235 3326 3642 139 961 4752 3155 130 0,489079924 1‐ MAP0631c 617 873 925 35 771 1713 1171 46 0,521587231 1pepC MAP0632 89 133 320 5 196 140 174 6 0,712361356 1‐ MAP0633 127 3515 2401 182 675 3079 2372 207 0,514699911 1‐ MAP0634c 252 538 106 56 354 1723 536 121 0,120761147 1purL MAP0635 1702 4788 3957 62 1320 4905 3706 52 0,500171094 1‐ MAP0636 0 99 124 3 13 0 108 2 0,266436496 1‐ MAP0637 144 107 38 15 103 13 75 9 0,152368404 1purF MAP0638 3056 8311 7564 157 3720 7949 6373 146 0,487151539 1purM MAP0639 2479 9798 13014 287 2315 13275 11882 286 0,482858821 1‐ MAP0640c 1361 1782 2351 465 1485 2322 2154 457 0,499119113 1‐ predicted RNA 112 933 1540 2087 33 1282 1259 1884 0,497774453 1‐ predicted RNA 1291 59 3 1366 1047 0 61 939 0,911837167 1‐ MAP0641c 602 2233 3205 68 697 2957 2273 64 0,504899527 1pabC MAP0642 266 671 761 26 212 407 406 16 0,227696074 1

27


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0643c 1534 4111 3081 172 1536 3732 3524 161 0,492485229 1sseC MAP0644c 460 7428 4546 445 826 16577 8263 869 0,820432204 1cysA3 MAP0645c 3924 15389 17519 556 3975 41504 27224 939 0,575297547 1‐ MAP0646c 555 811 1846 97 776 2192 1519 122 0,520455784 1‐ predicted RNA 1754 434 277 1825 1916 366 411 1711 0,499686334 1‐ predicted RNA 437 10124 6475 5024 613 14308 11836 7685 0,568817001 1‐ predicted RNA 528 0 14 1231 489 4 19 966 0,355664266 1‐ predicted RNA 1931 19 26 1284 1447 0 30 809 0,962155492 1thiX MAP0647c 149 0 36 12 72 72 89 8 0,165217787 1‐ MAP0648c 319 200 234 16 712 374 301 29 0,21680744 1‐ MAP0649 258 5761 5068 151 486 4438 4116 126 0,501835669 1‐ MAP0650 287 948 1129 32 464 1317 1586 44 0,737766122 1phoS2_1 MAP0651 255 928 1303 28 374 2398 1701 46 0,913010436 1pstC2_1 MAP0652 215 360 466 15 226 894 607 21 0,364047608 1pstA1_1 MAP0653 728 1263 1617 58 983 3705 2729 98 0,618643412 1phoT MAP0654 942 5065 4018 157 1250 7094 5720 207 0,531556292 1phoY2_2 MAP0655c 2400 10735 7209 385 2887 8413 7047 347 0,493350686 1‐ MAP0656c 2896 6231 6955 112 3051 6345 6521 104 0,489166737 1‐ predicted RNA 299 2228 2119 3368 154 3131 1956 3379 0,492238473 1‐ MAP0657c 825 6773 6589 143 1453 5069 2946 103 0,506474008 1desA1 MAP0658c 3339 83571 37028 1276 8328 36488 21561 776 0,58139881 1‐ predicted RNA 95 5133 3921 8593 36 5223 3790 8183 0,500071602 1‐ MAP0659c 451 901 751 50 415 1039 543 43 0,536772739 1‐ MAP0660 185 226 286 10 221 369 353 12 0,384863174 1‐ MAP0661c 137 2711 2715 146 976 3411 2746 214 0,539794279 1‐ MAP0662c 569 1217 1093 83 516 1599 1543 90 0,518551512 1‐ MAP0663 390 298 459 25 315 540 355 21 0,416880509 1‐ MAP0664c 2676 10440 5897 210 2850 8690 6182 188 0,494059756 1‐ MAP_t13 928 14024 4648 2932 1441 6406 3396 1842 0,578503792 1‐ MAP_t14 44 942 829 265 104 679 475 194 0,328521726 1‐ MAP_t15 122 2625 846 515 133 1774 596 354 0,992662222 1‐ MAP_t16 217 484 269 196 135 280 289 126 0,20094725 1‐ MAP0665c 987 985 1078 63 1250 956 666 59 0,492652406 1‐ MAP0666c 1023 2805 2835 139 836 1976 1096 81 0,830581256 1

28


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0668 141 1026 539 15 184 386 251 8 0,19665467 1‐ predicted RNA 783 1554 5173 2674 636 7338 7473 4615 0,604449195 1‐ predicted RNA 1373 378 860 1687 855 1547 1620 1620 0,496145256 1‐ predicted RNA 114 1248 4956 1982 86 8594 8585 4995 0,364559699 1‐ predicted RNA 225 2151 4805 1427 448 12267 10801 4327 0,104530489 1‐ predicted RNA 1014 307 1261 1901 265 1389 1284 1305 0,801757625 1cspA_2 MAP0669 6346 48375 49047 5875 8438 110926 74288 10057 0,58189123 1‐ predicted RNA 14834 179 71 6031 25434 353 175 8700 0,551867235 1‐ predicted RNA 1164 14 0 1260 2222 200 28 2082 0,774890592 1‐ predicted RNA 1245 0 0 1343 1094 0 0 990 0,728199707 1lpqR MAP0670 702 955 993 57 1425 1878 1091 91 0,590215495 1‐ MAP0671 326 356 105 15 354 418 371 17 0,414354119 1‐ MAP0672c 72 251 180 8 85 121 0 4 0,060809664 1‐ MAP0673 303 1537 1495 25 619 1825 1359 30 0,520505986 1mcmA2 MAP0674 53 275 419 20 183 131 81 15 0,3928279 1‐ MAP0675 100 453 610 14 237 482 243 14 0,573607873 1‐ MAP0676 105 384 498 11 373 751 406 20 0,236140658 1‐ MAP0677c 324 1554 571 24 288 892 538 17 0,75455195 1‐ MAP0678c 98 897 254 45 180 396 466 43 0,534256273 1fdxB MAP0679c 93 646 464 41 72 404 389 29 0,265258794 1‐ MAP0680 142 393 323 8 142 178 144 5 0,137194521 1‐ MAP0681 58 537 376 12 66 461 207 9 0,234454366 1‐ MAP0682 108 542 395 11 183 532 356 12 0,901518715 1‐ MAP0683 48 412 142 9 116 159 247 9 0,844408329 1‐ MAP0684c 180 461 208 14 262 252 141 12 0,405872291 1‐ MAP0685 57 358 107 12 36 67 107 5 0,018542642 1‐ MAP0686 230 892 370 17 195 484 339 11 0,28255627 1‐ MAP0687 30 119 78 3 36 156 138 4 0,38926627 1‐ MAP0688 59 105 91 4 0 142 57 2 0,055449557 1narL_1 MAP0689c 35 2107 1335 54 205 1353 1196 47 0,491996576 1‐ MAP0690 196 440 418 11 174 337 288 8 0,317706039 1‐ MAP0691c 149 411 310 7 33 287 551 6 0,310641515 1‐ MAP0692c 72 304 264 11 72 87 79 5 0,029909933 1‐ MAP0693 214 289 612 18 159 380 695 17 0,505791191 1

29


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



mhpA MAP0694 396 957 1281 20 497 878 516 15 0,75421587 1mhpB MAP0695 108 467 394 12 178 395 249 11 0,428679074 1‐ MAP0696 321 1444 1210 21 648 915 1833 26 0,520427476 1‐ MAP0697 504 7200 4436 101 776 7823 4953 111 0,51771316 1‐ MAP0698 311 1121 915 37 238 952 1032 31 0,519199042 1‐ MAP0699 412 2282 2040 57 529 2427 1880 57 0,494622599 1‐ MAP0700 97 438 93 10 240 137 413 14 0,204756714 1‐ MAP0701c 108 566 610 9 102 288 450 6 0,2540431 1‐ MAP0702 0 354 36 4 71 45 65 3 0,563721219 1‐ MAP0703 0 446 243 10 36 262 143 7 0,342459774 1‐ MAP0704 288 1329 850 24 334 758 621 17 0,924141843 1‐ MAP0705 504 4479 2196 70 465 2946 2075 52 0,522260301 1‐ MAP0706 0 994 783 15 201 1211 597 19 0,601450595 1‐ MAP0707 36 786 402 11 72 613 397 10 0,428196479 1‐ MAP0708 36 388 247 3 108 555 213 4 0,211038477 1‐ MAP0709 234 338 108 14 101 287 167 8 0,139656757 1‐ MAP0710c 432 1097 690 37 720 746 483 37 0,494801762 1‐ MAP0711c 561 1642 1621 60 632 2922 2180 79 0,525167693 1‐ MAP0712c 1943 2213 2319 167 2253 2982 2567 178 0,479712627 1‐ MAP0713 36 286 554 8 92 916 344 12 0,247680028 1‐ MAP0714c 176 72 36 25 169 145 36 23 0,94602292 1‐ MAP0715c 72 180 82 7 108 219 209 10 0,215856232 1‐ MAP0716c 97 707 814 17 156 964 908 21 0,687311127 1‐ MAP0717c 180 644 370 35 230 398 578 36 0,936226889 1‐ MAP0718c 243 2055 1341 34 376 1942 1497 36 0,482058846 1‐ MAP0719c 92 4096 3004 226 652 2895 2211 206 0,50580048 1‐ MAP0720c 685 9583 5427 134 1958 6723 3935 122 0,491399258 1‐ MAP0721c 304 2397 1798 97 353 1505 1597 76 0,508428139 1‐ MAP0722 680 8771 3170 107 1124 5008 3019 83 0,503388533 1fadE12_1 MAP0723 321 1641 1526 36 636 1778 1104 39 0,481992536 1fadA6_2 MAP0724 249 1801 1290 33 313 977 739 22 0,855118824 1‐ MAP0725 47 238 323 11 77 83 108 6 0,085989724 1‐ MAP0726 14 193 365 11 36 44 120 5 0,018904492 1‐ MAP0727 264 1353 1210 27 527 1647 861 30 0,515112448 1

30


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0728 48 139 253 19 243 346 153 38 0,054739955 1‐ MAP0730c 348 5814 3037 82 784 1869 1395 44 0,987416479 1‐ MAP0731c 0 174 196 4 51 220 71 5 0,753923389 1‐ MAP0732c 72 298 126 6 72 133 271 6 0,984924727 1‐ MAP0733c 106 383 237 5 238 174 310 6 0,344144252 1‐ MAP0734 324 66 102 30 817 162 33 60 0,170394052 1‐ MAP0735 180 767 1713 29 204 896 1394 27 0,495094883 1‐ MAP0736 16 156 421 8 36 465 318 11 0,314060683 1‐ MAP0737 412 90 288 18 542 120 151 18 0,907875459 1‐ MAP0738c 533 1279 1223 32 499 961 1041 25 0,527663624 1‐ MAP0739 317 252 144 30 253 557 471 36 0,397297094 1‐ MAP0740c 400 2778 2937 82 1057 1909 2171 80 0,499101586 1‐ MAP0741c 144 5978 7317 412 542 3323 6119 328 0,502842633 1‐ MAP0742c 1176 15992 10099 262 2864 8703 5941 194 0,517875756 1‐ MAP0743c 316 3263 3275 69 559 2243 1692 49 0,518706536 1‐ MAP0744c 72 72 349 7 69 108 53 3 0,010187048 1‐ MAP0745c 36 999 237 25 36 676 192 17 0,232808174 1‐ MAP0746 72 239 165 9 107 157 189 9 0,876122467 1‐ MAP0747 0 433 288 6 72 151 296 6 0,855955665 1‐ MAP0748 36 410 251 6 147 358 215 8 0,366213961 1‐ MAP0749c 36 200 127 3 36 313 34 3 0,847799726 1‐ MAP0750c 504 1169 1410 75 645 1354 1350 79 0,483012645 1‐ MAP0751c 1028 2780 2955 103 1566 2550 2455 104 0,492282489 1‐ MAP0752c 252 1513 1413 30 267 2312 1813 38 0,521175205 1‐ MAP0753c 151 1165 551 109 122 1428 593 113 0,736556043 1‐ MAP0754c 36 766 330 17 116 1200 502 27 0,261699288 1aldA_2 MAP0755 163 1505 968 19 347 1669 1204 24 0,553633749 1‐ MAP0756 344 1263 821 26 841 1755 1733 47 0,699788328 1‐ MAP0757 575 2108 1632 72 850 2724 2375 94 0,524304399 1‐ MAP0758 1322 2855 3508 127 1175 4101 4614 141 0,523439665 1‐ MAP0759 2475 6229 6776 168 2931 8413 8559 198 0,458965506 1‐ MAP0760 1948 4723 6397 173 3043 7477 8708 240 0,555935588 1‐ MAP0761 1585 6721 5692 158 2380 8332 8283 206 0,547733166 1‐ MAP0762 1549 3195 4102 175 1328 5142 4482 184 0,483722156 1

31


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0763 267 249 803 29 337 780 1197 44 0,451545018 1‐ MAP0764 144 209 455 9 144 475 558 11 0,372087813 1‐ MAP0765 575 354 675 16 576 1569 1020 23 0,865642322 1‐ MAP0766c 1322 9858 6111 388 2443 8294 5467 386 0,478690318 1‐ predicted RNA 2403 591 364 2130 3514 383 323 2499 0,528513422 1‐ predicted RNA 2324 32 0 2097 2384 0 0 1799 0,510337723 1‐ MAP0767c 590 640 1180 56 835 892 1573 71 0,5209553 1‐ MAP0768c 682 3626 3062 100 1241 3721 2980 111 0,522565233 1‐ MAP0769 3620 9810 11379 795 7479 14651 13492 1153 0,546068686 1‐ predicted RNA 2803 29 158 2439 3721 10 50 2677 0,521449768 1‐ MAP0770c 526 289 2730 93 793 433 640 61 0,920794467 1‐ MAP0774c 563 3485 6386 86 558 3572 4219 67 0,512531929 1‐ MAP0775 1071 2257 1996 105 873 1299 1537 71 0,538553335 1‐ MAP0776c 1222 1089 1288 143 1047 1637 1159 126 0,503290667 1‐ MAP0777c 574 2690 1688 82 965 2823 2030 98 0,518294594 1‐ MAP0778 355 1780 1236 79 828 1732 1515 104 0,522157546 1‐ MAP0779 675 10700 3587 136 1341 7422 4428 127 0,489468856 1fadD3_2 MAP0780 216 797 540 14 108 752 515 10 0,350634193 1fadD16 MAP0781 180 321 163 16 330 362 192 22 0,308822341 1‐ MAP0782 134 19 69 28 180 38 51 31 0,683680558 1pdc MAP0783c 1134 4490 3984 72 1088 3103 3068 54 0,519060199 1‐ MAP0784 2265 25045 13703 1037 3604 29071 20256 1315 0,533333581 1far MAP0785 266 2089 1307 39 562 2444 1661 51 0,521943548 1‐ MAP0786 2721 9119 11164 636 3871 22988 24650 1258 0,580096073 1‐ MAP0787 299 2042 2613 126 560 4865 5230 256 0,908755891 1‐ MAP0788c 395 1640 1856 41 573 676 841 26 0,965669756 1fadA_1 MAP0789 6774 36742 24617 690 11119 25134 17266 593 0,521845148 1‐ predicted RNA 2415 192 126 2033 3791 96 81 2618 0,538984203 1fadB_1 MAP0790 16874 110657 97411 1237 24179 92434 68724 1047 0,511835794 1‐ predicted RNA 578 0 0 1247 740 0 3 1342 0,530954696 1‐ predicted RNA 1919 54 164 1839 2955 0 21 2300 0,525456781 1‐ MAP0791c 315 791 650 41 260 1064 442 35 0,904538074 1‐ MAP0792c 375 658 576 28 659 543 723 35 0,8897332 1‐ MAP0793c 215 334 143 9 321 203 182 10 0,711747539 1

32


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0794 256 333 644 33 144 513 812 31 0,4702338 1‐ MAP0795 202 635 728 21 348 550 364 19 0,447144145 1‐ MAP0796c 98 1493 680 84 396 410 764 77 0,532176805 1‐ MAP0797 36 179 205 11 72 225 107 11 0,921103204 1‐ MAP0798 360 1073 413 22 211 585 520 14 0,281660448 1‐ MAP0799c 828 4869 5035 77 880 4818 4585 71 0,494545965 1‐ MAP0800c 471 2151 1633 23 944 1946 1842 28 0,517900647 1‐ MAP0801 1199 1383 1574 261 1468 1476 1411 260 0,496765352 1moaC MAP0802 626 1168 1956 99 144 1549 1118 56 0,678572896 1mog MAP0803 211 540 694 40 245 425 475 32 0,383847283 1moaE2 MAP0804 340 658 656 57 371 634 434 48 0,919147611 1‐ MAP0805c 2206 3787 4602 209 1927 1340 1825 112 0,786342531 1‐ predicted RNA 4598 18931 14318 4894 4969 7983 9570 3160 0,528610265 1‐ predicted RNA 1315 56 0 1346 881 0 0 747 0,412723118 1‐ predicted RNA 2702 33 0 2193 2625 0 2 1783 0,521489814 1moaD2 MAP0806c 608 826 1720 163 865 1282 1744 192 0,51776198 1‐ MAP0807c 509 864 1966 73 441 1146 1750 66 0,486938383 1‐ MAP0808 252 36 0 17 214 0 36 13 0,292622041 1‐ MAP0809c 477 1575 2596 143 562 2568 2377 158 0,512458037 1cspB MAP0810 1452 11129 6762 542 1189 7020 5223 367 0,515963869 1fadE10 MAP0811 822 1915 1185 29 431 5014 2471 43 0,536526897 1‐ MAP0812 503 1600 2312 56 396 3213 2485 66 0,517681951 1‐ MAP0813c 108 287 360 10 180 429 368 13 0,325165945 1‐ MAP0814c 1006 379 977 93 576 494 671 54 0,666815394 1‐ MAP0815c 466 1730 1967 31 424 1723 1265 24 0,513217951 1‐ MAP0816 885 3499 2787 98 600 2096 1649 57 0,816256641 1‐ MAP0817c 452 1260 260 63 395 576 107 36 0,238690426 1‐ MAP0818c 114 376 175 33 216 395 285 45 0,255395219 1‐ MAP0819 193 953 650 51 258 882 600 50 0,537549466 1‐ MAP0820 291 1495 1044 40 208 939 1154 30 0,733159706 1‐ MAP0821 446 502 541 83 276 389 570 57 0,36390517 1‐ MAP0822c 1813 22430 11294 516 1653 11236 9596 329 0,52558568 1serC MAP0823c 656 3868 3211 82 1331 3473 2865 88 0,48224973 1‐ MAP0824 5041 195444 34541 2339 6837 101746 44835 1559 0,537233261 1

33


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 2433 0 0 2072 4037 20 0 2890 0,54541343 1fprB MAP0825 1339 10420 4296 111 1826 5879 3055 80 0,504876228 1‐ MAP0826c 274 814 341 42 396 603 304 41 0,478098103 1citA MAP0827c 325 2522 2230 52 466 1193 1348 34 0,896193112 1pdxH MAP0828 412 2586 2167 92 768 3193 1815 105 0,514282432 1gltA MAP0829 5256 26456 25075 535 9141 22534 16282 487 0,513830114 1‐ MAP0830c 1262 515 980 36 1115 872 986 31 0,497062515 1‐ MAP0831c 36 587 1052 68 0 1351 1046 89 0,594514655 1IS1601_B_1 MAP0832c 488 1242 755 29 265 966 658 18 0,727164514 1‐ MAP0833c 887 2213 1476 48 885 1322 1357 37 0,505883891 1‐ MAP0834c 805 2888 2201 110 727 2505 2143 94 0,511829747 1‐ MAP0835c 0 283 81 2 0 0 36 0 8,51E‐20 1‐ MAP0836 12 1400 142 12 0 284 21 2 2,25E‐10 1‐ MAP0837 108 1135 304 8 284 268 216 5 0,313414026 1‐ MAP0838c 0 0 0 0 36 0 0 2 1 1accD3 MAP0839c 126 525 308 8 72 359 200 5 0,137111494 1echA6 MAP0840 712 2168 1979 89 696 2158 1504 75 0,505239666 1‐ MAP0841 518 1381 1497 41 612 1359 1338 39 0,486102593 1‐ MAP0842 420 1094 1929 28 839 1787 1548 35 0,51993464 1ctpE MAP0843 792 1528 2330 27 956 2370 1940 28 0,508528041 1‐ MAP0844 480 1213 735 185 483 822 503 138 0,829873122 1‐ MAP0845 230 4552 2246 162 396 2862 2132 130 0,514729921 1‐ MAP0846 346 609 303 46 248 454 291 32 0,30002291 1‐ MAP0849c 1027 820 915 41 1520 1053 1117 51 0,520818897 1‐ MAP0850c 250 2231 1438 37 417 2143 1850 43 0,517022617 1‐ MAP0851 36 108 79 3 127 392 261 11 6,75E‐04 1‐ MAP0852 577 2471 4083 158 685 5085 5007 219 0,540200954 1‐ MAP0853 474 828 1445 58 323 1863 1219 59 0,482398021 1‐ MAP0854 2763 8467 14444 207 4351 19481 15946 298 0,544914057 1‐ MAP0855 1989 12249 16301 378 4358 20241 17652 525 0,542302082 1‐ MAP0856c 2015 9631 5141 123 2617 8442 6817 128 0,475316185 1‐ MAP0858 1234 810 357 93 1177 768 711 85 0,491674046 1‐ MAP0859c 1096 5044 7277 266 1652 5385 5599 255 0,487920843 1‐ MAP0860c 2458 15854 12681 413 2404 13579 11957 359 0,498873396 1

34


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0861 357 788 691 77 184 1196 470 61 0,884125288 1‐ MAP0862 2170 3397 5247 147 2096 5242 6040 157 0,477580441 1‐ MAP0863 434 2777 2589 101 732 5659 3171 157 0,554686812 1‐ MAP0864 61 611 385 28 104 1367 1044 62 0,107643589 1‐ MAP0865 432 2044 1860 42 662 3392 2219 57 0,526725755 1‐ MAP0866 508 2069 2293 75 1084 4270 3113 127 0,571877267 1‐ MAP_t17 36 319 142 78 82 320 72 80 0,825537385 1‐ MAP0867c 1181 6412 5540 194 1670 6195 4786 188 0,487427174 1‐ MAP0868c 670 3931 3742 92 1210 4949 3497 107 0,526906534 1nramp MAP0869c 594 1289 1649 38 997 1448 1369 43 0,514964171 1‐ MAP0870c 0 809 286 10 0 319 223 4 0,067350798 1‐ MAP0871c 191 324 261 15 237 323 87 13 0,371149447 1phoS2_2 MAP0872 1586 4133 4917 129 1800 5859 3435 125 0,489125303 1pstC2_2 MAP0873 552 1269 2495 58 706 2124 2383 65 0,514366434 1pstA1_2 MAP0874 532 504 1252 39 569 1039 633 35 0,491995954 1‐ MAP0875c 1305 8415 7926 229 1717 11822 8620 273 0,543294311 1‐ MAP0876c 108 497 468 14 214 353 435 15 0,990453647 1‐ MAP0877c 324 1202 890 22 433 579 716 17 0,770846943 1‐ MAP0878c 343 1187 917 37 237 757 589 22 0,374822664 1‐ MAP0879c 1657 6371 6180 117 1715 2188 1797 56 0,865087837 1‐ MAP0880 466 3039 1689 27 1236 2117 1573 30 0,513512498 1‐ MAP0881 604 913 889 19 848 903 631 19 0,482934586 1‐ MAP0882c 37 395 250 8 194 213 214 10 0,351367077 1echA12_1 MAP0883 1718 4332 9364 229 1022 8686 9490 244 0,472247213 1‐ MAP0884c 417 1266 1668 50 491 1367 1240 45 0,485914065 1‐ MAP0885c 457 3217 2491 94 512 2573 1773 74 0,513711319 1‐ MAP0886c 1563 2813 1141 97 1108 1586 2536 78 0,52365425 1‐ MAP0887c 5966 29106 2172 534 6906 11042 6471 388 0,532819395 1‐ predicted RNA 1331 2 31 1400 1737 0 0 1522 0,517238707 1‐ predicted RNA 418 0 0 1127 329 0 0 744 0,198409036 1‐ predicted RNA 1517 3377 339 2929 1445 2147 1370 2544 0,514949058 1‐ MAP0888 324 1146 1104 40 242 1037 1155 35 0,500923223 1‐ MAP0889 227 1381 1831 46 550 2014 1567 58 0,52153887 1‐ MAP0890 490 2138 1358 66 653 2162 1464 70 0,48813947 1

35


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



pgi MAP0891c 1439 4226 2830 70 1667 3193 2399 60 0,498436958 1‐ MAP0892c 1260 6325 7002 551 1630 6954 5548 524 0,486155746 1‐ predicted RNA 359 2282 2787 2765 316 2281 2433 2438 0,502862972 1uvrD MAP0893 1718 5780 6063 75 2463 5809 4990 75 0,481550637 1‐ MAP0894c 685 5359 4192 190 764 4194 3860 162 0,498493666 1‐ MAP0895c 3474 10819 9687 284 7236 6065 5885 280 0,484560152 1sucC MAP0896 3107 9343 5765 206 2984 4989 3658 136 0,520641465 1sucD MAP0897 1989 7390 6145 223 3130 3234 3780 172 0,504352991 1‐ MAP0898 472 693 929 20 498 425 651 16 0,844892229 1‐ MAP0899c 94 713 318 15 35 430 227 8 0,105277896 1‐ MAP0900 1224 5189 4453 153 1331 3873 2985 116 0,505957254 1‐ MAP0901 456 2324 2549 46 835 3063 2215 53 0,516936025 1purN MAP0902 504 3708 3937 149 875 4346 2730 147 0,493728343 1purH MAP0903 1638 2387 2166 61 1277 2138 2175 48 0,524422055 1‐ MAP0904 3821 51602 14276 1039 10124 36440 16564 1062 0,491813873 1‐ predicted RNA 1097 34 0 995 3914 34 0 2962 0,069051581 1‐ MAP0905 2522 7544 8075 173 3400 6353 4681 144 0,49900974 1‐ MAP0906 1629 6181 11952 121 2802 9420 8250 127 0,472250057 1‐ MAP0907 816 3589 5258 138 705 4121 4187 120 0,495884228 1‐ MAP0908c 2289 3625 2955 220 4167 5540 5128 344 0,546990518 1echA7 MAP0909c 167 638 422 20 540 607 524 32 0,268746683 1fadE12_2 MAP0910c 557 3576 2067 63 585 3001 1604 52 0,513449821 1accA2 MAP0911c 452 6629 4472 63 749 6602 3536 59 0,493267582 1accD2 MAP0912c 559 2836 2969 48 1098 3358 2699 56 0,522674484 1fadE13 MAP0913c 324 1762 1940 42 291 1331 1158 28 0,84999039 1‐ MAP0914c 385 1218 1146 21 427 1497 981 20 0,486412676 1rpmF MAP0915 266 2054 1820 275 83 1489 1171 164 0,732987435 1‐ MAP0916 1793 3051 8311 258 1195 6085 6359 229 0,492915764 1‐ MAP0917 1707 4599 10165 136 904 7876 6831 111 0,499974558 1‐ MAP0918 2303 9575 13483 212 2871 11827 8569 190 0,492244954 1moaB2 MAP0919 1284 6299 6911 316 2456 6092 6116 339 0,471914003 1mscL MAP0920c 748 4968 2854 224 1098 3637 2434 196 0,506691037 1‐ predicted RNA 3040 17 0 2593 3684 0 22 2640 0,484200325 1‐ MAP0921c 1762 1641 792 119 3255 897 439 148 0,535311874 1

36


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0922c 346 1446 1165 115 401 782 481 71 0,63688592 1‐ MAP0923c 36 234 106 6 36 143 89 4 0,314520678 1galU MAP0924 1807 23177 15658 494 2363 15883 13795 396 0,519410889 1moeA MAP0925 582 5252 2809 77 1094 3637 2422 69 0,504758218 1rimJ MAP0926 601 1986 2113 93 923 1944 2122 101 0,510946557 1‐ MAP0927 2914 42550 18597 625 2132 13565 9615 255 0,525146093 1‐ MAP_t18 439 10586 11775 3326 291 13629 8539 3086 0,490073115 1‐ MAP0928 132 2157 1999 304 154 2156 1850 288 0,486437362 1‐ MAP0929 305 242 390 95 185 374 426 76 0,364881745 1‐ MAP0930 109 292 441 17 82 561 771 25 0,297640252 1‐ MAP0931 259 310 251 28 286 371 265 28 0,856256375 1‐ MAP0932c 186 538 289 22 373 802 560 37 0,251316597 1‐ MAP0933 144 153 177 6 180 197 142 6 0,981033124 1‐ MAP0934 287 499 144 13 199 1856 894 28 0,145997965 1‐ MAP0935 393 1027 1012 32 223 1437 1128 30 0,493736157 1gmhA MAP0936 233 576 488 30 108 635 536 23 0,369325997 1‐ MAP0937 108 72 331 13 72 143 187 9 0,24091754 1‐ MAP0938 265 439 340 16 793 482 519 31 0,180010434 1‐ MAP0939 72 105 72 5 42 72 169 4 0,754834692 1‐ MAP0940 252 304 688 27 466 490 305 30 0,602498942 1‐ MAP0941 382 35 72 25 125 371 118 15 0,136856814 1arcA MAP0942 576 2063 2403 53 328 2740 2138 47 0,502916434 1‐ MAP0943c 544 923 1123 25 426 1236 1671 26 0,480913588 1‐ MAP0944 108 821 605 21 159 537 517 17 0,391099347 1pabB MAP0945c 553 1978 2269 47 431 1553 1675 34 0,558739802 1‐ MAP0946c 105 198 179 7 71 323 177 7 0,93151242 1‐ MAP0947c 58 338 230 6 50 72 0 1 9,04E‐05 1‐ MAP0948 1257 1432 1954 44 999 2332 2901 46 0,509001266 1‐ MAP0949 1419 2496 2381 51 1485 2759 2836 52 0,488650009 1‐ MAP0950c 218 494 154 16 176 327 345 14 0,404041435 1‐ MAP0951 288 815 458 13 255 573 759 12 0,876485398 1‐ MAP0952 1366 3761 2290 71 1182 3296 3319 67 0,491431328 1‐ MAP0953 934 4067 3712 73 774 5137 5426 85 0,527418264 1‐ MAP0954 282 544 335 17 263 775 867 23 0,567165666 1

37


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP0955 174 265 222 11 144 317 352 11 0,919889535 1‐ MAP0956 363 1471 1246 23 563 1990 1845 31 0,523271703 1‐ MAP0957c 333 621 578 25 288 814 725 26 0,494033594 1‐ MAP0958c 555 1069 588 29 325 1343 1602 33 0,515122532 1‐ MAP0959 144 294 86 18 42 249 76 9 0,054816481 1CpsH MAP0960 69 70 0 5 36 37 175 6 0,735030015 1‐ MAP0961c 70 225 154 5 68 359 180 6 0,484909563 1‐ MAP0962c 83 1051 358 9 115 648 755 9 0,601988883 1‐ MAP0963c 177 991 608 14 180 895 787 14 0,605199929 1‐ MAP0964c 169 251 194 6 314 285 161 8 0,310079101 1‐ MAP0965c 72 175 217 11 104 426 325 17 0,126006467 1‐ MAP0966c 36 36 36 1 102 144 142 4 0,004334416 1‐ MAP0967 3144 1659 934 104 1390 1930 1207 56 0,791854313 1‐ MAP0968 650 1167 2531 82 355 1469 2207 65 0,500179707 1cprA MAP0969 358 431 1072 39 251 958 741 33 0,649448457 1‐ MAP0970 1030 3874 2625 47 1129 2686 2280 38 0,520488644 1‐ MAP0971 291 251 182 13 403 360 380 18 0,353890332 1metG MAP0972c 1606 3791 5582 95 1925 5432 5170 101 0,482024472 1‐ MAP0973 325 780 1567 40 288 751 1128 31 0,710185476 1‐ predicted RNA 229 5117 5260 3145 586 6258 4888 3512 0,523299417 1‐ MAP0974 3702 9077 9580 277 6985 10766 7460 330 0,527460197 1ksgA MAP0975 1207 844 2647 79 2343 1652 1881 103 0,539608754 1‐ MAP0976 953 998 1091 54 926 836 873 44 0,492212013 1pks16 MAP0977 2197 21616 14413 265 3354 14565 11841 216 0,515217898 1pth MAP0978c 371 211 321 30 180 327 160 16 0,138856883 1rplY MAP0979c 940 3026 1936 121 959 1988 1780 96 0,517666807 1‐ MAP0980c 72 65 174 5 144 319 616 15 0,005144058 1lpqT MAP0981c 1002 826 2249 98 982 991 1900 85 0,503602062 1arsC MAP0982c 1513 2145 3508 308 1639 1809 2426 251 0,514219407 1prsA MAP0983c 2185 12969 8107 287 2493 10212 6457 235 0,505505766 1glmU MAP0984c 1584 3390 3019 78 1147 2523 2932 58 0,523765888 1‐ MAP_t19 11 213 174 59 0 67 238 44 0,408433518 1‐ MAP0985 513 2987 3227 130 618 2793 2308 109 0,514125053 1lysA_1 MAP0986c 108 108 16 3 180 0 0 3 0,887364907 1

38


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



mfd MAP0987 1846 6546 8980 59 1773 8372 6371 52 0,491466592 1‐ MAP0988 424 1770 2783 60 817 2645 2504 73 0,519655606 1‐ predicted RNA 96 3458 3841 2879 147 2592 2505 2040 0,519710433 1lpqU MAP0989 698 3313 3163 111 390 3540 3327 99 0,511732525 1eno MAP0990 1741 7264 3618 127 1590 4162 3630 93 0,505783036 1‐ MAP0991 548 429 1032 48 511 321 348 30 0,476834663 1‐ MAP0992 321 1842 3961 145 674 2849 3287 164 0,516269023 1‐ MAP0993 661 3163 5156 113 1227 4281 4750 130 0,526504882 1‐ MAP0994 125 99 123 19 109 251 143 20 0,732317472 1kdpE MAP0995c 388 882 757 42 396 677 746 36 0,561953629 1kdpD MAP0996c 1285 4411 2654 43 1886 4553 2806 47 0,521703038 1kdpC MAP0997c 144 596 215 14 36 476 369 10 0,266471676 1‐ MAP0998c 36 72 71 4 72 144 72 6 0,201352812 1‐ MAP0999c 210 753 249 10 312 1283 474 16 0,310478634 1kdpA MAP1000c 354 924 214 13 321 3660 1176 32 0,094219907 1‐ MAP1001c 3546 1036 4423 112 1861 19009 15106 252 0,786521306 1‐ MAP1002c 3606 3585 13569 385 2133 49191 38763 1202 0,3224536 1‐ predicted RNA 465 9256 5562 4544 1017 8002 6310 4711 0,479665902 1‐ predicted RNA 14420 143164 72055 7639 28738 163227 103272 9929 0,5455659 1‐ MAP_t20 6 7 1 3 0 33 0 4 0,625180118 1‐ MAP1004 439 641 817 24 391 960 974 24 0,501886851 1‐ MAP1005 288 1125 687 34 252 1028 592 28 0,857559164 1‐ MAP1006 267 303 470 21 333 623 456 25 0,466351811 1‐ MAP1007 435 530 541 21 349 1260 802 25 0,744450811 1fadD14 MAP1008 365 4130 2789 49 1150 3686 2471 55 0,520108069 1‐ MAP1009 43 420 160 15 195 457 323 27 0,088754807 1‐ MAP1010 421 429 285 23 123 636 493 16 0,308388223 1‐ MAP1011 180 104 186 10 123 84 218 7 0,282645419 1‐ MAP1012c 253 1022 642 23 213 606 621 16 0,497096309 1lpqV MAP1013c 108 427 271 23 125 349 355 22 0,989466837 1‐ MAP1014 282 725 592 38 58 1598 1518 55 0,629159262 1‐ MAP1015 230 450 85 28 329 657 406 43 0,292929031 1‐ MAP1016c 1073 3840 4450 67 1703 2927 2778 57 0,496699316 1echA8_1 MAP1017c 610 3261 2533 98 818 1803 1494 69 0,520541023 1

39


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



echA9 MAP1018c 466 5555 3799 103 806 4060 1870 75 0,529924534 1‐ predicted RNA 795 863 1799 2546 553 1558 2312 2602 0,491286831 1‐ MAP1019 2179 12976 9280 346 2118 9996 5277 241 0,52011118 1‐ MAP1020c 283 750 673 62 171 590 519 41 0,294306221 1‐ MAP1021c 1486 9140 7414 255 1624 8029 6694 226 0,491596655 1‐ MAP1022c 426 2941 2565 71 373 2580 2539 63 0,505408895 1cysM2 MAP1024 250 3257 2124 44 490 2432 1986 40 0,500355391 1pra MAP1025 1803 6905 4762 242 2685 4297 2738 195 0,498752344 1metB MAP1026 2257 1236 1223 84 1268 1262 1246 51 0,596153313 1greA MAP1027c 3035 23347 17464 1030 2278 23090 18669 963 0,51487996 1‐ predicted RNA 1620 0 134 1496 1656 127 166 1332 0,494369642 1‐ MAP1028c 102 179 446 23 67 207 267 15 0,18688751 1‐ MAP1029 1133 4368 5105 150 1053 5310 4009 135 0,496443938 1‐ MAP1030 3166 9063 8837 378 4374 10483 8387 406 0,471054856 1speE MAP1031c 650 324 263 17 537 295 114 11 0,462344785 1‐ MAP1032c 0 105 72 3 0 102 246 7 0,063567334 1‐ MAP1033 3516 1577 746 112 2179 1589 1227 71 0,538856564 1‐ MAP1034c 70 36 36 5 36 36 72 4 0,316045876 1‐ MAP1035c 236 1071 487 37 132 474 456 21 0,192885172 1‐ predicted RNA 0 1443 2157 2064 9 2121 2465 2591 0,520371989 1ruvC MAP1036 235 3311 3412 134 171 2823 3574 122 0,507091193 1ruvA MAP1037 168 360 351 21 6 348 300 11 0,090310661 1ruvB MAP1038 288 725 571 21 180 429 501 13 0,262342303 1‐ MAP1039 2152 2063 2495 123 781 12358 7632 229 0,715451645 1fadD9 MAP1040c 358 3143 1772 17 321 1179 1163 9 0,509961646 1gabT MAP1041c 432 1563 1550 33 819 1420 1363 37 0,516026299 1yajC MAP1042 296 512 543 62 251 762 616 62 0,490364353 1secD MAP1043 1990 5405 6090 99 2021 4644 5121 84 0,496681046 1secF MAP1044 1277 2267 3782 79 1282 2764 2625 67 0,509220072 1‐ MAP1045 380 1893 2073 31 234 1752 1847 25 0,492677997 1relA MAP1047 2698 27199 21665 245 3161 18754 15374 179 0,546637131 1‐ MAP1048c 144 216 215 9 92 584 698 15 0,152475283 1pknE MAP1049c 432 1129 1220 22 537 1096 1281 23 0,48235482 1ppiB MAP1050c 898 8867 5150 179 857 6272 3727 128 0,506671473 1

40


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP1051 670 1941 1757 90 543 1292 779 53 0,828972267 1hisS MAP1052 591 2333 2479 54 243 1725 1508 30 0,759881548 1‐ MAP1053 668 948 839 31 1182 907 788 38 0,521327701 1‐ MAP1054 136 215 141 7 229 160 72 8 0,887705613 1‐ MAP1055c 216 250 178 7 156 164 214 5 0,215831419 1‐ MAP1056 1121 2333 1244 147 1744 2948 2201 201 0,54308649 1‐ MAP1057c 150 90 126 13 191 142 158 15 0,60662821 1‐ MAP1058 316 1835 1014 47 287 1729 774 39 0,500474211 1dapA_1 MAP1059 507 336 284 25 150 103 420 11 0,049434271 1‐ MAP1060c 683 1614 1443 60 865 1459 906 53 0,493605113 1‐ MAP1061c 943 1174 1385 113 914 1998 1772 125 0,512100266 1‐ MAP1062c 218 251 283 15 283 394 535 21 0,344970896 1aspS MAP1063 1785 2022 3298 63 1320 2827 2352 49 0,518708606 1‐ MAP1064 1031 4939 7740 353 976 7726 9221 426 0,537250717 1‐ predicted RNA 1237 5851 4505 4255 2374 7236 5510 5609 0,537452102 1‐ predicted RNA 468 22208 23864 13492 435 49912 38344 24618 0,586366482 1‐ MAP1065 108 2131 1015 80 189 1984 1468 90 0,515822812 1‐ predicted RNA 1608 0 31 1496 2601 79 0 2039 0,526852773 1‐ MAP1066 108 192 179 6 108 433 361 10 0,173011672 1‐ MAP1067c 251 2147 918 98 425 1639 841 91 0,486629495 1‐ MAP1068 308 1291 655 31 90 3306 1608 53 0,685813419 1‐ MAP1069 343 1397 1539 40 402 3139 2200 62 0,563913286 1‐ MAP1070c 480 1334 1351 16 553 1066 918 13 0,502535588 1‐ MAP1071c 515 1224 515 35 208 802 590 20 0,24827838 1‐ MAP1072 129 982 630 15 285 845 523 15 0,797762988 1‐ MAP1073 147 412 247 33 246 291 197 34 0,911879194 1‐ MAP1074c 71 1502 542 72 268 516 513 56 0,480526074 1‐ MAP1075c 147 2542 902 145 388 1084 526 97 0,961769618 1‐ MAP1076 1407 1390 4656 271 1416 1847 2090 194 0,531521481 1‐ predicted RNA 527 1764 3593 2698 938 2413 2881 2930 0,510836998 1alaS MAP1077 3198 14446 15052 149 2671 13342 10087 112 0,511147064 1‐ predicted RNA 1589 0 0 1469 1363 21 0 1063 0,665499589 1‐ MAP1078 72 453 576 25 180 309 174 19 0,282654779 1‐ MAP1079 2025 6269 7680 167 1906 7237 5786 145 0,493142617 1

41


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP1081 72 143 91 10 108 28 84 9 0,700904841 1‐ MAP1082c 277 321 251 13 464 352 449 19 0,329284775 1‐ MAP1083c 360 1760 1071 32 528 1723 1212 34 0,519387033 1‐ MAP1084c 0 71 17 0 144 93 72 5 5,47E‐08 1‐ MAP1085 36 710 215 8 483 751 501 20 0,04668769 1‐ MAP1086 190 309 104 6 359 436 501 12 0,144609507 1‐ MAP1087 0 195 35 5 24 41 35 3 0,196665898 1‐ MAP1088 15 429 107 11 36 239 94 8 0,345496506 1‐ MAP1089 36 36 36 2 0 36 72 1 0,179769458 1dppD_2 MAP1090 72 10 71 1 119 71 72 2 0,214285769 1aroF MAP1091 630 3362 2244 63 285 2211 1809 39 0,783764182 1aroK MAP1092 430 2178 1566 97 187 1848 1561 73 0,568154846 1aroB MAP1093 938 2021 2440 69 1010 2183 1687 59 0,510317527 1aroD MAP1094 901 393 403 86 502 491 521 55 0,739320685 1‐ MAP1095c 1109 5570 3491 188 969 3989 3563 151 0,503841014 1pepQ MAP1096 1191 3379 4562 108 1178 3059 3180 85 0,510748241 1efp MAP1097 1150 5195 4205 234 1190 5113 3813 213 0,495805218 1nusB MAP1098 250 789 1110 58 206 1251 1153 62 0,500116171 1‐ MAP1099 413 832 2507 124 141 1316 1758 90 0,672566652 1adi MAP1100 1759 9379 8642 84 1901 9068 9490 83 0,480336817 1‐ MAP1101 0 214 158 2 143 213 252 6 0,020656361 1tcrA MAP1102c 243 746 683 33 174 673 448 23 0,321483392 1‐ MAP1103c 36 0 61 5 11 139 133 9 0,174052631 1‐ MAP1104c 101 553 340 15 148 548 358 16 0,919917986 1‐ MAP1105 71 216 161 6 32 341 143 5 0,877066851 1‐ MAP1106 0 155 35 8 108 123 0 17 0,044228674 1‐ MAP1107 179 36 70 13 288 158 142 20 0,144209796 1‐ MAP1108 0 25 67 1 36 35 118 2 0,045959781 1‐ MAP1109 59 36 36 3 72 179 36 4 0,162498382 1‐ MAP1110 0 35 16 0 72 0 0 2 0,001434505 1frdA MAP1111 72 144 145 1 192 251 188 3 0,085297329 1‐ MAP1112c 65 536 590 25 180 235 351 20 0,360617907 1‐ MAP1113c 286 567 628 18 301 688 562 18 0,733231093 1pyrR MAP1114 437 161 263 32 233 235 352 21 0,281887579 1

42


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



pyrB MAP1115 36 1011 653 18 141 642 276 13 0,310874294 1pyrC MAP1116 108 999 405 13 151 429 572 11 0,38104693 1‐ MAP1117 434 1038 801 63 348 848 603 46 0,994226749 1carA MAP1118 497 977 783 30 292 666 499 17 0,250507348 1carB MAP1119 1079 2999 3424 30 1199 3585 3210 29 0,48573807 1pyrF MAP1120 242 248 266 15 149 198 142 8 0,114818682 1‐ MAP1121c 1353 1077 892 127 1262 981 661 101 0,504372432 1‐ predicted RNA 620 0 0 1254 665 0 0 1129 0,44465447 1‐ predicted RNA 19 13816 10175 22061 16 15780 11957 25005 0,461474924 1mIHF MAP1122 5275 41928 18478 2293 6706 28423 17126 1869 0,532007433 1‐ predicted RNA 2036 74 71 1820 2544 18 55 1888 0,507061691 1gmk MAP1123 2118 4257 4855 240 2169 4007 4228 211 0,493669958 1‐ MAP1124 2049 8003 8980 734 1735 6821 6715 559 0,506847621 1dfp MAP1125 2064 8922 14340 243 3096 9612 12322 243 0,481297792 1metK MAP1126 1973 7444 8231 184 2261 7868 7955 181 0,483161249 1‐ MAP1127c 1596 1975 2534 65 1775 3179 2933 73 0,524637226 1lipI MAP1128c 180 1005 1416 31 348 1034 752 28 0,499853657 1‐ MAP1129 130 1085 567 26 321 731 625 28 0,961976736 1priA MAP1130 186 583 472 8 193 651 457 8 0,691404995 1‐ MAP1131 468 821 463 57 699 443 224 52 0,498751965 1‐ MAP1132c 43 318 0 5 137 36 102 6 0,598258538 1fmt MAP1133 72 285 179 7 59 101 72 3 0,038916393 1fmu MAP1134 108 215 566 8 144 144 282 5 0,218955987 1rpe MAP1135 809 4084 3483 147 1074 3172 2822 127 0,508279461 1ribG MAP1136 597 605 975 34 646 528 665 28 0,514333629 1‐ MAP1137c 3285 10687 12805 217 3282 9849 8521 170 0,506394344 1lprG MAP1138c 3312 19268 16748 659 3213 20881 14037 601 0,516328373 1ribC MAP1139 201 810 746 37 281 773 765 38 0,638492246 1ribA2 MAP1140 3846 32210 39447 672 4203 37187 28554 599 0,513959054 1‐ predicted RNA 2672 0 62 2293 2446 0 29 1757 0,524094618 1ribH MAP1141 660 564 726 71 887 881 588 79 0,515143443 1‐ MAP1142 2466 610 1087 209 1698 1018 1633 157 0,52936237 1‐ MAP1143c 7561 21389 17341 1894 7392 34250 19026 2143 0,522693443 1‐ predicted RNA 545 14 46 1304 703 62 42 1437 0,546494322 1

43


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 1683 0 0 1512 2339 48 0 1777 0,517145283 1‐ MAP1144c 47 25 15 1 36 50 37 1 0,865808701 1‐ MAP1145c 133 1705 1546 31 81 2938 1371 37 0,519723659 1uvrC MAP1146 1110 3771 4534 62 620 3484 3030 42 0,535126921 1‐ MAP1147 887 852 1088 52 750 1084 854 42 0,493382746 1‐ MAP1148 749 3955 4052 98 820 6240 4270 116 0,52858921 1‐ MAP1149 605 2513 2618 73 669 2240 2223 64 0,507273502 1‐ MAP1150c 1072 924 1340 46 1768 1152 1057 56 0,518691583 1‐ MAP1151c 0 0 0 0 36 0 0 3 1 1‐ MAP1152 189 179 266 8 200 1319 623 19 0,080363138 1‐ MAP1153 570 753 1186 28 823 3694 2143 58 0,629625217 1‐ MAP1154 111 958 581 53 184 3031 1431 136 0,067964107 1‐ MAP1155 125 348 404 12 367 847 572 24 0,142279845 1‐ MAP1156 1487 6453 5455 121 2258 8727 6247 149 0,540331614 1‐ MAP1157c 203 36 71 10 108 142 77 7 0,197988618 1lipO MAP1158c 943 1005 2452 52 1005 1191 1151 40 0,507201029 1fadD12_1 MAP1159c 1427 4484 4934 87 2503 3787 3500 86 0,488462731 1‐ MAP1160c 986 1718 1436 78 1133 1288 1046 66 0,503937908 1‐ MAP1161 221 825 377 50 216 817 458 48 0,504105493 1‐ MAP1162 153 876 875 13 74 584 693 8 0,281191253 1‐ MAP1163 96 340 749 10 175 508 480 10 0,978014837 1‐ predicted RNA 774 6366 3675 4830 1345 4765 2961 4318 0,495916846 1gap MAP1164 3013 19533 12777 413 4108 14656 8580 332 0,512682469 1pgk MAP1165 1252 3158 4025 91 1639 2668 2729 79 0,498451373 1tpiA MAP1166 1089 4147 6402 183 891 4345 4124 138 0,504376407 1secG MAP1167 2242 1270 3981 546 2107 3187 3827 548 0,487930166 1‐ MAP1168c 1439 270 180 55 1226 286 35 39 0,710783738 1ppc MAP1169 389 1637 1815 17 616 1564 1273 15 0,487516185 1‐ MAP1170 299 281 265 19 197 423 380 17 0,403481515 1‐ MAP1171 193 573 492 17 400 1404 1014 35 0,15278948 1‐ MAP1172c 220 1783 933 36 718 966 967 41 0,514858936 1‐ MAP1173c 471 8287 4328 353 356 6161 4112 277 0,503194048 1devB MAP1174c 500 1347 2190 69 678 1917 2113 78 0,513666532 1opcA MAP1175c 892 1838 3427 91 874 2772 3223 92 0,496183019 1

44


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



zwf2 MAP1176c 2169 7802 10214 165 3368 9953 8942 181 0,465308775 1tal MAP1177c 3120 17776 12900 365 4492 15964 10957 345 0,505262485 1tkt MAP1178c 2403 19122 15391 203 4182 16749 11635 187 0,509962098 1ctaB MAP1179 980 3188 5321 129 1025 6163 6392 166 0,530643877 1qor MAP1180c 274 2126 867 38 293 1417 885 30 0,561933044 1‐ MAP1181 100 72 0 5 143 108 23 7 0,370490415 1‐ MAP1182c 150 803 452 18 72 671 475 14 0,342826627 1‐ MAP1183c 510 1655 1799 66 733 1630 1370 63 0,490880144 1‐ MAP1184c 1141 2037 1732 80 723 1423 1585 53 0,581669818 1‐ MAP1185c 707 1883 1949 36 810 1573 1201 29 0,502259411 1‐ MAP1186 1231 3409 2179 113 630 2280 1978 70 0,568429039 1‐ MAP1187 4139 20742 15495 344 2619 15227 12218 237 0,532849149 1‐ MAP1188 1831 8345 11967 225 1128 9220 10093 189 0,502303088 1‐ MAP1189 1501 7614 9207 282 1008 7601 8018 235 0,497648496 1‐ MAP1190 1085 2061 2091 62 442 1523 1621 34 0,839001828 1‐ MAP1191 598 2902 2105 145 411 2806 2391 131 0,504189141 1‐ MAP1192 656 1206 1141 129 300 1409 992 91 0,771137329 1‐ MAP1193c 325 200 239 20 136 493 499 18 0,417559792 1‐ MAP1194c 243 1166 1155 40 331 3822 1566 78 0,48922631 1fadE15 MAP1195c 982 4846 4413 68 1337 3628 2754 54 0,5062459 1trxB MAP1196 666 5410 5618 378 972 12574 10355 718 0,751073588 1echA12_2 MAP1197 709 2758 5100 129 689 4036 4150 124 0,48737549 1‐ MAP1198 498 1531 3312 40 790 1925 2204 38 0,498926418 1‐ MAP1199 402 6527 2475 515 354 5814 3965 535 0,480497993 1‐ MAP1200c 272 360 687 34 859 304 525 55 0,294358529 1acn MAP1201c 5062 16007 16125 174 4064 14007 10201 124 0,531682337 1‐ predicted RNA 3788 0 0 3143 2657 66 0 1866 0,564181525 1‐ MAP1202 347 1465 2019 75 216 714 901 35 0,166789055 1‐ predicted RNA 2059 691 1221 2401 1424 1339 1270 1800 0,524759186 1moxR MAP1205 2374 15306 11206 301 3883 16180 10974 326 0,514678464 1‐ MAP1206 637 1305 1268 49 368 1432 1404 40 0,49212949 1‐ MAP1207 1861 3195 5935 153 2187 5634 6226 177 0,529101063 1‐ MAP1208 0 0 72 0 36 36 84 2 0,036873504 1fabG1 MAP1209 2989 4696 4456 247 3102 4286 4630 226 0,487729875 1

45


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



inhA MAP1210 2028 7981 6738 265 2312 5945 4638 207 0,504751509 1hemH MAP1211 242 346 436 15 484 274 310 18 0,405318347 1‐ MAP1212c 432 1343 889 37 566 1268 616 34 0,489899633 1‐ MAP1213 288 1244 929 70 238 1023 965 59 0,558924406 1‐ MAP1214 241 287 307 12 36 484 257 7 0,132197734 1‐ MAP1215 553 490 455 77 589 428 337 66 0,678286485 1lpqQ MAP1216c 776 2699 4748 341 903 4158 4620 377 0,523717864 1‐ MAP1217c 2289 6558 6748 268 2344 6466 7041 256 0,483495933 1‐ MAP1218c 482 836 750 107 640 889 479 104 0,495082906 1‐ MAP1219c 49 251 367 16 204 267 166 20 0,344149243 1‐ MAP1220c 36 0 35 4 36 70 36 5 0,568863618 1‐ MAP1221 0 116 34 2 90 146 13 5 0,022639505 1‐ MAP1222 64 152 0 2 36 78 0 1 0,056234212 1‐ MAP1223c 107 358 535 15 201 502 465 18 0,402190561 1‐ MAP1224c 287 1093 759 35 168 907 643 25 0,634181005 1mutA MAP1225 305 2289 2145 29 369 894 1009 15 0,445011589 1mutB MAP1226 1023 7654 6199 76 1123 3757 2810 42 0,888389948 1‐ MAP1227 130 1801 3213 57 144 2649 2576 57 0,493778141 1lipL MAP1228 615 3705 1986 59 847 3514 3638 73 0,532052824 1‐ MAP1229 720 1337 2169 49 757 1386 1553 41 0,499982158 1‐ MAP1230 934 4630 3732 94 1650 3747 2360 85 0,491432282 1‐ predicted RNA 114 1024 3318 1705 102 3161 3572 2441 0,529352817 1‐ predicted RNA 1564 0 0 1405 1445 54 0 1103 0,51291696 1gmdA MAP1231 2336 3862 5847 170 2244 8022 8107 216 0,543940185 1epiA MAP1232 3388 5804 11107 296 3418 12999 11270 347 0,534884296 1‐ MAP1233 12568 32546 57818 1859 14599 61229 56826 2181 0,525466866 1‐ predicted RNA 5105 34 40 2861 5744 60 0 2699 0,488698589 1‐ predicted RNA 2165 0 30 1955 2058 0 0 1553 0,511691628 1‐ MAP1234 5318 23120 33406 942 5392 33804 36443 1066 0,528385216 1‐ predicted RNA 2624 34 10 2370 2072 54 40 1589 0,527518948 1‐ MAP1235 5448 31899 25933 570 3096 41381 33063 616 0,51903659 1drrC MAP1236c 3206 1651 2353 183 2698 3362 3005 172 0,49079203 1drrB MAP1237c 1421 871 1563 96 1730 2595 2225 128 0,539564258 1drrA MAP1238c 2012 3246 3460 140 1402 5139 4978 147 0,485281646 1

46


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



mmpL4_2 MAP1239c 17246 23646 38217 410 18736 50038 55063 537 0,549230419 1‐ predicted RNA 1645 0 79 1590 1723 17 0 1381 0,494888095 1mmpL4_3 MAP1240c 17676 44271 56495 555 21854 76939 77167 740 0,54653263 1‐ predicted RNA 1572 0 0 1453 1673 29 0 1306 0,490418608 1‐ predicted RNA 5313 0 10 4650 6950 20 0 5107 0,470228024 1mmpS4 MAP1241c 2366 9541 10437 668 3176 14832 13186 871 0,541793499 1‐ predicted RNA 671 33 24 1173 650 4 37 952 0,546556882 1‐ predicted RNA 2180 29 242 1791 2939 70 73 1982 0,513520689 1‐ predicted RNA 19485 56699 53138 4623 17510 69255 62468 4739 0,475699205 1pstA MAP1242 16541 70364 71576 164 18663 90639 79035 181 0,471552934 1‐ MAP1243 829 2279 1903 121 421 2574 1586 91 0,509885873 1‐ MAP1244 863 4292 3899 99 2086 3196 3646 112 0,524586547 1‐ predicted RNA 10516 48698 31000 6166 12072 25434 26116 4574 0,543241371 1‐ predicted RNA 4773 21905 24205 3770 5312 48282 42948 6355 0,596389785 1‐ predicted RNA 3212 4010 5506 3882 4315 5461 6226 4526 0,460908754 1‐ predicted RNA 6096 143 150 4005 6282 171 114 3469 0,49376387 1‐ predicted RNA 7147 259 312 1472 8614 322 69 1476 0,479591491 1‐ predicted RNA 1097 23 0 1428 1378 75 0 1524 0,515782639 1‐ predicted RNA 3159 278 77 1922 4636 0 49 2299 0,529302929 1‐ predicted RNA 981 0 0 1380 682 0 20 815 0,259521624 1ileS MAP1246 2056 4399 5917 54 1927 5949 5632 53 0,484635906 1‐ MAP1247 144 1466 1261 37 286 1574 1393 43 0,510989168 1dinX MAP1248 108 531 496 10 244 346 539 11 0,421730879 1ansA MAP1249c 72 1214 687 22 120 782 500 16 0,34686561 1lspA MAP1250 36 445 574 20 143 108 429 17 0,328469843 1‐ MAP1251 216 1065 991 30 103 572 552 15 0,147212998 1‐ MAP1252c 216 350 169 16 359 353 286 21 0,359855374 1glbN MAP1253c 0 36 30 1 36 108 71 6 5,34E‐04 1‐ MAP1254 1547 3651 3301 128 1547 4505 4701 142 0,52160917 1‐ MAP1255 722 2252 1956 82 725 3179 2872 99 0,523054914 1‐ MAP1256 122 375 550 31 50 463 395 22 0,291765758 1dnaE MAP1257 9284 21203 28288 229 12855 24524 25434 241 0,483070743 1‐ MAP1258c 36 14 36 3 36 36 36 3 0,945411452 1‐ MAP1259 134 851 1055 50 125 898 622 38 0,565981501 1

47


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



fadD11_1 MAP1260 47 842 784 9 71 447 201 4 0,042479206 1plsB1 MAP1261 179 1613 1247 18 699 1031 1057 21 0,516136978 1‐ MAP1262 134 178 85 8 217 144 243 12 0,182423909 1‐ MAP1263 667 6075 5567 319 1402 6400 3882 316 0,488394523 1ilvA MAP1264 519 1085 1512 33 979 1008 1165 37 0,517559649 1‐ MAP1265 248 0 69 13 108 36 70 6 0,034229457 1‐ MAP1266c 233 745 826 29 157 485 808 22 0,457233806 1‐ MAP1267 84 254 283 6 108 213 106 4 0,3098511 1glgZ MAP1268c 1626 1369 1745 47 1146 3788 2552 52 0,518701583 1glgY MAP1269c 1115 751 1621 26 389 2682 1497 22 0,501372528 1glgX_1 MAP1270c 4096 8587 10942 151 3776 15118 14238 180 0,522687394 1‐ MAP1271c 1505 3497 3791 56 1248 4795 4038 56 0,489153901 1‐ MAP1273c 288 684 1175 99 180 646 1051 77 0,987411997 1bioA MAP1274 72 676 481 10 280 822 556 16 0,294910636 1bioF MAP1275 357 1624 710 30 291 769 792 20 0,569586414 1bioD MAP1276 180 410 293 18 72 221 197 8 0,061077417 1‐ MAP1277 166 448 835 36 273 345 912 40 0,630921966 1‐ MAP1279c 1371 1075 685 28 876 11275 5614 85 0,103806133 1‐ MAP1280c 136 324 316 7 130 517 323 8 0,549446997 1‐ MAP1281c 72 706 292 33 31 736 345 31 0,436750522 1‐ MAP1282c 934 2586 1493 38 708 5373 2071 49 0,532927256 1bioB MAP1283 1525 4606 5585 148 1154 5346 4312 122 0,498719525 1‐ MAP1284 216 3286 4922 386 229 3992 4482 387 0,493627258 1‐ MAP1285 379 488 914 45 330 726 903 43 0,501394432 1‐ MAP1286c 1436 7426 5180 129 1479 4659 4401 97 0,501833379 1IS1601_B_3 MAP1287 215 853 430 16 141 451 674 12 0,364111693 1‐ MAP1288c 288 796 466 30 106 1195 625 28 0,882752995 1‐ predicted RNA 757 636 219 1646 232 623 528 888 0,205857768 1nadA MAP1289 1933 6832 2252 144 1563 4581 3214 113 0,503043894 1nadB MAP1290 1222 2081 1298 46 587 1094 817 21 0,227425177 1nadC MAP1291 1079 2552 2539 101 710 1734 1922 65 0,545430923 1‐ MAP1292c 613 711 177 68 406 466 239 43 0,283073779 1hisD MAP1293 567 2195 1163 35 601 819 616 21 0,74781211 1hisC MAP1294 788 1178 1465 43 957 880 838 36 0,49270809 1

48


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



hisB MAP1295 625 2328 2513 111 468 1740 1292 68 0,955138261 1hisH MAP1296 773 2081 3832 139 1057 2201 2714 126 0,509898663 1hisA MAP1297 631 1428 1623 70 601 1605 1486 64 0,49125134 1impA MAP1298 136 338 774 20 135 728 487 19 0,740922085 1hisF MAP1299 206 703 1612 38 365 1658 627 39 0,50403328 1hisI MAP1300 129 1154 1247 82 129 1253 1276 83 0,501795991 1chaA MAP1301 395 801 1022 28 601 1250 1330 38 0,630182034 1bcpB MAP1302c 775 4224 4894 212 957 3852 3266 173 0,505281041 1trpE MAP1303 1301 3165 2902 67 1126 2798 2684 55 0,515645654 1‐ MAP1304 277 1157 1099 73 360 775 831 60 0,64948948 1trpC MAP1305 2326 8198 9449 312 2587 7370 6255 251 0,504460674 1trpB MAP1306 3198 5018 6941 179 5092 5361 4249 184 0,476850985 1trpA MAP1307 793 2977 3327 110 1553 3093 2950 125 0,525587873 1lgt MAP1308 1930 3198 3526 102 2865 4266 3230 118 0,521317676 1‐ MAP1309 264 704 1031 62 307 1286 981 73 0,581522018 1pykA MAP1310 3931 10243 11408 245 2804 13449 12113 233 0,491877997 1tesB1 MAP1311 878 1582 1928 71 854 2061 1651 66 0,500123121 1‐ MAP1312 1252 9140 6017 132 2349 12041 8251 181 0,560003322 1cydC MAP1313c 1136 3055 4199 65 2515 4154 4131 89 0,537112735 1cydD MAP1314c 671 2759 3968 56 1473 2558 2671 57 0,491548353 1cydB MAP1315c 1117 27412 16778 460 4596 20062 14229 445 0,491223438 1appC MAP1316c 11050 46201 35966 806 28545 41257 34166 1035 0,545742216 1‐ predicted RNA 941 82 17 872 3511 48 73 2683 0,044797296 1‐ predicted RNA 1630 0 0 1465 3699 0 0 2791 0,935332289 1‐ predicted RNA 399 0 0 922 853 0 0 1655 0,212873832 1‐ MAP1317c 1685 16912 7046 491 2253 9681 6686 374 0,514405208 1‐ MAP1318c 681 4944 5311 95 2000 5508 5122 120 0,527691917 1‐ MAP_t21 11 209 151 53 60 240 211 82 0,151657729 1‐ MAP1319 1396 5632 2552 202 2400 3323 1767 183 0,495614873 1‐ MAP1320c 469 1132 1268 32 420 987 896 24 0,647098822 1‐ MAP1321c 288 896 818 60 318 860 386 46 0,822201649 1polA MAP1322 2334 4510 4777 61 2081 4286 3834 49 0,498023512 1‐ MAP1323 144 178 292 15 283 215 206 18 0,316629852 1‐ MAP1324 251 638 994 16 195 784 566 12 0,571405272 1

49


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



rpsA MAP1325 33721 60247 80124 1756 35950 79017 73104 1731 0,489670294 1‐ predicted RNA 1386 0 0 1281 1034 31 0 810 0,865442098 1‐ predicted RNA 22525 101 34 12591 21578 56 52 10125 0,53417062 1‐ predicted RNA 837 113 118 1226 966 144 57 1173 0,497464527 1coaE MAP1326 1649 1072 1641 66 1318 1957 1613 58 0,512866035 1‐ MAP1327c 317 1576 759 80 719 536 428 70 0,495413316 1‐ MAP1328c 47 213 330 9 151 547 359 16 0,088611809 1‐ MAP1329c 1314 1183 2368 74 1355 2412 2535 81 0,513764138 1‐ MAP1330c 346 1012 1202 72 236 1717 1607 85 0,515259609 1‐ MAP1331c 349 752 865 10 173 1523 1401 13 0,593465407 1pknF MAP1332 30 191 168 2 36 250 144 2 0,871106656 1‐ MAP1333 64 702 321 15 350 384 510 23 0,297044276 1‐ predicted RNA 767 633 707 1926 891 1349 1220 2493 0,521720889 1‐ predicted RNA 1465 48 0 1367 1743 0 0 1352 0,487315088 1‐ MAP1334 699 3047 1561 197 850 3276 2609 234 0,521324058 1uvrB MAP1335 2124 10107 9351 122 2500 10055 10006 124 0,476028533 1‐ MAP1336 155 885 894 21 318 1042 835 25 0,887520585 1‐ MAP1337c 97 1074 792 30 215 1910 855 44 0,571178783 1‐ MAP1338c 809 1647 2479 37 575 2046 2469 33 0,50467453 1‐ MAP1339 2558 24393 10562 968 3081 15713 11733 800 0,514127158 1‐ MAP1340c 444 1166 806 43 916 982 762 54 0,515966853 1uvrA MAP1341 1888 10009 8265 84 1833 9868 7579 76 0,492982309 1‐ MAP1342c 65 508 248 40 252 457 249 57 0,256300076 1‐ MAP1343 594 8300 4907 207 1118 6497 3980 181 0,494264259 1‐ MAP1344 591 1353 1172 32 583 1721 1405 34 0,484100358 1‐ MAP1345 917 5124 2891 183 1290 4548 3148 184 0,483245019 1‐ MAP1346c 745 2066 2760 76 918 2235 3783 90 0,522632082 1‐ MAP1347c 1329 1545 2599 96 909 1860 2328 75 0,522160206 1moeY MAP1348c 724 4088 2743 43 864 3158 3693 43 0,492518008 1‐ MAP1349c 205 504 393 23 122 303 252 13 0,122808323 1‐ MAP1350c 1320 3408 2685 70 1462 2406 2045 56 0,518186909 1lysS MAP1351c 2964 7613 7509 70 2600 7825 8442 66 0,487753704 1‐ predicted RNA 2115 16232 11372 4682 2346 11476 10736 3865 0,501149954 1‐ predicted RNA 114 8466 6157 6298 86 9593 7384 7106 0,524397321 1

50


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



infC MAP1352 8531 64597 40052 2389 8965 53062 40438 2107 0,513589764 1‐ predicted RNA 516 4068 4719 3441 431 5624 4133 3489 0,481813842 1‐ predicted RNA 7324 1137 498 1835 4967 1201 666 1109 0,570925642 1‐ predicted RNA 3490 81 50 3006 3328 114 49 2420 0,511169743 1‐ predicted RNA 1400 0 0 1562 1666 0 0 1560 0,485520575 1‐ predicted RNA 2370 150 68 1643 2423 95 28 1395 0,512878664 1rpmI MAP1353 4720 19008 18237 2727 4390 23167 21407 2897 0,505899881 1‐ predicted RNA 1003 0 24 1363 783 0 23 896 0,637478484 1‐ predicted RNA 3737 139 52 1861 2613 229 0 1106 0,562064746 1rplT MAP1354 3840 13502 12286 975 3110 11704 9925 757 0,507468082 1‐ predicted RNA 980 1 7 1223 1336 23 0 1403 0,509701883 1tsnR MAP1355 445 550 539 32 104 632 287 14 0,108767651 1‐ MAP1356c 106 1771 606 25 224 3411 2848 64 0,094131338 1‐ MAP1357 1095 4066 3209 112 1315 2165 2588 86 0,522403868 1‐ MAP1358 646 4676 3173 121 511 3169 3538 99 0,518975465 1pheS MAP1359 725 1044 1042 42 1068 1012 513 41 0,484904611 1pheT MAP1360 1494 1492 2055 34 846 1672 1512 22 0,558199791 1argC MAP1361 334 4664 3298 87 828 1981 1411 53 0,618551217 1argJ MAP1362 873 1588 1549 49 838 525 568 27 0,683299249 1argB MAP1363 1476 5940 4610 173 1809 2142 1571 96 0,718888753 1argD MAP1364 793 9962 6935 159 1164 2755 2969 72 0,6985639 1argF MAP1365 1467 5512 3309 146 1987 2205 2052 103 0,515363993 1argR MAP1366 361 2634 2546 130 264 1238 1801 77 0,867284266 1argG MAP1367 1109 13894 6907 203 1685 3855 2850 93 0,552263006 1argH MAP1368 888 4804 3376 78 1388 1191 971 41 0,913940259 1pks10 MAP1369 832 3681 3593 95 2173 2337 2299 99 0,480146243 1pks7 MAP1370 1727 15892 8753 49 5088 11073 8700 55 0,47360233 1pks8 MAP1371 1838 7289 4889 55 3973 5842 3984 62 0,466399781 1‐ predicted RNA 659 5492 8361 7472 857 6825 7854 7805 0,478686687 1pks11 MAP1372 1490 7414 9564 209 1557 8363 8787 202 0,484863947 1‐ MAP1373c 508 284 177 16 522 538 426 18 0,98717056 1‐ MAP1374c 425 574 427 13 650 908 1086 21 0,503655286 1‐ MAP1375c 365 674 540 21 392 2487 1317 42 0,197556699 1‐ MAP1376c 180 669 708 20 179 1119 1022 27 0,678755156 1

51


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP1377 108 1211 745 29 104 612 773 21 0,373566439 1‐ MAP1378 108 191 266 11 36 292 195 8 0,250426827 1‐ MAP1379 73 353 241 7 252 299 284 11 0,193276234 1‐ MAP1380 144 168 347 12 288 223 183 14 0,354601015 1‐ MAP1381 29 152 135 4 0 251 245 6 0,389959311 1‐ MAP1382c 72 75 141 4 0 671 450 9 0,019632451 1‐ MAP1383c 36 103 91 3 72 697 251 10 1,60E‐04 1‐ MAP1384c 72 229 335 4 152 907 344 8 0,082045718 1‐ MAP1385c 180 229 34 4 116 1228 600 12 0,024627351 1‐ MAP1386c 0 108 36 1 72 251 163 8 1,23E‐04 1‐ MAP1389 1549 3039 2663 37 1266 3435 2179 30 0,511309468 1‐ MAP1390 274 1014 1589 165 177 1175 1189 132 0,602837381 1‐ MAP1391c 593 581 501 48 497 526 640 40 0,607860897 1‐ MAP1392c 66 365 211 11 23 252 72 5 0,038282438 1‐ MAP1393c 72 288 283 10 107 387 224 11 0,790686027 1amt_1 MAP1394c 200 491 418 12 88 357 250 6 0,094433772 1‐ MAP1395 128 39 37 7 121 100 103 8 0,750087234 1tyrS MAP1396 1014 1378 1803 51 680 1172 1266 34 0,769260272 1‐ MAP1398 129 360 421 15 101 482 586 17 0,637452196 1‐ MAP1399 305 139 310 14 242 326 363 13 0,477230969 1‐ MAP1400 215 431 617 95 231 752 643 108 0,550883137 1tlyA MAP1401 350 1983 1366 55 552 1529 1944 62 0,516519765 1ppnK MAP1402 593 2364 3034 80 929 2113 2394 76 0,503629173 1recN MAP1403 504 1752 1430 27 431 1697 1592 25 0,488190209 1‐ MAP1404 5013 26831 11578 459 3110 13405 10695 273 0,538110155 1‐ MAP1405 2791 15177 10174 361 1571 7924 7692 208 0,598414443 1‐ predicted RNA 2046 731 1000 2271 2019 1012 791 1965 0,51516119 1pyrG MAP1406 4678 11537 10879 216 3797 9887 8816 165 0,508297105 1‐ predicted RNA 2495 0 0 2242 1325 0 0 999 0,172692079 1‐ MAP1407 929 1465 3768 136 1095 2013 2220 116 0,516549025 1xerD MAP1408 578 1621 5456 99 360 3737 5464 110 0,523797872 1‐ MAP1409c 378 2845 1416 77 446 1971 1377 64 0,494662026 1‐ MAP1410 1310 3916 4709 138 1949 3484 2971 124 0,49680026 1‐ MAP1411 2375 5164 8678 268 2774 7204 8496 286 0,472736961 1

52


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 1267 0 27 1214 1503 34 0 1209 0,482662698 1‐ MAP1412 797 2199 3653 122 1362 3158 3228 142 0,528731341 1‐ MAP1413 1260 2083 3687 135 1038 3408 4025 139 0,481985043 1cmk MAP1414 1068 1059 1425 87 1016 1870 1706 92 0,509050189 1engA MAP1415 1093 2908 2794 66 926 4636 4232 81 0,529723433 1‐ MAP_t22 312 603 279 254 280 713 494 263 0,473921022 1‐ MAP1416c 1107 3173 2085 133 1366 2302 1672 114 0,516775846 1‐ MAP1417c 341 144 0 28 463 263 126 37 0,362587347 1mbtH_1 MAP1419 788 5196 2924 487 489 5206 3335 443 0,495252003 1‐ MAP1420 26797 124939 121378 176 29262 151952 135256 191 0,514361694 1‐ predicted RNA 620 27 7 1133 716 27 7 1098 0,487670333 1asnB_1 MAP1421 2795 6376 7598 129 3247 8782 7644 139 0,468930077 1‐ MAP1422 1863 6976 11211 138 3070 10882 10702 167 0,545571611 1‐ MAP1423 1550 2103 2676 70 1339 3502 3839 78 0,524011524 1‐ MAP1424c 108 323 217 19 288 896 264 41 0,070777781 1‐ MAP1425c 144 35 48 8 40 143 255 7 0,92861836 1‐ MAP1426c 72 107 72 6 144 179 107 10 0,128916983 1‐ MAP1427 287 685 684 16 416 871 892 20 0,993881341 1‐ MAP1428c 132 144 123 6 14 242 99 3 0,069410085 1‐ MAP1429 107 143 178 7 132 141 13 5 0,411551501 1‐ MAP1430c 213 331 316 15 264 672 367 19 0,371783555 1‐ MAP1431 468 3448 4471 141 1045 4868 4595 180 0,532679825 1‐ MAP1432 774 1810 926 35 550 1972 985 29 0,4923175 1‐ MAP1433c 318 427 319 10 472 358 355 11 0,528310482 1‐ MAP1434 246 485 442 15 198 1282 856 23 0,333492515 1‐ MAP1435 216 367 286 19 227 432 323 19 0,833902321 1‐ MAP1436c 93 35 36 4 108 144 36 5 0,480689743 1‐ MAP1437c 72 108 36 3 36 180 202 4 0,320776495 1lipH MAP1438c 0 36 72 1 0 47 174 2 0,060698242 1‐ MAP1439c 0 108 144 3 72 80 74 4 0,387152994 1‐ MAP1440c 137 594 288 25 166 507 387 25 0,858349406 1‐ MAP1441 0 251 404 3 247 459 232 6 0,059206821 1‐ MAP1442 107 122 159 7 108 36 80 4 0,205586113 1‐ MAP1443c 0 203 84 4 76 288 285 13 0,005883402 1

53


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP1444c 0 140 175 8 0 405 247 16 0,04721575 1‐ MAP1445c 0 174 215 4 36 104 60 2 0,180464438 1‐ MAP1446c 47 1587 1086 33 216 1825 1157 41 0,595875403 1‐ MAP1447c 323 7634 4634 88 907 5305 4194 78 0,497244618 1‐ MAP1448c 481 3448 1674 56 577 2783 1425 47 0,50600791 1‐ MAP1449c 107 20 281 8 64 288 203 8 0,934343696 1‐ MAP1450c 288 549 768 14 445 1220 745 19 0,786147268 1‐ MAP1451 45 0 38 2 63 89 103 4 0,075069631 1‐ MAP1452c 635 999 1280 48 431 1780 1614 50 0,483567755 1‐ MAP1453c 537 1072 1559 28 411 6190 3648 69 0,200363163 1‐ MAP1455c 107 249 308 15 233 143 179 16 0,840582836 1‐ MAP1456 35 580 190 7 180 866 511 16 0,067655456 1‐ MAP1457 1664 9262 8264 90 2138 10969 9174 100 0,464061383 1‐ MAP1458 153 1268 695 20 103 930 306 12 0,228498821 1‐ MAP1459 0 853 602 12 36 889 961 17 0,351681792 1‐ MAP1460 0 412 363 16 0 189 234 8 0,07594527 1‐ MAP1461 0 119 187 7 36 209 141 10 0,281548466 1‐ MAP1462 108 192 179 6 72 355 302 7 0,588173517 1‐ MAP1463 214 1190 1109 18 287 1094 1078 17 0,496420888 1fadD1_1 MAP1464 251 1398 981 19 419 697 1099 18 0,494800217 1‐ MAP1465c 778 2386 612 37 556 2135 1238 33 0,49510899 1‐ MAP1466c 86 1043 1027 21 96 1019 710 17 0,760399405 1‐ MAP1467c 316 3850 2539 63 337 3751 2614 61 0,501993318 1‐ MAP1468c 225 1505 1731 42 288 861 891 26 0,779756214 1‐ MAP1469c 451 4300 1991 62 384 2026 1886 40 0,658549565 1‐ MAP1470c 143 1746 665 39 300 736 360 26 0,428788369 1‐ MAP1471 137 428 321 28 321 359 232 34 0,391805457 1‐ MAP1472c 286 1958 1583 91 245 1517 1044 64 0,765508665 1‐ MAP1473c 1619 3942 2872 199 1187 2705 2276 135 0,53534755 1sigF_1 MAP1474c 606 2952 4165 114 383 5176 5441 144 0,531524334 1‐ predicted RNA 1341 264 476 1547 640 432 628 855 0,5229122 1‐ MAP1475 171 261 387 13 144 216 120 7 0,132135357 1‐ MAP1476c 291 208 394 22 251 143 243 15 0,285769679 1‐ MAP1477c 528 3695 2073 110 622 2454 1342 79 0,516620859 1

54


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP1478 107 535 452 7 337 385 230 8 0,424060977 1‐ MAP1479c 93 144 201 10 2 199 229 7 0,232486842 1‐ MAP1480 0 105 11 1 0 0 57 1 0,217989153 1‐ MAP1481c 1106 154 1114 33 425 2516 1397 33 0,487930254 1‐ predicted RNA 2445 107 627 2070 650 1157 1859 1158 0,955938958 1‐ MAP1482 1494 4195 4246 148 1670 8062 5821 201 0,535993047 1‐ MAP1483c 144 141 144 4 237 107 143 5 0,514839326 1‐ MAP1484c 72 262 193 4 216 214 245 7 0,156829162 1‐ MAP1485c 216 455 167 10 72 293 201 5 0,086223745 1‐ MAP1486c 61 1475 1199 33 326 2269 1518 52 0,828660657 1‐ MAP1487c 97 214 234 7 178 546 277 12 0,13681155 1‐ MAP1488c 107 496 339 11 112 251 214 7 0,171341893 1‐ MAP1489c 102 247 153 8 163 431 346 13 0,129215782 1‐ MAP1490 0 228 190 4 22 334 159 6 0,413271991 1‐ MAP1491 36 36 101 9 0 0 0 0 1 1‐ MAP1493c 144 1141 667 12 369 232 304 8 0,302578356 1‐ MAP1494 454 1245 1072 68 545 1230 1443 74 0,519344716 1‐ MAP1495 324 840 348 48 134 2795 863 84 0,257032543 1‐ MAP1497c 576 1399 852 20 502 934 1019 16 0,506741816 1‐ MAP1498c 174 503 320 27 157 247 167 16 0,141461944 1‐ MAP1499c 0 410 285 7 144 424 359 13 0,121503142 1‐ MAP1500c 187 627 902 10 180 696 450 7 0,348575322 1‐ predicted RNA 154 4380 5142 3015 275 6991 6058 4045 0,538016313 1‐ MAP1501 954 5444 4583 87 2763 5249 3696 107 0,526266558 1‐ MAP1502 5085 23496 26177 161 9324 26857 24181 182 0,524961032 1‐ MAP1503c 1021 996 1083 41 1362 1042 1301 46 0,513476451 1‐ MAP1504 108 391 345 56 69 666 365 61 0,5251738 1‐ MAP1505 776 3757 2165 66 922 1580 1328 42 0,580006419 1‐ MAP1506 1448 25089 17797 391 1917 21617 12857 318 0,528057749 1‐ predicted RNA 14614 26962 13157 5896 24059 21042 15540 6860 0,454858788 1PE_4 MAP1507 5632 49539 16926 2793 10825 37943 25717 3069 0,470911835 1‐ predicted RNA 4251 16852 6043 3399 9098 12989 8434 4277 0,529169701 1‐ MAP1508 10438 124228 59555 7298 21850 129862 76479 8792 0,537698481 1‐ MAP1509 3120 7235 8826 294 3002 7255 6613 243 0,503676289 1

55


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 281 1549 3566 2316 791 3373 4385 3719 0,554317626 1‐ MAP1510 1043 9253 5808 122 1965 7495 5443 119 0,480784734 1‐ MAP1511 4515 23911 22088 335 8008 31324 23423 415 0,537119347 1‐ MAP1512 1647 6436 4570 135 2611 6369 4369 146 0,475056587 1‐ MAP1513 5108 15978 25374 323 6308 26422 24442 371 0,522762128 1‐ predicted RNA 336 5519 4711 3273 343 3183 2079 1743 0,894032872 1‐ predicted RNA 13564 273 389 9287 20613 210 308 11776 0,533347038 1‐ predicted RNA 1217 0 31 1281 2356 62 0 2082 0,676097763 1‐ predicted RNA 3442 19 42 2800 5702 121 57 3915 0,538993961 1‐ predicted RNA 1540 600 264 1622 3140 678 160 2588 0,546971656 1‐ predicted RNA 11298 866 427 2057 21826 785 390 3284 0,56296097 1‐ predicted RNA 1312 3 0 1370 2233 0 0 1956 0,52593627 1‐ predicted RNA 459 16 0 937 954 32 0 1637 0,223313792 1PE_5 MAP1514 79 695 303 41 119 73 318 24 0,135790226 1‐ MAP1515 0 536 352 7 86 72 177 4 0,091610751 1‐ MAP1516 133 496 320 10 106 159 139 4 0,056708515 1‐ MAP1517 105 88 129 15 1 71 36 2 1,46E‐06 1‐ MAP1518 34 72 55 1 43 108 82 2 0,526491342 1‐ MAP1519 16 108 106 1 102 122 72 3 0,112719453 1‐ MAP1520 66 0 91 9 36 127 142 10 0,572820476 1‐ MAP1521 3085 3661 22390 303 1545 75777 38371 923 0,531165822 1‐ MAP1522 4385 539 10056 184 2110 17239 15732 279 0,558656474 1‐ MAP1523 2206 535 8326 519 1237 15867 18076 1173 0,846809232 1‐ predicted RNA 2949 0 219 1051 1315 88 70 400 0,097518554 1mgtC MAP1524 324 413 1352 40 72 2698 2588 76 0,427264689 1‐ MAP1525 1756 2717 2890 128 2144 3976 2700 140 0,520566551 1‐ MAP1526 1704 4716 2005 179 1308 3166 2841 140 0,510621381 1‐ MAP1527c 547 964 533 62 697 821 1151 75 0,51298716 1‐ MAP1528 344 678 546 33 464 626 706 37 0,692016448 1‐ MAP1529 144 742 492 44 238 712 344 43 0,777236616 1‐ MAP1530 381 2554 1240 33 545 929 620 20 0,780763735 1‐ MAP1531c 681 2585 2416 37 1006 2630 2601 41 0,512157174 1‐ MAP1532 143 1230 1033 43 108 1225 704 34 0,97394166 1‐ MAP1533 250 741 931 25 158 817 357 15 0,257520868 1

56


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



secA2 MAP1534 2206 4789 5690 76 1993 4520 4961 64 0,497205673 1pgsA2 MAP1535 108 324 146 12 0 610 251 12 0,98468194 1‐ MAP1536 161 3451 1919 63 349 2202 2344 59 0,497968796 1‐ MAP1537 216 234 356 39 72 227 327 22 0,12577865 1‐ MAP1538 403 1499 1985 58 525 1834 1674 58 0,487871017 1gcvH MAP1539 854 3879 2771 237 987 2850 2336 196 0,520369686 1‐ predicted RNA 1744 14439 17470 3688 2737 17762 15319 3885 0,507131051 1‐ MAP1540 6212 42714 32009 1990 7500 42068 35354 2029 0,478151456 1‐ MAP1541 2486 7994 11775 377 2995 10531 9958 380 0,477387134 1‐ MAP1542 2531 16102 15172 808 2519 18608 17249 862 0,507611167 1‐ predicted RNA 2756 3197 7476 3403 2496 8298 9564 4211 0,548093393 1‐ predicted RNA 3020 226 88 1738 3794 192 72 1820 0,479929291 1‐ predicted RNA 973 0 37 1226 1183 0 25 1246 0,49430354 1‐ MAP1543 3384 23033 22693 848 4111 21380 20767 788 0,512747332 1‐ predicted RNA 3297 84 30 1658 2809 136 54 1202 0,530805874 1‐ MAP1544 2180 4490 5732 713 1631 4621 4121 534 0,502173138 1gcvB MAP1545 1978 2915 5129 52 1591 3402 3540 40 0,504570993 1‐ MAP1546c 150 287 423 17 234 613 429 24 0,346951082 1‐ MAP1547c 196 294 250 13 201 69 128 8 0,161282107 1‐ MAP1548c 2735 4515 5818 94 2477 4741 4797 79 0,497195185 1‐ predicted RNA 1142 0 0 1368 892 0 0 897 0,815389793 1glcB MAP1549c 7721 21517 19802 303 5124 19725 14604 217 0,551134446 1‐ predicted RNA 1008 81 45 1254 792 0 76 828 0,704695855 1‐ MAP1550c 171 6252 7743 143 486 8010 6567 151 0,482605632 1‐ MAP1551c 465 3592 3031 60 657 2342 1983 44 0,522674429 1‐ MAP1552 962 1354 545 148 1318 917 754 156 0,487304377 1fadE14 MAP1553c 2395 23837 8855 343 4920 20375 14180 406 0,522031594 1fadD33_2 MAP1554c 1507 4851 1179 68 3779 4382 2848 110 0,549655546 1‐ MAP1555c 90 1820 164 81 659 645 442 105 0,825070944 1guaB1 MAP1556c 474 2738 2162 45 753 2638 1640 43 0,497842739 1gnd MAP1557c 2075 4781 3692 103 2699 4996 2897 102 0,487178787 1‐ MAP1558c 431 1918 1376 49 611 970 890 37 0,612740872 1‐ MAP1559c 3315 8908 13800 814 3595 18378 16093 1051 0,531370883 1‐ MAP1560 865 1249 1153 123 826 1825 1155 122 0,490751982 1

57


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



ndh MAP1561c 1198 4880 5524 104 1547 1952 2265 61 0,614278267 1‐ MAP1562c 907 4273 3444 279 1503 5337 3197 323 0,526550463 1‐ predicted RNA 821 333 266 1254 1720 509 360 2126 0,888936244 1‐ predicted RNA 394 10 0 1284 297 0 10 817 0,165483124 1‐ predicted RNA 2560 0 0 2301 3129 0 0 2361 0,505802723 1‐ MAP1563c 4163 8027 4970 288 3903 9645 5947 281 0,480776094 1‐ MAP1564c 444 3432 1265 89 1344 4216 1697 137 0,546880006 1modA MAP1565 134 1137 252 23 467 360 107 22 0,551516909 1‐ MAP1566 2369 9560 7334 230 2607 14885 13536 330 0,558269776 1modB MAP1567 76 390 211 10 0 189 149 4 0,012902852 1modC MAP1568 72 41 250 4 72 27 215 4 0,621149348 1modD MAP1569 1989 11465 4703 202 1589 9272 5442 168 0,497816499 1adhA_1 MAP1571 581 1128 743 36 392 1238 778 29 0,534067612 1‐ MAP1572c 928 5029 4196 163 575 5074 3562 133 0,502851537 1‐ MAP1573c 1080 3835 3525 45 1648 5391 4452 59 0,535162923 1‐ MAP1574c 300 746 404 24 216 471 414 17 0,306326712 1uppP MAP1575c 72 426 285 10 216 473 507 17 0,180181106 1‐ MAP1576 657 948 995 16 926 879 784 17 0,481909424 1‐ MAP1577 625 950 930 26 608 935 595 21 0,528561427 1‐ MAP1578 362 1638 627 16 305 1033 962 13 0,547210238 1‐ MAP1579c 509 3788 3482 73 1931 5640 3537 115 0,545792415 1‐ MAP1580c 95 228 108 8 108 359 534 16 0,073719075 1‐ MAP1581c 36 387 184 10 0 213 71 4 0,009621166 1‐ MAP1582c 36 472 359 28 288 287 241 39 0,272960171 1‐ MAP1583c 882 3838 2853 240 1781 5319 3588 341 0,539904536 1‐ MAP1584c 718 1191 1237 20 780 1310 1587 21 0,486139958 1lldD2 MAP1585c 468 1444 2053 40 741 2062 1800 46 0,515352805 1oxyR MAP1590 746 7571 7752 184 916 4160 3008 97 0,990439518 1‐ MAP1591 332 3206 2600 99 479 1936 1833 72 0,509689257 1‐ MAP1592 464 1740 1149 99 63 1627 997 61 0,802364513 1‐ MAP1593 723 3544 2056 105 1251 2235 1759 98 0,507236299 1‐ MAP1594c 196 448 204 68 206 127 53 39 0,118865626 1‐ predicted RNA 0 3750 7559 9814 8 8329 6579 12344 0,530403333 1bfrA MAP1595 4544 25643 23470 1346 2979 15742 11028 718 0,563902535 1

58


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 2104 13 75 1917 1221 0 0 921 0,257452741 1‐ predicted RNA 523 0 0 1128 497 0 4 903 0,364512501 1‐ MAP1596 860 1842 3059 37 607 1884 1355 23 0,781780195 1‐ MAP1597 466 4362 2469 168 899 2603 1382 127 0,522163576 1‐ MAP1598 70 858 320 15 311 643 323 20 0,371589517 1glnA3 MAP1599 337 354 209 12 123 389 134 6 0,073798882 1‐ MAP1600 102 214 212 6 36 108 319 4 0,327455848 1‐ MAP1601 1255 3826 2899 84 1105 4530 3195 82 0,485084801 1‐ MAP1602c 504 285 945 63 600 680 1013 73 0,503222468 1‐ MAP1603c 579 1514 1254 34 567 1795 1066 32 0,486913315 1lppE MAP1604c 662 2129 1816 145 863 1795 1874 142 0,49625089 1‐ MAP1605c 1280 2816 1528 101 1686 2671 2227 113 0,520628161 1‐ MAP1606c 386 2569 1862 119 786 3624 3716 198 0,575302026 1‐ MAP1607c 968 1085 1287 108 1463 3495 2646 195 0,765145952 1‐ MAP1608c 654 1003 2842 121 537 1467 1539 88 0,536982528 1fbpB MAP1609c 36732 181130 117884 4223 60613 142563 95872 4021 0,511530881 1‐ predicted RNA 16204 248 72 10550 28558 67 0 15528 0,556787623 1‐ predicted RNA 2834 65 36 1783 4193 118 0 2211 0,530663003 1‐ predicted RNA 6967 56 0 4808 11530 0 34 6672 0,560069959 1‐ predicted RNA 1650 34 0 1492 2983 75 3 2270 0,536903542 1‐ predicted RNA 3169 42 21 2105 4596 78 66 2577 0,531258619 1‐ MAP1610 2279 3142 7744 320 2429 6314 8564 372 0,53675792 1‐ predicted RNA 991 52 58 1185 964 0 32 947 0,662125867 1‐ MAP1611 1037 1168 2192 59 934 1555 1672 50 0,507670735 1‐ MAP1612c 764 1542 1920 106 436 2177 1338 81 0,500054189 1adhA_2 MAP1613c 1136 2208 1726 75 1142 2044 1297 62 0,512658426 1‐ MAP1614c 539 3942 1963 59 424 1307 1089 27 0,193227121 1‐ MAP1615 588 4002 1690 189 870 2253 1975 164 0,509390663 1‐ MAP1616 145 847 407 54 131 336 315 31 0,185555699 1‐ MAP1617 345 642 321 89 310 258 196 55 0,245762235 1‐ MAP1618c 709 3825 1681 68 1059 1615 1274 50 0,519868988 1‐ MAP1619 288 158 179 9 105 213 280 5 0,151692351 1‐ MAP1620 396 871 885 15 422 942 1038 15 0,503722391 1‐ MAP1621 143 324 84 8 36 143 106 3 0,013704465 1

59


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP1622c 628 1353 1185 50 673 1582 1508 54 0,515202741 1‐ MAP1624 335 2480 1880 179 574 3036 2182 219 0,519856006 1cinA MAP1625 358 1472 1468 31 367 1847 1545 33 0,481740177 1nanT MAP1626c 450 1537 853 30 347 965 705 20 0,954264615 1‐ MAP1627 808 10119 8227 198 1506 7843 7865 186 0,485500526 1‐ MAP1628 672 3254 3313 227 1036 5696 4040 318 0,539785495 1aao MAP1629c 393 1090 983 34 534 1002 1310 39 0,513812368 1‐ MAP1630c 363 4272 3183 138 865 2629 2256 115 0,520030387 1‐ MAP1631c 214 1752 1067 51 432 1202 1024 50 0,490266168 1‐ MAP1632c 144 108 0 4 101 71 144 3 0,738812789 1‐ MAP1633c 72 36 36 8 72 36 32 7 0,668695188 1‐ MAP1634 493 819 985 37 250 2207 2329 57 0,74524562 1‐ MAP1635c 435 431 503 37 243 429 713 29 0,570357438 1‐ MAP1636c 0 164 71 4 144 72 57 10 0,033817861 1‐ MAP1637c 404 1065 553 20 282 1179 778 18 0,498156484 1‐ MAP1638c 241 566 381 27 200 564 335 22 0,380604226 1‐ MAP1641c 0 201 36 7 72 35 71 9 0,45180921 1‐ MAP1642 36 0 0 1 65 0 37 3 0,167228725 1aceAb MAP1643 3487 19257 13585 193 3852 18113 13442 182 0,510177772 1‐ MAP1644 250 346 232 30 102 981 304 32 0,656897136 1‐ MAP1645 1329 5373 2657 105 1227 4726 2902 92 0,495990752 1‐ MAP1646c 604 2544 1895 137 777 2053 1641 123 0,502422386 1fadD31 MAP1647 280 653 776 12 360 986 436 12 0,495246094 1‐ MAP1648 180 517 707 25 108 716 752 24 0,594486793 1‐ MAP1649c 66 216 426 11 131 275 278 11 0,911200134 1‐ MAP1650 631 1910 466 91 1427 1073 659 116 0,520507986 1‐ MAP1651c 30 306 219 8 349 216 116 17 0,0514179 1‐ MAP1652c 252 833 624 23 397 582 774 25 0,687321622 1tpx MAP1653 2753 8209 6115 472 4553 5952 4677 462 0,483279901 1‐ predicted RNA 457 13 0 994 867 0 0 1570 0,273862198 1‐ MAP1654c 911 251 206 35 1278 534 316 44 0,515883554 1‐ MAP1655c 0 175 0 4 166 154 0 15 8,56E‐04 1‐ MAP1656 260 1819 1366 34 254 1712 1363 31 0,485088267 1‐ MAP1657 625 1280 1266 51 252 1305 1582 39 0,531875008 1

60


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP1658 478 4267 5574 75 909 3514 3099 58 0,515902178 1‐ MAP1659 209 838 319 23 267 541 286 19 0,39719455 1‐ MAP1660 745 910 1010 51 530 553 427 28 0,399882208 1‐ MAP1661c 899 5489 2693 133 1199 4937 3317 137 0,482163511 1‐ predicted RNA 1698 783 1097 2064 544 5511 2070 2427 0,522144887 1‐ MAP1662c 553 2554 1342 86 446 2301 1459 74 0,497635383 1‐ MAP1663 349 732 410 34 245 842 731 33 0,495295779 1‐ MAP1664c 1065 1307 2588 70 1277 1241 1764 61 0,509170358 1‐ MAP1665c 916 2972 4391 139 935 2479 2717 102 0,529679974 1‐ MAP1666c 808 1167 1779 45 931 1220 947 37 0,497655208 1‐ MAP1667 634 3891 2188 99 665 3350 2159 88 0,511601951 1katG MAP1668c 4150 22129 15135 226 10040 53054 30108 482 0,607256526 1lppS_1 MAP1670c 536 2567 1269 43 180 12329 5403 136 0,078193393 1‐ MAP1671 0 72 92 2 91 216 86 6 0,00293157 1‐ MAP1672 252 93 0 5 144 644 227 7 0,261284859 1‐ MAP1673c 180 643 464 16 144 447 355 11 0,307427729 1‐ MAP1674c 143 312 694 12 181 363 222 9 0,292134228 1‐ predicted RNA 3374 5670 9199 3207 2341 7427 12687 3303 0,473569497 1‐ predicted RNA 2464 113 94 2045 1843 35 126 1294 0,644401509 1‐ MAP1675 423 672 698 109 328 1049 543 96 0,549018635 1‐ MAP1676 100 221 84 5 36 252 192 5 0,750258008 1‐ MAP1677 432 1456 1626 54 360 1620 1499 49 0,48649335 1‐ MAP1678 276 214 143 15 253 211 0 10 0,223598109 1‐ MAP1679c 606 674 239 43 491 338 570 34 0,927900109 1‐ MAP1680c 1301 2382 1875 128 1328 2103 2256 120 0,505795445 1‐ MAP1681c 170 725 398 21 173 975 533 25 0,441084674 1‐ MAP1682c 108 222 368 9 67 958 519 15 0,176762356 1‐ MAP1683c 108 383 637 12 324 392 311 14 0,423384307 1hrpA MAP1684 967 860 1226 13 870 993 1446 12 0,492894696 1‐ MAP1685 53 51 143 2 36 32 104 1 0,194950894 1‐ MAP1686 519 1434 964 42 981 479 527 37 0,485776892 1‐ MAP1687 1806 4048 4314 58 2314 5479 4404 65 0,520454845 1‐ MAP1688 179 1352 801 40 163 1112 600 30 0,863832184 1‐ MAP1689 785 2301 1455 51 522 2594 1396 42 0,503411136 1

61


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP1690c 171 180 250 12 136 252 142 9 0,237344061 1‐ MAP1691c 36 38 49 3 72 34 71 4 0,218847124 1fabG2_1 MAP1692 176 105 21 9 290 112 106 13 0,172623343 1‐ MAP1693c 716 1275 1523 91 831 1341 926 79 0,491807709 1papA2 MAP1694 681 3072 1516 44 1153 982 1113 34 0,508247112 1‐ MAP1695c 89 1623 227 47 139 1041 720 48 0,831203205 1hsp18_1 MAP1696c 207 59437 6989 1512 855 18165 7095 619 0,519989631 1‐ MAP1697 72 1953 826 78 179 514 201 30 0,054051899 1hsp18_2 MAP1698c 36 676 221 22 261 965 635 51 0,065481475 1thiI MAP1699 344 595 647 19 274 758 407 15 0,627634929 1‐ MAP1700c 89 250 466 8 208 358 778 14 0,197432669 1‐ MAP1701c 291 1935 1490 29 639 1967 1040 31 0,483946176 1‐ MAP1702c 108 177 227 10 173 123 16 8 0,498343849 1‐ MAP1703c 410 618 805 78 274 634 781 61 0,960773434 1‐ MAP1704c 545 3929 3762 238 516 4536 2316 200 0,518058057 1‐ MAP1705c 501 1215 1101 52 340 1408 776 40 0,619006618 1‐ MAP1708 139 107 51 9 99 509 307 16 0,096568107 1fadD11_2 MAP1709c 70 494 51 4 0 233 161 2 0,011465053 1‐ MAP1710 203 202 126 11 36 0 73 2 1,90E‐09 1‐ MAP1711c 72 465 366 18 36 512 361 16 0,458025506 1fadA_2 MAP1714 24 683 208 7 0 286 291 4 0,143945954 1fadB_2 MAP1715 6 955 429 6 72 360 399 4 0,246117805 1‐ MAP1716 30 216 40 4 0 35 67 1 0,006135566 1‐ MAP1717 619 5598 3068 165 887 3691 2620 133 0,516380513 1‐ MAP1719c 160 320 377 20 216 118 137 13 0,205185516 1‐ MAP1720 0 215 108 3 0 72 72 1 0,045737767 1‐ MAP1721c 527 1628 1382 70 639 2547 2143 95 0,525240174 1‐ MAP1722 4027 1810 756 127 1697 1677 1556 64 0,907746445 1‐ MAP1723 241 3237 1026 74 396 960 793 42 0,58650598 1‐ MAP1724c 214 35 53 14 212 93 125 14 0,970309459 1‐ MAP1727 69 696 261 12 82 253 197 7 0,123961051 1yfnB MAP1728c 138 719 322 20 216 324 331 17 0,388565148 1‐ MAP1729c 394 395 358 24 511 284 409 25 0,747211539 1‐ MAP1730c 251 698 403 18 200 461 678 16 0,434541541 1

62


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP1731c 0 94 54 5 0 23 0 0 1,01E‐11 1‐ MAP1732c 61 36 63 4 1 36 51 1 0,010241662 1‐ MAP1733 72 117 0 5 180 144 36 10 0,05438382 1‐ MAP1734 36 187 264 4 0 131 94 1 0,008887589 1‐ MAP1735 45 144 175 5 52 0 36 1 0,01196335 1‐ MAP1736 562 899 2045 80 467 857 714 46 0,642809223 1‐ predicted RNA 1094 4924 13180 4507 1270 3917 2817 2020 0,45074877 1mmpL5 MAP1738 7766 13992 81625 437 3797 12637 12970 124 0,084426713 1fabG3_1 MAP1739c 471 1315 934 48 547 867 235 32 0,905557412 1‐ MAP1740c 144 915 723 13 616 1159 734 22 0,282799391 1‐ MAP1744 0 330 19 7 0 16 94 2 0,013614935 1‐ MAP1745c 128 2313 441 81 165 840 500 46 0,230745129 1‐ MAP1747c 71 299 460 11 0 182 180 4 0,005626957 1‐ MAP1748c 36 561 526 9 36 461 277 6 0,191520009 1‐ MAP1749 180 491 254 16 144 206 419 12 0,338659297 1‐ MAP1750 286 368 298 30 109 329 229 16 0,091968116 1‐ MAP1751 368 421 216 15 254 143 107 8 0,100973529 1‐ MAP1752c 220 1067 958 28 125 1233 665 22 0,987548117 1‐ MAP1753 432 1098 743 24 508 1522 967 29 0,51230055 1‐ MAP1754c 654 6662 539 102 724 1596 1197 53 0,715891188 1‐ MAP1755c 118 71 31 5 175 128 93 7 0,228363384 1‐ MAP1757c 24 72 0 2 175 36 72 9 2,52E‐04 1nrtC MAP1758c 0 64 108 1 144 106 121 5 7,44E‐04 1‐ MAP1760c 461 1503 1968 39 576 3394 2468 58 0,530414421 1‐ MAP1761c 960 5050 4284 100 1551 5393 4501 112 0,520031111 1‐ MAP1762c 518 1486 1307 27 831 1893 1656 35 0,521105886 1‐ MAP1763c 36 72 166 4 144 271 245 10 0,010980826 1‐ MAP1764 509 1279 2218 183 489 1106 1508 138 0,553470492 1‐ MAP1765c 607 734 1644 45 263 1527 1564 39 0,487221463 1‐ MAP1766c 455 1124 1701 40 396 1693 1592 40 0,484390018 1‐ MAP1767c 251 360 491 20 143 288 429 13 0,283897899 1‐ MAP1768c 287 360 419 18 156 784 916 22 0,559836835 1‐ MAP1769c 154 182 633 10 216 636 501 12 0,378861171 1‐ MAP1770c 55 228 246 7 81 269 466 10 0,160029277 1

63


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP1771c 6289 2837 1526 202 2380 3083 1553 89 0,421623565 1‐ MAP1772 180 0 36 14 72 0 22 5 0,004352075 1‐ MAP1773c 526 1142 1902 60 495 1403 1018 46 0,549803505 1pncA MAP1774c 258 1739 993 63 72 1252 1169 46 0,856921394 1‐ MAP1775 682 890 644 35 309 4791 1532 64 0,950513941 1‐ MAP1776c 343 148 105 23 117 101 189 10 0,047910956 1‐ MAP1777c 102 3392 1498 133 116 1244 964 64 0,19146631 1‐ MAP1778c 0 93 208 6 106 85 11 7 0,547461103 1‐ MAP1779c 617 7966 6474 83 1374 6226 6455 82 0,483897255 1lipT MAP1780c 1018 3635 3211 65 915 2863 2720 51 0,522014917 1lppI MAP1781 72 756 667 24 236 954 381 28 0,428050001 1‐ MAP1782c 468 573 1004 25 774 447 340 23 0,495361738 1‐ MAP1783 108 572 2015 48 137 1378 1090 44 0,496200363 1‐ MAP1784c 163 703 510 28 359 676 533 35 0,580454669 1‐ MAP1785 3598 2114 1009 120 1522 1908 1227 59 0,996905333 1‐ MAP1786c 245 107 189 10 180 250 177 8 0,304185074 1‐ MAP1787c 144 107 251 9 68 248 127 6 0,177218147 1‐ MAP1788 29 568 661 22 180 728 1061 38 0,234051656 1‐ MAP1789 72 285 198 10 108 270 144 9 0,989193228 1morD MAP1790 47 180 179 3 127 396 142 5 0,119409023 1norQ MAP1791 0 192 142 4 144 108 143 8 0,052894871 1‐ MAP1792 381 241 248 31 653 227 272 41 0,531121035 1‐ MAP1793c 6814 3477 1427 220 2530 2758 1434 89 0,169876763 1‐ MAP1794 108 214 36 13 85 108 122 10 0,488783786 1‐ MAP1795c 964 1609 2098 26 859 1488 1672 21 0,509966867 1pks12 MAP1796c 13009 26511 31070 80 12071 36009 27575 76 0,49199021 1‐ MAP1798 1763 15084 11466 967 2004 12174 8344 763 0,507248141 1‐ MAP1799c 1856 2948 2624 145 2219 3270 3032 153 0,482190074 1‐ MAP1800c 1695 4211 5659 83 1537 5988 5248 81 0,486725742 1‐ MAP1801c 395 767 667 16 436 759 889 17 0,499390885 1fxsA MAP1802c 382 611 1132 59 612 1707 1252 88 0,959503746 1‐ MAP1803 612 4154 2185 118 1584 2861 2298 134 0,522087735 1‐ MAP1804c 654 1456 1786 142 1225 1686 1515 171 0,518570796 1cobN MAP1805c 1157 2145 2964 25 1521 2635 2198 25 0,496350848 1

64


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP1806c 95 36 194 7 84 211 176 8 0,655833673 1‐ MAP1807c 424 422 279 20 607 759 480 28 0,644319604 1‐ MAP1808c 71 144 205 7 144 424 215 13 0,104711084 1‐ MAP1809c 426 555 635 31 354 962 623 30 0,502741526 1cobG MAP1810 0 240 340 5 177 357 72 8 0,178089653 1cobH MAP1811 102 394 312 16 214 340 247 18 0,402440848 1cobI MAP1812 184 946 767 15 383 757 904 18 0,85444934 1‐ MAP1813c 83 0 34 1 141 17 76 2 0,147679484 1‐ MAP1814 1569 6662 4153 115 1946 4864 4197 103 0,492310943 1cobM MAP1816c 72 142 286 8 0 72 144 2 0,001942984 1cobL MAP1817c 70 72 175 4 36 236 117 3 0,772283536 1‐ MAP1818c 0 0 0 0 0 0 20 1 2,05E‐263 1‐ MAP1819c 72 396 104 12 36 237 92 7 0,026074646 1‐ MAP1820 2591 5174 10068 553 2061 8890 8719 531 0,485174675 1‐ predicted RNA 2251 666 707 2412 1812 766 710 1777 0,525853028 1‐ predicted RNA 1099 20 487 1465 674 380 605 1015 0,910747284 1‐ MAP1821c 288 3069 2078 113 460 2133 1223 84 0,518152918 1‐ MAP1822c 561 3975 3813 31 881 3417 3209 29 0,501591295 1pepE MAP1823c 36 729 668 13 206 1038 944 22 0,25387803 1‐ MAP1824c 467 3066 3530 64 515 3308 2552 56 0,513727008 1‐ MAP1825 795 857 428 40 508 791 444 27 0,93941944 1‐ MAP1826c 5463 11344 9207 485 6801 12330 8566 493 0,4961479 1‐ MAP1827c 31 34 121 7 36 125 74 8 0,83035117 1helY MAP1828c 1016 2254 3699 38 934 3076 2761 33 0,511533479 1‐ MAP1829c 594 2486 4632 97 772 3651 3610 98 0,491533137 1tatA MAP1830c 7120 77005 64550 5903 7002 64522 51564 4761 0,528161534 1‐ predicted RNA 36 2883 3114 6242 16 4099 3788 7931 0,525894083 1‐ MAP1831c 416 1979 3181 68 141 1826 3119 56 0,5071388 1‐ MAP1832c 919 2469 2621 77 548 3431 1835 62 0,517506622 1‐ MAP1833c 8853 21119 31005 606 9073 28332 29956 613 0,490522698 1prcA MAP1834c 2865 7002 13721 399 2105 11266 9970 349 0,495246414 1prcB MAP1835c 2162 5660 8503 237 2372 7358 5910 215 0,488727132 1‐ MAP1836c 5121 15969 11290 2258 3922 13209 9758 1711 0,517394744 1‐ predicted RNA 1239 37820 40158 10721 920 58985 41406 13015 0,449533223 1

65


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 1815 0 0 1631 3098 0 25 2345 0,535780682 1‐ predicted RNA 2411 50 0 2121 3647 92 58 2717 0,537922807 1‐ predicted RNA 728 0 0 1239 1072 0 0 1532 0,959213432 1‐ predicted RNA 4382 44 65 3176 4611 55 0 2794 0,496886613 1‐ MAP1837c 5247 9831 18320 306 5532 11048 11083 246 0,523372622 1‐ predicted RNA 856 0 0 1108 1020 0 0 1108 0,499691598 1‐ MAP1838 1191 3816 2685 161 1098 3180 1808 121 0,527246816 1‐ MAP1839 17023 1133 998 312 22444 1192 1329 347 0,516081358 1‐ predicted RNA 2199 437 935 2035 2649 1018 782 2138 0,510342671 1‐ predicted RNA 463 1722 2080 2998 801 2236 2403 3806 0,522378613 1‐ predicted RNA 4666 5577 5710 2354 5385 5573 4924 2221 0,485618301 1‐ predicted RNA 516 8417 9043 5271 612 6795 6220 3965 0,504613226 1‐ predicted RNA 360 1124 1562 2808 311 1454 1091 2402 0,489530017 1‐ predicted RNA 589 7 0 1195 882 0 0 1497 0,703835909 1lppK MAP1840 979 378 637 68 892 966 904 69 0,48267071 1‐ MAP1841 95 126 178 20 307 43 85 32 0,137767389 1‐ MAP1842c 527 427 702 33 282 678 656 24 0,781511035 1‐ MAP1843 834 4018 2068 96 714 2184 1554 62 0,552701442 1lpd MAP1844c 521 2401 2881 51 849 2416 2137 49 0,499929628 1‐ MAP1845c 272 526 384 32 290 395 287 26 0,378464327 1hisG MAP1846c 380 2139 1738 60 461 1612 1391 49 0,491889154 1hisE MAP1847c 151 634 298 50 126 512 370 43 0,398734071 1‐ MAP1848c 387 585 170 29 463 531 711 37 0,751358134 1‐ MAP1849 342 356 103 18 406 723 554 27 0,29120171 1‐ MAP1850 318 1440 346 32 436 2125 1474 54 0,590545079 1‐ MAP1851 795 1169 187 24 950 1417 1427 34 0,523024593 1‐ MAP1852 668 1363 923 42 1002 2456 2969 77 0,917779704 1‐ MAP1853 210 215 302 11 346 461 567 18 0,259617062 1‐ MAP1854 582 2018 1173 45 689 2291 3538 70 0,535709268 1‐ MAP1855 495 785 363 22 504 866 1137 27 0,671499026 1‐ MAP1856 580 774 491 24 396 1624 1701 35 0,736529916 1‐ MAP1857 928 1491 544 73 787 1769 1299 75 0,487695733 1‐ MAP1858 928 504 220 48 713 673 795 44 0,488684065 1metH MAP1859c 3879 6945 11479 83 2649 9185 8846 66 0,506343303 1

66


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP1860 952 4112 2850 111 1156 2955 2753 98 0,507328942 1‐ MAP1861c 216 351 180 13 374 356 324 18 0,342483736 1‐ MAP1862c 11 0 0 0 70 0 35 2 1,65E‐08 1‐ MAP1863c 6 0 22 0 36 0 0 1 0,106355501 1‐ MAP1864c 0 72 12 1 0 14 25 0 0,128036472 1‐ MAP1865c 0 108 0 2 0 0 0 0 0 1‐ MAP1866c 0 36 35 0 0 0 0 0 0 1pks5 MAP1867c 72 144 212 0 101 12 27 0 0,068499778 1efpA_1 MAP1868c 68 106 0 2 36 72 16 1 0,119066834 1‐ MAP1869c 72 25 25 4 216 36 36 10 0,02329915 1‐ MAP1870c 72 186 125 1 169 269 255 2 0,088565736 1‐ MAP1871c 216 466 272 6 252 323 360 6 0,618233591 1mbtH_2 MAP1872c 0 0 0 0 0 25 35 2 1 1‐ MAP1873c 409 143 123 9 864 180 170 15 0,243504899 1‐ MAP1874c 66 922 526 6 180 533 463 5 0,418435763 1‐ MAP1875c 983 3226 2584 33 1271 2216 2691 31 0,506468183 1cysS MAP1876c 811 1378 1380 43 1044 1461 1256 44 0,492204241 1cysQ_1 MAP1877c 359 1038 820 38 388 509 360 24 0,379070886 1‐ MAP1878c 617 1602 1562 63 582 1517 1112 51 0,49305841 1‐ MAP1879c 1831 11863 9593 470 2761 10458 7472 428 0,49005367 1‐ MAP1880c 1714 3266 3978 163 1212 4437 4403 153 0,49377587 1‐ predicted RNA 571 2889 3083 3612 697 3393 3676 4100 0,520319799 1lppL MAP1881 688 611 605 30 851 516 310 27 0,492660143 1‐ MAP1882 411 786 856 111 486 1000 1017 123 0,504092429 1pyrD MAP1883 544 1204 1904 44 462 1681 1271 37 0,490115691 1‐ MAP1884c 508 156 252 14 483 295 249 13 0,47546184 1‐ MAP1885c 339 1002 1099 61 323 2306 779 71 0,511884383 1dapE2 MAP1886c 1378 3929 3166 85 1123 4767 4416 90 0,482648484 1‐ MAP1887 794 2184 2723 106 853 3373 2562 114 0,510824856 1‐ MAP1888c 597 4245 3342 242 845 4614 4198 280 0,526238249 1wag31 MAP1889c 8422 91338 68394 2407 13429 100866 91484 2920 0,54299837 1‐ predicted RNA 1332 193 412 1411 3474 2063 1470 3692 0,158303214 1‐ predicted RNA 3038 34 0 2529 4448 33 0 3106 0,530209856 1‐ predicted RNA 1139 0 0 1316 1898 25 0 1849 0,528670198 1

67


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 6301 131 260 1088 7745 340 260 1132 0,475362538 1‐ MAP1890c 1070 1430 3237 286 791 2605 2567 252 0,513115727 1‐ predicted RNA 1007 71 48 1165 485 31 63 488 0,073308236 1‐ MAP1891c 3681 53249 18795 1287 2583 17357 12386 563 0,795731324 1‐ predicted RNA 5399 201 49 3473 3029 84 0 1628 0,859093805 1‐ MAP1892c 1137 1907 3000 110 703 1941 2611 82 0,525432182 1yfiH MAP1893c 461 2595 1647 76 381 1500 1519 53 0,668281881 1ftsZ MAP1894c 7734 56279 29287 951 7739 31932 29231 707 0,543460611 1‐ predicted RNA 8814 330 63 2331 10615 91 139 2344 0,478075365 1ftsQ MAP1895c 2770 10589 7763 243 3408 8832 8307 234 0,482335524 1murC MAP1896c 928 1672 2079 45 816 1454 1537 35 0,508778377 1murG MAP1897c 133 431 567 11 185 279 165 7 0,198410625 1ftsW MAP1898c 2255 11504 8497 150 1839 12770 9107 146 0,481743744 1murD MAP1899c 1727 3696 3772 89 1566 3203 3405 74 0,500854705 1mraY MAP1900c 396 819 746 26 322 539 776 20 0,979915373 1murF MAP1901c 546 2432 2559 43 382 2136 2617 37 0,507019983 1murE MAP1902c 598 1751 1225 31 375 851 590 15 0,201957083 1pbpB MAP1903c 1889 5910 5432 88 1501 6228 6611 85 0,484839457 1‐ MAP1904c 286 1144 855 23 49 638 734 11 0,166127531 1mraW MAP1905c 562 4028 2994 88 748 2838 2751 75 0,517420486 1‐ MAP1906c 3571 5952 5354 533 1209 5585 5804 341 0,531599057 1‐ predicted RNA 1836 17 40 1667 2559 70 18 1954 0,516633989 1‐ MAP1907c 2724 8111 3680 510 3975 5260 3098 471 0,485963743 1‐ predicted RNA 244 3788 4229 2899 375 2777 3203 2279 0,525295476 1lppM MAP1909 532 1078 668 47 476 995 586 38 0,565100567 1‐ MAP1910c 616 814 717 39 292 680 924 26 0,905474803 1idsA2_1 MAP1911 216 1556 1755 39 540 1730 1169 41 0,481316987 1‐ MAP1912 1540 722 1338 46 1260 1718 1050 40 0,508199973 1‐ MAP1913c 1166 8308 5646 383 1316 6199 5740 333 0,494814009 1pknL MAP1914 108 599 206 9 180 391 243 9 0,826632882 1‐ MAP1915 746 1613 1284 36 1380 1778 777 42 0,516212041 1aroG MAP1916c 4084 25627 23486 454 5576 18516 16971 364 0,534367644 1‐ MAP1918c 362 386 706 28 306 692 648 26 0,671542021 1‐ MAP1919 548 2652 2176 51 495 1939 1797 39 0,506978 1

68


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP1920c 2771 8612 9802 383 3556 11239 9820 422 0,46777946 1‐ MAP1921c 287 335 322 40 69 486 304 24 0,181706793 1‐ MAP1922c 270 980 809 23 347 1003 951 25 0,498297702 1‐ MAP1923c 629 5289 3736 254 1095 5515 4242 288 0,52506849 1‐ MAP1924c 552 2482 1440 143 553 1845 1681 125 0,498030185 1fadD15 MAP1925 1200 3837 4436 68 3066 9226 7018 135 0,895410884 1‐ MAP1926c 601 532 770 28 447 869 387 21 0,947038921 1‐ MAP1927c 596 766 2928 71 594 1638 2501 72 0,494825153 1‐ MAP1928c 4911 14912 19190 439 9634 15036 15701 493 0,513506278 1‐ predicted RNA 732 0 0 1029 1370 0 0 1618 0,518580984 1‐ MAP1929c 300 469 219 59 238 387 340 49 0,380179295 1‐ MAP1930 36 57 30 1 102 249 87 3 0,004138904 1trpD MAP1931c 205 670 594 17 126 557 241 10 0,203817662 1ctaE MAP1932 3449 5028 5053 350 4154 5944 4853 359 0,477284053 1qcrC MAP1933 3876 9482 9301 367 5231 9659 8546 376 0,481878288 1qcrA MAP1934 9079 19117 17629 525 12511 19533 16467 550 0,509746082 1‐ predicted RNA 2632 14 36 2255 3560 89 19 2571 0,524692801 1qcrB MAP1935 6672 31632 23315 452 8765 29122 21961 437 0,502717602 1‐ predicted RNA 2156 30 35 992 2365 0 0 904 0,5033223 1‐ MAP1936c 330 816 1106 59 459 1020 1086 65 0,504799227 1‐ MAP1937c 901 1578 1655 98 432 1824 1654 73 0,506192251 1mmpS3 MAP1938c 2829 7656 7195 302 1347 7296 7502 231 0,506951147 1‐ MAP1939c 1006 5702 7874 410 1139 5646 6457 365 0,493381618 1ctaC MAP1940c 5530 14240 13023 421 7802 15374 12104 447 0,506163897 1asnB_2 MAP1941 695 611 908 19 898 1034 907 22 0,520328925 1cbhK MAP1942c 953 1870 2317 75 899 1964 1743 62 0,511695772 1‐ predicted RNA 1020 243 121 1465 1140 81 138 1329 0,49013126 1‐ MAP1943 3309 2191 1300 209 2825 1996 1626 166 0,503035026 1‐ predicted RNA 556 170 124 1397 722 125 144 1488 0,989800803 1‐ MAP1944c 4126 18884 12201 1179 5473 14911 11515 1086 0,512558153 1‐ MAP1945c 559 1465 1957 46 805 1094 1586 42 0,493212594 1‐ MAP1946 1261 4413 4446 189 1457 3963 3371 162 0,498672826 1cobU MAP1947 38 278 208 11 56 466 171 14 0,459754744 1cobT MAP1948 144 1102 1212 26 254 1259 1243 30 0,500801149 1

69


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



cobS MAP1949 133 0 182 8 91 72 31 4 0,091258821 1ilvE MAP1950c 1864 12737 7854 239 2598 9489 7812 217 0,491206071 1gcvT MAP1951c 359 1472 1865 41 349 1577 1163 33 0,511582586 1IS1547_1 MAP1952c 755 1684 2117 57 871 2613 2454 67 0,517551809 1‐ predicted RNA 0 7205 15511 6583 23 16363 12238 7878 0,454873303 1pepB MAP1953 1357 3480 2944 70 1195 2942 2588 56 0,515629214 1‐ MAP1954c 143 144 72 15 72 284 259 16 0,73632268 1ephD MAP1955c 460 1458 872 21 547 1109 757 18 0,489842628 1dlaT MAP1956 4715 19112 14875 279 5753 12508 9726 212 0,53396481 1‐ predicted RNA 1766 27 87 1620 2489 54 27 1900 0,516507136 1‐ MAP1957 462 839 951 36 330 423 296 17 0,140438519 1lipB MAP1958 466 1426 1710 67 585 1517 929 56 0,488206287 1lipA MAP1959 929 2023 5250 115 961 3283 4304 111 0,486171433 1‐ MAP1960 281 5113 5871 161 562 5153 3821 138 0,497324306 1‐ MAP1961c 426 642 536 48 383 823 322 40 0,993065541 1glnA1 MAP1962 5727 22040 15896 395 15446 37886 28101 746 0,604609616 1‐ predicted RNA 807 0 0 842 2211 0 0 1937 0,134286901 1‐ MAP1963c 1213 3707 4587 144 1670 5318 5238 175 0,525307507 1‐ MAP1964c 555 848 1485 75 693 1356 814 71 0,483729009 1glnE MAP1965c 1022 5071 5601 47 1515 4685 3345 40 0,499938588 1glnA2 MAP1966c 4752 9261 6690 234 7235 12343 8965 303 0,53262599 1‐ MAP1968c 2281 5867 5892 123 1835 5875 5347 103 0,497543904 1‐ MAP1969c 355 4332 3022 61 668 2973 2897 55 0,511257695 1panB MAP1970 290 3374 2061 74 325 958 832 31 0,123256472 1‐ MAP1971 764 859 515 32 708 307 549 23 0,803383116 1‐ MAP1972c 82 1655 866 74 87 1419 727 62 0,774794932 1‐ MAP1973 486 1094 870 78 323 693 925 55 0,966680403 1‐ MAP1974 456 932 751 19 426 735 800 16 0,528851869 1‐ MAP1975 188405 24333 12547 19415 341540 15512 6677 28505 0,581295189 1‐ predicted RNA 156548 4004240 2080220 198767 279435 2545449 1493993 142245 0,414888034 1‐ MAP1976 227 464 140 18 350 534 273 24 0,364853305 1‐ MAP1977c 127 308 321 16 180 428 94 15 0,607975672 1‐ MAP1978 72 82 72 6 0 45 0 0 7,73E‐22 1‐ MAP1979 624 2631 2087 58 755 2234 2009 53 0,501296567 1

70


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP1980c 522 1392 2215 47 588 1954 1796 47 0,49267702 1‐ MAP1981c 459 2565 2660 92 393 2850 1697 74 0,508818603 1‐ MAP1982c 190 2252 1705 40 198 1861 1170 30 0,576989945 1cobC MAP1983c 173 759 394 15 53 408 483 9 0,218560041 1‐ MAP1984 92 359 467 17 122 360 393 16 0,67207964 1ptpA MAP1985 128 355 584 28 250 288 325 26 0,478061523 1‐ MAP1986 72 642 709 19 291 675 354 21 0,436722896 1cobD MAP1987c 53 36 0 2 67 0 51 2 0,745910234 1‐ MAP1988 345 3179 2933 89 502 2371 2217 72 0,513016194 1‐ MAP1989c 471 1618 1614 39 1114 1381 1070 45 0,515713115 1‐ MAP1990 171 0 0 6 103 30 0 3 0,086265365 1‐ MAP_t24 0 83 68 21 0 0 0 0 1 1ahpE MAP1991c 1219 2071 2695 191 1219 2278 2417 174 0,509857562 1‐ MAP1992c 2992 11950 9697 711 3459 11572 8741 664 0,488189832 1‐ MAP1993c 991 2384 4007 132 1965 2955 3856 164 0,531492538 1aceE MAP1994 2629 18601 15194 153 3318 14358 10508 120 0,51433281 1‐ MAP1995 659 2487 2695 56 632 3202 2436 55 0,500385302 1fabD MAP1996 8927 54946 34545 1306 22059 57160 34330 1644 0,541737054 1‐ predicted RNA 635 13013 10561 5081 1084 16507 9050 5460 0,468001189 1‐ predicted RNA 8223 216 216 3339 16847 639 72 5731 0,568400551 1acpP MAP1997 5704 67519 28007 3252 11051 57620 25302 3160 0,485496373 1‐ predicted RNA 1225 66 0 1118 2649 0 27 2007 0,907342651 1‐ predicted RNA 1556 168 100 1473 3742 186 65 2890 0,971446395 1kasA MAP1998 6961 96800 64712 1478 9349 77805 43351 1147 0,528190205 1‐ predicted RNA 2044 105 0 1865 2339 0 8 1767 0,499413733 1kasB_1 MAP1999 3980 28310 26905 521 7317 31525 18918 523 0,497875658 1‐ predicted RNA 685 79 77 1250 1166 57 19 1705 0,850486608 1accD6 MAP2000 3120 16616 14793 295 5722 14660 9945 279 0,506879482 1‐ MAP2001c 140 142 69 4 84 185 94 3 0,445016793 1glpD1 MAP2002c 154 239 322 6 102 270 306 5 0,268503181 1‐ MAP2003c 36 260 35 5 36 129 177 5 0,943036168 1‐ MAP2004 358 559 514 14 120 300 436 6 0,115000287 1‐ MAP2005 3890 854 806 90 5133 1154 905 101 0,520285393 1‐ predicted RNA 2319 1124 700 2593 2596 666 688 2337 0,509945917 1

71


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2006c 528 1366 1523 56 425 1094 1380 44 0,524303235 1‐ MAP2007c 322 629 321 18 458 358 379 18 0,736430734 1adhE2 MAP2008 301 2694 733 39 446 967 774 27 0,935295849 1‐ MAP2009 207 1017 1057 44 340 1448 774 49 0,499806044 1‐ MAP2010 144 674 599 16 243 464 668 17 0,571536677 1‐ MAP2012c 531 1903 1721 32 240 1947 1568 24 0,519344492 1‐ MAP2013c 670 2455 1218 53 511 1590 1140 37 0,684785602 1‐ MAP2014 1027 3985 2618 286 1841 3938 2592 328 0,525612347 1‐ MAP2015 1117 7274 4843 120 1811 4558 3620 99 0,497740823 1‐ MAP2016 125 990 679 40 196 686 536 34 0,445100366 1lppN MAP2017 159 291 251 22 176 69 226 16 0,227997734 1‐ MAP2018c 832 15350 5611 157 2984 14219 9735 213 0,557036277 1‐ MAP2020 432 2177 1553 64 288 2407 1225 53 0,491218828 1‐ MAP2021c 230 481 359 21 213 517 223 17 0,372221774 1‐ MAP2022 180 108 91 6 36 35 107 2 8,95E‐04 1‐ MAP2023c 519 934 892 60 440 1069 716 50 0,513661164 1‐ MAP2024c 108 103 317 16 36 144 143 7 0,046786814 1‐ MAP2025c 144 72 228 16 0 309 208 10 0,180317133 1‐ MAP2026 6891 22652 12179 369 6515 20834 15109 344 0,512496694 1‐ predicted RNA 1732 523 638 1887 1761 857 750 1774 0,500160707 1‐ MAP2027c 6164 3638 12830 915 5297 15564 14185 1081 0,521068265 1‐ predicted RNA 2126 0 0 1911 1901 0 29 1443 0,509036717 1‐ predicted RNA 1348 0 0 1363 987 0 0 837 0,758510835 1‐ MAP2028c 6839 7185 18568 1882 6478 25682 26041 2665 0,548671951 1‐ predicted RNA 2929 0 45 2443 3005 32 1 2100 0,514849873 1‐ MAP2029c 326 4165 2099 161 363 3142 2637 148 0,504245446 1‐ MAP2030 890 1862 1158 46 1034 1327 1057 40 0,499536072 1‐ MAP2031c 684 391 696 22 395 568 546 15 0,65860041 1‐ MAP2032c 183 191 173 15 114 426 366 17 0,366016424 1‐ MAP2033 323 298 188 11 60 166 50 2 8,91E‐06 1‐ MAP2034c 6070 3328 1619 201 3466 2353 1743 110 0,872380349 1‐ predicted RNA 3496 220 160 1720 1464 0 0 584 0,057848882 1‐ predicted RNA 18414 36 98 4177 7246 0 0 1376 0,100604801 1‐ MAP2038c 5798 635 1549 222 1436 1757 1257 72 0,097037365 1

72


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



lipM MAP2041 899 1614 1410 46 540 1205 1311 30 0,804311353 1‐ MAP2042c 214 394 113 27 152 677 290 30 0,526292904 1yjcE MAP2043 322 850 738 16 680 1050 989 24 0,835615527 1‐ MAP2044 114 284 282 7 143 491 443 11 0,258162538 1‐ MAP2045 0 72 26 0 0 0 0 0 0 1sseB MAP2046 228 447 332 17 144 529 437 15 0,407155722 1‐ MAP2047 36 36 36 2 71 0 115 4 0,144329138 1lppO MAP2048 511 1665 572 71 733 1297 698 72 0,481939446 1‐ MAP2049 1898 2057 3053 115 1996 3761 3496 128 0,522328946 1IS1601_B_2 MAP2050 126 695 304 11 284 768 275 14 0,377259854 1‐ MAP2051c 216 143 215 8 0 430 164 4 0,095725707 1‐ MAP2052c 72 169 215 9 66 144 107 6 0,257312864 1‐ MAP2053 108 132 72 7 127 72 72 6 0,754733536 1‐ MAP2054c 108 816 575 17 248 574 487 17 0,886329296 1‐ MAP2055 356 144 179 12 273 108 38 7 0,144810696 1‐ MAP2056c 1235 4292 6264 204 1850 4402 6065 215 0,482940052 1‐ predicted RNA 1056 941 877 3291 1982 1059 778 4500 0,527362358 1‐ MAP2057 4027 14633 16744 498 7553 11162 9368 452 0,514661079 1‐ predicted RNA 955 0 0 909 2294 24 0 1839 0,331699471 1cysQ_2 MAP2058c 412 168 219 23 822 93 477 39 0,263605063 1‐ MAP2059 72 390 256 14 108 609 358 20 0,238976802 1‐ MAP2060c 36 369 120 5 35 184 14 2 0,029395989 1‐ MAP2061 36 1704 627 61 96 1047 859 54 0,862803821 1pknM MAP2064 679 1488 1232 66 659 1737 1917 73 0,514696577 1‐ MAP2065 348 1347 615 23 282 1228 748 20 0,501404808 1‐ MAP2066 281 425 274 9 444 460 380 12 0,448320082 1‐ MAP2067c 210 1123 663 24 411 1357 957 33 0,88747884 1‐ MAP2068c 108 2920 1978 244 426 6340 3014 472 0,985228556 1htpG MAP2069c 1598 14669 5925 132 1362 8372 4787 85 0,521939458 1‐ MAP2070 360 1608 924 59 216 1682 783 47 0,561401923 1‐ MAP2071c 36 0 58 1 0 144 55 1 0,926440035 1‐ MAP2072c 13 83 143 3 0 83 36 1 0,044167711 1‐ MAP2073c 504 329 752 38 432 432 570 30 0,999302966 1‐ MAP2074c 0 49 0 0 0 0 0 0 0 1

73


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2075c 280 2265 1894 80 495 1829 1734 76 0,490532566 1‐ MAP2076c 179 2409 2433 59 418 2654 1820 59 0,493134718 1‐ MAP2077c 108 216 292 26 293 599 275 49 0,107270319 1‐ MAP2078c 1376 2023 3276 37 1564 2141 2360 32 0,507531712 1‐ MAP2079 1388 6351 7217 20 1860 4879 5176 16 0,498149205 1‐ MAP2080 180 192 494 18 375 481 280 25 0,349108781 1‐ MAP2081 1006 192 655 24 1007 404 360 20 0,488817443 1‐ MAP2082 341 70 171 9 0 137 35 1 6,06E‐22 1‐ MAP2083c 754 1644 1144 57 824 1533 959 51 0,492660505 1‐ MAP2084 1290 6544 2547 90 1378 6221 4645 99 0,517684656 1‐ MAP2085 214 233 215 29 423 177 147 38 0,356141707 1‐ MAP_t25 0 144 36 23 72 0 108 42 0,120919186 1‐ MAP2086c 530 5302 2534 189 1830 1903 1324 162 0,515591746 1‐ MAP2087c 238 2279 2268 62 753 1902 1288 59 0,492988145 1‐ MAP2088c 155 143 356 7 186 402 361 9 0,340200534 1‐ MAP2089c 468 858 745 20 534 805 1287 23 0,508636321 1uspA MAP2090 36 0 106 2 307 34 108 11 7,80E‐06 1uspE MAP2091 141 45 81 7 101 36 74 4 0,218428343 1uspC MAP2092 144 319 320 8 347 287 288 11 0,322446733 1rocE MAP2093c 357 559 376 14 227 72 244 6 0,062614937 1rocD1 MAP2094c 72 264 446 7 180 424 179 8 0,510642789 1‐ MAP2095c 63 205 24 4 144 354 425 13 0,005827368 1‐ MAP2096 144 72 161 15 144 152 164 15 0,936938211 1‐ MAP2097c 446 536 995 35 647 632 1047 40 0,506124767 1‐ MAP2098c 610 2650 3150 36 625 3228 2944 36 0,499119767 1‐ MAP2099 165 463 443 29 36 502 322 18 0,176128667 1‐ MAP2100 407 1404 2167 28 108 1530 1552 19 0,834852819 1‐ MAP2101 2284 11282 8536 140 4105 11126 6475 145 0,473679841 1narK3_1 MAP2102c 479 658 317 17 831 326 491 21 0,804083638 1lppP MAP2103c 715 5399 3552 234 675 5640 4582 248 0,481394365 1fdhF MAP2104 72 442 262 2 229 717 762 4 0,0581617 1‐ MAP2106c 0 0 0 0 108 36 0 6 1 1‐ MAP2107c 0 0 0 0 36 0 35 7 1 1‐ MAP2108 3321 1708 1120 111 1661 1772 1013 59 0,767745452 1

74


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2109c 80 79 84 10 193 74 83 16 0,136473893 1‐ MAP2111c 322 159 183 9 580 564 427 17 0,198028099 1lprM MAP2112c 36 71 178 3 286 214 171 10 0,001398522 1‐ MAP2113c 36 156 136 3 466 319 106 12 1,43E‐05 1‐ MAP2115c 179 144 0 6 252 421 78 11 0,140018897 1mce3 MAP2116c 320 214 101 10 811 745 376 25 0,074624789 1‐ MAP2119 760 516 372 27 945 1349 987 39 0,689772866 1‐ MAP2120c 2175 4067 4445 78 3021 5408 4088 87 0,526870639 1‐ MAP2121c 1432 8456 5597 203 2272 9678 5987 232 0,464730483 1‐ predicted RNA 165 3943 8838 3856 110 13134 9042 6152 0,548157111 1‐ MAP2122 3017 6707 6979 183 2459 25211 16453 368 0,584334986 1cysK MAP2123 2162 3841 3605 156 2238 7996 5967 213 0,540667695 1‐ predicted RNA 1575 0 0 1544 1805 30 0 1494 0,489886399 1cysE MAP2124 634 2600 2676 107 1157 5655 3982 183 0,571024961 1‐ MAP2125 89 242 238 6 187 317 257 9 0,217362603 1‐ MAP2126 72 529 370 10 115 369 417 9 0,834960341 1‐ MAP2127 36 142 268 3 200 412 322 9 0,023567877 1‐ MAP2128c 151 631 341 22 91 286 623 18 0,378900034 1‐ MAP_t26 66 7163 3351 1462 0 7893 4206 1612 0,522959958 1‐ MAP2129 828 2174 3103 265 597 2369 1559 179 0,526314158 1dnaG MAP2130c 1843 5410 4972 84 1482 5189 5676 76 0,491830014 1‐ MAP2131c 725 4602 2577 154 754 1709 1532 85 0,951353477 1dgt MAP2132c 174 1112 1036 21 313 1285 1149 25 0,570773757 1‐ MAP2133 108 843 372 10 396 778 478 15 0,310039822 1‐ MAP2134 445 36 52 32 282 29 13 17 0,086981165 1‐ MAP2135c 2179 11338 10392 674 1431 11218 9713 572 0,499415745 1‐ MAP2136c 406 4731 2951 73 1078 3385 2260 68 0,505257049 1glyS MAP2137c 1742 3711 4001 97 1397 4514 4118 89 0,49498228 1‐ MAP2138 72 966 734 45 139 568 522 34 0,344861437 1furB MAP2139 420 1783 2232 134 696 1464 1627 122 0,49496516 1‐ MAP2140c 540 359 775 68 650 588 623 69 0,502224877 1‐ MAP2141c 1146 2204 3296 105 1400 1849 2715 95 0,509349002 1recO MAP2142c 841 548 441 46 719 540 632 39 0,493825412 1amiA2 MAP2143 432 298 722 16 455 610 772 17 0,501878346 1

75


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2144 665 695 243 21 216 2339 1292 28 0,667548625 1era MAP2145c 466 2113 4103 88 1146 3482 4502 124 0,54517088 1‐ MAP2146c 1182 4153 5768 107 1813 5631 6667 132 0,528909621 1‐ MAP2147c 836 2094 3261 64 998 2277 1492 50 0,519847456 1‐ MAP2148 182 0 56 9 272 72 94 13 0,207529157 1‐ MAP2149c 3505 36 16 176 2392 0 37 101 0,665996994 1‐ MAP2150 1639 1073 1094 60 1963 1276 1090 62 0,50382331 1‐ MAP2151 141 428 462 31 36 665 900 38 0,385747124 1‐ MAP2152c 105 721 931 54 180 1183 906 68 0,786551359 1‐ MAP2153 6415 20825 14465 534 7834 19150 13565 508 0,509669273 1‐ predicted RNA 629 7661 7609 4629 643 11437 9497 5939 0,545059179 1‐ predicted RNA 1884 26501 16844 8556 2841 40401 36947 14661 0,577910193 1‐ MAP2154c 504 72 75 30 953 36 66 46 0,356618074 1IS6110 MAP2155 295 485 318 56 181 607 766 60 0,456546186 1‐ MAP2156 279 134 97 11 252 213 364 13 0,459173034 1‐ MAP2157 3679 1805 1232 122 1330 1649 1591 56 0,76605071 1‐ MAP2158 873 3380 2816 156 863 4017 3228 163 0,486201706 1‐ predicted RNA 2765 71 0 2146 3451 36 16 2244 0,487552195 1‐ MAP2159c 4825 4398 7398 521 5592 7353 8903 593 0,46511371 1phoH MAP2160c 1629 5737 8881 192 1817 10200 6936 205 0,472091952 1‐ MAP2161c 36 97 269 6 36 81 72 3 0,047674939 1dnaJ2 MAP2162c 418 3650 2524 66 745 2637 2215 59 0,507168372 1hrcA MAP2163c 722 8065 5305 152 1097 5152 4842 125 0,497969359 1‐ MAP2164 351 1791 1360 137 600 2324 1354 165 0,5197849 1‐ MAP2165 261 575 298 28 168 161 196 13 0,055611165 1‐ MAP2166 180 252 130 10 154 40 138 6 0,159855123 1mbtH_3 MAP2169c 42 78 53 12 29 106 86 12 0,948268972 1mbtG MAP2170c 128 155 177 5 137 121 184 5 0,794610462 1mbtF MAP2171c 142 106 70 1 133 249 105 1 0,689573129 1‐ MAP2172c 324 4075 648 44 733 3385 1805 55 0,520748015 1mbtE MAP2173c 952 11425 2865 32 3701 9642 6209 48 0,562885581 1mbtD MAP2174c 216 770 398 6 354 826 690 8 0,605474665 1mbtC MAP2175c 216 1279 643 19 144 429 957 13 0,479083898 1‐ MAP2176c 143 526 227 15 0 336 132 5 0,007889872 1

76


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



mbtB MAP2177c 148 2630 559 10 696 923 307 8 0,493508093 1mbtA MAP2178 129 321 36 6 131 36 144 4 0,333187922 1‐ MAP2179 370 317 324 40 708 239 428 56 0,503309269 1‐ MAP2180c 679 5738 4419 292 984 7574 5596 368 0,52796921 1‐ MAP2181c 741 2404 1258 88 805 1896 1565 81 0,499153946 1‐ MAP2182c 0 36 72 2 0 2 0 0 1 1‐ MAP2183c 0 0 37 0 0 0 36 0 0,29340367 1‐ MAP2184c 0 71 22 1 0 16 36 0 0,209825465 1‐ MAP2185c 36 36 188 2 0 215 138 2 0,976985569 1‐ MAP2186c 0 97 151 5 0 71 177 6 0,954813245 1‐ MAP2187c 0 108 113 2 0 302 359 6 0,003304279 1‐ MAP2188c 72 422 395 6 125 653 378 8 0,334979489 1‐ MAP2189 23 216 188 3 36 0 76 1 0,010109616 1‐ MAP2190 17 0 0 0 36 144 179 4 2,30E‐13 1‐ MAP2191 36 125 0 2 108 143 72 4 0,04241581 1‐ MAP2192 468 239 393 16 611 322 468 18 0,962272095 1‐ MAP2193 36 36 72 2 0 299 177 4 0,053507954 1‐ MAP2194 36 141 139 2 13 179 300 3 0,343985898 1‐ MAP2195 72 0 0 1 36 0 0 0 0,066111695 1‐ MAP2196 36 43 11 2 0 42 67 1 0,239592785 1lipK MAP2197 0 571 213 7 36 356 284 7 0,867341302 1‐ MAP2198 36 280 292 8 0 121 187 3 0,028750426 1‐ MAP2199 36 727 458 14 16 531 195 8 0,114350271 1‐ MAP2200 108 1294 782 15 126 522 706 10 0,289324671 1‐ MAP2201 288 839 869 28 250 538 596 19 0,429055391 1‐ MAP2202c 148 419 438 24 87 230 433 16 0,224007671 1‐ MAP2203c 6380 3632 1571 211 2896 2703 2075 103 0,787187114 1‐ MAP2204c 1836 14548 3404 343 1099 7093 3743 197 0,74819649 1trpE2 MAP2205c 355 3834 827 42 585 1181 989 27 0,885679985 1‐ MAP2206 267 361 286 12 477 786 519 20 0,239169753 1hemN MAP2207c 335 2128 1537 40 708 1854 2028 49 0,519262221 1‐ predicted RNA 1557 2366 9198 2273 1008 6091 7734 2208 0,484489926 1nirA_2 MAP2208 4650 6111 12616 207 3779 12991 11940 210 0,487941467 1cysH_2 MAP2209 1030 1006 2108 88 1229 2939 2836 122 0,540745077 1

77


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



cysA MAP2210c 838 3845 2843 86 1517 5438 3353 116 0,536416752 1cysW MAP2211c 1367 5332 3961 168 1281 5398 4523 163 0,489970667 1cysT MAP2212c 525 1417 1681 55 652 3299 2459 85 0,532876159 1subI MAP2213c 1613 3156 2666 107 2097 6017 4903 160 0,543284971 1‐ MAP2214c 178 786 630 98 143 853 349 75 0,35979538 1‐ MAP2215 2191 34375 23082 331 3105 27112 22432 294 0,517407608 1lppR MAP2216c 780 466 533 46 597 679 408 35 0,763606722 1lepA MAP2217c 1290 4283 6108 75 1326 4907 5837 73 0,488575765 1‐ MAP2218 576 1853 1524 85 910 1682 1026 83 0,491613127 1‐ MAP2219c 1309 6891 6947 427 3718 9013 7315 613 0,562848534 1‐ MAP2220 180 527 263 16 282 119 370 15 0,467361113 1‐ MAP2221c 746 701 1059 27 1646 4384 2665 74 0,130720212 1‐ MAP2222c 421 737 1260 35 1021 3823 2443 91 0,118175236 1rpsT MAP2224 2196 3790 3443 553 1982 3508 4181 504 0,493266791 1‐ predicted RNA 2251 0 31 2032 2586 17 0 1955 0,501908812 1‐ MAP2225c 1674 2019 1219 88 1125 1313 668 50 0,936335337 1‐ MAP2226c 36 36 0 1 0 0 0 0 1 1fadE17 MAP2227 852 15276 8337 227 1638 10011 6328 176 0,508036661 1‐ MAP2228 578 5906 4748 114 645 4125 3031 79 0,527844665 1‐ MAP2229 488 175 323 49 578 167 158 44 0,539360182 1‐ MAP2230c 16356 26424 37412 107 29755 37230 29572 133 0,53907896 1‐ predicted RNA 518 0 15 1128 676 9 0 1229 0,447116998 1‐ predicted RNA 352 10 0 1148 639 0 0 1735 0,282234071 1‐ predicted RNA 1915 665 1331 2298 2111 1231 1681 2417 0,509486501 1papA3_1 MAP2231 5906 11433 14029 318 8106 20322 19323 434 0,544332834 1‐ predicted RNA 1803 69 64 1658 1969 0 0 1485 0,499559942 1mmpL10 MAP2232 2253 3464 4983 64 4849 5089 4374 91 0,549518384 1‐ MAP2233 324 256 1417 55 616 881 1148 73 0,777723351 1‐ MAP2234 3457 3908 3285 163 4093 5006 3050 168 0,474749707 1fadD21_1 MAP2235 2517 4578 4308 98 5211 4391 4038 130 0,54673356 1‐ predicted RNA 475 0 0 904 1024 0 0 1636 0,207455664 1‐ MAP2236 205 114 265 16 178 570 672 26 0,215080738 1‐ MAP2237 711 2780 1643 61 1273 2438 1618 68 0,512482682 1‐ MAP2238 584 2262 1707 119 751 1961 1597 112 0,497700485 1

78


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



mmpL4_4 MAP2239 2607 6827 6420 75 2802 4628 5714 62 0,499177647 1‐ MAP2240c 174 71 357 12 142 251 482 13 0,38367921 1‐ MAP2241c 540 694 1383 52 388 863 1314 43 0,490371543 1‐ MAP2242c 323 1056 1087 47 214 979 701 33 0,799722894 1‐ MAP2243c 783 746 1010 109 714 1035 1125 103 0,484998619 1nadD MAP2244c 1288 1077 1542 102 893 1418 1210 75 0,50909855 1‐ MAP2245c 787 3693 4286 73 888 3431 2554 57 0,52208466 1‐ MAP2246c 1550 3501 4549 151 1454 2849 2382 104 0,524573316 1proA MAP2247c 1297 5090 3669 99 1793 4149 2503 87 0,497871603 1‐ MAP2248c 108 248 180 7 144 244 431 10 0,218129155 1‐ MAP2249c 72 276 558 23 70 306 403 19 0,307140992 1‐ MAP2250c 551 4125 2415 37 715 2145 2353 29 0,520592857 1rbsK MAP2251 191 226 141 10 186 178 121 8 0,308060897 1‐ MAP2252c 230 336 258 17 71 250 228 8 0,073218027 1‐ MAP2253 36 241 132 3 86 404 174 5 0,136177183 1‐ MAP2254 0 202 141 3 0 67 118 2 0,055959346 1‐ MAP2255 35 140 143 3 36 86 134 2 0,539771296 1‐ MAP2256 17 0 0 0 0 0 0 0 0 1‐ MAP2257 95 1021 71 27 157 206 165 15 0,12854096 1‐ MAP2260 365 825 1368 40 208 995 865 28 0,94671134 1‐ MAP2261c 562 1336 642 28 355 1893 955 28 0,484105022 1‐ MAP2262 250 290 389 23 241 1261 616 38 0,255984971 1proB MAP2263c 315 429 478 17 299 241 386 13 0,340986858 1obgE MAP2264c 999 1682 1222 41 613 1578 994 28 0,723386882 1rpmA MAP2265c 2490 2732 2470 499 1951 2665 2884 408 0,501499168 1rplU MAP2266c 7354 17217 13874 1771 5818 20849 16761 1703 0,508638377 1‐ predicted RNA 1895 1533 2865 2973 1528 2074 2374 2402 0,515768007 1rne MAP2267c 6701 15044 16390 189 5897 15970 11999 153 0,5339088 1‐ predicted RNA 92 1337 1871 2573 14 2214 1910 2962 0,518116173 1‐ predicted RNA 1212 449 1148 1998 1005 1022 868 1647 0,496694404 1‐ predicted RNA 2074 0 0 1864 1963 0 0 1481 0,507466798 1‐ predicted RNA 6156 0 46 4249 3211 105 68 1892 0,632612827 1‐ predicted RNA 1296 0 24 1318 666 30 0 573 0,10737678 1ndk MAP2268c 603 6018 2700 258 743 4324 2524 211 0,514440501 1

79


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2269c 173 1578 2440 124 78 1558 2007 101 0,495778934 1folC MAP2270c 288 2453 3636 49 681 1802 2053 39 0,513175947 1valS MAP2271c 1905 18582 13759 146 2765 10766 8092 98 0,519886858 1‐ MAP2272c 1557 2059 2644 78 1485 1768 1959 61 0,523904292 1‐ MAP2273c 36 15 134 4 0 164 58 3 0,431990898 1‐ MAP2274 1748 879 1033 61 2272 1165 1344 70 0,519326899 1‐ MAP2275c 954 1957 4706 169 784 1835 2092 102 0,590896661 1‐ MAP2276c 1252 8418 6809 178 1836 3765 2902 106 0,717409723 1‐ MAP2277c 3997 46136 33943 475 4878 17476 13293 221 0,601560994 1‐ predicted RNA 714 4701 10044 4212 648 4577 4719 2645 0,640933755 1‐ predicted RNA 2694 0 22 2362 1295 0 0 950 0,120632428 1clpX MAP2278c 16352 79952 86354 1739 20508 93924 78955 1778 0,481401954 1‐ predicted RNA 1703 45 20 1548 2346 36 0 1779 0,515384637 1‐ predicted RNA 5568 74 138 1788 8032 93 58 2153 0,539845195 1‐ predicted RNA 4465 61 296 2746 5578 136 104 2850 0,484409609 1‐ predicted RNA 2292 18698 27915 5238 3134 33227 30458 6809 0,540322742 1‐ predicted RNA 2882 577 959 2662 2625 1646 2231 2703 0,482781763 1mmuM MAP2279 1348 815 627 63 1122 1035 1123 56 0,498670477 1clpP2 MAP2280c 4868 13256 11149 636 6027 12442 11224 629 0,501104057 1clpP MAP2281c 5095 17370 17407 865 4734 20394 15786 812 0,514189526 1tig MAP2282c 2595 7197 6516 160 1877 5919 4562 111 0,514608631 1‐ MAP_t27 72 106 564 127 65 237 221 85 0,184686989 1‐ MAP_t28 207 340 1509 370 156 1031 1263 387 0,497341071 1lipP MAP2283 540 2622 2310 56 1323 2873 1680 67 0,521623961 1‐ MAP2284c 300 816 639 30 350 930 788 32 0,550102215 1rpi MAP2285c 357 1138 753 63 420 1338 787 67 0,503966579 1‐ MAP2286c 59 471 791 24 98 438 403 17 0,328381539 1pepD MAP2287 1599 5458 5662 63 2075 7614 5779 72 0,532186465 1‐ MAP2288c 934 5621 3297 250 1025 4182 2752 201 0,507718505 1‐ MAP2289c 1175 13964 9679 1150 2121 11222 7747 1019 0,494397324 1‐ MAP2290c 503 2289 2829 106 1405 2583 1985 128 0,524390508 1glbO MAP2291 593 611 819 86 288 1058 1022 73 0,51209687 1‐ MAP2292 1624 4627 4229 61 1751 4022 3739 53 0,497086372 1‐ MAP2293c 394 792 752 41 459 1051 757 44 0,501041895 1

80


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2294c 3244 6653 8081 52 3247 9064 8832 55 0,471551545 1‐ MAP2295c 4178 21461 16681 310 5097 20291 16051 297 0,4887475 1‐ MAP2296c 41 71 36 4 55 15 59 4 0,834941431 1‐ MAP2297c 288 606 453 9 343 404 392 8 0,42398157 1plsB2 MAP2298c 3073 4336 8287 97 3760 7107 7202 104 0,471119321 1‐ MAP2299c 966 5101 5183 126 1323 4133 3399 103 0,501786518 1‐ MAP2300c 1104 5064 3284 81 1609 3413 2403 68 0,499713469 1lipQ MAP2301c 809 3697 2435 69 644 1807 1618 40 0,823291663 1‐ MAP_t29 136 277 301 139 0 310 624 131 0,71452594 1‐ MAP2302 1081 6688 4091 120 1415 6209 4832 124 0,485675102 1‐ MAP2303c 226 2531 562 121 120 708 430 46 0,048138608 1‐ MAP2304 155 901 544 30 114 331 396 16 0,155796373 1‐ MAP2305 109 960 1206 62 274 2279 1651 112 0,345945463 1echA14 MAP2306 72 71 36 4 72 178 36 5 0,597217046 1pdhC MAP2307c 144 2592 2042 44 141 1390 924 22 0,312057745 1pdhB MAP2308c 228 2385 1322 42 519 677 783 27 0,944898694 1pdhA MAP2309c 292 3919 1131 54 306 1002 673 22 0,12059722 1citE MAP2310c 106 323 546 15 288 527 643 23 0,276648266 1‐ MAP2311c 185 1174 862 52 180 911 781 43 0,975905597 1fadE19 MAP2312c 396 3666 2057 60 504 2608 2160 52 0,506597977 1accA1 MAP2313c 376 1024 805 15 180 1049 746 11 0,927767165 1accD1 MAP2314c 405 1202 1224 22 464 751 629 15 0,96000781 1‐ MAP2315 36 181 36 4 63 71 90 5 0,881283972 1‐ MAP2316 858 1688 1805 83 1275 2030 1111 85 0,492405222 1‐ MAP2317c 311 395 237 12 307 371 247 10 0,41056732 1‐ MAP2318 473 514 390 30 316 327 412 19 0,293206934 1‐ MAP2319c 858 1813 1583 39 959 1310 806 29 0,502198426 1‐ MAP2320 522 2567 1014 80 532 2507 1453 82 0,490132788 1‐ MAP_t30 108 118 141 84 41 152 117 51 0,151981256 1‐ MAP2321 340 216 411 51 229 178 394 35 0,303751258 1lppS_2 MAP2322c 1543 3727 2679 93 1529 3236 3486 89 0,487823957 1‐ MAP2323c 158 71 195 8 188 698 136 14 0,151717996 1‐ MAP2324c 431 430 338 9 186 3146 1211 19 0,140295489 1‐ MAP2325 32 176 53 2 94 387 110 5 0,02402044 1

81


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP_t31 229 514 381 225 233 501 309 195 0,404068175 1‐ MAP2326 206 718 907 87 230 613 461 63 0,366545322 1‐ MAP2327 583 1923 887 26 692 1067 968 22 0,488281047 1‐ MAP2328c 419 8777 6263 632 281 8887 7041 634 0,482917874 1bcp MAP2329 376 1588 1521 88 587 808 596 60 0,91238623 1‐ MAP2330c 2092 3602 5731 115 2073 6697 5486 124 0,474562851 1acpS MAP2331c 901 7687 5537 413 888 8533 6281 434 0,478617371 1fas MAP2332c 12088 132252 83139 275 11957 89800 75528 212 0,521166406 1‐ predicted RNA 5025 0 22 4285 2242 47 35 1624 0,157535881 1‐ predicted RNA 13 1117 3644 1807 60 1848 3536 2050 0,515371209 1‐ predicted RNA 3787 1163 5694 3908 1636 2748 6103 2734 0,507059384 1‐ MAP2333 17 0 0 1 0 0 0 0 0 1‐ MAP2334c 560 2604 1868 87 319 1095 1183 43 0,345802038 1‐ MAP2335c 524 1672 1622 55 564 1712 1730 54 0,489166417 1‐ MAP2336 72 144 107 4 36 72 144 2 0,208067341 1‐ MAP2337c 272 1682 704 23 208 890 856 16 0,9089544 1‐ MAP2338 252 2520 1299 29 754 1776 907 29 0,485795897 1‐ MAP2339c 0 465 1078 36 169 788 1078 53 0,334851313 1‐ MAP2340c 36 952 481 29 214 518 339 26 0,428524072 1‐ MAP2341c 197 1141 741 59 583 957 529 71 0,740343905 1‐ MAP2342c 221 1174 1152 19 205 966 606 13 0,654512619 1‐ MAP2343c 864 5543 4171 109 1092 4002 3500 90 0,500391853 1‐ MAP2344 0 204 144 2 324 250 286 10 6,07E‐06 1‐ MAP2345c 34 530 273 47 108 452 70 40 0,522889171 1‐ MAP2346c 372 2142 1548 20 278 2206 1772 19 0,488545934 1‐ MAP2347 273 1511 1859 52 115 1584 1158 36 0,846599796 1‐ MAP2348 36 396 161 9 72 168 258 8 0,990314735 1‐ MAP2349c 101 443 872 19 72 501 819 18 0,433484847 1‐ MAP2350 93 500 381 10 36 519 307 7 0,270432355 1‐ MAP2351 180 389 433 12 144 286 372 9 0,318205872 1‐ MAP2352 120 1505 946 24 180 1030 572 17 0,711069129 1‐ MAP2353 88 363 237 9 216 248 133 10 0,74518639 1‐ MAP2354 449 714 483 31 1348 408 391 53 0,537964973 1‐ MAP2355 50 309 520 15 156 484 415 19 0,317721678 1

82


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2356 232 900 878 24 182 824 693 19 0,770380503 1‐ MAP2357 430 6267 2821 86 523 3425 2321 58 0,536248437 1‐ MAP2358c 180 17 51 21 144 80 54 17 0,589034697 1‐ MAP2359c 178 885 910 16 271 2109 1993 32 0,188356989 1‐ MAP2360c 33 0 0 1 72 137 36 6 0,008849372 1rsbU MAP2361 549 3235 2185 36 1522 2449 1216 39 0,50822633 1‐ MAP2362c 403 1256 966 28 360 1011 798 22 0,672017995 1‐ MAP2363c 72 323 431 8 192 426 234 10 0,366593486 1‐ MAP2364c 180 1178 660 25 561 922 481 30 0,822183639 1‐ MAP2365 312 608 751 19 108 391 387 8 0,087071547 1‐ MAP2366 401 2170 3366 44 783 2383 2669 45 0,505107059 1‐ MAP2367c 466 1686 1562 25 933 733 428 19 0,56690415 1‐ MAP2368c 0 474 639 16 85 204 116 8 0,057226572 1‐ MAP2369c 0 484 300 12 71 181 122 8 0,145228926 1‐ MAP2370c 72 250 202 8 36 281 103 5 0,243132289 1‐ MAP2371c 72 106 130 3 0 0 70 0 1,42E‐07 1accD4_2 MAP2372 180 570 430 10 216 428 213 8 0,345630294 1‐ MAP2373c 143 508 469 13 108 804 697 17 0,388134185 1‐ MAP2374c 0 631 654 37 72 940 1018 61 0,252853957 1‐ MAP2375c 0 245 374 5 0 319 180 4 0,459005309 1‐ MAP2376c 72 410 424 6 180 591 657 10 0,232817213 1‐ MAP2377 0 387 178 5 72 233 215 6 0,596639138 1‐ MAP2378 0 0 0 0 0 0 0 0 1 1‐ MAP2379 0 179 144 5 72 92 156 7 0,292849307 1fadD19_2 MAP2380 180 1094 609 13 288 557 787 13 0,723175241 1‐ MAP2381 72 36 129 4 36 0 125 2 0,046346474 1‐ MAP2382 36 144 134 3 36 150 0 1 0,112285292 1‐ MAP2383 340 2511 1333 40 515 1935 1155 36 0,489431951 1‐ MAP2384 302 320 251 13 481 337 389 17 0,389687149 1‐ MAP2385c 288 523 492 16 426 689 571 20 0,765886724 1‐ MAP2386c 72 1029 545 17 36 562 307 9 0,109596043 1‐ MAP2387c 77 316 219 9 163 278 152 10 0,780380909 1fadD19_3 MAP2388c 71 164 311 4 91 164 170 3 0,599929472 1‐ MAP2389c 36 346 145 5 34 48 0 1 1,26E‐05 1

83


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2390c 0 43 72 1 0 14 107 1 0,631428872 1‐ MAP2391 108 694 104 33 72 1287 443 54 0,233405666 1‐ MAP2392c 290 1263 645 27 216 1053 438 19 0,666164099 1‐ MAP2393c 372 1282 1315 48 557 1331 1270 51 0,481141082 1‐ MAP2394 391 1381 1856 56 692 1852 1227 60 0,515079486 1‐ MAP2395c 144 352 317 12 395 0 110 13 0,799648128 1‐ MAP2396c 36 144 0 3 72 108 120 6 0,136219832 1echA10 MAP2397 0 72 129 2 55 235 240 7 0,003196134 1‐ MAP2398 108 431 601 17 72 360 144 8 0,061118503 1echA16_1 MAP2399 36 144 178 5 0 89 144 2 0,071038498 1‐ MAP2400 36 247 25 2 36 227 106 2 0,735495557 1fadD35 MAP2401 66 156 197 3 36 286 168 3 0,945341625 1‐ MAP2402 178 72 107 4 600 3 35 10 0,040905375 1‐ MAP2403c 534 614 1167 98 658 1055 1342 116 0,518053248 1‐ MAP2404c 138 207 135 11 207 143 188 12 0,647783991 1fadE3_1 MAP2405c 132 1983 1599 33 294 1203 1092 25 0,620733441 1‐ MAP2406c 174 411 670 14 50 334 310 6 0,048400397 1fadA3 MAP2407c 180 848 251 13 108 322 346 7 0,16697479 1fabG MAP2408c 102 1672 703 35 399 501 538 28 0,927267274 1fadE25_3 MAP2409 137 574 432 12 167 491 225 9 0,362662085 1‐ MAP2410 216 1033 322 24 85 452 422 13 0,177805378 1‐ MAP2411 36 843 297 28 103 430 189 20 0,225506376 1‐ MAP2412c 36 294 123 4 59 334 217 6 0,346796242 1‐ MAP2413c 72 1251 398 10 342 642 662 12 0,683962904 1‐ MAP2414c 394 1786 487 13 776 814 611 13 0,488539816 1‐ MAP2416c 1434 5623 2609 76 1545 5947 3349 79 0,485616912 1lppJ MAP2417c 108 1261 759 45 358 834 636 46 0,49383031 1‐ MAP2418 276 1887 1575 111 421 1826 1750 120 0,516663117 1pks14 MAP2419 955 936 1416 157 1362 1277 1458 184 0,516740401 1‐ MAP2420c 269 1021 907 45 404 1604 1409 66 0,985876681 1‐ MAP2421c 238 537 1804 105 426 1107 1044 108 0,493311697 1rph MAP2422c 900 2752 2165 101 887 2612 2430 95 0,505243679 1‐ MAP2423c 1793 3807 4134 168 2161 4700 4218 178 0,484193901 1murI MAP2424c 136 393 426 15 252 249 178 13 0,402472654 1

84


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2426c 225 285 391 65 166 311 210 44 0,239136429 1‐ MAP2427c 133 353 635 13 449 642 618 23 0,234147575 1‐ MAP2428c 286 706 1026 46 643 1854 1072 78 0,552814371 1clpS MAP2429c 3353 6904 4245 692 5818 7886 5899 925 0,557284358 1‐ MAP2430 311 791 935 19 547 887 604 21 0,50024867 1dinG MAP2431 250 565 495 9 144 725 481 7 0,399165271 1glgP MAP2432c 811 6076 4607 51 1192 5703 4628 51 0,487620086 1‐ MAP2433 3781 5125 8456 122 2672 19060 12828 180 0,554682844 1glgB MAP2434 3594 3261 3925 86 1979 12149 6788 108 0,547317507 1‐ MAP2435c 425 2797 1905 66 619 1366 1042 44 0,804108637 1fadA4 MAP2436c 1920 12915 7178 224 1809 7048 3896 133 0,593345957 1‐ MAP2437 4808 26729 26807 1507 5095 12939 7727 732 0,715512585 1‐ predicted RNA 1448 37 21 1395 1266 18 0 1016 0,665643211 1‐ MAP2438c 359 250 185 53 446 242 444 64 0,407271419 1‐ MAP2439c 308 2193 1960 76 569 2539 1745 84 0,513213715 1‐ MAP2440 453 2777 1884 37 986 1788 1303 35 0,499440869 1‐ MAP2441c 390 108 275 13 72 183 199 4 0,007137933 1‐ MAP2442 264 216 246 14 0 211 144 3 7,45E‐05 1alkA MAP2443 314 984 917 19 485 956 780 19 0,502425888 1‐ MAP2444c 6762 3192 1359 216 2795 2589 1951 98 0,584033444 1ogt MAP2445 438 630 310 47 440 548 340 41 0,953300017 1‐ MAP2446c 1048 2425 2090 160 1064 3008 2863 176 0,515773099 1‐ MAP_r01 3410 198741 99368 26802 1507 71371 49982 10762 0,753192158 1‐ MAP_r03 58933730 6340919 3087778 643460 88291410 5630790 2760210 797398 1 1murA MAP2447c 2744 6274 8224 189 3130 7600 6603 180 0,486667974 1‐ MAP2448 703 2370 2055 112 768 2094 2104 105 0,500759481 1‐ MAP2449c 403 617 1444 77 652 948 992 83 0,513761518 1atpC MAP2450c 3341 9178 8630 790 3744 11423 8463 815 0,475535789 1atpD MAP2451c 7406 30970 28360 696 8991 34068 27665 709 0,487244815 1atpG MAP2452c 6492 16878 21067 655 5742 25571 24184 714 0,514936543 1atpA MAP2453c 10098 38754 41841 690 12665 45295 41243 726 0,482253398 1atpH MAP2454c 5094 19413 34694 541 5166 26378 32434 549 0,494471564 1atpF MAP2455c 2216 14099 10569 600 2158 11756 8594 486 0,504121195 1atpE MAP2456c 3986 4453 1797 748 4286 4248 2453 713 0,482895776 1

85


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



atpB MAP2457c 4586 11164 12278 511 4372 14395 13001 517 0,496633624 1‐ MAP2458c 1967 5573 4316 338 2105 6786 4800 355 0,478409749 1rfe MAP2459c 1035 2373 2378 66 1308 3001 2636 74 0,519503157 1‐ MAP2460c 414 496 780 40 365 606 300 28 0,510250072 1hemK MAP2461c 486 929 1151 41 783 1371 1028 49 0,520043309 1prfA MAP2462c 2349 2412 4072 133 2057 4327 4271 132 0,487839799 1rpmE MAP2463c 3055 6263 6342 935 2793 8039 7426 948 0,47897143 1rho MAP2464c 24351 68343 77526 1224 27587 98534 88547 1405 0,531390151 1‐ MAP2465c 15260 61661 87274 6629 13645 100726 105328 7988 0,540918685 1thrB MAP2466c 1140 1312 2604 81 1323 3103 2676 98 0,528332335 1thrC MAP2467c 2029 3776 4869 142 1265 5584 5435 133 0,490133184 1thrA MAP2468c 1016 2078 2884 63 1044 2441 2241 56 0,511569739 1lysA_2 MAP2469c 1431 4472 6754 114 1330 4597 4278 88 0,502538245 1argS MAP2470c 1383 4786 4292 82 566 4285 3341 55 0,526794525 1‐ MAP_t33 85 78 243 83 57 161 229 75 0,870317516 1‐ MAP2471 411 1375 1244 135 286 1766 1177 124 0,485306835 1‐ MAP2472 1396 12146 13235 279 1518 11169 8963 221 0,508580902 1‐ MAP2473 269 382 1478 64 149 555 989 45 0,632330422 1‐ MAP2474c 119 837 574 38 185 641 715 40 0,469411737 1‐ MAP2475 313 1405 1032 49 458 881 803 41 0,507429441 1‐ MAP2476 628 8689 4445 309 1346 6591 4710 302 0,48798681 1‐ MAP2477c 627 570 107 42 739 216 12 35 0,916691546 1‐ MAP2478 36 579 187 23 222 349 422 37 0,177076803 1‐ MAP2479 239 922 593 13 625 515 709 16 0,914233713 1‐ MAP2480c 121 2178 849 54 233 1349 624 40 0,847961074 1‐ MAP2481c 170 1063 522 21 72 719 356 12 0,214210639 1‐ MAP2482 764 5486 5003 331 1362 5488 5371 368 0,51843341 1‐ MAP2483c 448 974 853 67 716 494 716 65 0,493583447 1cysN MAP2484c 144 647 251 7 105 215 177 3 0,072592625 1cysD MAP2485c 0 72 175 2 51 441 635 13 2,45E‐07 1‐ MAP2486 180 395 396 31 216 348 155 23 0,339402522 1‐ MAP2487c 570 1643 425 78 466 1363 913 71 0,487434826 1oppB MAP2488 138 475 625 16 238 422 303 13 0,396795975 1oppC MAP2489 263 356 580 20 403 746 339 24 0,649063388 1

86


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



oppD MAP2490 324 610 1189 15 606 1759 1498 26 0,715041645 1oppA MAP2491 589 1219 2520 35 617 3405 2474 45 0,523635508 1‐ MAP2492c 36 444 449 10 72 282 586 11 0,610870633 1‐ MAP2493c 973 4257 3636 42 801 2727 2838 29 0,534009298 1‐ MAP2494c 361 2630 1335 44 751 1530 868 38 0,49105815 1‐ MAP2495 688 1958 948 36 967 1395 1268 37 0,488509413 1‐ MAP2496 501 126 177 40 573 151 108 37 0,459633928 1lprC MAP2497c 1269 6825 8244 343 1697 12527 9593 465 0,55889525 1lprB MAP2498c 1412 3375 2476 187 1395 4155 2822 191 0,481751519 1‐ MAP2499 228 486 519 10 423 500 335 11 0,481991352 1‐ MAP2500 488 1204 2082 26 607 1274 1621 24 0,489606018 1‐ MAP2501 36 153 211 14 7 330 430 22 0,138031498 1‐ MAP2502 2114 8257 4213 115 1930 8612 5021 110 0,481565819 1embR_2 MAP2503 183 734 598 16 108 1045 406 14 0,422468542 1‐ MAP2504 450 3591 2366 61 536 3270 3000 64 0,505472799 1‐ MAP2505 324 750 1178 49 174 1212 1429 51 0,503368647 1‐ predicted RNA 120 42124 11230 13870 69 16566 6438 5856 0,672332924 1‐ MAP2507c 684 3464 1107 57 542 1772 1420 40 0,58421191 1‐ MAP2508 0 36 0 0 52 71 24 4 1,35E‐09 1amiB2 MAP2509c 226 671 728 15 108 292 552 8 0,181077385 1‐ MAP2510 578 878 571 76 439 931 591 61 0,630266174 1‐ MAP2511 108 1276 598 21 94 622 484 12 0,234943274 1‐ MAP2512 27 224 43 1 72 0 54 1 0,38623402 1‐ MAP2513c 200 275 283 11 158 214 131 7 0,161163317 1‐ MAP2514c 252 1262 1184 29 737 1617 953 40 0,589707733 1‐ MAP2515c 108 365 168 9 301 575 176 16 0,140038301 1‐ MAP2516 142 684 557 13 312 711 472 16 0,52142594 1‐ MAP2517 360 3860 2867 58 573 2360 1952 42 0,52110988 1‐ MAP2518 321 716 893 21 230 672 392 13 0,267106974 1‐ MAP2519 76 104 183 9 144 282 72 12 0,339403418 1‐ MAP2520c 503 848 1183 32 501 1003 1408 33 0,483361927 1deaD MAP2521c 1382 10747 9192 145 1711 10495 7851 134 0,49041812 1lprE MAP2522 252 542 249 26 317 318 346 25 0,144319144 1‐ MAP2523c 45 493 365 9 186 447 414 13 0,292932923 1

87


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2524c 36 107 394 6 108 139 171 6 0,982888171 1‐ MAP2525c 72 714 563 11 352 745 780 18 0,259184173 1‐ MAP2526c 0 110 238 4 72 46 414 9 0,054711271 1‐ MAP2527c 243 887 1368 48 435 753 698 41 0,557126471 1‐ MAP2528 108 143 194 8 119 320 108 8 0,826297086 1‐ MAP2529 36 252 108 7 72 86 75 5 0,3967862 1‐ MAP2530 108 501 428 16 72 801 519 19 0,414060314 1‐ MAP2531 108 431 682 27 72 713 390 22 0,39055312 1‐ MAP2533 880 1618 1692 18 1228 1493 2196 20 0,514921317 1‐ MAP2534c 335 2573 909 22 512 1793 1151 21 0,486073541 1‐ predicted RNA 72 1729 2056 2741 79 2008 1968 2802 0,482218075 1‐ MAP2535 1886 7172 9577 301 1579 7433 7061 242 0,501226786 1‐ predicted RNA 410 4021 4698 2849 431 4554 4205 2758 0,488587318 1kgd MAP2536 7286 37980 41222 279 9477 40063 31820 259 0,495308624 1‐ MAP2537 1418 12586 4455 259 1761 9550 6549 250 0,483309713 1‐ MAP2538 1200 2830 2004 102 737 2229 2407 78 0,524948094 1lpqZ MAP2539c 727 762 1024 48 459 257 539 23 0,182022954 1‐ MAP2540c 5254 15951 11508 368 2712 8645 8278 200 0,659979025 1mdh MAP2541c 2111 7753 5446 203 2344 6382 4604 173 0,49504235 1corA MAP2542 564 3333 2008 65 841 2541 1805 59 0,503961058 1‐ MAP2543 72 36 125 5 50 36 72 3 0,137322167 1‐ MAP2544c 36 36 178 8 36 89 0 4 0,081035355 1sugC MAP2545c 554 3026 2206 59 920 3409 2641 72 0,523882744 1sugB MAP2546c 445 777 1386 45 665 1314 1179 53 0,519266196 1sugA MAP2547c 431 466 571 26 376 390 849 24 0,501834628 1lpqY MAP2548c 576 878 1584 31 389 1295 1297 25 0,491650353 1‐ MAP2549c 1327 7693 4579 316 1764 5635 4052 273 0,494545635 1‐ MAP2550 938 3282 3316 74 1350 3470 2850 76 0,485332059 1‐ MAP2551 331 1103 2016 79 786 1713 1242 93 0,519056421 1‐ predicted RNA 314 5126 5515 3395 603 10796 7525 5629 0,551762196 1‐ MAP2552 1568 4297 4533 103 1677 5928 3853 103 0,487621513 1mrp MAP2553 1112 7113 5429 140 1577 5464 4559 122 0,493746183 1‐ MAP2554c 341 1550 1830 115 588 1690 1551 122 0,484372838 1htrA MAP2555c 3428 12654 15300 262 5065 18264 14028 302 0,517899068 1

88


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2556c 1171 2513 4323 270 1520 4232 4847 331 0,531704195 1sigE MAP2557c 4532 14427 20461 669 5568 30392 16831 809 0,525103801 1‐ MAP2558 531 2915 1668 85 629 1598 1266 61 0,537984552 1‐ MAP2559 13671 55733 38225 1726 23878 55578 35385 1917 0,515567048 1‐ predicted RNA 719 15 0 1170 1113 0 15 1520 0,930045901 1‐ predicted RNA 1507 0 26 1532 2449 24 15 2091 0,526461985 1‐ predicted RNA 741 0 0 922 1795 0 0 1875 0,182374609 1‐ MAP2560 14111 68116 39488 1982 25865 48746 32217 1936 0,502105366 1‐ predicted RNA 7646 91 0 4356 11978 4 68 5722 0,552369964 1‐ predicted RNA 2984 33 34 2493 6289 0 0 4380 0,630732258 1‐ predicted RNA 336 0 0 1087 621 0 4 1691 0,251810884 1‐ predicted RNA 628 0 0 1129 869 0 0 1311 0,878391467 1‐ MAP2561 8565 40734 32697 620 13805 34190 26683 595 0,488674951 1‐ predicted RNA 1140 12 0 1088 2741 18 22 2202 0,63734609 1‐ predicted RNA 1522 0 0 1448 2575 21 0 2063 0,529272179 1‐ MAP2562 16216 16996 15348 1258 27087 17056 14016 1540 0,446183215 1‐ predicted RNA 1153 0 30 1254 1573 0 0 1424 0,519935187 1‐ predicted RNA 12845 201 52 1590 20302 98 36 2101 0,539047753 1‐ MAP2563 3715 4184 6174 133 3809 5132 6857 133 0,481670475 1‐ predicted RNA 1967 0 4 1676 2585 0 0 1848 0,512454737 1glgC MAP2564c 1606 4538 3418 108 2396 5110 3437 122 0,519488905 1‐ MAP2565 227 1785 1272 32 166 1267 776 20 0,78863072 1‐ MAP2566 2389 8829 4910 128 2115 9141 4644 114 0,490346357 1‐ predicted RNA 3788 19850 16409 3796 4235 23012 16306 3899 0,499655853 1‐ predicted RNA 484 14 51 1167 535 0 34 1065 0,428095882 1‐ predicted RNA 1674 34 0 1557 2079 30 0 1621 0,508509261 1tagA MAP2567c 677 942 1693 84 1181 1157 1902 109 0,523646255 1‐ MAP2568c 723 2034 2172 189 508 2889 1975 175 0,500727788 1‐ MAP2569c 108 1416 1249 30 323 1243 783 28 0,496442954 1folP2 MAP2570c 403 1678 1516 49 160 1199 888 27 0,42509378 1fadD6 MAP2571c 1040 2415 1347 40 1013 2181 1581 36 0,504413157 1‐ MAP2572c 135 843 1409 49 208 1084 1126 49 0,500386574 1‐ MAP2573 189 180 213 5 99 63 123 2 0,035386225 1dapE MAP2574c 106 1076 894 21 300 759 535 19 0,981490403 1

89


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2575c 68 128 102 3 0 247 115 3 0,453517564 1PE_6 MAP2576c 36 71 36 2 55 159 125 5 0,020983905 1‐ MAP2577 3949 1770 1372 130 1677 1633 1265 60 0,880969371 1‐ MAP2578 496 1623 742 41 699 921 975 39 0,483433515 1‐ MAP2579c 531 1283 1346 32 848 2151 1242 42 0,520620157 1fadD36 MAP2580c 147 331 289 7 180 149 148 5 0,212602474 1‐ MAP2581c 547 2110 997 53 283 2113 1351 45 0,489059847 1‐ MAP2582c 2444 715 1798 45 686 10818 5359 76 0,553667298 1‐ MAP2583c 3001 8610 5028 159 612 48171 18821 451 0,728791197 1‐ MAP2584 1215 4295 3543 99 896 4741 3112 84 0,497925262 1fadE26_2 MAP2585 1386 6394 5333 138 1203 7821 5246 136 0,485147105 1‐ MAP2586 194 1797 957 61 389 2335 893 76 0,515484033 1‐ MAP2587 180 1681 1571 96 296 2374 1478 113 0,52095101 1‐ MAP2588 1014 2916 3236 85 961 4442 2697 85 0,489559495 1‐ MAP2589 635 1801 1524 117 1081 2203 1404 140 0,518010167 1ltp2_2 MAP2590 432 1897 1806 44 480 2703 2876 59 0,525904926 1‐ MAP2591 102 108 214 11 36 399 426 15 0,202420157 1‐ MAP2592c 0 286 129 4 111 68 112 5 0,60285316 1rocA MAP2593c 176 745 536 11 249 217 213 6 0,223704493 1‐ MAP2594 72 212 133 3 70 298 45 3 0,748365156 1‐ MAP2595 413 108 309 10 264 142 86 5 0,114515656 1fadD21_2 MAP2596 3348 359 427 66 3984 606 394 67 0,485126342 1‐ predicted RNA 3251 4490 7115 3263 3342 8266 7109 3536 0,469345157 1‐ MAP2597c 645 7423 4644 426 873 4647 2651 285 0,531475558 1‐ predicted RNA 1236 0 0 1212 981 0 0 807 0,951243487 1sat MAP2598c 2562 13255 9035 243 2813 8878 5483 172 0,522038199 1‐ MAP2599c 410 2202 1565 73 552 1808 949 60 0,490974034 1‐ MAP2600 102 178 180 5 36 116 246 3 0,258973126 1‐ MAP2601 0 169 96 2 50 0 38 1 0,234958645 1‐ MAP2602 42 36 35 8 0 72 0 2 0,014734921 1‐ MAP2603c 72 379 888 3 107 882 686 4 0,409323631 1‐ MAP2604c 190 1328 863 12 486 893 501 11 0,49921385 1‐ MAP2605c 920 4530 4407 50 1917 5255 4833 63 0,529098526 1‐ MAP2608 215 152 265 11 108 435 313 10 0,478008085 1

90


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2609 4479 23061 17702 1672 4322 31464 20864 1898 0,518620201 1‐ predicted RNA 1508 0 0 1394 1262 3 12 984 0,734542219 1‐ MAP2610c 3268 545 344 159 2263 661 466 100 0,542281605 1fbiC MAP2611c 3060 9834 11001 119 4037 9304 9885 116 0,484289127 1‐ MAP2612c 679 3005 3039 170 732 2696 2485 146 0,515523834 1‐ MAP2613c 243 283 675 19 108 425 284 10 0,155907588 1‐ MAP2614 294 501 488 28 338 251 353 22 0,367675878 1lpqW MAP2615c 631 1210 1901 27 308 1348 1711 20 0,573974916 1‐ MAP2616c 828 1612 1038 26 580 1349 1251 20 0,505071175 1narI MAP2617c 410 499 847 37 268 576 744 28 0,807876317 1narH MAP2619c 590 2212 2819 43 1125 2841 2927 54 0,530087142 1narG MAP2620c 896 3534 3292 26 1041 3977 3371 27 0,482830763 1mutT2 MAP2621c 36 70 98 7 108 36 109 11 0,187282662 1‐ MAP2622 1139 13639 9811 289 2195 12702 9789 298 0,473649591 1phhB MAP2623 830 9112 4141 480 1962 6975 4601 506 0,47971116 1pimE MAP2624c 655 1089 1734 38 512 1161 1239 28 0,575134065 1‐ MAP2625 116 3220 1307 69 477 6538 3063 151 0,591165269 1‐ MAP2626 702 960 570 34 1551 2147 2216 78 0,326975098 1‐ MAP2627c 503 3153 1825 449 1489 2150 1027 484 0,510057755 1‐ MAP2628c 1696 18986 14643 685 2979 14918 12448 613 0,503303231 1‐ predicted RNA 586 68 55 1188 723 118 108 1288 0,878636706 1‐ MAP2629c 134 1631 1312 151 239 1770 958 146 0,491874675 1‐ MAP2630c 493 853 1365 87 667 1210 1583 104 0,520818636 1‐ MAP2631 31 105 215 7 143 134 219 13 0,101904835 1‐ MAP2632c 144 2474 1463 120 208 1565 1552 100 0,488687853 1‐ MAP2633 451 930 810 45 360 1038 760 38 0,515196018 1‐ MAP2634c 418 617 408 36 262 616 588 29 0,690690469 1‐ MAP2635c 385 700 727 11 1138 900 732 19 0,48671704 1‐ MAP2636 2870 2234 2123 933 2743 3329 2434 894 0,490890605 1‐ MAP2637c 722 746 459 46 421 391 369 24 0,213160369 1mcr MAP2638c 402 3754 1889 63 632 1537 869 37 0,875167451 1echA11 MAP2639 684 1049 1340 57 671 596 395 34 0,723600928 1‐ MAP2640c 310 594 712 32 671 539 431 38 0,885649003 1‐ MAP2641c 308 1578 1252 27 788 1375 1123 33 0,520979356 1

91


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2643 216 3879 2511 142 253 4050 2917 151 0,508329547 1‐ MAP2644 144 392 266 11 203 319 52 8 0,282933832 1echA1_1 MAP2645c 208 1037 1079 35 257 508 231 17 0,142285655 1fadA6_3 MAP2646c 1621 13590 6661 221 2830 6279 3583 150 0,518102534 1‐ MAP2647c 107 1140 1332 65 170 750 650 42 0,379428739 1‐ MAP2648c 354 5906 3234 97 589 2683 1228 51 0,914460706 1‐ MAP2649c 24 396 180 5 89 322 175 5 0,670024285 1‐ MAP2650c 7 106 117 2 36 71 54 2 0,684603467 1‐ MAP2651c 143 287 179 8 144 72 34 4 0,078368351 1‐ MAP2652c 36 140 36 2 105 72 36 3 0,368449069 1nirQ MAP2653c 0 108 247 4 83 105 72 4 0,781702341 1‐ MAP2654c 0 106 35 0 35 0 92 1 0,306161441 1‐ MAP2655 218 2200 1726 39 408 1960 2098 44 0,515617348 1‐ MAP2656 165 448 671 15 422 518 461 19 0,521385401 1‐ MAP2657 252 1872 1531 65 271 1814 1356 59 0,485125452 1‐ MAP2658 596 1249 1018 32 899 945 785 32 0,4832534 1‐ MAP2659 244 1417 909 37 457 1307 905 40 0,50639899 1‐ MAP2660 144 142 247 13 220 85 371 17 0,286755782 1metE MAP2661 790 1759 1425 25 612 2715 1442 25 0,49518402 1‐ MAP2662c 456 2749 1894 35 925 2147 1815 36 0,509075346 1‐ MAP2663c 372 2838 1365 105 407 2170 1466 91 0,49449422 1ppdK MAP2664 504 1005 835 20 555 857 515 16 0,565771519 1‐ MAP2665 177 388 711 28 180 643 796 32 0,455513301 1‐ MAP2666c 72 36 80 2 36 108 59 2 0,389142857 1ephC MAP2667c 150 1116 722 27 235 783 464 21 0,608873665 1‐ MAP2668c 0 72 138 4 0 144 3 2 0,177369942 1bpoB MAP2669 555 2752 2734 79 985 2143 1175 63 0,5141053 1gnd2 MAP2670c 634 4913 3095 98 1608 5840 4304 140 0,541199791 1zwf MAP2671c 975 4667 2499 73 1319 5288 3806 89 0,530405675 1‐ MAP2672 326 466 72 23 88 354 321 13 0,146783973 1‐ MAP2673 390 1936 1176 47 510 1755 1075 44 0,485036932 1‐ MAP2674c 72 70 36 13 65 142 107 17 0,462914931 1‐ MAP2675c 77 500 151 17 36 240 190 10 0,120805406 1‐ MAP2676c 308 778 1079 82 468 1562 1029 107 0,715264984 1

92


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2677c 140 725 177 33 246 315 448 36 0,678797042 1‐ MAP2678c 40 108 215 16 36 246 35 12 0,441214468 1‐ MAP2679c 321 4593 2620 187 734 4927 2912 219 0,526689266 1‐ MAP2680c 882 7158 4454 389 789 6004 4337 332 0,499130468 1‐ predicted RNA 90 43562 11152 5922 93 34042 14969 5222 0,522680663 1‐ MAP2681c 971 1811 1286 66 693 1519 1461 51 0,503155851 1‐ MAP2682c 825 3576 4630 103 1146 4721 4450 114 0,522554279 1‐ MAP2683 2230 3923 7154 154 1661 5408 5960 132 0,495746653 1ispH MAP2684c 1844 5234 4953 163 2444 6153 3347 159 0,486541765 1‐ MAP2685 3079 11042 9082 508 4199 14206 11258 614 0,530374016 1‐ predicted RNA 1414 0 21 1313 2957 0 38 2307 0,762248758 1xseA MAP2686 894 1375 2500 55 928 1784 1624 47 0,507419133 1xseB MAP2687 976 7953 13381 1014 492 16824 13105 1245 0,546523677 1‐ MAP2688 1051 933 1845 57 1320 2143 1688 67 0,517570878 1‐ MAP2689c 757 1844 1298 36 870 1400 1321 32 0,496365495 1‐ MAP2690c 349 2590 3112 86 327 1833 2226 62 0,512400871 1‐ MAP2691c 748 2168 2054 90 634 1663 1259 62 0,598391338 1glpX MAP2692 1382 6795 5666 158 1925 4381 3982 125 0,499395697 1fumC MAP2693 1962 6959 5214 131 2023 3353 3353 86 0,538079581 1‐ predicted RNA 797 0 0 1121 750 0 0 885 0,817392228 1‐ MAP2694 943 1651 2825 72 1009 1642 1800 58 0,515029512 1‐ MAP2695c 772 716 1399 31 530 650 763 19 0,789050076 1‐ MAP2696c 1292 1464 1991 88 873 1855 1785 68 0,51755973 1phoH2 MAP2697c 1996 7960 7183 167 2203 6902 6015 144 0,494114352 1desA2 MAP2698c 3397 42299 17079 843 4873 17923 16121 570 0,559288254 1glyA MAP2699c 1170 7577 5719 134 1614 5205 3972 105 0,499798981 1coaA MAP2700 829 8846 10057 234 1331 8601 7832 213 0,489378692 1‐ MAP2701c 36 1866 373 53 115 592 240 26 0,127142112 1‐ MAP2702c 303 1601 1391 29 364 960 958 21 0,782980752 1‐ MAP2703c 641 1785 1230 64 632 1293 784 47 0,63383828 1‐ MAP2704 565 1995 1419 68 623 2067 1620 69 0,49043372 1‐ MAP2705c 454 1523 821 99 108 1160 642 53 0,223775753 1‐ MAP2706c 468 854 1744 20 495 1162 1282 18 0,485423228 1‐ MAP2707c 291 326 1010 73 226 842 746 68 0,626043634 1

93


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2708c 380 540 1372 61 384 1221 1143 65 0,50745864 1tesB2 MAP2709c 1777 10848 13281 364 2986 9943 9365 327 0,491552951 1‐ MAP2710c 5534 24161 22667 718 5198 19718 13845 517 0,549715188 1‐ predicted RNA 442 2 0 1101 561 0 0 1172 0,701501955 1‐ MAP2711c 659 1301 2008 54 669 1870 1907 54 0,493092985 1‐ MAP2712c 569 2140 1691 50 754 2227 2073 56 0,512607601 1‐ MAP2713c 581 538 1146 37 564 589 733 29 0,616409321 1pgsA MAP2714c 453 1198 1176 60 320 889 769 39 0,84321287 1‐ MAP2715c 819 3632 3647 172 1041 3723 3087 164 0,492990596 1thrS MAP2716c 3461 5500 7323 118 2468 4838 5875 85 0,51264205 1‐ MAP2717 339 667 1920 21 698 1587 1696 29 0,522503537 1‐ MAP2718c 250 342 404 12 379 1037 532 20 0,26472761 1‐ MAP2719c 254 464 798 33 288 538 648 31 0,628546537 1‐ MAP2720c 1486 4466 5723 164 1814 7484 6539 204 0,535319173 1‐ MAP2721 144 320 288 21 134 497 569 28 0,322524687 1‐ MAP2722c 192 1203 699 26 131 804 266 14 0,181196582 1‐ MAP2723c 104 685 231 35 72 275 278 21 0,143437491 1‐ MAP2724c 113 174 146 16 71 143 211 13 0,610902626 1‐ MAP2725c 182 344 242 16 171 410 185 14 0,386822112 1fdxA MAP2726c 166 319 375 34 144 250 214 23 0,204105842 1‐ MAP2727 72 62 0 3 0 0 36 0 8,61E‐13 1‐ MAP2728 36 761 277 43 0 663 710 52 0,376307995 1pcaB MAP2729c 72 320 248 6 214 50 334 8 0,310294743 1pcaG MAP2730c 97 396 352 19 36 429 255 13 0,211278886 1pcaH MAP2731c 108 251 274 11 252 215 108 13 0,525649466 1‐ MAP2732c 348 1260 332 55 119 1608 783 54 0,501583907 1‐ MAP2733c 129 739 264 14 72 1539 659 23 0,253743315 1‐ MAP2734 52 2540 396 22 369 1038 862 21 0,496461218 1‐ MAP2735 72 389 36 11 72 157 99 8 0,289462346 1fabG5_1 MAP2736 0 249 36 3 108 89 0 4 0,277638378 1fliH MAP2737 89 703 192 16 34 177 261 7 0,050932475 1‐ MAP2738c 66 644 637 18 117 951 670 23 0,381269948 1‐ MAP2739 96 401 281 11 180 116 75 7 0,188734989 1‐ MAP2740 246 1054 816 40 395 569 499 32 0,941466161 1

94


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2741c 879 2903 2516 134 897 4769 3613 173 0,537885427 1‐ MAP2742 693 5090 4677 277 891 9098 8567 459 0,550651092 1‐ predicted RNA 3219 35 41 1908 5977 29 0 2957 0,546003217 1‐ MAP2743c 221 83 293 14 406 216 179 19 0,32463464 1‐ MAP2744c 396 659 536 26 673 569 499 30 0,694313553 1‐ MAP2745c 240 504 250 19 127 740 251 16 0,389274486 1‐ MAP2746 211 833 497 38 420 951 808 55 0,543192262 1‐ MAP2747 236 1533 864 20 742 786 1035 24 0,511232505 1‐ MAP2748c 108 133 82 6 109 71 89 5 0,547712423 1‐ MAP2749c 0 379 206 19 59 279 227 22 0,618920628 1‐ MAP2750c 294 3574 1121 127 216 1565 1640 87 0,785542187 1‐ MAP_t35 36 300 352 107 51 304 163 81 0,405947491 1‐ MAP_t36 200 933 1994 521 209 711 1062 335 0,756282973 1‐ MAP_t37 32 2513 1235 533 0 1283 557 246 0,130886284 1‐ MAP2751 193 12 360 17 0 275 632 16 0,608973631 1‐ MAP2752 449 288 428 19 190 480 508 13 0,306480541 1‐ MAP2753 267 939 825 34 352 743 872 34 0,502068195 1‐ MAP2754 36 557 269 36 36 402 168 25 0,198049302 1‐ MAP2755 87 277 252 27 119 258 321 30 0,700952413 1‐ MAP2756c 606 1311 1740 10 636 1254 1121 8 0,494178034 1‐ MAP2757 269 1101 587 90 360 425 215 56 0,266981156 1‐ MAP2758 1623 7837 10537 958 1292 10447 11289 1008 0,4713372 1‐ MAP2759 515 4763 2253 166 855 2128 1291 109 0,537271493 1‐ MAP2760c 50 75 101 8 107 107 40 10 0,450394202 1‐ MAP2761c 92 727 125 15 64 339 179 9 0,143117248 1‐ MAP2762c 72 467 285 22 36 342 135 12 0,113475288 1‐ MAP2763c 36 72 233 14 0 36 110 4 0,007788765 1‐ MAP2764c 74 281 321 19 72 317 108 13 0,240845218 1‐ MAP2765c 74 120 179 4 28 178 108 2 0,195720408 1‐ MAP2766c 683 214 160 54 304 219 217 26 0,131807589 1‐ MAP2767c 2543 3268 6083 325 2117 5329 6356 318 0,482218997 1‐ MAP2768c 7845 24284 36579 849 8092 35818 31065 854 0,486450453 1‐ predicted RNA 28 1844 4869 5486 7 5477 5979 8902 0,555365282 1‐ predicted RNA 13596 642 614 4975 16178 722 643 4979 0,497719465 1

95


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 1949 0 0 1752 1344 0 39 1026 0,817775288 1‐ predicted RNA 1957 275 549 1997 2073 662 682 1939 0,500452967 1‐ predicted RNA 1728 0 0 1553 1689 0 17 1279 0,496264777 1‐ predicted RNA 17931 16912 33759 5176 20025 29953 29032 5305 0,478179207 1‐ predicted RNA 815 1436 5064 2794 480 6276 7989 4647 0,564066946 1‐ MAP2769c 109 0 34 12 169 0 0 14 0,604949281 1‐ MAP2770 420 2638 2215 112 215 2760 2404 102 0,500812315 1‐ MAP2771c 718 3378 2034 60 976 2399 2114 55 0,506797483 1‐ MAP2772c 216 1020 635 19 344 998 1145 25 0,92104684 1‐ MAP2773c 282 942 820 33 540 1275 804 43 0,822213554 1‐ MAP2774c 468 1616 1786 51 593 1830 1125 46 0,489532394 1‐ MAP2775 72 390 121 8 72 467 231 9 0,537221945 1‐ MAP2776c 887 11438 4274 146 612 6039 3549 88 0,741930071 1‐ MAP2777c 224 0 125 11 514 52 158 21 0,105047545 1‐ MAP2778c 611 802 991 56 325 691 732 34 0,588949605 1‐ MAP2779 94 323 232 10 84 276 153 7 0,097883021 1‐ MAP2780 72 124 170 6 0 209 118 3 0,12341183 1‐ MAP2781 57 144 126 5 0 116 36 1 0,002863146 1‐ MAP2782 36 36 176 2 22 108 93 1 0,435592312 1‐ MAP2783 902 3090 2888 319 419 4129 3164 296 0,506608636 1‐ MAP2784 12999 164919 100095 2460 27031 135259 91926 2375 0,507756962 1‐ predicted RNA 6735 921 854 1396 11344 849 896 1927 0,558034898 1‐ predicted RNA 10538 352 380 2744 18130 438 299 3935 0,545348391 1‐ predicted RNA 1465 89 107 1497 2211 20 85 1854 0,520462631 1‐ predicted RNA 568 14553 24154 9527 1088 24305 25822 12146 0,533662786 1‐ MAP2785c 1845 1044 749 160 2778 1703 1075 211 0,541808191 1‐ MAP2786c 867 9577 2671 429 3599 8184 4239 633 0,546619603 1clpX' MAP2787 216 352 137 15 36 209 103 5 0,002961036 1‐ MAP2788 1258 4629 3056 223 1631 3207 3074 203 0,491980586 1‐ MAP2789 1472 794 2235 152 961 1037 1247 94 0,74890677 1‐ MAP2790c 995 777 407 40 657 356 287 22 0,402083497 1ribD MAP2791 252 449 215 19 174 144 139 9 0,076903764 1‐ MAP2792 892 2043 2100 44 831 2288 1485 37 0,509713466 1‐ MAP2793 807 1863 2453 54 567 1350 1465 34 0,894014861 1

96


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2794 939 2112 2445 190 1057 2878 2659 207 0,512782377 1‐ MAP2795 468 499 752 33 300 1721 1446 46 0,966477361 1‐ MAP2796c 902 926 1250 68 641 1647 1576 66 0,490733041 1‐ MAP2797c 464 2708 3723 116 762 3262 3180 122 0,508825772 1hemY' MAP2798c 100 473 296 8 31 287 411 5 0,221597086 1hemE MAP2799c 216 1674 949 30 288 1717 1131 33 0,510766374 1echA15 MAP2800 1400 2802 3663 135 1531 3168 2495 118 0,498155721 1‐ MAP2801 790 1756 2411 107 1176 5866 6302 243 0,714577071 1‐ MAP2802 264 735 1034 20 396 1573 1887 35 0,509918819 1dxs MAP2803c 1896 5274 5246 87 1538 4720 4246 68 0,500266179 1‐ MAP2804 174 712 344 33 252 393 491 32 0,78084834 1arsA MAP2805 650 828 1282 33 618 1015 676 25 0,546182241 1‐ MAP2806c 205 254 602 14 200 498 444 13 0,576184734 1‐ MAP2807c 766 4531 2633 48 899 3236 2944 43 0,508421355 1trkA MAP2808 1649 4341 4569 216 1907 4707 3708 203 0,49126996 1trkB MAP2809 1614 4295 3844 205 1611 4681 3274 186 0,496123254 1‐ MAP2810c 893 1448 1581 93 408 2346 1375 73 0,500416077 1‐ MAP2811c 1495 9789 6585 470 1373 16581 8452 618 0,556012969 1‐ MAP2812 72 353 108 9 220 242 273 15 0,130543274 1‐ MAP2813c 577 3113 2314 94 784 2994 2105 92 0,501059915 1dut MAP2814c 246 3816 2605 156 601 4132 1828 158 0,503127095 1‐ MAP2815 353 824 754 56 644 600 357 55 0,500492756 1‐ MAP2816c 986 8438 3110 482 836 4345 2968 312 0,552474849 1‐ MAP2817 533 1486 950 62 572 678 525 41 0,942742849 1suhB MAP2818c 57 166 47 4 294 234 120 12 0,003289587 1ppgK MAP2819 402 3780 1973 87 762 2078 1173 64 0,511245574 1‐ predicted RNA 1290 510 1038 1995 470 662 604 876 0,143747956 1sigA MAP2820 6726 16730 16995 367 6392 13557 9947 265 0,54629603 1‐ MAP2821 332 2501 3063 166 275 2282 2625 139 0,507662288 1‐ MAP2822 160 1476 2736 139 196 2491 3371 185 0,525387094 1‐ predicted RNA 1682 0 0 1600 872 0 0 696 0,132549257 1‐ MAP2823 938 1127 1582 58 1115 1115 807 49 0,499192313 1‐ MAP2824c 1325 20609 16906 1761 862 20302 10781 1357 0,513386665 1‐ MAP2825 500 2717 3798 180 686 3164 3279 180 0,497070608 1

97


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



sigB MAP2826 8846 122896 125625 2823 7533 116336 66621 1993 0,535690376 1‐ predicted RNA 1547 32 25 1489 1119 3 12 898 0,814407201 1‐ predicted RNA 421 10 10 1152 343 0 0 776 0,218970583 1‐ predicted RNA 429 2663 2521 3330 389 2246 2399 2868 0,50574321 1ideR MAP2827c 2074 143 0 120 1761 0 20 84 0,53729686 1‐ MAP2829 1365 4683 3023 85 2521 4260 3272 101 0,524360321 1‐ MAP2830c 326 1506 1678 51 805 1631 1692 66 0,520985325 1‐ MAP2831 3659 7178 4325 240 5575 6179 3826 256 0,470579748 1‐ predicted RNA 2589 0 0 2094 3475 0 0 2360 0,521294342 1‐ MAP2832 640 2296 2789 70 2084 2088 1778 92 0,537356369 1‐ MAP2833c 693 1264 802 88 878 857 839 84 0,484773777 1nrdR MAP2834c 625 1719 1210 106 762 2077 1105 111 0,487574726 1‐ MAP2835c 482 528 272 45 154 809 707 37 0,713902687 1‐ predicted RNA 6243 2838 1123 4089 825 17719 9069 4789 0,457426736 1lexA MAP2836 468 2276 787 69 592 975 1186 58 0,488255694 1‐ MAP2837c 2127 14371 11750 141 2720 32257 29593 293 0,584022457 1fadE20_2 MAP2838c 934 6312 5103 121 1547 7552 5586 143 0,526671254 1hflX MAP2839c 1025 7671 6274 120 877 4395 4155 75 0,652813196 1dapF MAP2840c 526 1187 793 41 418 856 1106 35 0,492312499 1miaA MAP2841c 144 345 251 11 107 322 349 10 0,555715352 1‐ MAP2842c 125 108 381 13 88 319 347 13 0,928822209 1‐ MAP2843c 412 1256 1715 44 1129 4545 3226 108 0,18133137 1‐ predicted RNA 69 1184 4367 1903 118 3637 5938 3177 0,568573984 1‐ MAP2844 870 8088 4020 105 736 5158 3971 78 0,505215615 1‐ MAP2845c 557 1379 945 68 406 815 467 38 0,454457973 1‐ MAP2846c 886 2225 1695 43 530 2464 1387 33 0,508651663 1recX MAP2847c 217 1137 644 47 70 1023 675 35 0,570221656 1recA MAP2848c 5071 17056 11415 366 3722 14316 12151 296 0,520408816 1‐ MAP2849 663 42 70 34 657 76 208 31 0,998807039 1‐ MAP2850c 491 2180 1418 251 570 3169 1665 301 0,518640835 1‐ MAP2851c 72 365 422 8 180 392 177 8 0,992954696 1‐ MAP2852 1569 4026 3992 306 1729 4899 3568 302 0,488977356 1‐ MAP2853c 2325 2271 4753 348 3137 3596 4158 384 0,520875698 1‐ MAP2854c 823 3268 4672 133 846 3906 3060 113 0,506459036 1

98


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



35kd_ag MAP2855c 1776 17701 10714 413 1981 9436 7683 270 0,529755476 1‐ MAP2856c 475 6880 10271 588 681 6786 4710 403 0,509315917 1pgsA3 MAP2857c 249 2641 1263 78 495 2141 1671 85 0,515258838 1‐ MAP2858 590 1111 1325 83 504 1780 1682 92 0,517112237 1ftsK MAP2859c 2229 13493 8162 107 1531 5732 4940 55 0,974436303 1‐ MAP2860 456 1933 1593 160 608 1810 1202 146 0,490039086 1‐ MAP2861 436 1568 1784 58 852 1910 1703 71 0,519666484 1‐ MAP2862 1040 885 928 59 949 950 807 49 0,492062029 1‐ MAP2863c 2328 4915 6695 116 3045 5801 5103 114 0,479433655 1dapA MAP2864c 2682 4050 4202 189 2498 3824 2882 148 0,500069121 1thyX MAP2865c 604 981 1436 59 324 921 976 37 0,8343311 1‐ MAP2866c 107 46 41 3 0 0 20 0 5,13E‐107 1‐ MAP2867c 442 2158 2775 87 416 2294 2088 74 0,504844012 1‐ predicted RNA 46 4328 6443 4023 83 4932 5669 3909 0,486196338 1dfrA MAP2868c 120 419 842 31 165 546 678 30 0,921293743 1thyA MAP2869c 1193 4412 3354 146 1131 3198 2000 101 0,532491811 1‐ MAP2870 375 1522 458 42 288 923 444 28 0,624269044 1‐ MAP2871c 159 282 278 8 164 106 207 6 0,210143433 1fabG MAP2872c 156 1233 669 30 309 859 517 28 0,757163753 1‐ MAP2873c 353 1110 1382 11 707 810 539 10 0,490532578 1fadD13 MAP2874c 386 1320 753 21 703 978 918 24 0,513222695 1‐ MAP2875 144 462 323 14 36 312 315 8 0,12477425 1‐ MAP2876c 288 705 507 46 272 442 559 37 0,469709703 1‐ MAP2877c 36 528 609 28 144 453 500 29 0,925438977 1dapB MAP2878c 1073 2639 1099 97 1458 2827 1663 113 0,519778637 1‐ MAP2879c 334 72 136 23 130 1809 891 52 0,099248162 1‐ MAP2880 0 105 34 1 0 143 0 0 0,645175269 1‐ MAP2881c 154 1598 895 27 242 834 1056 23 0,538288676 1‐ MAP2882c 197 750 665 19 279 608 687 19 0,495804286 1‐ MAP2883 278 214 226 20 212 325 96 14 0,277000626 1‐ MAP2884c 106 1356 249 17 360 908 911 25 0,447333319 1‐ MAP2885c 313 3647 981 31 282 1258 1532 20 0,933012488 1‐ MAP2886c 226 1760 214 29 305 1053 707 28 0,502486417 1‐ MAP2887c 426 614 461 53 366 392 229 34 0,285757407 1

99


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



ald MAP2888 279 669 641 19 310 567 253 14 0,344021513 1‐ MAP2889c 970 3099 2972 90 682 3654 3049 83 0,507743457 1pepR MAP2890c 2165 3403 4890 117 2749 5318 5281 136 0,530160381 1gpsI MAP2891c 19259 27710 33516 550 20796 39103 33000 564 0,504457436 1‐ predicted RNA 1955 16204 15988 7243 1418 25694 21930 9498 0,536380232 1rpsO MAP2892c 967 3030 2200 311 682 2382 2170 237 0,522168417 1‐ predicted RNA 1596 3003 5205 2790 1775 5653 5133 3183 0,520463852 1‐ predicted RNA 1920 0 23 1834 2246 0 0 1794 0,496465567 1‐ predicted RNA 992 48 0 1302 673 0 0 731 0,230212892 1‐ predicted RNA 3992 0 0 2348 3816 36 0 1890 0,502857774 1‐ predicted RNA 2792 0 0 885 1992 36 0 533 0,692355863 1ribF MAP2893c 2485 5928 7639 223 2317 7954 5590 199 0,49082212 1‐ MAP2894 415 3282 1769 253 713 1743 1967 225 0,502877937 1‐ MAP2895 272 213 57 25 233 243 337 27 0,681231045 1fadE21 MAP2896c 1614 6068 5080 131 1214 3847 4309 91 0,509654356 1ltp1 MAP2897c 1425 12680 5666 191 2139 6126 3466 127 0,517048962 1truB MAP2898c 125 110 244 8 89 154 164 6 0,345441388 1‐ MAP2899c 177 462 533 23 180 637 448 22 0,778970927 1‐ MAP2900c 790 2150 2426 73 1353 2413 1994 81 0,514130518 1‐ MAP2901 457 862 530 43 243 500 598 27 0,273717453 1‐ MAP2902 583 428 266 14 738 603 289 16 0,514756178 1‐ MAP2903c 384 1594 1120 70 844 1364 863 79 0,520393157 1echA16_2 MAP2904 108 618 318 17 167 351 258 14 0,364468555 1‐ MAP2905c 973 7055 6961 174 1179 5528 4433 131 0,502612114 1rbfA MAP2906c 2420 6423 4704 389 2942 4756 2139 299 0,502752243 1infB MAP2907c 6040 52517 44917 425 6247 45032 32756 337 0,527441344 1‐ predicted RNA 87 8292 8422 5587 187 11833 8562 6662 0,537249185 1‐ MAP2908c 12975 87977 71832 6594 16697 121104 85923 8079 0,542184629 1‐ predicted RNA 9 19500 17496 37596 13 29085 22151 50778 0,539838073 1‐ predicted RNA 1164 0 2 1256 1565 0 0 1417 0,519450674 1‐ predicted RNA 736 126 35 1411 549 93 34 896 0,275538988 1‐ predicted RNA 15391 315 429 1967 19229 520 272 2062 0,502293478 1nusA MAP2909c 712 4024 2112 79 434 3516 2133 63 0,520180785 1‐ MAP2910c 1547 9287 7216 403 1480 8015 6260 338 0,497344617 1

100


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP2911 144 252 255 18 229 109 223 17 0,933225509 1‐ MAP2912 356 819 705 60 244 728 519 42 0,530622317 1proS MAP2913c 982 1616 746 31 830 1130 651 22 0,637845783 1‐ MAP2914c 396 370 639 18 138 1491 548 18 0,494586856 1efpA_2 MAP2915c 1824 17485 13806 232 4746 20807 13076 285 0,52664346 1cysG2 MAP2916c 732 1462 1941 48 1209 1664 1305 51 0,509571879 1cobB MAP2917c 0 461 443 6 170 337 179 6 0,823287843 1cobA MAP2918c 209 1955 1655 70 246 1352 1537 58 0,491765323 1‐ MAP2919c 341 565 548 12 474 438 322 11 0,886543234 1‐ MAP2920c 216 576 796 44 72 885 783 39 0,542315236 1‐ MAP2921c 638 3145 3342 57 716 3300 2980 54 0,504677904 1‐ MAP2922 249 1376 1497 36 445 1862 1193 40 0,519100401 1gorA MAP2923 288 856 819 19 405 1186 766 21 0,548129063 1nicT MAP2924 548 749 578 25 684 906 680 27 0,506043263 1‐ MAP2925 0 0 110 1 0 143 52 1 0,315865818 1‐ MAP2926 281 937 1497 76 212 1659 1360 80 0,488386281 1‐ MAP2927 66 274 268 8 95 216 206 7 0,754296125 1‐ MAP2928c 258 605 639 27 411 825 816 35 0,74882063 1aldC MAP2929c 324 1137 1392 26 709 1857 1534 38 0,564198364 1‐ MAP2930c 465 2764 1768 79 288 3776 2409 89 0,514019953 1glnA4 MAP2931c 988 3022 3262 69 1522 5194 3966 95 0,538656878 1‐ MAP2932c 1510 2189 1524 156 1727 2683 2080 170 0,517585618 1cobQ MAP2933c 781 616 1463 31 354 1043 1585 24 0,53937654 1map MAP2934c 1396 4542 4811 163 1670 5178 4035 159 0,489419559 1‐ MAP2935c 286 1036 612 43 432 935 610 45 0,496384315 1‐ MAP2936c 1610 8576 4954 100 1415 4362 3018 59 0,761502149 1‐ MAP2937c 669 6500 4878 159 753 4250 3876 118 0,50802072 1ispG MAP2938c 2988 19462 27798 500 4023 28993 22407 530 0,509618585 1‐ MAP2939c 2484 5554 7230 173 2521 6287 5494 151 0,491812423 1‐ MAP2940c 438 3049 3016 60 1014 2979 2275 63 0,507286762 1mpt53 MAP2942c 86 72 106 8 301 36 36 17 0,064211247 1‐ MAP2943c 282 2289 1532 43 498 1664 1376 39 0,487461732 1cdsA MAP2944c 206 1540 1503 40 598 1034 1187 41 0,482583618 1frr MAP2945c 1963 25116 11963 775 2189 16671 12424 622 0,515081173 1

101


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



pyrH MAP2946c 1839 32356 13394 643 2618 28764 15731 632 0,492531844 1‐ MAP2947 2682 2989 959 273 1371 26863 9579 840 0,101760421 1‐ MAP2948 797 1054 630 55 371 7207 3223 145 0,148166943 1‐ MAP2949c 800 1134 969 50 353 9419 3505 142 0,116209118 1‐ MAP2950c 761 1080 732 74 602 4998 1190 130 0,782508748 1‐ MAP2951 288 125 164 14 128 275 201 9 0,18660914 1‐ MAP2952c 108 744 229 31 59 2409 548 71 0,106224282 1‐ MAP2953 263 488 418 41 144 139 419 23 0,150928225 1amiC MAP2954c 1031 2944 1500 54 1990 1844 1650 62 0,520312373 1‐ predicted RNA 828 160 170 1371 653 67 76 872 0,403745991 1tsf MAP2955c 2758 3464 2365 178 2796 4163 1928 162 0,492732258 1‐ predicted RNA 511 0 15 1113 510 0 2 925 0,382540429 1rpsB MAP2956c 7671 14740 9314 589 6746 12754 10503 498 0,527008013 1‐ predicted RNA 702 0 0 1135 382 0 0 518 0,085523431 1‐ predicted RNA 782 0 21 1215 860 12 0 1117 0,511372121 1‐ predicted RNA 1773 17 0 1598 1355 0 32 1032 0,933747155 1‐ predicted RNA 2429 30 14 1882 3283 84 9 2143 0,520621511 1‐ predicted RNA 946 33 25 1248 606 122 23 712 0,235331183 1‐ predicted RNA 3646 1979 1942 3672 3180 2514 1537 2931 0,500672416 1‐ MAP2957 131 83 105 12 36 36 36 3 3,02E‐04 1xerC MAP2958c 0 237 129 4 58 456 382 10 0,005174324 1‐ MAP2959c 793 2232 2591 64 700 2787 2464 61 0,503327339 1viuB MAP2960c 495 3041 2474 103 800 2707 1718 93 0,504781757 1‐ MAP2961c 0 70 0 0 36 0 83 1 0,024121391 1‐ MAP2962c 72 12 57 2 36 71 0 1 0,093877053 1‐ MAP2963c 1073 880 536 18 1646 1116 1069 25 0,526709311 1‐ MAP2964c 320 583 743 21 262 576 754 18 0,940068129 1‐ MAP2965c 72 36 180 15 107 20 90 13 0,707908174 1fdhD MAP2966c 252 628 480 23 712 463 447 34 0,46166392 1‐ MAP2967c 238 494 554 18 289 571 265 16 0,414012667 1‐ MAP2968 936 4286 4602 157 839 3115 3355 114 0,524621993 1‐ MAP2969c 1335 10149 9429 791 1776 9997 8283 751 0,487029082 1‐ predicted RNA 495 0 32 1091 883 4 23 1618 0,330919943 1rnhB MAP2970c 748 7728 7437 247 1041 10524 6863 276 0,467583196 1

102


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



lepB MAP2971c 1874 2330 3389 132 1289 3629 3181 114 0,49747935 1‐ predicted RNA 2650 0 36 1148 1875 107 0 692 0,756258099 1rplS MAP2972c 4683 10127 8507 696 3184 7986 8955 526 0,51085616 1lppW MAP2973 239 1314 877 30 474 828 893 31 0,502597719 1trmD MAP2974c 320 783 693 35 353 789 753 34 0,496471889 1rimM MAP2975c 145 391 466 25 285 647 393 33 0,3561209 1‐ MAP2976c 800 903 1100 191 584 925 1179 153 0,505581917 1rpsP MAP2977c 1592 12461 7216 481 1180 9290 7206 379 0,504106823 1‐ MAP2978c 166 1788 711 71 144 1321 316 46 0,414783511 1dacB MAP2979 395 1219 1020 40 962 951 424 45 0,516741358 1‐ MAP2980c 36 740 762 27 527 951 659 50 0,2051882 1‐ MAP2981c 504 3693 2687 43 1772 5165 2317 64 0,547857118 1‐ MAP2982c 492 553 592 25 307 538 539 17 0,539068799 1ffh MAP2983c 2183 6469 5832 125 2176 6148 4740 107 0,495605099 1‐ MAP2984 371 1031 677 36 391 790 754 32 0,499518189 1‐ MAP2985 252 920 1231 17 323 974 803 14 0,507308463 1glnD MAP2986c 251 725 1095 11 432 1860 1419 18 0,610786143 1glnB MAP2987c 608 3908 3263 272 1595 5923 4661 437 0,54681948 1amt_2 MAP2988c 1171 7029 7624 130 3184 16327 12857 261 0,58557407 1ftsY MAP2989c 539 1038 799 26 251 706 837 16 0,601416468 1smc MAP2990c 1895 4886 4874 43 1637 5851 5179 41 0,487687344 1‐ MAP2991c 6 550 105 22 93 242 322 28 0,422830567 1‐ MAP2992c 36 785 932 44 108 1107 498 43 0,860128033 1‐ MAP2993 216 49 251 13 144 144 127 8 0,173245229 1fpg MAP2994c 183 770 794 25 355 695 579 26 0,712059447 1rnc MAP2995c 700 3880 3035 129 1147 2918 2685 122 0,503105046 1‐ MAP2996c 640 2952 1742 107 1020 1555 1251 88 0,508250562 1‐ MAP2997c 5056 23153 10916 681 3747 8626 5594 327 0,971914464 1‐ predicted RNA 2023 16 0 1822 1521 5 0 1149 0,283899683 1‐ MAP2998c 279 558 700 27 101 359 587 15 0,20296202 1‐ MAP2999 207 2638 1394 40 85 658 808 14 0,043744732 1‐ MAP3000c 157 838 836 12 50 1181 736 11 0,815418268 1‐ MAP3001 1117 10608 3164 137 1249 4915 3154 90 0,55399003 1coaD MAP3002c 1852 2020 2302 215 1636 2517 2473 195 0,498017562 1

103


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3003c 6 82 111 3 108 116 202 11 0,005084044 1‐ MAP3004c 323 996 1197 51 781 982 737 60 0,512882742 1‐ MAP3005c 1721 5282 4719 204 1800 4177 3677 165 0,499614816 1lipN MAP3006c 651 2090 2706 62 823 1485 1191 43 0,537847568 1‐ MAP3007 1745 7855 4948 218 2061 5409 4294 180 0,498283764 1‐ MAP3008c 218 725 1086 35 300 1091 753 36 0,496679235 1recG MAP3009c 687 2703 3681 39 919 4388 4564 51 0,535742296 1‐ MAP3010c 696 1708 1725 33 576 1975 1318 27 0,498333168 1‐ MAP3011c 36 78 35 2 97 62 35 4 0,183131616 1‐ MAP3012c 1403 108 146 58 651 113 329 27 0,158947261 1‐ MAP3013c 72 57 92 4 36 141 78 3 0,545808374 1‐ MAP3014 127 287 251 6 36 252 196 3 0,111666803 1‐ MAP3015 36 142 84 4 72 72 72 4 0,935206452 1ung MAP3016c 210 276 206 17 171 793 392 23 0,326879733 1thiL MAP3017c 99 428 191 9 134 211 260 8 0,608989613 1‐ MAP3018 219 72 168 17 107 171 80 9 0,103256338 1ddl MAP3019c 1009 1839 2701 71 1144 2033 1592 60 0,513636046 1gpsA MAP3020c 112 537 464 13 108 464 247 9 0,275890466 1‐ MAP3021 54 431 252 12 108 304 336 14 0,724699341 1ppk MAP3022 2311 10299 6966 113 3092 8145 6313 103 0,49128168 1mutT1 MAP3023 633 1715 2064 62 1148 2162 1995 76 0,520205662 1‐ predicted RNA 6956 206 38 4945 12782 149 72 7595 0,566414563 1hupB MAP3024c 34854 72031 35662 3444 46604 53411 32403 3296 0,492331675 1‐ predicted RNA 1899 63 44 1737 2104 49 48 1614 0,500116554 1‐ predicted RNA 27736 242 108 3952 41661 71 81 4970 0,441491402 1leuD MAP3025c 236 1691 1345 63 144 2387 1436 68 0,480902942 1leuC MAP3026c 681 1414 923 31 538 2952 1938 43 0,525317943 1‐ MAP3027 100 250 178 10 69 406 328 13 0,43330113 1‐ MAP3028 916 1034 499 87 722 975 807 72 0,488741834 1‐ MAP_t38 370 217 133 212 385 239 131 192 0,419776324 1‐ MAP_t39 197 5011 2138 1073 88 7117 4309 1587 0,549085126 1gltX MAP3029c 1144 1516 2669 54 1376 2053 2366 55 0,504674224 1‐ MAP3030c 367 738 698 36 663 856 752 46 0,833298712 1‐ MAP3031 850 1201 1343 41 844 1099 919 32 0,49357871 1

104


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



leuB MAP3032c 1006 1835 2556 76 1130 2182 2171 73 0,503640836 1serA MAP3033c 830 5223 3075 69 898 4166 3917 66 0,486973684 1‐ MAP3034 108 682 258 8 106 326 297 6 0,24262059 1‐ MAP3035 575 853 1003 62 628 1039 754 57 0,488011844 1ilvC MAP3036c 2487 7910 7067 225 3473 6343 4939 199 0,493331655 1‐ predicted RNA 1702 0 0 1573 1611 0 0 1250 0,494852362 1ilvH MAP3037c 1377 4701 5365 291 1932 4027 2977 240 0,500932905 1ilvB_1 MAP3038c 762 4459 5532 68 1293 4183 3009 56 0,499464521 1‐ MAP3039c 763 672 1311 98 652 1000 1250 88 0,486328451 1‐ MAP3040c 2213 11638 6909 299 1980 8265 7082 240 0,504599855 1lppZ MAP3041 712 1423 1225 41 565 1619 877 32 0,503891953 1gatB MAP3042c 2378 10783 9511 187 2814 14719 11348 221 0,536069174 1‐ MAP3043c 458 1004 881 29 610 5883 2140 79 0,091892658 1pfkA MAP3044c 1062 4101 3523 108 1080 4852 3782 111 0,482713456 1gatA MAP3045c 455 1848 2024 36 549 2438 1854 38 0,509868135 1gatC MAP3046c 258 277 321 48 135 321 275 32 0,22632405 1‐ MAP3047 107 287 363 15 152 180 104 10 0,1898723 1‐ MAP3048c 109 144 70 13 108 143 192 14 0,637332694 1mmpL2 MAP3049c 185 1646 1264 12 502 1702 2060 17 0,612980745 1‐ MAP3050c 36 36 110 7 0 61 108 5 0,199063373 1‐ MAP3051 72 35 55 6 35 0 45 2 0,04326649 1‐ MAP3052c 381 2588 2581 107 241 2412 2144 86 0,505268919 1‐ MAP3053c 107 349 360 9 200 197 228 8 0,556148359 1ligA MAP3054c 441 1562 1757 23 789 1305 932 21 0,487893602 1‐ MAP3055c 36 108 136 3 36 71 71 2 0,220263029 1lpqA MAP3056 177 343 134 16 375 294 290 24 0,24497724 1mnmA MAP3057c 765 2206 2784 70 766 2332 2150 60 0,510175657 1‐ MAP3058c 1045 2985 3258 82 1417 2691 2669 78 0,497936839 1‐ MAP3059c 0 169 126 3 0 0 0 0 1 1fixB MAP3060c 973 4351 3437 115 1321 3503 2489 99 0,502035508 1fixA MAP3061c 3359 20657 14649 586 3234 17691 10388 457 0,524116099 1‐ predicted RNA 711 17 0 1363 625 26 1 1013 0,42143397 1‐ MAP3062 348 716 1005 35 259 496 632 22 0,357095744 1‐ MAP3063 942 3785 3858 67 461 2677 2621 40 0,571225203 1

105


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3064 982 2366 2000 60 1055 1470 1288 44 0,518446741 1‐ MAP3065 202 923 358 14 135 642 351 10 0,298176975 1‐ MAP3066c 36 0 0 1 72 199 23 5 0,005595592 1‐ MAP3067c 47 65 21 3 72 269 215 9 0,004985273 1‐ MAP3068 72 36 62 6 147 36 86 10 0,129553445 1idsA2_2 MAP3069 36 72 180 3 56 441 84 5 0,100698323 1‐ MAP3070 0 0 36 0 71 91 19 1 7,71E‐12 1‐ MAP3071 0 0 0 0 0 142 108 3 1 1‐ MAP3072 0 70 18 2 0 79 315 12 1,03E‐04 1‐ MAP3073 0 0 0 0 36 0 103 6 1 1crtT MAP3074 36 0 0 1 72 41 55 4 0,051371605 1‐ MAP3075 72 37 41 2 72 71 108 2 0,52690066 1‐ MAP3076 72 87 78 3 36 71 143 3 0,523460551 1‐ MAP3077 324 302 222 27 180 336 100 15 0,136300168 1‐ MAP3078c 216 126 101 9 287 811 294 18 0,099840631 1‐ MAP3079c 720 1698 1445 53 643 2615 2145 62 0,516830339 1‐ MAP3080 110 210 314 4 99 179 255 3 0,382938752 1phr MAP3081 62 70 216 3 127 143 273 5 0,164792927 1‐ MAP3082c 936 3888 2571 124 1384 3327 2437 123 0,491712531 1‐ MAP3083 278 957 534 21 238 534 396 13 0,286413936 1‐ MAP3084c 614 1764 2164 87 505 2672 2438 94 0,510926523 1‐ MAP3085c 251 615 705 19 72 972 714 16 0,581007076 1‐ MAP3086c 1021 4206 5522 136 1031 3391 3776 103 0,508516311 1echA17 MAP3087c 391 620 1324 42 246 500 392 20 0,126491529 1‐ MAP3088c 143 1171 983 31 298 889 487 25 0,984396876 1‐ MAP3089c 454 1393 1303 49 431 1519 1036 43 0,486977206 1serB2 MAP3090c 790 3854 5227 96 904 5509 4706 102 0,48241415 1ctaD MAP3091c 7017 15221 13781 298 9349 15711 10194 291 0,491748706 1‐ predicted RNA 908 0 0 1088 1759 0 0 1769 0,795653049 1‐ predicted RNA 854 1585 1471 2935 1376 1651 1266 3314 0,514043351 1fecB MAP3092 413 393 511 20 295 673 420 17 0,627630054 1adhC MAP3093 925 1925 1762 64 853 2265 1651 59 0,502099092 1‐ MAP3094c 445 1808 1737 121 346 1233 1204 81 0,85948709 1nrdF MAP3095c 4808 46704 23497 877 8289 25207 16843 655 0,544850972 1

106


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 1805 0 2 1623 2982 0 0 2250 0,531485009 1‐ MAP3096 36 93 248 9 6 36 28 1 3,74E‐07 1‐ MAP3097 821 72 0 49 942 0 0 46 0,500487062 1‐ MAP3098c 5991 31181 7231 369 5543 21131 15526 333 0,517863022 1‐ MAP3099c 3287 17175 26308 749 2055 20274 25077 696 0,51427343 1nrdE MAP3100c 7018 88224 59209 784 13743 44602 38521 551 0,539857806 1nrdI MAP3101c 1250 21523 9319 765 2117 8929 6229 456 0,548615328 1nrdH MAP3102c 1359 19019 7137 1260 2436 9283 5243 866 0,522621167 1‐ predicted RNA 500 90 21 822 1253 21 21 1640 0,163640942 1‐ predicted RNA 1013 25 0 1270 1675 13 0 1754 0,610413618 1‐ predicted RNA 1901 17 0 1713 3390 18 48 2577 0,545694485 1‐ MAP3103c 3017 4340 2884 637 5921 2242 1750 750 0,535904599 1‐ MAP3104c 143 1072 991 42 287 1491 1695 66 0,636128416 1‐ MAP3105 137 499 461 23 72 246 365 13 0,123925291 1dinP MAP3106 494 348 616 24 501 576 850 27 0,496708365 1‐ MAP3107c 1019 1419 910 60 540 1098 1151 39 0,872661386 1‐ MAP3108c 144 483 445 21 460 359 274 28 0,354467028 1‐ MAP3109 937 9103 3504 104 1977 5815 3102 94 0,492312892 1‐ MAP3110c 238 373 249 26 144 144 197 14 0,088726753 1‐ MAP3111c 884 143 378 35 288 3403 1708 59 0,985892842 1‐ MAP3112c 108 12 139 3 102 72 105 3 0,728765676 1‐ MAP3113c 155 594 316 11 0 187 124 2 3,03E‐07 1‐ MAP3114 108 286 178 22 36 356 36 12 0,089208667 1fadE22 MAP3115c 206 1754 976 15 191 706 619 8 0,212533134 1‐ MAP3116c 146 1587 770 37 291 1214 483 31 0,624491734 1ligB MAP3117 72 71 85 2 0 72 107 1 0,042274027 1cstA MAP3118 207 820 354 8 410 569 580 10 0,654113126 1‐ MAP3119 593 2035 1337 34 694 1516 999 28 0,492800621 1‐ MAP3120c 216 143 52 9 108 237 72 6 0,180130667 1‐ MAP3121 36 427 501 12 180 155 232 10 0,301811706 1fadE1_2 MAP3122 273 1669 929 26 205 1113 621 17 0,67238407 1‐ MAP3124c 188 36 0 7 230 36 36 8 0,724464311 1‐ MAP3125c 0 36 69 1 0 181 137 3 0,027339236 1‐ MAP3126c 96 36 140 6 36 180 163 5 0,717421814 1

107


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



emrE MAP3127 72 243 200 16 37 330 480 22 0,227742953 1‐ MAP3128 340 1880 1508 31 691 2822 1976 46 0,528104652 1‐ MAP3129 330 602 664 55 130 562 780 40 0,40861857 1mmpS2 MAP3130 166 105 164 18 72 41 225 10 0,109701204 1‐ MAP3131 675 1002 1166 15 1077 1813 1935 23 0,538651899 1‐ MAP3132 87 479 506 4 108 634 446 4 0,926284382 1‐ MAP3133c 49 6 30 1 32 72 0 1 0,462027564 1‐ MAP3134c 0 36 36 1 72 36 0 4 0,017796038 1‐ MAP3135c 12 171 64 3 118 121 81 6 0,068556439 1‐ MAP3136c 199 639 356 12 70 500 572 10 0,353707254 1‐ MAP3137c 112 191 470 14 36 560 398 14 0,96248099 1‐ MAP3138c 36 58 153 4 36 313 187 7 0,082102173 1‐ MAP3139c 64 258 478 21 262 416 365 32 0,223750693 1‐ MAP3140c 128 280 522 9 77 482 465 9 0,437549803 1‐ MAP3141c 366 1168 1124 27 384 1132 477 20 0,858171946 1‐ MAP3142 55 106 72 4 0 0 0 0 1 1‐ MAP3144c 1977 2002 4419 341 2410 2697 3618 338 0,488920058 1‐ MAP_t40 93 354 499 161 87 880 247 178 0,604756039 1‐ MAP3145c 288 1011 821 22 450 858 831 23 0,500561264 1pgmA MAP3146c 359 3087 2548 41 744 2076 1644 34 0,508736241 1ccrB MAP3147 44 215 72 10 0 89 13 2 1,77E‐04 1ccrB MAP3148 12 153 141 9 99 25 0 7 0,707632629 1‐ MAP3149c 108 858 631 29 180 470 250 18 0,265648143 1‐ MAP3150c 432 2976 1583 166 761 2795 1830 185 0,512930521 1‐ MAP3151 36 99 107 2 185 90 36 4 0,05568347 1‐ MAP3152c 1025 2643 1733 83 1209 2889 1958 87 0,506945953 1‐ MAP3154 827 931 2027 39 539 1644 1142 28 0,574370892 1‐ MAP3155c 272 530 227 59 351 556 244 63 0,501596195 1‐ MAP3156c 182 512 778 32 106 782 501 25 0,380447354 1‐ MAP3157 256 584 221 16 398 161 157 13 0,398651931 1‐ MAP3158c 36 787 480 35 430 891 599 66 0,181281162 1‐ MAP3159 686 1752 1612 38 770 1648 1571 36 0,496288954 1‐ MAP3160 282 2432 2605 72 304 2223 2170 62 0,501097995 1‐ MAP3161c 85 48 85 5 108 96 103 6 0,567313021 1

108


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3162c 108 640 577 27 203 570 637 30 0,432801911 1‐ MAP3163 3 181 36 3 152 205 218 12 9,11E‐05 1‐ MAP3164 337 1920 1734 95 406 2201 2163 108 0,515964575 1‐ MAP3165 315 1201 1740 34 656 1814 1750 45 0,522653278 1‐ MAP3166c 509 504 656 39 582 708 429 37 0,498872886 1‐ MAP3167c 577 2697 5104 209 814 7366 7212 352 0,567508185 1‐ predicted RNA 843026 4447435 2397323 292575 1479001 3687989 2244784 300564 0,442344205 1‐ predicted RNA 743152 29572 19380 90229 1292807 24400 10015 130338 0,589982583 1‐ MAP3168c 286 498 373 21 302 273 449 18 0,412342796 1‐ MAP3169c 779 1716 2514 87 677 3249 3267 106 0,5247799 1smpB MAP3170c 2231 7382 10777 508 1798 13626 14271 646 0,547361041 1‐ predicted RNA 391 11 11 1170 310 0 11 776 0,190469486 1ftsX MAP3171c 2178 2249 3905 150 1247 4555 4557 140 0,493873699 1ftsE MAP3172c 772 2154 2665 107 1040 2988 2983 127 0,524007154 1‐ MAP3173c 261 743 1368 60 408 1518 1176 75 0,532289183 1‐ MAP3174c 876 3396 4684 111 1044 3717 3339 99 0,496320986 1prfB MAP3175c 3668 14617 24727 469 4370 26233 24304 556 0,523063598 1fprA MAP3176 919 2601 2621 60 1382 2117 2758 63 0,509788054 1‐ MAP3177 36 1987 613 58 204 855 868 50 0,765152433 1‐ MAP3180 187 1115 104 33 612 457 465 49 0,426959407 1‐ MAP3181 64 155 144 3 101 72 122 2 0,832922603 1‐ MAP3182 36 72 36 3 36 35 36 2 0,422407123 1‐ MAP3183 0 107 0 1 71 72 143 5 0,001136538 1‐ predicted RNA 3499 10309 5979 5879 2674 13323 14882 7605 0,543375555 1‐ predicted RNA 3296 0 28 2891 1705 34 32 1269 0,209047421 1‐ MAP3184 599 567 622 26 385 1112 1100 27 0,505304603 1‐ MAP3185 513 238 248 19 432 263 736 20 0,83434224 1‐ MAP3186c 315 1087 1129 95 426 1109 989 94 0,493786097 1‐ MAP3187 74 184 69 6 72 143 163 6 0,876667391 1fadE24 MAP3188 550 8358 4974 108 1183 3563 2954 69 0,58749153 1fadE23 MAP3189 1395 10534 5432 169 1966 5789 4685 130 0,505547686 1fadB4 MAP3190 323 1550 1466 42 484 1536 1359 43 0,482010186 1‐ MAP3191 156 200 655 12 255 496 303 12 0,827031398 1‐ MAP3192 645 1808 1853 49 439 2242 1953 45 0,497645151 1

109


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3193 352 811 771 22 187 876 786 17 0,960018056 1‐ MAP3194 206 516 475 18 183 356 276 12 0,288722431 1‐ MAP3195 265 1219 1148 51 128 1313 1083 43 0,550311222 1fadE12_3 MAP3196 397 1661 1377 35 528 1901 1243 36 0,483482239 1‐ MAP3197 97 298 608 15 214 525 505 20 0,373581156 1‐ MAP3198 92 560 430 33 167 1056 883 61 0,201101169 1‐ MAP3199 182 435 520 29 31 636 581 24 0,381415329 1‐ MAP3200 243 1671 1195 88 423 1723 1230 98 0,518514872 1nuoA MAP3201 1147 8178 8465 547 2244 10976 8303 666 0,546237348 1nuoB MAP3202 2766 7829 8849 468 3032 7302 5078 368 0,506291728 1nuoC MAP3203 3639 5842 8487 375 4266 6415 8281 374 0,477632031 1‐ predicted RNA 379 0 0 1115 482 0 0 1190 0,870116317 1nuoD MAP3204 6941 19073 30372 555 10386 24970 25983 599 0,517556908 1‐ predicted RNA 426 12 12 1169 332 0 25 774 0,210582332 1‐ predicted RNA 1337 8 40 1412 1910 19 48 1696 0,519281694 1nuoE MAP3205 2007 4143 6986 237 2615 4441 5098 220 0,487857776 1nuoF MAP3206 7212 12063 21795 429 8419 15865 16604 407 0,508387557 1‐ predicted RNA 2857 0 0 2498 3377 6 0 2480 0,494601683 1nuoG MAP3207 2785 11369 12691 143 4158 11534 9513 137 0,489422486 1nuoH MAP3208 4795 3959 5481 205 6487 4592 4612 218 0,469315952 1‐ predicted RNA 1415 0 0 1477 1281 0 0 1122 0,581793091 1nuoI_2 MAP3209 2191 3904 5514 307 3354 5304 4394 343 0,469587368 1nuoJ MAP3210 1839 2035 3260 138 2009 2821 2507 130 0,488662235 1nuoK MAP3211 1791 2487 4069 419 2340 4563 4168 502 0,524179 1‐ predicted RNA 2122 0 11 1910 2046 28 0 1550 0,509169554 1nuoL MAP3212 2549 7617 12183 152 4342 10084 8978 163 0,471907035 1nuoM MAP3213 3876 4656 8414 166 5331 8317 6773 187 0,462802067 1‐ predicted RNA 1473 0 8 1447 1762 0 0 1450 0,486853558 1nuoN MAP3214 1875 2621 4272 83 2784 3904 3269 92 0,518566453 1‐ MAP3215c 912 36 71 44 612 72 106 26 0,26737951 1omt MAP3216 103 734 578 19 180 1100 490 24 0,487835018 1‐ MAP3217c 36 307 306 6 72 315 314 7 0,705604088 1moxR3 MAP3218c 125 2419 1315 42 152 909 778 21 0,194175866 1‐ MAP3219c 180 2238 923 76 635 725 766 66 0,490658506 1

110


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3220c 0 255 486 8 36 264 210 5 0,376518098 1‐ MAP3221 72 35 72 2 0 71 110 1 0,095566938 1‐ MAP3222c 60 204 36 5 144 105 107 7 0,228342339 1‐ MAP3223c 144 1214 538 34 150 780 854 31 0,894005394 1‐ MAP3224 223 2636 1092 38 336 2613 1566 43 0,517308417 1‐ MAP3225 252 1293 523 23 210 360 241 10 0,096055094 1‐ MAP3226c 325 609 563 16 358 745 632 17 0,656332952 1‐ MAP3227c 303 717 288 13 374 646 325 13 0,958076417 1‐ MAP3228 785 935 839 32 400 1067 705 21 0,937027269 1hpx MAP3229c 243 806 249 19 36 643 326 10 0,179233706 1‐ MAP3230c 216 275 398 12 288 1590 972 30 0,08481111 1‐ MAP3231c 0 292 121 3 100 843 135 10 0,003725204 1‐ MAP3232 143 171 178 8 295 286 380 15 0,11590702 1‐ MAP3233c 2059 12893 14095 185 4673 16557 14172 233 0,528746586 1‐ MAP3234c 298 1152 1132 43 478 1194 849 43 0,492660175 1‐ MAP3235c 735 1703 1844 58 2012 2608 1349 91 0,546669681 1catB MAP3236 370 1635 399 15 263 5775 1519 35 0,148072957 1‐ MAP3237c 196 72 24 12 110 306 104 11 0,926275875 1‐ MAP3239 108 437 449 16 99 1625 979 37 0,108013707 1‐ MAP3240 72 16 104 4 72 234 82 6 0,273632828 1‐ MAP3241 36 0 0 3 57 0 52 6 0,179334193 1‐ MAP3242 36 108 0 2 36 461 279 7 1,16E‐04 1‐ MAP3243 144 487 447 35 72 1393 1295 72 0,146298099 1‐ MAP3244 107 215 72 5 72 1081 560 14 0,004035796 1‐ MAP3245 8 0 14 0 0 141 0 1 0,018318093 1‐ MAP3246 0 0 0 0 0 72 0 0 1 1‐ MAP3247c 0 0 16 0 0 0 0 0 1,41E‐70 1‐ MAP3248 0 0 0 0 0 72 30 0 1 1‐ MAP3249 72 49 12 1 23 108 34 1 0,260896297 1‐ MAP3250 0 36 0 0 0 0 23 0 0,420057094 1‐ MAP3251 0 0 19 0 0 0 0 0 1,02E‐93 1‐ MAP3252 36 106 84 1 59 108 79 1 0,697038702 1‐ MAP3253 0 0 56 0 0 72 0 0 0,448829876 1‐ MAP3254 36 32 88 1 0 19 35 0 8,48E‐05 1

111


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3255 360 1328 536 16 300 4712 1999 40 0,132822857 1‐ MAP3256c 281 316 142 20 144 1139 457 28 0,329253778 1‐ MAP3257c 610 2247 827 79 318 12368 3782 256 0,067141588 1‐ MAP3258 36 0 0 1 0 323 238 4 5,03E‐05 1pknJ MAP3259 0 225 184 4 74 371 150 7 0,110321531 1‐ MAP3260 324 6362 3804 115 316 4849 3877 97 0,503236975 1‐ MAP3261c 244 498 394 20 288 1198 366 27 0,486934004 1glgX_2 MAP3262c 4262 2002 2303 84 1900 27973 10621 195 0,777084663 1‐ MAP3264c 1540 5102 5162 209 2078 6964 5769 248 0,531678705 1‐ predicted RNA 2382 17 2 1981 3810 49 0 2665 0,54298243 1‐ predicted RNA 4365 4768 4929 5458 5457 6385 6551 6325 0,458867531 1‐ MAP3265 1044 2617 4311 80 1242 4335 3525 85 0,479314197 1‐ MAP3266c 361 375 216 29 384 361 388 30 0,735259636 1‐ MAP3267c 36 307 101 14 36 72 108 7 0,074849532 1hsp18_3 MAP3268 72 418 149 17 176 216 59 16 0,794836144 1‐ MAP3269 108 426 453 17 135 286 542 16 0,663372413 1‐ MAP3270c 304 899 1532 21 361 957 1189 19 0,492202435 1‐ MAP3271c 612 1909 1780 85 534 1583 1653 70 0,498041995 1‐ MAP3273c 0 1508 0 14 0 176 36 2 3,27E‐17 1‐ MAP3274 144 1857 1005 28 335 1433 933 27 0,493362587 1narL_2 MAP3275 180 896 493 29 250 689 486 27 0,459371682 1‐ MAP3276c 463 144 87 12 396 72 72 9 0,310520264 1‐ MAP3277c 5 33 36 2 36 105 281 15 1,70E‐06 1‐ MAP3278c 188 584 309 11 304 176 142 8 0,3486179 1‐ MAP3279 340 1343 677 29 417 1379 1163 34 0,50859797 1‐ MAP3280c 103 472 349 9 160 177 284 7 0,283882553 1‐ MAP3281c 603 4680 3086 89 723 2863 2397 66 0,530965935 1‐ MAP3282c 468 15391 7201 257 485 8144 6228 167 0,520448893 1‐ MAP3283c 504 7084 2631 123 987 3469 1884 86 0,532891436 1fadD29 MAP3284c 3092 96185 47438 457 5015 58330 36873 319 0,536731071 1‐ MAP3285c 469 678 435 24 454 874 1000 29 0,634588495 1‐ predicted RNA 20 7380 15943 6777 0 16532 10830 7470 0,464822331 1IS1547_2 MAP3286 587 2208 2437 60 701 2174 2183 56 0,499113069 1‐ MAP3287 435 2200 1512 58 815 1150 1063 50 0,491427031 1

112


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3288 664 6427 4466 142 1216 5408 3351 129 0,496294895 1mce1_1 MAP3289c 4735 15626 20924 399 8055 19799 15166 426 0,506850272 1‐ predicted RNA 361 5642 5775 3768 637 5279 3796 3144 0,499815079 1mpt64 MAP3290c 286 1955 634 58 573 1347 897 63 0,514287514 1‐ MAP_t41 0 3895 1090 661 0 1726 439 276 0,099538268 1‐ MAP3291c 6250 10387 15265 156 6375 11642 12576 139 0,518551864 1‐ MAP3292c 323 2962 1963 58 472 2180 997 42 0,560596901 1‐ MAP3293 1407 8803 9411 167 1721 9277 8002 158 0,487717519 1‐ MAP3294 6 166 214 4 48 264 474 10 0,033098918 1‐ MAP3295 3605 7495 6573 193 3904 8185 5986 183 0,485493756 1‐ MAP3296c 693 954 921 152 834 295 328 106 0,880731281 1uvrD2 MAP3297c 585 3651 3176 41 932 3829 2635 42 0,494731806 1‐ MAP3298 550 866 698 131 838 1072 251 138 0,510314261 1‐ MAP3299c 1034 3720 4230 57 1854 4076 4154 66 0,526354882 1‐ MAP3300c 162 216 252 3 180 313 321 3 0,329865049 1‐ MAP3301c 276 383 123 4 72 318 99 1 0,033204976 1‐ MAP3302 250 2017 1451 181 288 1636 1118 147 0,501918158 1lipV MAP3303 143 1827 949 41 252 1282 1124 39 0,494749621 1‐ MAP3304 180 125 53 25 72 175 144 16 0,236263407 1‐ MAP3305c 618 2493 1157 65 668 1289 987 47 0,623964524 1moeZ MAP3306c 814 2726 2900 69 650 1732 2052 46 0,528918745 1‐ MAP3307c 1457 2833 3269 99 1127 2958 3450 86 0,50059819 1‐ MAP3308 647 1607 1738 80 657 1428 1581 70 0,49611024 1‐ MAP3309c 300 1940 1050 149 180 1568 775 104 0,916630167 1‐ MAP3311c 963 6959 6850 238 1117 6392 6736 225 0,4877905 1‐ predicted RNA 9953 10187 26861 9870 5900 23882 24830 9033 0,513020041 1‐ predicted RNA 9371 84 67 6349 4577 0 74 2607 0,260675649 1rhlE MAP3312 3984 9294 15921 257 2995 15927 15664 262 0,503435168 1‐ MAP3313 412 730 1082 26 637 1575 1034 35 0,59824157 1‐ MAP3314c 475 1850 971 54 1004 1797 1065 68 0,520968347 1entD MAP3315 180 463 321 20 215 957 566 31 0,295899337 1entC MAP3316 360 540 718 22 270 747 805 20 0,505977702 1‐ MAP3317 250 567 600 41 469 492 406 44 0,84158041 1‐ MAP3318c 180 531 319 29 193 176 36 14 0,072341457 1

113


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3319 528 642 610 30 292 758 623 22 0,823870878 1‐ predicted RNA 1281 7596 21703 4537 1525 16445 15830 4738 0,487985113 1whiB1 MAP3320 2113 22590 23847 2127 5073 17531 12342 1696 0,536225294 1‐ predicted RNA 387 0 5 1143 378 0 0 933 0,350962327 1‐ predicted RNA 7411 0 56 1669 12221 88 48 2314 0,557462826 1‐ MAP3321c 1010 2072 2468 52 888 2502 1808 44 0,513457405 1‐ MAP3322c 1279 10245 8821 1057 928 11906 9819 1086 0,475911253 1‐ predicted RNA 695 387 409 1611 856 289 326 1550 0,49622842 1‐ MAP3323c 1665 1153 858 235 1954 1183 900 234 0,499211598 1sigH MAP3324c 2227 9209 10146 334 3170 9193 8128 320 0,482976405 1‐ MAP3325 960 6022 5092 169 1145 4624 4355 142 0,499916699 1‐ MAP3326c 430 107 249 18 298 211 252 13 0,321145146 1‐ MAP3327c 49 177 177 4 0 108 311 3 0,632297662 1‐ MAP3328c 36 144 54 4 36 214 238 7 0,078805982 1‐ MAP3329c 72 105 71 3 108 72 72 3 0,848575249 1‐ MAP3330 22 34 36 1 36 36 0 1 0,616470552 1‐ MAP3331 0 53 72 2 36 36 36 2 0,591592344 1‐ MAP3332 401 1451 853 25 694 1285 1072 30 0,518447679 1‐ MAP3333c 255 780 1057 35 410 820 723 34 0,500827731 1aroA MAP3334 360 1497 984 27 457 977 961 24 0,491146831 1‐ MAP3335 144 607 300 13 72 476 330 9 0,283138824 1‐ MAP3336c 164 1001 464 42 81 734 484 30 0,315305245 1fadA6_4 MAP3337 169 56 177 6 36 106 76 2 0,003164833 1‐ MAP3338 0 0 0 0 36 0 0 1 1 1‐ MAP3339c 0 72 91 1 36 36 108 2 0,334950762 1‐ MAP3340 205 214 132 15 0 236 0 3 2,45E‐07 1‐ MAP3341 90285 567907 235974 18432 91557 556216 354383 19332 0,498370702 1‐ predicted RNA 114368 9381 5132 4937 113936 9568 5781 4166 0,537134309 1‐ MAP3342 43348 375404 219103 8917 49664 397921 324812 10342 0,525069228 1‐ predicted RNA 2601 0 50 2289 2881 27 47 2135 0,506864041 1‐ predicted RNA 11457 440 332 1855 14219 570 500 1945 0,50731496 1‐ predicted RNA 7601 602 496 1760 7610 600 443 1486 0,500867752 1desA3_1 MAP3343c 37446 179745 175202 3758 39298 239962 164481 3934 0,506117835 1‐ predicted RNA 4576 3389 2600 2065 4754 5116 4342 2211 0,472239417 1

114


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 8316 2300 2789 1890 9001 3757 3391 1858 0,484978495 1‐ predicted RNA 16751 164 471 2873 15332 525 327 2224 0,539880903 1‐ predicted RNA 8536 4 36 4391 8528 52 36 3691 0,502191086 1‐ predicted RNA 1648 55 118 1621 2307 128 27 1886 0,516371926 1‐ MAP3344c 8939 16980 25386 629 9024 18278 21955 565 0,515964469 1‐ predicted RNA 530 0 0 1143 596 25 0 1094 0,110306311 1‐ MAP3345c 508 740 927 65 617 730 1192 71 0,511762421 1pvdS MAP3346c 1037 4187 2260 111 1361 3397 2126 103 0,500299075 1‐ MAP3347c 570 515 1249 25 371 912 868 19 0,731611973 1‐ MAP3348 0 18 142 3 3 35 9 0 0,004002216 1kefB MAP3349c 193 215 217 9 243 142 72 7 0,284084853 1‐ MAP3350c 628 1073 679 78 439 593 740 52 0,92663649 1‐ MAP3351c 266 1439 624 38 144 607 579 20 0,194617462 1‐ MAP3352c 72 637 482 8 72 394 429 6 0,310177772 1‐ MAP3353c 72 36 23 3 0 0 22 0 8,21E‐33 1secA MAP3354c 5148 25670 28841 256 5030 28288 24528 234 0,512960917 1‐ MAP3355c 2925 36954 23743 1012 3561 33653 21145 911 0,515905183 1‐ predicted RNA 5709 14073 14532 7220 9855 23116 18712 10352 0,551086601 1‐ predicted RNA 4809 2 21 3388 7907 1 0 4669 0,545325218 1‐ MAP3356c 37 0 36 2 36 35 0 2 0,302152398 1‐ MAP3357c 1403 5370 2882 76 1700 5211 3156 76 0,488107559 1lpqB MAP3358c 1475 1320 4059 59 2032 6576 6884 108 0,678728039 1mtrB MAP3359c 3056 13867 15922 238 3279 18533 15664 253 0,506969013 1‐ predicted RNA 7176 175 140 2478 9124 98 29 2621 0,471414049 1mtrA MAP3360c 15883 50618 29822 1921 19004 31029 23517 1537 0,521499049 1‐ predicted RNA 4014 0 0 3418 2880 21 0 2063 0,555187839 1tmk MAP3361c 231 319 586 26 257 702 629 32 0,51060617 1sahH MAP3362c 4727 21968 23228 412 5849 24928 14675 366 0,518490847 1‐ MAP3363c 610 2563 1630 70 404 8237 2027 122 0,615969581 1‐ MAP3364c 635 10087 5142 128 1340 21132 7007 226 0,577549834 1‐ MAP3365c 913 3672 3920 70 1384 4213 4186 80 0,525146 1‐ MAP3366 320 303 159 10 244 288 229 8 0,361652012 1manA MAP3367c 648 1928 2204 51 1172 2326 2296 63 0,523435348 1‐ MAP3368c 467 1817 2970 58 567 2089 1181 42 0,513276972 1

115


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



manB MAP3369c 811 1737 1759 43 1271 2212 1207 47 0,512306849 1‐ MAP3370c 1036 513 741 93 466 504 876 54 0,610591041 1‐ MAP3371 874 307 556 88 1539 396 393 117 0,521068982 1whiB2 MAP3372c 1216 10023 3594 474 2769 12291 7178 725 0,566249747 1‐ predicted RNA 3466 46 169 1876 6437 132 41 2893 0,545422543 1‐ MAP3373 708 55 76 90 837 132 217 98 0,554680787 1‐ predicted RNA 2882 5823 2696 3178 7067 11436 9468 7140 0,733113555 1‐ MAP3374 305 952 769 26 226 896 812 22 0,733918539 1‐ MAP3375 215 346 456 11 287 429 787 15 0,355123694 1‐ MAP3376 216 1114 692 15 180 790 657 12 0,670817653 1‐ MAP3377 116 246 305 17 173 180 392 19 0,419908701 1rmlA2 MAP3378c 341 2112 1345 42 454 1321 1073 33 0,521162782 1wbbL MAP3379c 492 3283 2305 83 658 2521 1532 66 0,513011552 1rmlD MAP3380c 36 446 398 10 216 76 279 10 0,94985292 1‐ MAP3381 5164 8884 6511 218 2927 5047 3021 107 0,96368307 1‐ predicted RNA 892 0 0 1154 940 0 0 1021 0,50758898 1‐ MAP3382 310 735 1003 41 354 869 863 40 0,499385578 1‐ MAP3383 106 4828 1968 251 140 2263 1949 162 0,739736669 1ctpC MAP3384 456 3265 2442 33 390 2319 1274 20 0,808532488 1‐ MAP3385 83 308 472 11 92 256 309 8 0,244126737 1‐ MAP3386 704 2130 2461 57 1038 1869 1293 48 0,508276784 1pknD MAP3387c 1943 8931 9949 129 1983 5715 6170 88 0,518326581 1pstS MAP3388c 1962 7092 5627 168 1457 4962 3972 112 0,523908513 1‐ MAP3389c 280 2886 2491 144 258 4317 3302 187 0,529326454 1‐ MAP3390c 863 4217 5657 81 1264 7170 7614 114 0,538130864 1‐ MAP3391c 629 2217 1920 53 366 1663 1602 36 0,687290754 1fadE25_4 MAP3392c 2165 11542 10058 247 2771 9385 8152 213 0,496768126 1purE MAP3393c 261 1771 1703 83 401 1459 1121 69 0,489188763 1purK MAP3394c 441 1223 1542 33 460 1371 902 27 0,499122956 1‐ MAP3395 4591 4113 5208 366 6135 6363 5944 435 0,456157525 1‐ MAP3396c 1725 880 1249 149 1683 1440 988 134 0,509234744 1birA MAP3397c 230 604 456 21 349 243 451 19 0,442285389 1‐ MAP3398c 108 273 66 4 71 36 18 1 0,004166756 1accD5 MAP3399 11301 33455 26473 592 12540 26834 20045 490 0,524252321 1

116


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3400 791 5701 5021 514 762 5686 4097 449 0,498670334 1maf MAP3401 400 1385 1815 72 186 1140 1284 46 0,944782489 1sseA MAP3402 1673 12728 14874 375 1836 15473 13284 375 0,487318007 1‐ MAP3403 617 505 827 79 436 463 602 53 0,762356698 1accA3 MAP3404 3391 24527 17783 294 6649 12840 10218 224 0,540659103 1‐ predicted RNA 2336 671 1056 2459 2697 575 803 2298 0,50382098 1‐ predicted RNA 1215 0 0 1228 1267 0 28 1085 0,488054932 1‐ predicted RNA 2628 0 22 2244 3088 0 0 2207 0,499572107 1Rv0516c MAP3405 943 1124 2157 148 874 1544 1282 119 0,504734154 1‐ predicted RNA 2138 0 61 1838 3875 55 81 2806 0,554335039 1sigF_2 MAP3406c 1432 2528 2864 128 1253 14376 7437 311 0,46575018 1rsbW MAP3407c 748 986 1389 93 512 6161 3127 200 0,649305675 1‐ MAP3408c 1146 6532 3465 438 1979 3991 3858 424 0,490057755 1‐ predicted RNA 617 0 0 1174 855 0 17 1377 0,838959344 1‐ MAP3409c 1113 3067 2489 240 648 11296 7198 518 0,767291043 1lat MAP3410c 3403 5424 10262 203 4454 17852 22545 396 0,580706551 1‐ MAP3411c 500 489 252 52 759 358 311 60 0,806127123 1‐ MAP3412 520 1627 2310 45 602 2787 4375 71 0,543683827 1aldB MAP3413 1393 6802 8826 134 1410 13420 14355 207 0,571764863 1‐ MAP3414 3456 18402 15978 697 3820 16540 17299 673 0,50792777 1‐ predicted RNA 684 0 0 1165 964 0 0 1378 0,988077369 1lhr MAP3415 587 1449 1302 10 308 1705 1365 8 0,488820076 1nei MAP3416 72 258 355 11 180 263 280 13 0,337014738 1lpqC MAP3417c 165 482 399 15 263 267 517 16 0,662389132 1‐ MAP3418 758 4973 2528 220 394 2885 2462 142 0,534915767 1‐ MAP3419c 377 1272 2445 44 393 973 1883 35 0,50365698 1‐ MAP3420c 1231 3147 3001 89 1058 2017 1726 57 0,536399864 1‐ MAP3422c 314 466 610 24 247 729 797 25 0,935338406 1glpD2 MAP3423c 566 2133 1708 32 636 2334 1142 29 0,497455586 1lpdA MAP3424c 122 1003 779 14 144 1278 691 15 0,776883651 1‐ MAP3425 374 1166 996 72 479 1023 1139 74 0,489867187 1amiA MAP3426c 952 3527 3869 90 967 3525 2609 73 0,514790716 1amiB MAP3427c 653 1264 1037 36 967 1409 682 38 0,484279379 1‐ MAP3428c 324 1002 852 41 628 925 582 44 0,502252521 1

117


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



deoD MAP3429 142 324 534 16 36 359 265 8 0,090606839 1pmmB MAP3430 439 270 644 15 136 511 384 7 0,167545978 1upp MAP3431c 205 697 1070 32 369 715 390 26 0,932794862 1‐ MAP3432 264 142 108 12 430 429 374 21 0,190777869 1‐ MAP3433 816 6735 3422 97 1108 4488 2946 78 0,50248993 1‐ MAP3434 1439 2177 2964 100 1356 2859 2373 89 0,505870825 1‐ MAP3435c 359 2256 1684 50 629 2109 1784 55 0,512839947 1‐ MAP3436c 324 273 742 30 216 627 144 18 0,243983314 1‐ MAP3437c 216 92 121 10 196 438 410 16 0,213556395 1add MAP3438c 930 2256 3391 80 1379 4491 3322 104 0,534863709 1deoA MAP3439c 407 1418 1356 32 560 1830 2214 43 0,523545589 1cdd MAP3440c 55 262 121 13 0 329 175 12 0,737866233 1sdhC MAP3441 222 1986 1111 83 274 1212 703 57 0,999264478 1sdhD MAP3442 288 1441 1417 81 583 864 1028 74 0,487583989 1sdhA MAP3443 2541 9665 11706 171 3175 8790 9591 154 0,491380357 1sdhB MAP3444 750 1812 2336 83 395 1963 2209 65 0,507520389 1‐ MAP3445 164 70 172 10 246 106 154 12 0,497795495 1sigJ MAP3446c 162 36 64 7 106 36 72 4 0,097933072 1‐ MAP3447 108 71 50 3 144 0 0 2 0,581172756 1‐ MAP3448 772 1626 1434 47 595 1083 1192 33 0,726770299 1sugI MAP3449 228 712 510 14 174 518 752 13 0,441855071 1nagA MAP3450 23 66 144 2 108 35 72 3 0,329362613 1sugE MAP3451 140 252 108 20 72 180 254 16 0,44831997 1‐ MAP3452c 262 1108 1148 30 176 961 948 23 0,911040531 1trpS MAP3453c 482 2135 2085 56 675 1771 1234 46 0,499375921 1‐ MAP3454 1719 6783 2090 167 1879 3385 3138 136 0,502240589 1icd1 MAP3455c 3713 7676 11772 259 4070 9515 9526 243 0,488286962 1icd2 MAP3456c 4117 29373 25361 307 6527 21060 17237 249 0,532389881 1‐ predicted RNA 1535 438 868 2109 1333 678 913 1747 0,503434524 1‐ predicted RNA 1183 27 56 1349 828 0 29 786 0,478315202 1metC MAP3457 1197 6629 5829 120 2755 6339 3637 125 0,478423429 1metX MAP3458 889 5844 9404 158 2300 4915 4153 129 0,498978601 1‐ MAP3459 514 1677 4066 104 776 2069 1893 82 0,516336643 1‐ MAP3460c 637 1537 787 31 751 1321 1221 33 0,483711778 1

118


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3462c 125 406 296 39 230 452 591 59 0,269677396 1folD MAP3463c 1131 1463 1191 75 1031 2068 1255 71 0,498428337 1‐ MAP3464 605 4415 2253 70 1588 3186 1706 74 0,511727851 1‐ MAP3465 5507 8161 9813 138 5008 8633 8418 117 0,49985847 1‐ MAP3466 1492 2466 3879 46 1709 3520 3930 49 0,480586337 1‐ MAP3467c 1388 5486 2499 74 1585 5812 3314 78 0,482942263 1‐ MAP3468c 144 211 720 34 232 886 559 49 0,326615465 1‐ MAP3469c 703 587 748 62 540 557 629 45 0,844403395 1‐ MAP3470c 460 1642 1813 133 168 1599 1279 88 0,905350142 1‐ MAP3471c 216 2231 2201 123 268 1711 1205 85 0,77233579 1‐ MAP3472c 2157 16304 12267 126 1998 13742 9016 98 0,507297673 1‐ MAP3473c 72 252 419 15 36 251 208 9 0,132726285 1spoU MAP3474 288 162 180 27 108 180 287 16 0,141938691 1‐ MAP3475c 910 7597 5243 244 1047 8162 7138 279 0,529404921 1dnaE2 MAP3476c 180 482 319 4 108 252 317 2 0,168382219 1‐ MAP3477 219 3875 1449 46 663 3827 1604 55 0,516739074 1otsB2 MAP3478 472 8178 3334 110 1154 8220 4423 131 0,523655546 1‐ MAP3479c 129 534 527 17 149 308 354 12 0,304194762 1‐ MAP3480 3375 2071 857 113 1943 1652 1220 66 0,585829517 1lpqD MAP3481 2639 9915 8517 381 3875 9918 7569 390 0,474847548 1acrA1 MAP3482 1387 13778 3909 107 1266 6708 5619 77 0,512109341 1‐ MAP3483 14 381 77 10 0 199 388 13 0,441560693 1iunH MAP3484 720 811 484 35 564 723 625 27 0,610951597 1kasB_2 MAP3485 2841 10707 9858 238 3729 9805 6731 209 0,494643977 1‐ MAP3486 819 878 629 35 1187 1720 1001 49 0,525047284 1‐ MAP3487c 435 4213 2232 49 1210 3562 2509 58 0,526143081 1‐ MAP3488c 36 578 229 10 0 215 294 5 0,10509332 1guaA MAP3489c 575 2456 2719 45 1047 2404 1667 43 0,500729658 1‐ MAP3490 25 0 36 0 29 87 160 2 0,027535497 1‐ MAP3491 324 1538 1082 46 605 2046 1443 64 0,52121101 1‐ MAP3492 1126 2475 4399 45 1613 3347 3346 46 0,481438692 1‐ MAP3493 36 32 68 2 36 36 14 1 0,241160603 1‐ MAP3494 251 72 40 6 0 103 89 1 2,25E‐07 1‐ MAP3495c 2617 7767 2081 236 1470 20017 5177 361 0,569787856 1

119


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3496 108 108 253 7 72 198 68 4 0,144167182 1fadD12_2 MAP3497 415 535 644 16 558 500 483 15 0,503207032 1ctpI MAP3498c 1183 4866 4272 27 1551 5360 3651 27 0,488085666 1‐ predicted RNA 3004 0 35 2502 5742 83 0 4018 0,545957451 1‐ MAP3499c 4052 10754 11852 1829 8210 15304 10041 2384 0,534134974 1‐ MAP3500c 315 301 679 42 422 757 753 55 0,730003151 1‐ MAP3501 144 316 243 20 36 242 166 10 0,055003645 1adhD MAP3502 72 692 452 11 216 549 418 13 0,428149581 1‐ MAP3503c 174 857 727 27 108 1001 745 25 0,754162708 1‐ MAP3504c 144 358 180 6 215 250 277 7 0,394016113 1‐ MAP3505c 36 198 173 6 72 107 0 3 0,110172295 1‐ MAP3506c 0 840 257 6 83 574 121 5 0,282229362 1‐ MAP3507 0 0 71 0 0 0 36 0 0,150034872 1‐ MAP3508 36 107 71 2 106 140 195 4 0,036152467 1‐ MAP3509 71 36 176 2 47 72 34 1 0,054253895 1‐ MAP3510 0 36 0 0 0 0 36 0 0,290785005 1‐ MAP3511 84 24 63 3 72 0 59 2 0,317491875 1‐ MAP3512 36 154 99 2 0 114 49 0 0,029311892 1‐ MAP3513 72 168 298 4 217 110 72 5 0,787521188 1‐ MAP3514 994 2449 3125 43 584 2983 3652 40 0,50694471 1‐ MAP3515c 422 370 282 33 192 438 368 21 0,269322635 1‐ predicted RNA 278 7438 6206 3874 921 5886 4961 3499 0,493353723 1‐ MAP3517 233 139 252 6 179 143 107 4 0,161017541 1‐ MAP3518c 179 474 763 18 450 860 473 24 0,570510842 1‐ MAP3519 148 215 242 15 175 382 248 17 0,351949192 1‐ MAP3520c 1025 1082 1537 79 648 1601 1538 64 0,500352752 1‐ MAP3521 36 178 248 7 108 216 267 10 0,25389182 1oxyS_1 MAP3522 144 214 127 8 36 100 136 3 0,019440249 1oxcA MAP3523c 141 427 422 7 71 467 238 4 0,196321899 1fadD7 MAP3524 48 461 231 5 138 106 347 5 0,976692582 1fusA2 MAP3525c 1084 9306 7751 96 2833 6777 5560 92 0,482559497 1‐ MAP3526c 228 520 457 39 211 259 211 23 0,208325671 1‐ predicted RNA 148 9246 5299 4177 134 10293 6271 4607 0,521936511 1pepA MAP3527 1103 4368 3009 101 914 6592 2817 106 0,480962698 1

120


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3528 3423 4051 6490 123 3621 17634 13315 228 0,57762288 1‐ MAP3529 753 1259 1579 39 853 5264 3124 77 0,965718126 1‐ MAP3530 1604 2683 2506 152 3529 4231 2501 235 0,545571225 1‐ MAP3532c 72 142 301 7 36 71 252 4 0,170634507 1‐ MAP3533c 74 562 247 8 72 497 462 9 0,408716753 1‐ MAP3534c 27 72 34 3 72 89 22 5 0,229293364 1‐ MAP3535 108 364 302 33 165 700 471 52 0,231172183 1‐ MAP3536 180 348 251 29 283 261 214 30 0,864497654 1bpoC_1 MAP3537c 0 99 0 1 0 250 71 3 0,01500215 1‐ MAP3538 211 1125 507 50 538 1013 646 67 0,839175653 1fadE1_3 MAP3539c 1206 7066 3660 108 1414 5144 3892 94 0,496596833 1‐ MAP3540c 180 1183 1248 43 431 1465 1333 56 0,594829199 1‐ MAP3541c 150 92 139 6 144 749 412 13 0,047071094 1‐ MAP3542 93 714 415 23 144 385 376 19 0,374468969 1‐ MAP3543 331 456 394 54 143 2597 493 92 0,25415398 1‐ MAP3544c 1589 3303 7545 218 1205 20633 25942 671 0,17290474 1‐ MAP3545 180 18508 6181 227 1103 9621 5545 162 0,513333373 1desA3_2 MAP3546 468 30628 5545 333 884 9799 8414 186 0,629444535 1‐ MAP3547c 123 180 93 6 394 216 142 12 0,040796507 1‐ MAP3548c 22 74 180 5 72 141 105 6 0,386047263 1‐ MAP3549 249 639 431 16 181 349 437 11 0,293739379 1ephF MAP3550 504 4931 2740 104 431 3547 2187 76 0,529488838 1‐ MAP3551c 360 1027 527 127 336 530 389 85 0,407144381 1‐ MAP3552c 199 415 400 24 607 530 182 38 0,272644068 1‐ MAP3553 301 3866 1963 51 799 1120 833 31 0,964574791 1‐ MAP3554c 1045 8545 3339 293 1384 8005 3458 286 0,488027395 1‐ MAP3555 228 320 161 24 36 285 285 13 0,109762645 1‐ MAP3556 36 320 357 7 100 36 225 5 0,220679047 1‐ MAP3557 72 204 111 14 225 46 275 25 0,097294979 1‐ MAP3558c 144 892 655 50 340 913 358 53 0,849367388 1‐ MAP3559 130 214 74 7 112 142 262 7 0,883914444 1‐ MAP3561 186 72 143 8 58 177 217 5 0,205141698 1‐ MAP3562 209 2303 2117 80 457 2293 2623 96 0,519059079 1‐ MAP3563 205 876 2303 42 104 656 1093 22 0,209300903 1

121


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3565 197 369 515 9 193 465 546 9 0,915700664 1‐ MAP3566 1749 16710 11032 228 2685 10140 8221 174 0,510874056 1‐ MAP3567 1908 15392 13819 414 1812 14153 10581 340 0,502017516 1‐ MAP3568c 219 143 313 25 552 106 189 39 0,285243813 1‐ MAP3569c 415 567 446 57 723 215 331 61 0,55595751 1fadE2 MAP3570c 839 3696 2330 71 862 3165 1681 57 0,522267285 1‐ MAP3571 29 287 94 11 14 184 183 9 0,64340762 1pntAA MAP3572 915 3294 2070 76 993 2583 1695 62 0,517297396 1pntAB MAP3573 845 1297 1204 165 628 942 719 105 0,998054651 1pntB MAP3574 2504 6525 6725 151 2710 5272 5487 127 0,496745964 1‐ MAP3575 412 2736 1894 94 626 2093 1260 78 0,500629216 1‐ MAP3576 1162 7211 5828 154 1739 4255 3660 114 0,503896717 1fabG3_2 MAP3577 1272 3218 2117 127 2028 2244 1421 122 0,498077056 1‐ MAP3578 333 1487 1396 29 323 1102 687 19 0,906063636 1‐ MAP3579c 239 478 714 36 378 678 505 39 0,858029437 1‐ MAP3580c 173 681 485 21 180 366 331 14 0,296525847 1‐ MAP3581c 246 615 618 23 396 565 282 21 0,460399244 1‐ MAP3582c 72 381 306 19 47 369 231 15 0,298755528 1‐ MAP3583 187 373 245 13 133 352 197 9 0,249611393 1‐ MAP3584 144 681 654 20 72 482 291 10 0,112085904 1‐ MAP3585 606 1309 1215 38 730 863 771 30 0,511118847 1‐ MAP3586c 72 742 691 23 269 690 763 30 0,509653107 1‐ MAP3587 165 295 549 11 252 346 686 14 0,383562114 1‐ MAP3588 0 144 113 5 48 108 36 5 0,992454676 1‐ MAP3589 72 356 318 13 254 323 391 20 0,20036423 1‐ MAP3590 93 248 151 5 200 359 176 8 0,160751507 1‐ MAP3591 108 393 239 10 210 140 215 9 0,755749103 1‐ MAP3592 0 140 0 2 72 143 72 6 0,011408111 1‐ MAP3593 30 36 72 2 36 36 49 2 0,705443169 1‐ MAP3594 317 144 286 9 174 107 388 6 0,253835204 1‐ MAP3595 0 98 86 2 71 53 56 3 0,115896344 1adhE MAP3596c 58 271 143 5 40 54 116 2 0,035276832 1‐ MAP3597 272 468 498 38 150 1012 596 40 0,464605071 1‐ MAP3598 1731 8273 6303 439 1521 8107 4824 363 0,498844893 1

122


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3599c 1408 6366 9701 259 1412 12615 13128 364 0,563116107 1‐ MAP3600 24330 154873 55882 12752 37571 134228 70482 13383 0,506633966 1‐ predicted RNA 44528 664 461 23809 73788 491 230 32976 0,544190217 1fadD5 MAP3601 49734 129498 141352 3206 79457 154612 141144 3747 0,531876788 1‐ predicted RNA 6904 40 14 1914 9658 220 35 2262 0,456883676 1‐ predicted RNA 1767 96 32 1623 2607 49 0 1979 0,519032438 1‐ predicted RNA 21274 567 633 8244 31973 815 539 10375 0,547136878 1‐ predicted RNA 158211 453 660 32894 291488 1062 543 50860 0,595512286 1‐ MAP3602 3372 17395 16504 556 5588 19586 15653 614 0,512354286 1‐ MAP3603 4104 13303 13618 538 7783 15158 12576 644 0,523754493 1‐ predicted RNA 744 0 0 1203 1308 0 0 1776 0,688063839 1mce1_2 MAP3604 11558 37950 47034 954 18444 47868 43402 1082 0,519960173 1‐ predicted RNA 2160 3 0 1890 4022 0 0 2953 0,554984577 1‐ predicted RNA 2666 234 130 2305 4471 116 238 3208 0,538689667 1‐ MAP3605 9074 29436 39290 961 14013 41952 40178 1156 0,45388957 1‐ MAP3606 14481 38755 44802 850 25752 44971 38129 980 0,52149835 1‐ predicted RNA 1338 10 102 1236 2214 83 44 1705 0,524626553 1‐ predicted RNA 678 0 15 1105 692 0 20 951 0,655362033 1‐ predicted RNA 409 0 0 1103 627 7 0 1424 0,369423789 1‐ predicted RNA 4102 0 46 3249 6409 54 0 4258 0,532045634 1‐ predicted RNA 1355 0 0 1328 2063 0 0 1698 0,521027716 1‐ MAP3607 7482 47808 50392 771 11752 55810 50795 857 0,516589924 1‐ predicted RNA 764 110 15 836 2162 31 34 1915 0,135687487 1lprK MAP3608 6563 21150 22132 563 10075 23483 25296 659 0,529785341 1‐ predicted RNA 1096 23 61 1135 2775 23 58 2382 0,498866208 1‐ MAP3609 13744 72627 88964 1355 21801 100987 87865 1595 0,537330817 1‐ predicted RNA 1204 0 42 1159 1443 0 34 1164 0,482119832 1‐ predicted RNA 6651 54 110 4339 10620 153 20 5802 0,55771021 1‐ MAP3610 2239 3703 6262 273 3629 5968 5728 336 0,540058754 1‐ MAP3611 1615 4125 6909 171 2311 6556 8093 217 0,54161374 1‐ MAP3612 5545 15079 18757 948 7763 30295 21695 1304 0,545820389 1‐ predicted RNA 745 22 0 1158 1113 0 0 1439 0,90607424 1‐ predicted RNA 1652 123 182 1572 3225 145 40 2482 0,543623813 1‐ MAP3613 3313 10808 14674 486 3704 19117 14073 564 0,518750822 1

123


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3614 301 479 749 34 697 1550 720 62 0,229080689 1‐ MAP3616c 522 1226 1301 29 360 1557 752 22 0,624654045 1‐ MAP3617c 279 901 582 32 425 823 1094 42 0,968578793 1‐ MAP3618c 36 174 36 3 47 107 62 3 0,817255877 1‐ MAP3619 65 157 36 3 72 159 16 3 0,776064712 1‐ MAP3620c 243 1602 1278 26 576 1510 1383 31 0,520034582 1sigG MAP3621c 180 572 701 17 180 483 642 14 0,417409445 1‐ MAP3622 216 1006 1257 36 576 1237 894 44 0,513886278 1‐ MAP3623 278 862 723 33 380 518 589 28 0,929600639 1‐ MAP3624 119 1418 917 53 360 1201 1025 62 0,537922335 1bglS MAP3625 720 615 284 15 663 602 752 15 0,494698125 1‐ MAP3626c 119 2108 988 222 67 1091 288 95 0,084796428 1‐ MAP3627 139 3138 2582 95 417 2758 2273 93 0,495892108 1‐ MAP3628c 36 86 54 3 36 87 0 2 0,158653935 1‐ MAP3629c 0 32 85 4 0 67 35 3 0,375661032 1‐ MAP3630 834 2555 466 129 690 1079 1145 94 0,596100932 1ilvD MAP3631c 1043 4500 2942 62 892 2316 1586 36 0,674053907 1‐ MAP3632 409 2762 1095 176 309 1487 994 112 0,994610238 1‐ MAP3633 630 2587 2643 59 758 2432 2275 54 0,505235441 1‐ MAP3634 3664 3737 3871 189 2503 5289 3360 147 0,503362701 1‐ MAP3635 0 383 349 12 178 384 163 16 0,210498472 1‐ MAP3636 2032 1936 1531 38 2762 1123 771 36 0,497275478 1mmpL11 MAP3637c 1736 17309 13087 120 2153 18408 17160 137 0,516934009 1‐ MAP3638 108 215 107 12 144 108 36 9 0,558742064 1‐ MAP3639c 426 1972 781 34 563 5222 3242 83 0,18813048 1‐ MAP3640 556 1575 1348 41 498 1977 1434 41 0,486955413 1mmpL3 MAP3641c 6316 14278 16758 181 7048 22787 17057 203 0,513839049 1‐ MAP3642c 956 4659 4560 174 978 11644 9172 326 0,738642039 1trmB MAP3643c 742 4298 6150 168 1267 15295 13463 411 0,478510526 1‐ MAP3645 687 1061 1637 32 804 3771 4587 69 0,688650265 1pckA MAP3646 7137 147327 95976 1462 10308 108200 70057 1109 0,526653026 1‐ MAP3647c 379 239 264 32 239 188 327 21 0,292997134 1‐ predicted RNA 1655 0 14 1579 2629 37 0 2110 0,52566143 1‐ MAP3648c 2861 2083 2576 268 2941 2720 2647 256 0,490741712 1

124


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



fadD4 MAP3649 3040 5012 3115 118 5026 4334 2088 130 0,468443087 1‐ MAP3650 17488 1363 613 608 29211 766 433 836 0,554159882 1‐ predicted RNA 98 11827 6438 5158 228 10300 5447 4427 0,495071942 1‐ predicted RNA 250 3703 2474 3191 299 5049 2894 3894 0,525455263 1‐ predicted RNA 7835 252633 87395 15968 11883 124795 82021 10424 0,551078151 1‐ predicted RNA 2284 9127 5600 2770 1661 6502 5232 2020 0,511532295 1‐ predicted RNA 255 3704 4505 2718 198 3594 3126 2128 0,526462581 1‐ predicted RNA 76 3579 2768 5549 146 2949 2298 4665 0,506495425 1‐ predicted RNA 14104 401 227 2038 22189 372 113 2675 0,538540376 1fadE3_2 MAP3651c 28385 138140 100532 2730 43477 104595 72027 2398 0,525064089 1‐ predicted RNA 512 13 8 1198 523 0 0 1014 0,393198503 1‐ predicted RNA 2883 39 36 1119 2794 91 0 913 0,522228572 1‐ predicted RNA 10049 93 118 5743 12642 66 93 6053 0,482502886 1‐ MAP3652 72 188 89 4 72 179 223 5 0,522942572 1‐ MAP3653 78 414 206 6 36 147 36 2 6,89E‐04 1‐ MAP3654 235 509 536 14 261 366 453 12 0,39943252 1lipW MAP3655c 216 2006 1456 46 288 1710 1454 43 0,483733368 1lipC MAP3656 1260 7983 7152 155 2155 5357 5348 133 0,4955119 1‐ MAP3657 1574 7642 8301 151 1505 12202 10215 187 0,548192951 1echA1_2 MAP3658 162 1362 751 33 72 834 710 21 0,303008307 1‐ predicted RNA 15 634 1371 2140 13 1616 1627 3292 0,464610227 1‐ MAP3659 8787 43568 35721 710 10748 32128 24225 555 0,532858925 1‐ MAP3660 2991 16422 13610 1518 3795 14091 12518 1396 0,50449116 1‐ MAP3661c 9162 90021 62600 2332 14430 28489 22685 1145 0,58601692 1‐ predicted RNA 457 531 839 1608 1062 736 666 2380 0,985018944 1‐ predicted RNA 511 70 37 1257 591 46 14 1187 0,460297022 1‐ predicted RNA 6266 667 506 1440 10213 228 18 1877 0,554830501 1‐ MAP3662c 773 5155 1885 63 1061 1827 1448 41 0,534402245 1‐ MAP3663c 84 70 13 4 72 0 36 3 0,252635244 1‐ MAP3664 435 1359 2059 42 813 1576 1628 46 0,514316359 1‐ MAP3665c 151 816 1007 13 169 1436 878 16 0,799413805 1‐ MAP3666c 3849 7634 6445 215 2249 8079 8418 182 0,501164675 1‐ MAP3667 1165 1425 854 49 1158 789 832 38 0,50070141 1‐ MAP3668c 3462 11557 7485 309 6049 10992 9873 379 0,531651179 1

125


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



fadE4 MAP3669 957 3888 1762 50 1244 1657 2052 41 0,520967546 1‐ MAP3670 144 251 212 9 180 426 393 13 0,253168021 1‐ MAP3671 1173 6612 996 163 749 17051 3340 308 0,741522022 1nrdB MAP3672 1616 13407 3346 231 986 27949 5453 362 0,56954154 1gabD1 MAP3673c 1019 4729 3797 84 815 4128 3304 67 0,507741619 1‐ MAP3674 139 265 227 59 252 233 192 69 0,344603912 1ilvB_2 MAP3675 72 252 438 6 202 366 464 9 0,237708707 1oxyS_2 MAP3676 36 250 287 7 108 176 392 9 0,290697888 1‐ MAP3678 180 1075 1172 76 504 1051 751 83 0,501490194 1‐ MAP3679 29 182 285 5 36 123 140 3 0,169977083 1‐ MAP3680c 72 2135 470 23 215 1721 839 26 0,499789336 1‐ MAP3681 72 6312 4162 245 164 3556 3612 174 0,533075967 1‐ MAP3682 144 11498 4533 112 214 7594 5386 91 0,497215958 1‐ MAP3683 156 1959 1888 30 36 1716 1265 20 0,865150649 1‐ MAP3684 108 22153 7590 159 321 15771 9774 139 0,495528382 1‐ MAP3685c 108 2654 1217 28 632 2804 1314 39 0,523255465 1‐ MAP3686c 786 1243 1607 13 736 1335 793 9 0,56478898 1‐ predicted RNA 1927 5346 6249 4766 2584 7905 8446 6182 0,548636316 1‐ MAP3687c 80 110 181 20 96 235 340 31 0,172262409 1lpqI MAP3688 376 1175 838 27 340 794 507 18 0,728665035 1‐ MAP3689 1274 1246 2334 121 1349 1887 1859 114 0,504702795 1‐ MAP3690 375 284 372 14 281 177 253 9 0,261232254 1‐ MAP3691c 2232 3353 3040 162 1240 3424 2718 112 0,51983576 1fabG MAP3692c 1274 2292 1659 59 910 2449 1417 45 0,519716556 1fadA2 MAP3693 948 4739 3424 83 1469 4984 2925 87 0,482413785 1fadE5 MAP3694c 354 23133 8286 175 1285 7393 3120 74 0,371758465 1‐ MAP3695 274 582 332 16 36 519 367 9 0,136468132 1‐ MAP3696 861 928 637 89 895 357 501 67 0,597677631 1‐ MAP3697c 10516 24946 35540 1290 11641 27770 24522 1121 0,51384607 1sdhA MAP3698c 12643 54362 64415 836 15838 54532 47229 743 0,513459901 1‐ MAP3699c 7156 44645 41402 1336 10700 43465 32922 1264 0,488976475 1‐ predicted RNA 30 775 1109 2039 35 1349 1024 2444 0,212111784 1‐ predicted RNA 2947 79 34 2680 2983 38 29 2269 0,516235254 1‐ predicted RNA 1315 56 54 1323 1648 0 26 1365 0,484041335 1

126


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 710 32 0 1164 1138 0 26 1560 0,858731181 1‐ MAP3700c 2157 2057 3202 394 1628 2341 2544 296 0,516106623 1hsp MAP3701c 439 5168 2829 213 375 3801 1668 142 0,533348318 1nirB MAP3702 252 1311 1083 12 853 3307 3699 36 0,065841156 1nirD MAP3703 70 107 144 16 168 260 129 27 0,104164947 1‐ MAP3704c 82 321 78 14 244 206 177 23 0,133144181 1‐ MAP3705c 36 35 0 1 144 374 319 13 1,04E‐13 1‐ MAP3706c 0 108 73 1 74 739 650 13 6,18E‐24 1narK3_2 MAP3707c 108 104 36 3 106 390 279 6 0,063474522 1‐ MAP3708c 1343 2439 2664 104 2082 3642 4319 150 0,540972108 1‐ MAP3709c 955 4972 3049 164 950 8299 6373 253 0,545920149 1fecB2 MAP3710c 477 1102 612 32 605 1534 902 39 0,513205898 1‐ MAP3711c 318 2479 1570 84 249 1656 1250 58 0,754836172 1narU MAP3712 480 85 119 12 422 69 277 10 0,405479636 1‐ MAP3713c 817 2099 1713 50 548 1144 1169 29 0,832490409 1fadD2 MAP3714 8289 38572 29412 566 7312 59498 38750 690 0,44796153 1‐ predicted RNA 1043 3 15 1170 858 64 0 823 0,934910919 1‐ MAP3715 742 751 819 103 857 1519 472 109 0,481329235 1‐ predicted RNA 1275 157 74 1210 3109 0 20 2352 0,905180286 1‐ predicted RNA 1685 54 23 850 5227 56 0 2192 0,172992032 1‐ predicted RNA 3274 110583 24859 9103 9837 23586 13870 4034 0,621314261 1fadE6 MAP3716c 2409 10840 9905 131 3433 7630 6593 106 0,506056561 1‐ MAP3717c 1099 5201 4432 117 1794 3606 2921 100 0,499663482 1‐ MAP3718c 344 4834 5235 169 584 3371 2722 113 0,537723076 1‐ MAP3719 1221 7346 6059 280 1598 5179 4306 220 0,499997352 1‐ MAP3721 583 2909 1586 43 506 3464 3897 59 0,537378416 1‐ MAP3722 183 198 276 9 271 169 205 9 0,75988483 1fadD27 MAP3723c 91 173 280 11 262 227 196 17 0,185705594 1‐ MAP3724 150 731 180 15 130 465 267 11 0,341022542 1‐ MAP3725 455 311 334 13 567 390 247 13 0,918750576 1‐ MAP3726 192 3351 3727 76 354 4525 4288 95 0,534285847 1‐ MAP3727 139 177 235 10 101 224 181 8 0,365564916 1‐ MAP3728 648 703 750 34 525 1022 914 32 0,49009754 1‐ MAP3729 288 282 536 22 143 663 832 24 0,457775464 1

127


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3730 1380 5002 4018 214 2203 4823 3948 232 0,516856501 1‐ MAP3731c 2295 965 1734 68 1179 1395 1634 41 0,569737534 1‐ MAP3732c 1290 107 143 62 1513 145 179 62 0,484629294 1‐ MAP3733c 324 178 298 24 508 321 563 36 0,307560013 1‐ MAP3734c 733 226 481 17 441 572 503 12 0,917619216 1‐ MAP3735c 286 266 392 12 267 206 164 8 0,285155572 1‐ MAP3736c 84 99 83 4 125 254 335 9 0,047914242 1‐ MAP3737 170 36 123 4 108 36 184 3 0,408206102 1‐ MAP3739c 173 191 47 5 105 286 95 4 0,536473603 1‐ MAP3740 999 729 699 5 1045 951 845 5 0,486338737 1‐ MAP3741 176 106 156 9 244 87 65 9 0,857403816 1‐ MAP3742 481 465 964 6 219 715 382 3 0,204016838 1‐ MAP3743 226 141 168 10 464 202 355 17 0,182955669 1‐ MAP3744 331 323 468 18 396 399 871 23 0,670143771 1‐ MAP3745 392 263 1005 34 266 1101 1407 43 0,792429987 1‐ MAP3746 521 1122 926 119 360 1258 1360 114 0,485647141 1‐ predicted RNA 478 24427 8470 6940 163 12624 8507 4335 0,531736822 1‐ predicted RNA 1080 5152 1859 4008 572 2611 2058 2379 0,62265353 1‐ MAP3747c 1979 1019 1634 74 729 2847 2488 59 0,524438746 1IS1110 MAP3748c 460 359 469 19 288 803 610 18 0,684012355 1‐ MAP3749 416 386 700 28 96 1065 508 20 0,457953859 1mmpS1 MAP3750 63 36 36 5 144 164 130 14 0,015880821 1mmpL4_5 MAP3751 2427 2293 4142 49 2111 3594 3552 43 0,495433558 1fadD28 MAP3752 1577 6576 3730 88 1622 5347 3729 76 0,494722725 1‐ MAP3753 1881 4552 8074 141 1569 6933 9053 151 0,470808096 1‐ predicted RNA 116 1158 2280 2325 235 2059 2739 3250 0,523612432 1‐ MAP3754 932 8970 8661 931 861 13847 12477 1272 0,560770911 1‐ MAP3755 2670 1138 1395 249 3449 2013 1964 296 0,52877738 1‐ MAP3756c 2217 858 1622 113 2033 2091 1983 111 0,490566296 1‐ MAP3757c 1939 1183 1759 84 1771 2165 2116 82 0,496723881 1‐ MAP3758c 1180 2854 1493 107 1911 3180 3117 151 0,544195 1‐ MAP3759c 975 927 1041 41 1219 1446 1049 46 0,514099952 1‐ predicted RNA 757 0 0 1113 629 0 0 776 0,355070834 1‐ MAP3760c 647 1334 1027 115 749 1879 1066 126 0,516166796 1

128


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3761c 608 425 778 44 671 916 958 50 0,510430185 1‐ MAP3762c 444 463 662 21 642 729 806 26 0,830716008 1papA3_2 MAP3763c 854 586 885 28 935 1061 1136 31 0,51761468 1pks2 MAP3764c 2582 1549 2393 19 2424 4355 3215 22 0,521055822 1‐ MAP3765 1838 2900 3421 76 1897 3312 3468 74 0,491446728 1‐ MAP3766 661 1642 1602 54 846 1998 1721 60 0,512252066 1rpsR MAP3767c 588 169 216 86 696 177 0 76 0,922575335 1rpsN MAP3768c 236 143 70 31 297 115 44 31 0,900898577 1rpmG MAP3769c 147 181 249 55 104 215 341 51 0,711857701 1‐ MAP3770 215 558 472 14 268 850 497 17 0,553269634 1rpmE2 MAP3771 219 178 139 35 194 144 202 29 0,359356948 1‐ MAP3772c 539 575 571 25 316 754 861 21 0,587017963 1‐ MAP3773c 384 291 445 47 276 596 731 49 0,743849503 1‐ MAP3774c 463 359 589 26 252 995 816 26 0,495637439 1‐ MAP3775c 648 177 597 39 431 720 806 37 0,498186437 1‐ MAP3776c 666 1389 1570 46 1020 2045 2805 69 0,533410596 1‐ MAP3777 1326 1715 2442 138 1386 2715 2156 139 0,496358231 1‐ predicted RNA 644 0 0 1157 618 0 0 932 0,391315127 1‐ MAP3778 2375 5506 2667 85 2953 4626 3867 88 0,481131231 1‐ MAP3779 990 4310 1647 56 1141 2563 2515 50 0,510581793 1‐ MAP3780 2558 13027 6070 68 3797 12024 10400 81 0,539662318 1‐ MAP3781 75 504 111 27 108 296 286 28 0,933560994 1‐ MAP3782 2866 56213 18005 555 3345 47251 26255 544 0,496888306 1‐ MAP3783 381 15928 4091 709 950 13822 6344 750 0,473753675 1‐ MAP3784 1007 6654 1700 393 1374 4339 3189 384 0,486681373 1‐ MAP3785 600 3873 2051 89 895 4207 2717 104 0,525287639 1‐ MAP3786 330 1126 388 17 335 1296 668 19 0,50803404 1‐ MAP3787 322 1141 355 17 351 901 664 17 0,496070104 1‐ MAP3788 472 820 629 41 755 501 851 47 0,504866022 1‐ MAP3789c 532 380 359 20 954 363 384 27 0,933405334 1‐ MAP3790 257 852 495 27 288 678 467 24 0,645807713 1atsG MAP3791c 1149 2313 1287 51 1021 2516 2103 51 0,497864642 1‐ MAP3792c 173 607 216 20 215 330 259 17 0,398772681 1‐ MAP3793 466 349 487 83 496 383 389 74 0,92281755 1

129


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3794c 539 1211 1142 85 402 1681 1302 83 0,4827034 1‐ MAP3795 144 36 108 8 180 36 124 9 0,745521657 1‐ MAP3797c 1063 2573 1658 154 2302 2474 1708 208 0,543793519 1‐ MAP3798c 108 308 104 12 72 178 65 6 0,094293682 1‐ MAP3799 246 751 370 15 137 1087 430 14 0,478355655 1‐ MAP3801 2527 5112 7148 141 3629 7284 6412 160 0,464896777 1‐ MAP3802c 418 978 839 48 350 635 371 29 0,326253347 1‐ MAP3803 262 1420 974 31 361 1381 1119 33 0,508548164 1‐ MAP3804 1084 6226 3727 164 1221 4719 3633 141 0,499354953 1‐ MAP3805c 546 645 530 18 583 778 589 18 0,497548795 1‐ MAP3806 180 278 248 16 216 179 106 12 0,260628745 1‐ MAP3807 215 324 250 18 133 300 322 14 0,314406786 1‐ MAP3808c 273 133 286 16 493 622 448 30 0,206494304 1‐ MAP3809c 1249 604 2601 52 897 1943 2744 51 0,501632113 1‐ MAP3810c 68 1201 828 52 108 906 1063 52 0,495691289 1‐ MAP3813 159 1885 2647 169 297 3897 4278 295 0,682767526 1‐ MAP3814c 393 323 90 11 886 108 72 17 0,295633888 1‐ MAP3815 1165 3834 3406 130 1821 5202 4053 165 0,533211631 1‐ MAP3816 108 0 35 15 101 47 55 15 0,97660631 1‐ MAP3817c 549 3596 1938 77 451 2155 1893 56 0,513965051 1‐ MAP3818 1696 5874 4321 121 982 5426 3859 91 0,504888777 1‐ MAP_t42 212 848 542 293 282 333 485 225 0,365161849 1‐ MAP3819 1140 645 1104 86 2246 756 1000 124 0,532119314 1dcd MAP3820 1472 959 2335 143 1395 1532 1362 116 0,517312384 1‐ MAP3821 584 1359 3286 32 506 2320 3041 32 0,494727463 1‐ predicted RNA 4253 1493 7277 3037 3089 5344 4937 2457 0,501155934 1‐ MAP3822 108 152 659 7 108 343 619 8 0,848663181 1‐ MAP3823 595 1986 2427 52 460 3494 2887 61 0,518480264 1‐ predicted RNA 587 120 120 1340 262 533 323 968 0,331677578 1‐ MAP3824 1125 2236 1606 55 770 3981 2782 65 0,521529463 1‐ MAP3826 146 1218 1580 40 144 1102 1180 32 0,639759018 1‐ MAP3827 668 3680 2419 236 384 2818 1921 162 0,52549116 1rmlA MAP3828 690 4051 3540 113 1008 3684 2656 102 0,503386337 1‐ MAP3829c 376 324 541 16 290 486 209 11 0,302481862 1

130


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



aspC MAP3830c 4785 13877 15159 349 5201 10750 11529 282 0,520341536 1‐ MAP3831c 6047 24558 21544 230 8171 19206 17323 203 0,51821517 1‐ MAP3832c 523 2907 3227 46 706 2377 2267 38 0,514834529 1‐ MAP3833c 1817 4710 4095 189 1266 5923 3613 163 0,497046598 1‐ predicted RNA 1684 881 1163 2288 398 914 1326 1021 0,17254215 1‐ MAP3834 985 1033 994 36 504 473 299 14 0,09080065 1‐ MAP3835c 1410 1367 2443 102 772 2802 3487 102 0,497492331 1‐ MAP3836c 4654 10958 12565 167 3498 14125 16144 171 0,503772309 1‐ MAP3838c 100 255 485 17 70 187 359 11 0,197716475 1dnaK MAP3840 9545 135748 69132 1256 10336 76257 52449 827 0,542695644 1grpE MAP3841 1587 14260 8089 402 1609 7800 5992 263 0,521891823 1‐ predicted RNA 123 14490 10729 7179 137 10259 9614 5628 0,506262449 1dnaJ MAP3842 2008 19083 12135 321 2114 12586 9305 232 0,513352338 1hspR MAP3843 323 6771 4888 323 542 5168 4809 289 0,496490028 1‐ MAP3844 863 3079 1820 18 808 2121 2150 15 0,512243375 1‐ MAP3845 324 1675 1000 46 477 995 696 36 0,580483904 1idsA MAP3846 247 971 695 20 89 852 474 12 0,256010836 1‐ MAP3847 30 38 177 12 36 43 159 11 0,96481433 1‐ MAP3848 163 789 852 21 323 670 751 22 0,752183622 1‐ MAP3849 758 1828 1703 19 1079 1859 1537 20 0,508505874 1‐ MAP3850c 306 251 756 22 157 645 342 15 0,287024367 1‐ MAP3851c 71 302 330 7 108 922 568 14 0,084697822 1clpB MAP3853 2192 25483 16742 194 2726 15706 11355 134 0,532400599 1‐ MAP3854 473 3474 3741 69 437 2908 3491 60 0,516841243 1‐ MAP3855 1307 4749 4557 156 1702 7474 6363 210 0,535393551 1‐ MAP3856 542 1325 1521 60 625 2207 1091 63 0,485617744 1pyrE MAP3857 328 354 428 34 318 756 484 38 0,649721543 1‐ MAP3858 356 573 1099 31 534 1183 955 39 0,573835522 1‐ MAP3859 50 335 429 14 336 338 433 25 0,145741756 1‐ MAP3860 619 1358 555 32 878 1174 926 37 0,52038302 1scoB MAP3861 2789 8575 6224 177 2865 8566 5940 163 0,490685168 1‐ MAP3862c 1470 2372 2905 146 1246 2803 2408 123 0,513418725 1‐ MAP3863c 1452 8192 6313 219 1455 7127 4829 178 0,499789853 1‐ MAP3864 72 1822 1543 78 37 1143 1189 52 0,878423829 1

131


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3865c 232 353 103 13 163 137 50 6 0,090581852 1‐ MAP3866c 108 143 234 9 209 118 72 9 0,919916785 1‐ MAP3867c 0 64 99 2 0 181 36 2 0,683546132 1purA MAP3869 508 4554 2817 69 964 2952 3155 67 0,499846584 1‐ MAP3870 395 596 824 42 180 937 1139 40 0,500484179 1purT MAP3871 144 553 467 11 187 524 298 10 0,401898367 1‐ MAP3872 160 870 280 37 155 657 463 34 0,435012024 1metZ MAP3873 1405 1697 1604 64 1629 1414 1572 60 0,505452935 1‐ MAP3874c 1045 4973 2726 76 2677 3884 3238 99 0,534538885 1‐ predicted RNA 180 6957 1120 4680 481 5423 3296 5469 0,52781655 1‐ MAP3875c 578 1281 1358 73 497 1631 1635 74 0,485640612 1‐ MAP3876c 282 1100 1955 61 274 2403 1383 67 0,519243408 1fadE20_3 MAP3877c 1467 5643 8313 166 1648 6403 6856 155 0,485998138 1fadE7 MAP3878c 2505 10669 14006 279 2336 12408 9900 238 0,498214261 1‐ MAP3879c 1210 9562 6869 266 1136 6463 5218 191 0,508655761 1‐ MAP3880 324 785 750 70 180 715 496 45 0,288891831 1‐ MAP3881 108 180 142 7 127 218 118 7 0,908752349 1‐ MAP3882 121 169 178 14 125 347 197 16 0,577883557 1‐ MAP3883c 240 529 1136 33 92 788 607 21 0,288023339 1‐ MAP3884 1380 7330 6458 182 2195 7799 5743 191 0,472946201 1pta MAP3885 1019 710 1721 27 1134 1611 1802 31 0,51351381 1ackA MAP3886 468 753 1387 32 769 1539 1091 40 0,520832283 1‐ MAP3887c 72 608 883 16 245 462 751 17 0,454069963 1‐ MAP3888c 36 395 488 7 108 404 289 7 0,787884486 1‐ MAP3889 0 36 36 1 0 0 0 0 0 1mmpL4_6 MAP3890 288 319 468 6 686 636 567 10 0,229140591 1‐ MAP3891 108 420 357 17 360 573 459 31 0,203881506 1‐ MAP3892 101 103 138 6 77 81 123 4 0,345557592 1pknG MAP3893c 2210 5966 9598 101 2705 8574 7842 103 0,477284142 1glnH MAP3894c 1162 4684 6330 162 1760 5546 5018 164 0,485358267 1‐ MAP3895c 2274 7155 9678 186 1907 9646 7965 171 0,49065884 1mutT3 MAP3896 768 4894 2969 161 570 2956 1797 96 0,608009283 1thiE MAP3897c 106 247 34 9 128 178 0 7 0,641217557 1‐ MAP3898 306 4406 3684 85 472 3195 2525 64 0,52775327 1

132


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP3899 235 798 629 111 180 610 474 78 0,324418596 1thiG MAP3900 366 805 881 38 306 651 863 31 0,779533539 1‐ MAP3901 332 336 307 23 287 447 358 21 0,434253016 1‐ MAP3902c 727 2080 1231 108 837 1339 1132 90 0,497465526 1‐ MAP3903c 212 2980 2177 110 910 2011 1574 112 0,493524095 1‐ MAP3904 798 8844 4247 468 986 6212 4579 400 0,495337355 1‐ MAP3905 449 3243 2137 161 588 2791 2265 155 0,498348091 1lpqL_1 MAP3906 899 6526 4535 93 964 7187 5003 97 0,485247372 1lpqL_2 MAP3907 324 675 741 17 625 868 1340 27 0,563476697 1lpqM MAP3908 669 1575 2023 40 913 2795 2276 52 0,523441493 1‐ MAP3909c 72 938 435 18 217 763 418 19 0,442674759 1‐ MAP3910c 120 297 14 20 144 268 103 22 0,742353666 1‐ MAP3911c 72 180 512 15 286 235 232 19 0,29963084 1thiD MAP3912c 215 576 1027 27 205 525 777 22 0,650501666 1thiC MAP3913c 3356 16715 13621 256 4565 13977 10365 224 0,509663278 1‐ predicted RNA 281 990 2028 2533 242 1647 1660 2487 0,482309762 1‐ MAP3914c 834 3204 2403 299 957 4039 3006 342 0,524178418 1‐ MAP3915c 940 2938 2251 184 1601 1327 1127 150 0,517770519 1‐ predicted RNA 446 3390 4632 3031 878 6273 6016 4593 0,543318333 1xthA MAP3916c 228 708 368 22 180 596 164 14 0,283421223 1‐ MAP3917c 36 106 108 3 0 36 202 3 0,463338121 1def MAP3918c 678 782 643 61 566 795 678 50 0,5160716 1‐ predicted RNA 1206 5309 3342 4340 1029 5180 4186 4172 0,491788622 1‐ MAP3919 1524 5977 3614 470 1174 4084 2278 304 0,552027061 1‐ MAP3920 1533 3136 2598 225 1515 3008 3174 216 0,486924949 1sodC MAP3921 1476 9311 7142 312 1537 6405 5573 235 0,508548911 1‐ MAP3922 683 1500 1922 49 1082 1382 1723 52 0,509448031 1‐ MAP3923 350 359 751 35 103 709 496 22 0,26837532 1‐ MAP3924 471 1734 1009 41 357 1396 912 31 0,60697821 1echA8_2 MAP3925 72 411 283 11 105 431 394 13 0,327960842 1‐ MAP3926c 72 107 72 5 41 27 0 1 0,005161069 1‐ MAP3927 36 87 36 3 66 35 25 3 0,930680198 1‐ MAP3928c 614 1249 1585 22 406 1530 1072 16 0,598077612 1pssA MAP3929c 216 1061 958 31 209 1384 678 29 0,500078565 1

133


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



psd MAP3930c 216 875 285 25 180 572 429 20 0,374909656 1‐ MAP3931 216 70 137 7 192 225 78 6 0,602678805 1moaA3 MAP3932c 72 1028 582 15 177 485 963 16 0,458572304 1‐ MAP3933c 214 1143 865 28 324 725 627 23 0,912163935 1‐ MAP3934c 646 1085 1068 82 648 911 595 62 0,610921555 1‐ MAP3935 323 1081 1087 44 168 903 667 27 0,415135068 1groEL MAP3936 2638 58164 18027 513 2545 29801 10802 281 0,586518454 1‐ MAP3937 119 150 215 9 36 281 176 6 0,33168822 1‐ MAP3938c 811 1360 950 125 697 1330 950 105 0,489533306 1‐ MAP3939c 389 1791 2164 82 624 1361 1552 71 0,493405511 1‐ MAP3940c 1154 10129 9705 138 1521 7623 5743 100 0,51208006 1gloA MAP3941 72 418 140 21 150 107 119 17 0,548633669 1‐ MAP3942 767 1832 2090 125 729 1705 1318 96 0,505025923 1‐ MAP3943 213 341 93 14 339 376 165 18 0,342688452 1‐ MAP3944c 102 166 252 4 144 178 145 3 0,864532625 1‐ MAP3945 327 544 4334 91 396 587 809 36 0,098169504 1‐ MAP3946 305 670 2276 78 411 587 778 48 0,697992148 1mmpL4_7 MAP3947 2868 6081 27718 154 2077 7663 6133 65 0,599854811 1‐ predicted RNA 1118 51 190 1489 1520 115 45 1647 0,519846581 1‐ MAP3948c 6880 29802 24794 2154 8834 30108 19943 2033 0,506932941 1‐ predicted RNA 3956 398 246 3362 5789 303 257 4071 0,525115017 1echA2 MAP3949c 345 3031 1681 63 179 1873 2033 48 0,508918397 1‐ MAP3950c 249 773 584 70 194 835 1135 82 0,996297297 1‐ MAP3951c 444 1711 1846 24 263 1328 707 13 0,394796178 1‐ MAP3952 4975 28479 21823 439 5671 33489 22740 464 0,511671192 1‐ MAP3953 72 585 492 27 0 327 315 13 0,067052662 1‐ MAP3955 148 537 775 32 548 681 861 53 0,2589721 1‐ MAP3956 2200 9479 7834 190 3506 11356 7297 214 0,461745273 1‐ MAP3957 334 144 108 47 755 102 72 78 0,249329634 1‐ MAP3958c 525 1126 1004 69 756 1427 1040 80 0,52058753 1‐ MAP3959c 623 1817 2156 40 463 2500 1687 35 0,500849006 1‐ MAP3960 1024 3037 1925 104 1163 2352 1841 92 0,512898646 1aceA MAP3961 131 982 629 15 86 631 415 9 0,243826358 1fadB2 MAP3962 528 3524 1961 83 521 2451 1639 62 0,513512527 1

134


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



umaA1 MAP3963 1664 4788 4091 167 1638 5585 3408 153 0,492601421 1umaA2 MAP3964c 2021 19216 10680 420 2771 17452 10190 398 0,494968888 1‐ MAP3965c 1775 3314 4459 194 1109 4060 3932 155 0,502176034 1‐ MAP3966 1245 5254 4400 100 1156 4689 3225 79 0,502583815 1‐ MAP3967 908 6064 3484 299 968 4498 4018 266 0,495894376 1‐ MAP3968 625 4881 2451 158 241 4147 3112 133 0,519137465 1‐ MAP3969 696 1944 1345 210 1533 1167 798 231 0,511928019 1‐ MAP3970 108 179 285 19 127 356 216 21 0,764717863 1deoC MAP3971 442 331 539 34 540 242 403 31 0,870372431 1‐ MAP3972c 7323 10386 16091 482 6145 13792 11916 399 0,531042469 1‐ predicted RNA 889 0 40 1390 703 21 0 918 0,473742745 1‐ predicted RNA 2736 17 27 2472 2184 36 58 1674 0,530712233 1‐ MAP3973c 358 1507 1868 56 448 1880 1161 50 0,487169236 1‐ MAP3974c 167 609 273 26 143 314 266 18 0,243141518 1murB MAP3975 144 431 91 8 36 203 111 3 0,01801544 1‐ MAP3976 1274 3420 3311 81 1244 2764 2908 67 0,509577538 1‐ MAP3977c 746 1987 1605 80 363 1602 1132 49 0,916952299 1‐ MAP3978 458 2855 3091 58 840 2792 2385 57 0,500454143 1‐ MAP3979 725 1214 2202 44 875 1758 1740 44 0,494855833 1‐ MAP3980 676 2489 4563 186 670 5599 5708 258 0,538866667 1gpmA MAP3981 1273 5063 4505 184 1289 3653 3979 149 0,502208664 1senX3 MAP3982 2290 12292 8843 233 2537 8478 6360 175 0,515011664 1regX3 MAP3983 1034 6789 4584 216 1345 4440 3570 169 0,503631576 1‐ MAP3984c 151 323 498 26 564 503 322 46 0,223732368 1‐ MAP3985c 72 191 214 6 108 107 259 7 0,79625295 1‐ MAP3986c 1264 4208 4576 162 1567 4178 4025 155 0,492525901 1‐ MAP3987 3641 15022 10704 370 3481 16933 11823 371 0,495155494 1‐ MAP3988 1198 3418 4545 124 872 5411 5086 132 0,481907494 1‐ MAP3989 458 1134 1438 48 294 1732 1580 48 0,482527031 1‐ MAP3990 310 576 996 31 299 922 1282 36 0,584975517 1proC MAP3991 833 1070 1155 55 425 463 850 28 0,222028039 1‐ MAP3992 1558 21115 13236 1531 1557 15847 9900 1142 0,51113834 1‐ predicted RNA 5675 59742 47651 11339 7497 58207 39531 10411 0,505728003 1‐ predicted RNA 2063 27 0 1861 1670 0 34 1270 0,622435469 1

135


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 4881 118 136 3087 7782 65 128 4104 0,54379468 1galE1 MAP3993 1925 17424 17035 366 1630 17846 15059 329 0,507916033 1‐ MAP3994 3074 11889 10466 306 3413 11632 9406 283 0,489850858 1cmaA2 MAP3995c 5487 53825 27604 1099 4600 68892 38001 1296 0,454176152 1‐ MAP3996c 13624 30712 15164 1710 11474 48956 23233 1924 0,460412033 1serB MAP3997c 605 2420 3242 85 406 3296 2486 74 0,510406056 1‐ predicted RNA 135 1716 1652 2760 116 2034 1976 3097 0,519630095 1‐ predicted RNA 281 2284 2580 2675 318 2436 1978 2386 0,4991816 1‐ predicted RNA 368 4734 3604 3100 443 5252 3432 3141 0,487213113 1‐ predicted RNA 264 945 1122 2972 288 1632 1233 3618 0,521619093 1‐ predicted RNA 468 5392 3746 3457 759 4594 3311 3183 0,493166134 1‐ predicted RNA 8711 280 135 4333 8042 238 181 3373 0,511588831 1‐ predicted RNA 569 60 157 1293 720 45 28 1267 0,765287002 1‐ predicted RNA 1661 7 0 1495 2165 35 8 1644 0,512352362 1‐ MAP3998c 2161 49910 39004 363 4406 43440 36154 341 0,495534895 1‐ predicted RNA 1480 0 63 1428 1088 24 70 898 0,917706313 1‐ MAP3999c 252 1848 782 125 240 1155 628 87 0,917835899 1‐ MAP4000c 190 947 544 61 146 594 508 43 0,318901571 1‐ MAP4001 178 248 389 45 43 544 435 40 0,405432265 1‐ predicted RNA 191 1319 1125 3095 152 941 1052 2425 0,828232205 1hemA MAP4002 1992 6446 5455 134 1730 4440 4536 99 0,50321254 1hemC MAP4003 1642 6595 9029 225 2773 7199 6257 220 0,482267555 1cysG MAP4004 1846 18049 17361 253 2301 13977 13388 202 0,512131453 1hemB MAP4005 2551 3152 4324 162 3062 4666 3494 167 0,482074705 1‐ MAP4006 634 2870 2969 134 405 3035 2971 119 0,510866264 1‐ predicted RNA 1942 7 47 1761 2033 73 69 1573 0,502005225 1‐ MAP4007c 4168 6058 6081 586 3121 10954 9772 661 0,462524544 1‐ predicted RNA 9273 0 17 7149 7918 0 64 5138 0,520200103 1‐ MAP4008 1984 6554 7131 155 2016 6945 6694 145 0,484227159 1‐ MAP4009 601 1701 2983 92 686 2196 3148 99 0,509942834 1‐ MAP4010c 467 687 1355 16 376 2067 1958 23 0,526802856 1‐ MAP4011c 606 1407 1743 54 1002 5628 5070 140 0,168709399 1‐ MAP4012c 0 0 0 0 0 6 0 0 1,50E‐28 1‐ MAP4013 1833 4449 2448 66 2538 9952 4931 110 0,553511876 1

136


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP4014 165 432 172 11 163 214 317 10 0,364164141 1‐ MAP4016c 124 488 659 17 208 537 556 18 0,622736514 1‐ MAP4017c 243 1043 903 23 467 1075 575 24 0,49989014 1‐ MAP4018c 251 6549 3176 244 540 3394 2640 173 0,533325741 1‐ MAP4019 978 1415 1873 188 1118 1878 1610 187 0,495164934 1hemL MAP4020 333 1224 931 24 196 959 625 15 0,545627415 1‐ MAP4021 72 318 508 17 288 465 172 22 0,340030453 1‐ MAP4022 199 390 415 24 108 676 353 21 0,40644997 1ccsA MAP4023 108 468 214 13 179 450 379 16 0,327131669 1‐ MAP4024 455 698 941 19 371 953 499 14 0,877672362 1ccsB MAP4025 1940 6089 6161 191 2463 10637 7951 256 0,555460042 1‐ predicted RNA 426 2922 3436 4153 250 4147 3517 4374 0,508621864 1‐ MAP4026 693 5830 5402 104 709 6070 3992 90 0,499100518 1‐ MAP4027 174 64 91 21 105 117 0 11 0,078621286 1fabH MAP4028c 1450 6702 4302 156 1278 5524 3962 127 0,499088068 1menA MAP4029c 286 1487 1281 42 110 1525 853 29 0,949654947 1pnp MAP4030 34 398 532 13 279 874 747 30 0,084938727 1‐ MAP4031 68 391 381 21 59 170 235 12 0,119710685 1‐ MAP4032 67 35 0 5 35 34 0 2 0,089716223 1‐ MAP4033c 180 805 988 14 194 643 1046 13 0,524051498 1‐ MAP4034 237 3077 2294 36 232 2359 1792 28 0,501589706 1‐ MAP4035 0 8 131 2 52 81 11 3 0,335619902 1‐ MAP4036 0 50 0 0 0 35 36 1 0,303552676 1‐ MAP4037c 241 216 302 9 280 652 316 12 0,369255593 1menE MAP4038c 216 91 510 12 281 888 306 17 0,326234581 1‐ MAP4039c 961 1385 2035 219 1557 1782 1577 250 0,515774662 1‐ predicted RNA 973 0 0 1259 1009 0 0 1096 0,503272398 1‐ MAP4040c 295 533 854 77 206 492 1139 73 0,050064847 1pitA MAP4041c 1396 6284 4631 122 2242 6776 5629 145 0,53258466 1‐ predicted RNA 2033 26 57 1801 3257 0 34 2401 0,53585847 1‐ MAP4042c 1501 2250 2554 239 2477 4087 3159 340 0,540461819 1‐ MAP4043c 904 3452 2767 102 1242 2317 2551 92 0,510457071 1menB MAP4044c 415 3727 3820 100 661 3300 2926 88 0,51316473 1‐ MAP4045c 230 173 322 73 235 397 250 74 0,846382082 1

137


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP4046c 43 215 52 4 134 125 46 5 0,340590324 1fadD8 MAP4048c 210 1512 833 18 465 380 520 13 0,824226392 1‐ MAP4049 159 323 179 5 108 275 72 3 0,150363523 1menC MAP4050 22 84 108 2 0 17 36 0 7,20E‐06 1bpoC_2 MAP4051 522 354 812 36 287 573 609 25 0,546193989 1menD MAP4052 485 1213 1215 24 316 1437 1136 20 0,489544852 1‐ MAP4053 324 488 1053 50 345 549 708 42 0,898044118 1‐ MAP4054 71 177 244 5 97 96 166 4 0,606221581 1ubiE MAP4055 1055 930 1180 80 1578 636 737 81 0,49308483 1‐ MAP4056c 2155 17406 9375 858 2845 9971 8593 667 0,507858943 1grcC1 MAP4058 701 1964 1985 62 851 1035 950 42 0,686894971 1htpX MAP4059 2455 1469 2558 140 2536 898 1201 104 0,520150613 1‐ MAP4060c 8252 9261 32149 458 6918 56156 35886 710 0,58651863 1gpsA MAP4061c 1206 5665 3942 135 1313 5916 3416 126 0,493498441 1‐ MAP4062c 1073 7971 7423 125 2087 8428 5754 129 0,47461754 1‐ MAP4063c 907 7395 3914 289 1858 6698 3590 306 0,484212839 1‐ MAP_t43 316 777 532 288 315 833 493 265 0,803144066 1‐ MAP4064c 72 580 381 12 144 520 461 14 0,476193289 1‐ MAP4065 374 1852 608 26 622 1464 921 29 0,517850839 1‐ MAP4066 3635 1446 1105 117 1643 1908 1258 62 0,774429778 1‐ MAP4067c 400 390 810 19 353 878 500 17 0,584441169 1‐ MAP4068c 73 272 489 8 36 79 215 3 0,013172226 1‐ MAP4069c 72 677 536 16 180 285 501 14 0,409902473 1‐ MAP4070c 181 258 224 5 72 264 248 3 0,177520521 1galT MAP4071 108 463 286 10 316 594 338 16 0,237707897 1galK MAP4072 0 72 0 0 12 124 72 2 0,008164242 1‐ MAP4073 71 40 145 7 0 142 252 6 0,893970175 1‐ MAP4074 924 1287 677 79 910 1078 902 71 0,489113741 1lpqN MAP4075c 219 365 144 17 179 390 142 14 0,347311974 1‐ MAP4076 420 510 204 7 504 219 291 7 0,468960876 1‐ MAP4077c 260 860 984 11 464 737 479 10 0,507847634 1‐ MAP4078 119 1699 2369 47 36 1307 1176 26 0,512707329 1‐ MAP4079 209 429 543 11 479 395 233 13 0,428984835 1‐ MAP4080c 238 286 144 45 735 263 251 95 0,135558493 1

138


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP4081 108 951 389 23 101 681 429 19 0,371048373 1‐ MAP4082 72 507 219 11 36 469 166 8 0,230946379 1‐ MAP4083 30 535 547 13 102 577 314 13 0,551401695 1mce2 MAP4084 282 530 723 19 215 575 713 16 0,636474505 1‐ MAP4085 216 494 686 18 144 394 465 12 0,275369296 1‐ MAP4086 294 988 553 17 130 575 812 12 0,429980559 1‐ MAP4087 288 568 330 12 325 252 323 9 0,373208724 1lprL MAP4088 86 497 660 12 216 653 539 15 0,39579141 1‐ MAP4089 184 464 334 9 209 304 357 8 0,410668733 1‐ MAP4090c 23 0 0 1 0 0 57 0 0,69350384 1recD MAP4091c 0 108 71 1 0 108 92 1 0,840101324 1‐ MAP4092c 36 72 97 1 0 65 35 0 0,018890506 1‐ MAP4093c 179 193 356 10 0 288 285 5 0,075876301 1recC MAP4094c 435 1788 1485 14 833 1551 1727 16 0,517254938 1‐ MAP4096 0 417 376 15 72 577 311 20 0,25031663 1‐ MAP4097 167 1182 597 29 208 822 685 26 0,95646991 1‐ MAP4098 179 1234 609 52 227 831 386 39 0,495272052 1‐ MAP4099 246 1475 1308 35 186 2354 1174 38 0,517300678 1‐ MAP4100c 166 36 36 12 92 114 34 8 0,184412041 1‐ MAP4101c 365 170 446 10 72 588 414 6 0,270342463 1echA3 MAP4102c 496 4099 5439 88 580 4045 5365 86 0,486575938 1‐ MAP4103c 3775 10401 8799 375 3118 9391 8156 308 0,502528749 1‐ MAP4104c 756 5031 5577 186 1539 5332 4607 197 0,484463442 1‐ MAP4105 960 1181 1087 234 858 1252 1142 204 0,494472268 1‐ MAP_t44 177 3876 2525 959 298 5381 2960 1224 0,532354657 1‐ MAP_t45 934 825 660 611 836 1113 1091 605 0,485338049 1rpmG MAP4106 2760 12623 9089 1834 1524 14659 10868 1749 0,485198452 1‐ predicted RNA 2691 51 0 2304 1566 116 30 1155 0,499232865 1‐ MAP4107 6307 14655 17908 1121 7153 21220 21072 1289 0,519062683 1‐ predicted RNA 2144 19 33 1942 1145 0 28 872 0,171705379 1‐ predicted RNA 1582 26 25 1567 1204 16 22 1002 0,983090551 1‐ predicted RNA 1481 57 161 1673 1534 142 26 1441 0,490005344 1‐ MAP4108 5042 10858 12308 932 5217 15276 9549 897 0,502252078 1‐ MAP4109 1966 2852 3479 255 1658 3725 3967 243 0,492468245 1

139


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP_t46 1169 1171 2926 1106 604 3374 3790 1216 0,515600214 1secE MAP4110 3952 17557 18025 1105 2938 20789 17043 1026 0,51524739 1‐ predicted RNA 1060 81 0 1209 706 43 58 696 0,293798151 1nusG MAP4111 8287 13396 14252 714 7149 16162 14356 646 0,518057174 1‐ predicted RNA 4465 0 0 2627 4215 61 36 2099 0,503152707 1rplK MAP4112 6145 22087 22330 1519 5785 25114 17030 1333 0,519537734 1‐ predicted RNA 5283 70 34 3739 3833 231 100 2333 0,676182881 1rplA MAP4113 2558 13172 9011 432 1894 8201 6317 275 0,525579602 1‐ MAP4114c 863 584 293 29 676 476 356 21 0,86274995 1‐ MAP4115c 102 1295 1334 44 200 1106 1080 40 0,497077847 1mmaA4 MAP4116c 6876 20947 16475 669 8346 17005 15198 611 0,514326481 1‐ predicted RNA 2207 36 0 1993 2151 0 0 1623 0,511588074 1mmaA1 MAP4117c 3871 7097 9099 338 4283 6223 6374 282 0,502095034 1lipG MAP4118c 871 4181 6174 148 1128 4941 5665 151 0,486271809 1‐ MAP4119c 1580 6859 6846 140 1759 6626 7136 137 0,480338407 1‐ MAP4120c 385 2285 1715 87 138 1968 1628 65 0,580203578 1‐ MAP4121 576 893 618 8 384 675 519 5 0,691705173 1fabD2 MAP4122 21 250 167 7 50 142 53 5 0,207978075 1‐ MAP4123 72 466 568 14 53 566 300 10 0,308453842 1‐ MAP4124 236 566 705 45 240 909 205 37 0,400952523 1‐ predicted RNA 1137 542 475 1682 366 744 624 841 0,203294262 1rplJ MAP4125 2231 42586 42833 1595 1388 47746 42260 1583 0,484912352 1rplL MAP4126 516 912 624 81 207 641 548 44 0,207210276 1‐ MAP4127c 72 70 91 5 203 50 127 9 0,071190448 1‐ MAP4128 0 421 277 4 163 307 176 6 0,291599561 1‐ MAP4129 14590 67890 51871 1663 19547 66926 54939 1723 0,475651532 1‐ predicted RNA 2140 1083 1511 2665 3438 1990 859 3357 0,53140702 1‐ predicted RNA 1758 97 165 1655 1827 57 115 1428 0,500008516 1‐ predicted RNA 1787 88 30 1685 1946 31 51 1534 0,498810474 1‐ predicted RNA 574 21 6 1256 707 6 12 1292 0,475028987 1‐ predicted RNA 7229 0 36 3841 8923 0 0 3973 0,475129627 1‐ predicted RNA 1955 32 3 1766 2904 8 2 2194 0,524222098 1rpoB MAP4130 26561 83844 82919 711 25832 94246 73930 658 0,496158476 1‐ predicted RNA 5767 118 402 1423 4283 288 174 895 0,591668507 1

140


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 2152 30 0 1889 2516 10 0 1849 0,498580633 1‐ predicted RNA 3499 36 36 1187 3365 36 66 963 0,510241726 1‐ predicted RNA 749 35 0 1293 624 0 0 892 0,330281027 1rpoC MAP4131 29066 86436 79265 664 30900 91898 63879 601 0,500212481 1‐ predicted RNA 1120 0 0 1449 1317 0 0 1431 0,486876435 1‐ predicted RNA 2424 19 0 2184 2999 0 33 2273 0,506804407 1‐ predicted RNA 784 0 76 1378 501 0 38 738 0,174929452 1‐ predicted RNA 1684 0 0 1513 1080 0 17 820 0,499998623 1‐ predicted RNA 1318 0 12 1336 1163 0 29 997 0,647254669 1‐ predicted RNA 4445 0 0 3060 3619 0 0 2091 0,528387594 1end MAP4132 880 5387 4707 173 826 6208 3843 159 0,49506659 1fadE8 MAP4133 1324 9208 7207 130 2027 5324 4950 98 0,507247466 1echA4 MAP4134 421 1009 632 32 437 930 684 29 0,496808126 1‐ MAP4135 130 403 316 15 105 145 394 11 0,238841605 1echA5 MAP4136 699 499 283 39 572 174 429 28 0,820501701 1‐ MAP4137c 1168 7404 5579 347 1613 7726 5681 362 0,47719991 1‐ MAP4138c 3238 7684 6698 663 3219 8588 7285 649 0,48120591 1‐ predicted RNA 1644 43 43 1502 3043 9 0 2298 0,537481326 1‐ MAP4139 612 469 712 50 549 629 845 47 0,494647012 1‐ predicted RNA 6838 7781 26458 4315 5297 17593 24276 4230 0,503205555 1rpsL MAP4140 8070 33501 37901 2644 6853 49124 48113 3097 0,454853775 1rpsG MAP4141 18142 39958 42065 3024 14894 46914 45453 2825 0,514682657 1fusA MAP4142 42737 101890 130478 1790 38821 138810 137507 1817 0,502282786 1‐ predicted RNA 11608 39131 63875 10759 10484 70431 66041 12318 0,524115035 1tuf MAP4143 20376 60022 54696 1532 16992 71742 51964 1413 0,489851599 1‐ MAP4144 225 3630 1092 86 337 1730 1269 62 0,655477182 1‐ MAP4145 2923 59942 31425 1185 5236 53080 36267 1204 0,476416916 1‐ predicted RNA 0 6137 3242 4459 27 6250 4462 5070 0,525431553 1‐ predicted RNA 6313 78 184 3044 5399 240 77 2201 0,509250835 1‐ predicted RNA 821 47 0 1350 690 39 0 954 0,556553073 1‐ predicted RNA 8141 166 204 1805 7360 81 344 1381 0,510054656 1‐ predicted RNA 8252 71 196 4818 6041 97 36 2953 0,544729944 1‐ predicted RNA 3177 70 229 2523 1826 114 236 1267 0,779983575 1‐ predicted RNA 8772 20 35 6183 6459 32 34 3828 0,538231148 1

141


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 3990 53 63 1692 3893 117 36 1392 0,50071555 1‐ predicted RNA 6934 133 86 1842 7070 61 89 1573 0,495783967 1‐ predicted RNA 28897 530 841 2681 24088 1245 820 1905 0,552466837 1‐ predicted RNA 3505 45 72 3098 2744 30 12 2025 0,54020881 1‐ predicted RNA 3648 72 36 2247 3254 40 20 1678 0,521212803 1fabG MAP4146 611 5529 3346 131 1218 5135 3888 147 0,524164971 1‐ MAP4147 801 2579 1594 56 891 2729 1517 54 0,497810362 1‐ MAP4148c 318 1144 1318 42 566 989 807 40 0,490888209 1‐ MAP4149 180 560 188 15 160 381 242 12 0,344002878 1‐ MAP4150c 47 140 73 3 92 138 261 6 0,069811996 1‐ MAP4151c 344 418 160 26 423 286 297 27 0,733706191 1‐ predicted RNA 2267 20065 7853 6599 4295 10955 4947 5098 0,507768957 1‐ MAP4152 1744 4407 2798 390 2916 2862 1211 358 0,495183183 1pqqE MAP4153 2322 7589 8014 192 4326 5842 2618 163 0,496857355 1lldD1 MAP4154 2195 13271 12521 281 5328 10361 6873 265 0,489684219 1‐ MAP4155 504 3220 1767 90 951 2526 1234 85 0,499503038 1‐ MAP4156 431 1899 1734 77 903 1199 1140 73 0,49034456 1‐ MAP4157 471 5957 4823 165 719 4496 3710 134 0,502975113 1‐ MAP4158 380 185 891 16 411 355 920 17 0,494718254 1‐ MAP4159 251 713 1093 49 36 887 1096 38 0,892711876 1‐ predicted RNA 30474 13627 22711 9206 31096 26447 25687 9239 0,496712171 1‐ predicted RNA 592 0 7 836 1484 18 0 1759 0,142535092 1‐ predicted RNA 34897 355 133 5816 36867 433 200 5167 0,502934483 1rpsJ MAP4160 7297 10644 11578 1513 5467 15483 15405 1498 0,495591548 1‐ predicted RNA 1485 56 29 1358 1677 8 16 1272 0,48820302 1‐ predicted RNA 1916 32 16 1785 2216 0 0 1720 0,497483679 1‐ predicted RNA 4441 143 58 1428 3577 100 199 983 0,527331936 1rplC MAP4161 5665 12334 14684 703 3837 18098 14954 661 0,511414921 1‐ predicted RNA 2285 0 0 2054 1831 35 0 1390 0,556323472 1rplD MAP4162 4676 4676 4784 378 3591 4837 4072 284 0,508567296 1rplW MAP4163 13004 12135 13728 2262 9545 18173 12328 1846 0,530991036 1‐ predicted RNA 12156 70 95 3015 9092 144 213 1913 0,526600437 1rplB MAP4164 10140 10893 12257 670 8699 11823 10226 541 0,534315724 1‐ predicted RNA 1485 0 0 1456 1444 0 0 1188 0,492968032 1

142


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 2784 0 0 2310 2620 0 0 1825 0,525253801 1rpsS MAP4165 5948 12316 15095 1679 4745 15917 12484 1456 0,522506023 1‐ predicted RNA 4452 210 88 2492 3762 129 30 1757 0,517672779 1rplV MAP4166 4102 13707 13242 749 3607 14598 10351 633 0,507882083 1‐ predicted RNA 1062 22 22 1339 889 22 0 936 0,951643187 1rpsC MAP4167 4220 12223 13081 468 2827 15284 10623 394 0,505494404 1rplP MAP4168 4085 14098 13483 990 3946 19283 12500 1005 0,500834735 1rpmC MAP4169 4450 24223 25693 2793 4108 32442 22806 2805 0,497315781 1‐ predicted RNA 3481 12 98 1388 3578 54 18 1193 0,499758472 1rpsQ MAP4170 5975 18278 16269 1536 5100 20597 15210 1391 0,518682051 1‐ predicted RNA 1903 22 112 1750 1802 0 23 1366 0,503166639 1‐ predicted RNA 2628 23 71 2098 2026 85 38 1371 0,539902281 1atsA MAP4171 2362 6003 6432 85 1620 5519 4372 59 0,508752544 1phoS2_3 MAP4172c 108 178 222 6 36 0 156 2 0,003624321 1‐ MAP4173 236 7130 2533 109 461 3609 2312 75 0,535630205 1‐ MAP4174 95 713 559 17 178 258 270 11 0,226425514 1‐ MAP4175 83 99 71 4 36 200 72 3 0,549493964 1‐ MAP4176 252 665 284 11 144 532 298 7 0,29585331 1‐ predicted RNA 3195 1601 2224 2644 2050 1779 2820 1906 0,508257779 1rplN MAP4177 5914 6098 6042 853 4943 7363 5173 699 0,502777582 1‐ predicted RNA 1966 0 33 1777 1282 0 0 967 0,611109377 1‐ predicted RNA 2532 2 0 2156 1688 0 35 1216 0,911388396 1rplX MAP4178 4602 16720 12656 1401 3418 21024 15160 1415 0,499097934 1‐ predicted RNA 2285 26 93 2089 1573 61 50 1217 0,934670774 1rplE MAP4179 8411 15865 18328 1103 6240 22397 20599 1062 0,504755881 1‐ predicted RNA 2090 0 22 1475 1825 36 0 1084 0,507610863 1rpsN MAP4180 5294 18445 22997 3207 3321 27508 22260 3143 0,502542129 1‐ predicted RNA 6209 104 85 3977 4777 324 47 2612 0,532059606 1rpsH MAP4181 4707 7423 7252 756 4087 9887 5784 662 0,494759099 1‐ predicted RNA 1698 0 0 1616 1119 64 0 911 0,64500903 1‐ predicted RNA 1362 0 0 1377 1179 23 0 1007 0,684019037 1rplF MAP4182 6352 13510 14604 912 4827 18162 13780 828 0,518665279 1‐ predicted RNA 4530 0 52 3679 3562 58 0 2432 0,549553275 1rplR MAP4183 6077 12525 12405 1104 4561 14392 10193 898 0,519766487 1

143


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ predicted RNA 3902 24 65 1429 3351 31 24 1028 0,521748449 1rpsE MAP4184 3001 6866 8846 383 2243 7428 5578 280 0,510956571 1rpmD MAP4185 1969 2060 1670 469 1307 1489 1245 290 0,560955565 1rplO MAP4186 6117 7668 7357 795 4976 10400 7262 701 0,49620178 1‐ predicted RNA 2265 34 21 1943 2448 31 0 1757 0,505991867 1‐ MAP4187c 2204 1296 1253 104 1545 1406 1438 76 0,531836187 1sppA MAP4188 613 1334 1164 25 453 1504 909 20 0,514166518 1‐ MAP4189c 496 419 474 27 689 342 306 27 0,496000004 1‐ MAP4190c 180 546 971 23 314 663 482 21 0,693627622 1‐ MAP4191c 180 1335 3020 47 190 1354 1237 29 0,83533213 1adh MAP4192 27 251 480 6 55 315 313 6 0,731112743 1fucA MAP4193c 290 332 386 25 214 309 304 18 0,317986439 1‐ MAP4194c 102 248 400 10 289 285 364 14 0,260332006 1xylB MAP4195 177 1063 586 16 165 643 444 11 0,303176226 1‐ MAP4196 2032 11268 9538 415 1837 8690 8807 338 0,506157064 1‐ MAP4197c 418 251 565 24 694 62 105 22 0,89754129 1‐ predicted RNA 1270 4802 7497 4313 1274 6815 6299 4250 0,484235951 1secY MAP4198 4943 11217 15822 330 6627 13858 12965 338 0,501282985 1adk MAP4199 825 3493 4993 209 1692 3995 3729 225 0,480281197 1map' MAP4200 970 1980 2690 99 1249 3175 3680 128 0,539738543 1sigL MAP4201 488 2264 2192 112 4277 2155 2733 303 0,154826759 1‐ MAP4202 159 1989 1735 60 919 1943 1329 80 0,522615211 1‐ MAP4203 171 688 633 15 864 866 360 28 0,203544879 1‐ MAP4212 72 320 216 15 94 336 322 18 0,269802442 1mmsB MAP4213c 299 1065 976 34 176 677 462 18 0,180736965 1fadE9 MAP4214c 467 2664 2647 59 385 1180 775 25 0,142660394 1mmsA MAP4215c 285 2134 1725 31 167 1158 513 13 0,111152799 1‐ MAP4216 396 1251 1266 26 535 748 1069 23 0,489892788 1‐ MAP4217 216 966 1007 50 297 897 318 36 0,642265438 1‐ MAP4218 0 144 249 5 0 193 108 4 0,312949501 1‐ MAP4219 63 161 226 15 0 36 105 3 6,52E‐05 1‐ MAP4220 330 670 455 23 342 599 374 20 0,624433789 1‐ MAP4221c 445 1653 1349 33 300 1754 1691 32 0,486018939 1atfA_1 MAP4222c 2613 6503 8136 204 2521 8523 9332 216 0,471622623 1

144


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



atfA_2 MAP4223c 1905 22932 12966 374 2235 22033 15748 385 0,502460125 1rmlC MAP4224c 858 3093 2721 143 1207 2690 2115 132 0,507370823 1rmlB MAP4225c 1973 6580 7897 213 1728 9290 8045 220 0,476566398 1‐ MAP4226c 142 1531 535 28 212 978 641 24 0,889277305 1‐ MAP4227c 277 998 744 31 108 774 857 22 0,620862304 1infA MAP4228 8105 22318 20651 3148 7390 31604 25625 3465 0,519842865 1‐ predicted RNA 942 2395 1971 6224 922 2173 2480 6006 0,502061716 1‐ predicted RNA 4421 66 98 3530 3708 36 0 2464 0,521109048 1‐ predicted RNA 6211 174 140 3926 6314 68 88 3329 0,49584111 1rpmJ MAP4229 5711 30345 29122 6929 5027 29547 25425 6003 0,522114586 1‐ predicted RNA 9633 164 377 2885 11322 276 175 2836 0,484508096 1‐ predicted RNA 2093 378 419 1945 2151 301 138 1607 0,512940678 1rpsM MAP4230 5952 23043 16682 1581 4026 25445 20059 1495 0,508815531 1‐ predicted RNA 2361 105 0 1682 2291 62 0 1365 0,51464781 1‐ predicted RNA 2722 204 82 1683 1582 81 120 833 0,488396771 1rpsK MAP4231 3838 13075 11856 905 2656 15211 12180 825 0,499165003 1‐ predicted RNA 1204 65 10 1417 759 51 0 752 0,220878974 1‐ predicted RNA 1002 0 25 1307 755 3 0 821 0,480192097 1rpsD MAP4232 3641 11325 13520 614 3147 13471 13573 589 0,496212375 1rpoA MAP4233 9601 14722 17088 609 6297 22122 19064 557 0,512874072 1‐ predicted RNA 1769 0 0 1683 928 0 0 741 0,144590535 1‐ predicted RNA 1746 0 17 1667 1141 34 0 920 0,597200571 1rplQ MAP4234 2525 7399 7935 424 1734 9620 7356 383 0,492640185 1truA MAP4235 424 479 813 35 509 875 385 34 0,500687309 1‐ MAP4236c 485 449 850 45 428 4083 3364 134 0,052248249 1‐ MAP4237c 4205 9719 6079 338 3061 13132 7711 329 0,481962946 1‐ MAP4238 36 36 70 1 209 114 71 5 8,62E‐04 1‐ MAP4239c 72 0 0 1 0 0 0 0 1 1‐ MAP4240c 36 35 0 1 0 0 0 0 1 1‐ MAP4241 19 72 35 0 72 25 84 0 0,039190016 1‐ MAP4242 36 35 25 1 0 34 80 0 0,248094093 1‐ MAP4243 324 2283 1164 141 463 1326 1300 122 0,487427641 1‐ MAP4244 135 931 548 64 222 605 885 71 0,72336583 1‐ predicted RNA 196 7022 8500 4597 215 6349 4685 3192 0,51277749 1

145


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



rplM MAP4245 3432 12762 8889 741 2253 10418 9176 578 0,508436064 1‐ predicted RNA 1654 0 86 1601 1466 30 0 1179 0,599838017 1rpsI MAP4246 2105 2408 2961 245 1171 2412 2325 158 0,540887491 1glmM MAP4247 511 1850 1894 40 814 1504 1519 39 0,494061207 1‐ MAP4248 72 0 72 9 0 35 36 2 4,47E‐04 1‐ MAP4249 283 89 35 7 443 132 117 10 0,287706558 1‐ MAP4250c 647 2928 2419 71 1412 3073 2316 87 0,528614345 1‐ MAP4251c 875 1698 1309 69 771 1534 1360 59 0,499541297 1‐ MAP4252c 51 76 67 11 36 0 0 3 0,010567915 1glmS MAP4253 2482 6628 10090 134 2272 6675 5899 99 0,509907347 1‐ MAP4254 468 2042 1207 52 493 2264 1576 56 0,514488878 1‐ MAP4255 466 739 522 37 275 572 646 27 0,629014413 1‐ MAP4256 323 649 556 15 137 496 379 8 0,184306039 1gadB MAP4257 1130 3677 3762 80 1453 3762 2686 74 0,491192327 1alr MAP4258 672 3751 2833 75 1276 3072 1986 71 0,50335512 1‐ MAP4259 211 1439 1662 38 351 1614 1113 36 0,48544795 1‐ MAP4260 108 107 234 14 0 429 136 11 0,475680496 1‐ MAP4261 36 134 151 6 0 66 109 2 0,031801085 1rimI MAP4262 144 511 752 37 87 488 765 32 0,406899038 1gcp MAP4263 180 501 482 15 197 634 462 15 0,100273426 1groES MAP4264 568 22870 7309 1041 390 12366 4091 552 0,807439946 1groEL MAP4265 783 9669 3915 98 842 5051 1689 53 0,78202424 1‐ MAP4266 604 3930 6021 80 357 4842 4297 66 0,501999929 1‐ MAP4267 3354 1702 943 371 2729 2073 1619 305 0,501344963 1‐ MAP4268c 2327 33997 13310 1759 2476 23204 11981 1324 0,542178274 1‐ MAP4269c 3070 18435 14859 1077 2600 18577 16420 1036 0,506904536 1‐ MAP4270 4788 26310 30928 1069 4368 51497 37180 1435 0,562567961 1‐ predicted RNA 1254 0 0 1309 1184 0 28 1047 0,520767662 1‐ MAP4271 1842 3568 5344 126 1363 6869 5325 131 0,483298729 1‐ MAP4272c 516 439 386 32 922 3409 1516 94 0,044235148 1whiB3 MAP4273c 323 3326 2257 215 3319 6545 4122 630 0,123621923 1‐ MAP4274 0 0 149 1 0 36 11 0 0,002739168 1sigD MAP4275 2178 6416 4478 301 2342 7809 6446 344 0,465756554 1‐ MAP4276 2135 3462 2428 160 2068 3143 2019 133 0,500020257 1

146


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP4277c 10668 14234 12043 1477 12138 13524 11875 1408 0,506840188 1‐ predicted RNA 9032 210 201 1775 9151 271 431 1531 0,496906908 1guaB2 MAP4278 1937 15941 13399 225 2483 12352 8930 173 0,507514585 1guaB3 MAP4279 1119 1904 1808 65 1122 1396 1468 52 0,514302243 1choD MAP4280 895 6707 4255 454 1313 8796 5672 580 0,531999252 1‐ MAP4281 3586 2215 1069 121 1390 1701 1004 52 0,51539857 1‐ MAP4282 167 484 1222 28 360 657 872 30 0,66597068 1‐ MAP4283 202 464 625 83 323 666 366 88 0,459857364 1ctpA MAP4284 641 1544 2005 25 575 1822 1514 21 0,497898393 1‐ MAP4285 696 881 813 26 797 708 702 23 0,486818948 1‐ MAP4286 935 2601 1620 85 595 1426 1307 51 0,999996761 1‐ MAP4287c 144 206 107 17 96 176 166 13 0,462155458 1lpqP MAP4288 0 214 69 2 12 36 0 0 5,99E‐04 1‐ MAP4289 324 910 262 16 216 394 522 11 0,307767387 1‐ MAP4290 174 215 179 17 105 212 216 12 0,232607186 1‐ MAP4291c 133 481 543 24 290 240 197 20 0,382475844 1‐ MAP4292 0 180 36 2 0 36 36 0 0,029679352 1‐ MAP4293 229 1129 1124 39 494 1088 1451 51 0,607328741 1fadD1_2 MAP4294 544 1245 970 24 264 1034 1243 18 0,658645955 1‐ MAP4295c 251 215 216 19 36 252 266 9 0,07432165 1‐ MAP4296c 108 250 377 23 96 448 372 24 0,597016646 1‐ MAP4297c 102 274 114 6 0 210 91 2 0,012042013 1‐ MAP4298c 324 1224 789 13 144 425 497 5 0,08097879 1‐ MAP4299c 449 1713 1071 31 333 1073 771 20 0,875714172 1‐ MAP4300 70 642 423 12 323 751 425 20 0,282165822 1‐ MAP4301c 175 135 108 19 129 143 86 13 0,262006284 1‐ MAP4302c 180 108 214 7 106 353 390 8 0,479440234 1‐ MAP4303c 108 419 639 7 162 476 552 7 0,93634204 1‐ MAP4304 36 13 71 3 72 36 17 3 0,685904815 1‐ MAP4305 404 1250 1579 45 322 1594 1761 46 0,482771806 1‐ MAP4306 463 1188 1249 33 319 1659 2323 42 0,52134706 1‐ MAP4307 1087 340 551 41 1183 1030 859 47 0,518069334 1‐ MAP4308c 2318 15750 8153 337 3024 10108 5806 255 0,514266883 1‐ predicted RNA 83 4608 7473 3547 548 8593 7279 4803 0,53391605 1

147


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP4309 321 780 1268 94 57 1509 1491 95 0,495066793 1‐ MAP4310c 180 71 72 6 213 142 35 6 0,905445323 1‐ MAP4311c 0 71 107 1 36 72 51 1 0,68931313 1‐ MAP4312 72 428 177 13 162 286 214 15 0,666269263 1‐ MAP4313 77 108 141 4 23 141 35 2 0,028888687 1‐ MAP4314 144 1504 564 14 179 610 351 8 0,204959885 1‐ MAP4315 144 249 229 7 72 323 156 4 0,197263722 1‐ MAP4316 658 3317 2218 202 798 1784 1334 137 0,529661131 1‐ MAP4317c 374 2817 3997 125 532 1635 2480 86 0,52477409 1‐ MAP4318c 853 3891 3159 81 1162 2287 2051 61 0,528881094 1‐ MAP4319 69 12067 6091 481 198 6428 5375 322 0,523379052 1‐ MAP4320 496 14276 12221 99 1359 9882 7982 74 0,51429758 1‐ MAP4321c 1025 2779 2339 20 1678 3295 2682 24 0,534108387 1‐ MAP4322c 36 403 172 19 29 199 267 15 0,54572302 1‐ MAP4323c 539 5113 2961 88 1044 4676 3326 96 0,476963726 1‐ MAP4324c 212 1462 2047 49 393 1402 1780 49 0,484196343 1‐ MAP4325c 290 2152 1495 50 384 1572 1063 39 0,522409801 1‐ MAP4326c 1244 7230 9462 98 2051 7575 7017 93 0,483900601 1‐ MAP4327c 869 3326 2870 166 977 2189 1767 120 0,529299394 1‐ MAP4328c 1206 11723 7803 415 1492 9287 7431 364 0,494798809 1‐ MAP4329c 216 7548 3334 348 427 3890 2240 216 0,54274372 1‐ MAP4330c 94 121 72 2 0 102 308 2 0,672867232 1‐ MAP4331c 36 257 308 13 135 83 254 14 0,848414335 1pcnA MAP4332c 674 1830 2268 44 508 1812 2102 37 0,503912767 1‐ MAP4333 2182 3384 3983 89 1663 4091 4918 83 0,491393033 1‐ MAP4334 1266 1071 1656 92 1165 1740 1435 84 0,502574817 1‐ MAP4335 1156 2510 2803 38 1220 2388 2491 34 0,511137819 1‐ MAP4336 2948 7030 8262 70 2744 7614 7625 63 0,493131109 1‐ predicted RNA 665 0 0 1195 379 0 0 572 0,100026066 1sigM MAP4337 228 212 321 21 161 141 176 12 0,13100154 1‐ MAP4338 108 179 143 9 217 216 107 12 0,076451138 1trxB2 MAP4339 1966 9363 7486 231 2751 10012 6441 233 0,478965635 1trxC MAP4340 577 5024 3918 308 812 4650 2736 266 0,502273216 1cwlM MAP4341 1904 4221 5718 134 1565 4188 3783 100 0,504488868 1

148


Raw Counts ∆furA2

Raw Counts ∆furA3


Raw Counts wt1

Raw Counts wt2

Raw Counts wt3

Expression valuewt



‐ MAP4342c 931 1315 1150 73 631 1107 729 46 0,97432681 1parA MAP4343c 770 3784 3237 97 738 2233 1746 60 0,570759205 1parB MAP4344c 502 1656 2004 48 1105 1599 896 49 0,491505427 1gidB MAP4345c 534 2759 2082 88 950 2462 1503 86 0,4966349 1‐ MAP4346c 1707 2920 3366 203 2268 4260 3259 231 0,523308703 1‐ MAP4347c 3049 7060 8476 242 3910 10850 10272 299 0,545595022 1‐ MAP4348c 368 2175 2214 162 474 2771 3269 212 0,524112642 1rnpA MAP4349c 513 328 737 77 205 382 773 48 0,285924272 1rpmH MAP4350c 1283 701 677 385 1249 771 718 339 0,496571273 1‐ predicted RNA 563 3962 7172 3431 531 7243 6622 3923 0,520573523 1

149

RCN Locus tagRaw Counts Standard Replicate 1

Raw Counts Standard Replicate 2

Expression value Standard

Raw Counts TPEN Replicate 1


Expression valueTPEN

pValue standard/TPEN

qValue standard/TPEN

‐ MAP3047 0 0 0 252 152 16 0,00E+00 0,00E+00‐ MAP3491 883 1014 69 28683 16992 1521 0,00E+00 0,00E+00‐ MAP3626c 406 225 120 22604 3836 3510 0,00E+00 0,00E+00‐ MAP3735c 41 1 2 4493 3474 172 0,00E+00 0,00E+00‐ MAP3736c 3 203 5 5276 2381 197 0,00E+00 0,00E+00‐ MAP3738c 102 203 11 21079 14944 1339 0,00E+00 0,00E+00‐ MAP3739c 51 74 2 18664 12434 540 0,00E+00 0,00E+00‐ predicted RNA 51 24 40 13818 21215 20394 0,00E+00 0,00E+00‐ MAP3740 305 250 1 34407 38380 237 0,00E+00 0,00E+00‐ MAP3741 0 47 1 4464 3563 266 0,00E+00 0,00E+00‐ MAP3747c 1203 1423 62 63416 49215 2571 0,00E+00 0,00E+00‐ MAP3749 351 263 21 59512 46219 3424 0,00E+00 0,00E+00mmpS1 MAP3750 92 125 13 8623 6170 871 0,00E+00 0,00E+00mmpL4_5 MAP3751 1376 2544 37 57298 45184 975 0,00E+00 0,00E+00‐ MAP3762c 306 221 12 12177 7570 427 0,00E+00 0,00E+00papA3_2 MAP3763c 756 604 26 20099 11659 546 0,00E+00 0,00E+00pks2 MAP3764c 1545 1958 16 59818 31839 373 0,00E+00 0,00E+00‐ predicted RNA 66 0 26 10275 8679 6899 0,00E+00 0,00E+00‐ MAP3765 1289 1779 54 60469 26298 1319 0,00E+00 0,00E+00rpsN MAP3768c 51 2 5 6802 4325 970 0,00E+00 0,00E+00rpmG MAP3769c 74 296 61 42279 28932 11707 0,00E+00 0,00E+00‐ MAP3770 278 349 15 83172 59699 3271 0,00E+00 0,00E+00rpmE2 MAP3771 64 91 15 18535 11772 2751 0,00E+00 0,00E+00‐ MAP3772c 153 488 15 41323 40881 2111 0,00E+00 0,00E+00‐ MAP3778 1664 2480 63 68650 52635 1819 0,00E+00 0,00E+00

Table 10: Raw data of RNA-Sequencing MAPwt TPEN/control. (Data were analysed by Rockhopper and sorted by q-value. Genes with a q-value ≤0.01 are differentially expressed. Only genes with raw counts (or no counts) in all replicates were included for further analysis.)

150









‐ MAP3779 650 1455 36 48801 31975 1339 0,00E+00 0,00E+00‐ MAP3780 5001 6241 81 181587 110692 1937 0,00E+00 0,00E+00‐ MAP3782 15744 13767 582 476226 266930 13022 0,00E+00 0,00E+00‐ MAP3784 1966 1610 360 57479 31867 7954 0,00E+00 0,00E+00‐ MAP3785 1528 1582 102 53556 26929 2314 0,00E+00 0,00E+00‐ MAP3787 433 372 16 14099 10664 487 0,00E+00 0,00E+00‐ MAP3788 203 448 25 10873 6586 637 0,00E+00 0,00E+00‐ MAP3781 100 174 25 6305 2920 744 2,42E‐300 3,26E‐298‐ MAP3783 7267 5246 1255 182548 109018 26113 1,43E‐287 1,87E‐285‐ MAP0488c 102 153 8 4860 2734 240 1,08E‐235 1,37E‐233‐ MAP0489c 137 94 7 4822 2296 190 1,72E‐208 2,13E‐206‐ MAP3774c 417 431 26 8423 6665 457 2,46E‐184 2,96E‐182‐ MAP2999 322 600 22 15134 4109 370 2,45E‐178 2,87E‐176‐ MAP3737 0 51 0 912 846 33 9,14E‐169 1,04E‐166‐ MAP3786 681 506 24 14862 6682 369 2,09E‐163 2,33E‐161‐ MAP3773c 289 508 53 9518 5123 897 1,77E‐161 1,93E‐159‐ MAP3776c 792 1856 67 24120 14702 925 2,74E‐159 2,90E‐157‐ MAP3734c 102 305 6 5104 2796 114 3,45E‐128 3,58E‐126‐ MAP3775c 298 412 27 6839 4403 412 5,67E‐115 5,74E‐113‐ MAP3492 1266 2177 41 25027 13738 421 1,11E‐77 1,10E‐75‐ MAP3568c 51 237 17 23 0 0 6,56E‐51 6,36E‐49mbtB MAP2177c 281 225 4 1850 2629 40 2,26E‐35 2,15E‐33‐ predicted RNA 670 862 882 12346 2784 6557 1,18E‐33 1,09E‐31‐ MAP0487c 289 142 14 2852 1743 141 4,61E‐32 4,19E‐30‐ predicted RNA 12081 15373 1839 170636 59365 12563 8,38E‐30 7,47E‐28‐ predicted RNA 11704 13363 13953 2885 1215 1926 9,08E‐30 7,94E‐28‐ MAP3732c 51 146 7 1669 903 92 1,37E‐29 1,17E‐27‐ MAP3766 775 1111 54 11379 4123 369 8,68E‐29 7,29E‐27‐ MAP1977c 89 50 6 978 780 75 2,00E‐24 1,65E‐22‐ MAP1555c 153 247 42 1877 1355 328 2,36E‐19 1,91E‐17

151









‐ MAP2172c 1355 701 48 6586 5437 268 9,33E‐19 7,43E‐17‐ MAP3632 626 757 137 6239 2434 716 7,01E‐15 5,48E‐13‐ MAP0192c 0 51 1 235 303 20 6,40E‐14 4,91E‐12‐ predicted RNA 144 178 774 2406 596 5510 1,06E‐13 8,03E‐12‐ predicted RNA 311 548 740 1722 2312 3816 4,04E‐12 3,00E‐10‐ MAP2176c 102 51 5 469 725 50 8,96E‐12 6,55E‐10‐ MAP3761c 406 529 36 3536 1711 181 9,29E‐12 6,68E‐10lpqA MAP3056 120 221 15 51 0 1 3,11E‐11 2,20E‐09pgsA2 MAP1535 458 203 30 102 0 2 3,51E‐11 2,44E‐09‐ MAP3733c 153 345 22 1665 1225 127 3,65E‐11 2,50E‐09mbtC MAP2175c 124 492 12 1141 1741 69 3,93E‐11 2,65E‐09trpE2 MAP2205c 540 588 24 2512 2522 109 1,54E‐10 1,02E‐08PE_5 MAP1514 0 349 31 51 0 2 2,17E‐10 1,42E‐08‐ MAP3731c 813 1023 35 4574 3342 144 7,88E‐10 5,09E‐08mbtE MAP2173c 3969 3399 40 14566 16134 174 5,44E‐09 3,46E‐07‐ MAP2414c 203 396 6 1119 1465 30 2,06E‐08 1,29E‐06‐ MAP3760c 638 676 98 4214 1927 394 2,70E‐08 1,67E‐06fadD33_2 MAP1554c 1510 1832 61 6478 5754 224 3,98E‐08 2,43E‐06pstB MAP0574 0 51 2 398 133 18 1,66E‐07 9,98E‐06mbtD MAP2174c 323 487 7 1501 1686 31 1,67E‐07 9,98E‐06fadD28 MAP3752 2265 2211 75 12119 5650 255 9,72E‐07 5,70E‐05‐ MAP4069c 50 25 2 508 203 19 1,00E‐06 5,81E‐05‐ predicted RNA 5110 4376 5449 20546 15224 19358 1,22E‐06 6,97E‐05fadE14 MAP1553c 8382 7917 407 35794 30675 1622 1,76E‐06 9,95E‐05IS1110 MAP3748c 153 397 12 1160 1073 53 2,19E‐06 1,22E‐04‐ MAP2138 346 320 45 152 6 6 6,14E‐06 3,38E‐04citE MAP2310c 141 581 24 204 0 4 5,32E‐05 2,89E‐03‐ MAP2412c 51 77 3 220 386 18 8,03E‐05 4,31E‐03‐ MAP4065 397 506 19 2684 865 60 8,32E‐05 4,41E‐03 Threshold‐ predicted RNA 1027 2268 2902 4332 4043 7590 2,04E‐04 1,07E‐02

152









‐ MAP1594c 32 75 16 297 264 86 3,16E‐04 1,64E‐02‐ MAP1087 0 50 3 255 102 19 3,54E‐04 1,81E‐02‐ MAP1660 51 102 5 355 355 24 4,81E‐04 2,44E‐02ispF MAP0477 153 138 17 57 7 2 5,62E‐04 2,80E‐02‐ MAP3730 1950 2668 209 7113 5150 532 5,60E‐04 2,80E‐02‐ MAP2413c 252 275 8 682 902 28 5,92E‐04 2,90E‐02‐ MAP4158 290 634 18 224 51 4 6,72E‐04 3,26E‐02bfrA MAP1595 5624 7080 762 5627 1166 302 6,96E‐04 3,33E‐02pcaG MAP2730c 271 156 22 122 0 3 7,54E‐04 3,57E‐02guaA MAP3489c 832 1303 38 4218 1955 97 7,83E‐04 3,67E‐02‐ MAP1006 222 278 18 69 36 3 1,03E‐03 4,76E‐02furB MAP2139 458 693 80 140 145 20 1,21E‐03 5,54E‐02‐ MAP3950c 435 727 107 302 106 31 1,22E‐03 5,55E‐02‐ MAP0396 120 276 23 945 477 75 1,57E‐03 7,06E‐02‐ MAP1520 152 101 22 0 29 3 1,67E‐03 7,42E‐02‐ MAP3557 0 140 9 362 251 43 1,77E‐03 7,80E‐02‐ MAP3870 558 702 56 357 103 16 2,22E‐03 9,71E‐02‐ MAP0075 174 67 17 746 324 62 2,27E‐03 9,82E‐02tmk MAP3361c 331 334 30 270 0 7 2,61E‐03 1,12E‐01ilvD MAP3631c 963 660 27 3632 1207 65 2,77E‐03 1,18E‐01‐ MAP4174 51 51 3 274 215 15 2,82E‐03 1,19E‐01‐ MAP3103c 641 1038 179 3189 1379 420 2,86E‐03 1,19E‐01‐ MAP1596 521 1167 22 910 0 7 3,01E‐03 1,24E‐01‐ MAP1785 351 336 16 1414 707 44 3,34E‐03 1,36E‐01lprE MAP2522 255 374 29 253 0 7 3,33E‐03 1,36E‐01‐ MAP0355 206 133 25 102 0 4 3,68E‐03 1,48E‐01‐ MAP3261c 253 101 13 1651 101 39 3,74E‐03 1,49E‐01lppW MAP2973 352 695 30 359 51 8 3,80E‐03 1,50E‐01‐ MAP3180 287 205 27 116 31 6 3,90E‐03 1,52E‐01cysQ_1 MAP1877c 193 98 10 920 297 35 4,27E‐03 1,65E‐01

153









‐ MAP0661c 1290 1471 195 718 407 71 4,42E‐03 1,70E‐01ppiA MAP0011 2882 3651 342 2689 855 148 5,02E‐03 1,91E‐01‐ MAP2707c 309 520 73 383 0 20 5,31E‐03 2,00E‐01echA21 MAP0249c 961 680 58 505 203 20 5,38E‐03 2,01E‐01‐ MAP3627 914 1518 105 5139 1465 228 6,07E‐03 2,25E‐01pabA MAP0015 783 671 62 609 102 21 6,13E‐03 2,26E‐01argF MAP1365 1115 1052 67 762 255 25 6,19E‐03 2,26E‐01‐ MAP0676 408 291 19 203 51 5 6,38E‐03 2,31E‐01‐ MAP3269 203 250 17 51 51 4 6,90E‐03 2,48E‐01‐ MAP3383 1344 1431 285 1113 302 112 8,41E‐03 3,00E‐01fadE26_1 MAP0559c 357 478 20 251 67 6 8,52E‐03 3,01E‐01‐ MAP3753 2888 4989 165 9441 7659 355 8,71E‐03 3,06E‐01‐ MAP3902c 624 970 87 500 199 32 9,24E‐03 3,22E‐01‐ MAP1708 179 254 18 169 0 4 9,35E‐03 3,23E‐01‐ MAP2430 395 356 15 255 51 4 9,63E‐03 3,30E‐01‐ MAP3515c 99 26 6 213 261 23 9,75E‐03 3,32E‐01‐ MAP2065 592 671 27 255 204 9 1,03E‐02 3,48E‐01‐ MAP1763c 149 283 14 47 50 3 1,05E‐02 3,50E‐01‐ MAP3891 354 252 28 279 51 10 1,06E‐02 3,50E‐01‐ MAP4151c 254 242 22 101 50 6 1,04E‐02 3,50E‐01‐ MAP1450c 191 204 7 704 442 18 1,11E‐02 3,63E‐01‐ MAP3227c 292 194 10 1258 356 25 1,12E‐02 3,65E‐01‐ MAP2109c 3 53 3 212 93 18 1,14E‐02 3,69E‐01‐ MAP2474c 430 658 66 510 43 22 1,26E‐02 4,03E‐01‐ MAP1386c 56 54 4 487 96 16 1,29E‐02 4,10E‐01‐ MAP1443c 356 140 25 115 51 7 1,31E‐02 4,13E‐01‐ MAP3479c 183 351 17 243 0 4 1,32E‐02 4,14E‐01‐ MAP1673c 329 321 18 326 0 5 1,34E‐02 4,18E‐01‐ MAP0191c 151 153 7 342 459 20 1,37E‐02 4,23E‐01‐ MAP0179c 638 1400 89 640 294 36 1,39E‐02 4,27E‐01

154









‐ MAP2634c 226 352 25 152 50 7 1,40E‐02 4,27E‐01‐ MAP1192 526 606 94 1864 885 197 1,44E‐02 4,35E‐01‐ MAP1434 602 552 30 712 0 10 1,53E‐02 4,61E‐01‐ MAP1697 205 100 23 718 304 65 1,60E‐02 4,80E‐01‐ MAP4021 220 100 15 121 0 3 1,64E‐02 4,87E‐01‐ MAP2073c 254 305 22 151 51 6 1,75E‐02 5,14E‐01fadB4 MAP3190 871 1059 57 852 203 23 1,76E‐02 5,14E‐01nuoK MAP3211 1928 2054 385 1885 527 181 1,74E‐02 5,14E‐01‐ predicted RNA 2592 2319 5319 2441 614 2499 1,79E‐02 5,19E‐01‐ MAP1015 166 128 19 1025 146 53 1,82E‐02 5,24E‐01‐ MAP2365 138 254 9 659 401 22 1,84E‐02 5,25E‐01‐ predicted RNA 5237 8408 7635 6052 2006 3675 1,87E‐02 5,32E‐01upp MAP3431c 153 149 11 1019 153 30 1,88E‐02 5,32E‐01‐ MAP2248c 245 311 16 65 87 4 1,92E‐02 5,37E‐01fadE28 MAP0523 228 188 11 915 337 27 1,95E‐02 5,43E‐01argD MAP1364 1120 2406 80 1634 427 37 1,95E‐02 5,43E‐01‐ MAP2032c 184 214 18 51 50 4 1,95E‐02 5,43E‐01‐ MAP3799 456 254 17 405 0 5 1,99E‐02 5,44E‐01‐ MAP1005 498 457 35 335 98 12 2,04E‐02 5,54E‐01‐ MAP3421c 559 280 61 375 51 20 2,04E‐02 5,54E‐01‐ MAP0118 203 381 44 169 51 13 2,07E‐02 5,54E‐01‐ MAP2063c 51 0 4 306 51 19 2,15E‐02 5,73E‐01‐ MAP1675 221 279 57 1492 188 132 2,24E‐02 5,95E‐01‐ MAP0258 2871 1008 753 2436 356 363 2,29E‐02 6,03E‐01‐ MAP1461 118 189 20 0 46 4 2,32E‐02 6,06E‐01‐ MAP1924c 1022 910 141 1018 159 60 2,31E‐02 6,06E‐01‐ MAP0973 219 528 24 1342 539 53 2,38E‐02 6,13E‐01lipG MAP4118c 2070 3841 184 2388 1012 91 2,37E‐02 6,13E‐01‐ MAP3934c 255 418 36 1207 509 80 2,43E‐02 6,22E‐01echA16_2 MAP2904 242 253 19 253 0 5 2,48E‐02 6,30E‐01

155









mraY MAP1900c 364 736 28 534 64 10 2,51E‐02 6,36E‐01‐ MAP4209 83 51 6 405 154 20 2,51E‐02 6,36E‐01‐ MAP4203 245 138 9 865 296 21 2,60E‐02 6,50E‐01‐ MAP3420c 946 864 46 2417 1394 87 2,66E‐02 6,63E‐01ltp1 MAP2897c 3056 1718 119 3144 383 58 2,69E‐02 6,66E‐01papA2 MAP1694 264 551 15 1185 672 31 2,73E‐02 6,72E‐01‐ MAP0721c 477 800 68 1349 1153 133 2,77E‐02 6,79E‐01‐ MAP3743 102 152 6 281 356 18 2,84E‐02 6,92E‐01‐ MAP0238c 237 102 11 703 304 27 2,96E‐02 7,17E‐01‐ MAP0751c 1295 1855 101 1244 506 47 3,00E‐02 7,22E‐01‐ MAP0337 533 282 24 301 91 8 3,15E‐02 7,43E‐01‐ MAP1558c 31 551 16 696 436 31 3,15E‐02 7,43E‐01‐ MAP2165 84 40 6 420 121 20 3,10E‐02 7,43E‐01‐ predicted RNA 19024 13389 4624 45831 17413 7305 3,11E‐02 7,43E‐01‐ MAP3460c 554 857 29 758 102 12 3,11E‐02 7,43E‐01‐ MAP2762c 153 80 15 88 0 3 3,20E‐02 7,47E‐01‐ MAP1409c 1094 1020 87 1026 231 38 3,22E‐02 7,48E‐01‐ MAP1187 5249 6944 242 15910 8489 432 3,25E‐02 7,50E‐01‐ MAP1440c 11 303 16 509 302 41 3,29E‐02 7,56E‐01‐ MAP0382c 583 341 42 1608 624 82 3,39E‐02 7,75E‐01‐ MAP2795 818 682 51 767 153 23 3,43E‐02 7,80E‐01‐ predicted RNA 3688 1755 3547 9603 3004 6304 3,43E‐02 7,80E‐01‐ MAP2241c 295 747 38 377 121 15 3,47E‐02 7,82E‐01‐ MAP1009 288 198 30 174 40 9 3,57E‐02 8,00E‐01‐ MAP1252c 152 253 15 204 0 4 3,64E‐02 8,12E‐01‐ MAP1219c 28 97 7 224 178 23 3,73E‐02 8,13E‐01‐ MAP1593 1001 1011 78 1022 207 34 3,67E‐02 8,13E‐01‐ MAP1677 539 1399 65 672 309 29 3,75E‐02 8,13E‐01trpD MAP1931c 153 186 8 493 355 21 3,70E‐02 8,13E‐01‐ MAP2125 106 242 8 793 232 20 3,69E‐02 8,13E‐01

156









‐ MAP2778c 100 254 14 496 357 34 3,78E‐02 8,13E‐01adhD MAP3502 387 226 15 264 48 5 3,70E‐02 8,13E‐01‐ MAP3978 757 1307 45 4577 658 82 3,72E‐02 8,13E‐01‐ MAP3108c 93 255 14 152 0 3 3,86E‐02 8,22E‐01‐ MAP3039c 444 828 78 324 239 33 3,89E‐02 8,26E‐01‐ MAP0817c 130 102 14 89 0 3 3,92E‐02 8,28E‐01‐ MAP1321c 203 200 26 410 456 59 3,93E‐02 8,28E‐01xerD MAP1408 1731 3091 145 1817 935 74 3,94E‐02 8,28E‐01‐ MAP0485c 263 378 20 391 0 7 4,01E‐02 8,35E‐01‐ MAP1601 2092 1703 86 1641 687 44 4,01E‐02 8,35E‐01nrdE MAP3100c 17433 23660 541 46900 24014 828 4,06E‐02 8,38E‐01gpsA MAP3020c 102 102 5 457 204 16 4,11E‐02 8,44E‐01‐ MAP3951c 504 248 11 1500 454 21 4,25E‐02 8,69E‐01‐ MAP2077c 153 122 24 56 24 5 4,28E‐02 8,71E‐01‐ MAP0818c 184 141 34 153 0 9 4,36E‐02 8,83E‐01‐ MAP3790 201 221 15 691 347 33 4,44E‐02 8,95E‐01hpx MAP3229c 212 63 8 560 253 21 4,48E‐02 8,99E‐01fabG3_1 MAP1739c 218 197 15 841 278 33 4,57E‐02 9,13E‐01fadE2 MAP3570c 1605 803 58 1248 306 27 4,61E‐02 9,16E‐01‐ MAP3696 147 304 26 575 409 55 4,66E‐02 9,24E‐01‐ MAP1494 486 977 73 989 51 34 4,69E‐02 9,25E‐01‐ predicted RNA 3461 5154 5032 3537 1918 2870 4,78E‐02 9,33E‐01‐ MAP3129 91 426 33 671 428 68 4,78E‐02 9,33E‐01mmpS2 MAP3130 49 222 16 101 0 3 4,76E‐02 9,33E‐01entD MAP3315 354 305 29 304 51 11 4,78E‐02 9,33E‐01‐ MAP0844 404 285 107 310 61 41 4,94E‐02 9,53E‐01‐ MAP3812c 152 370 17 923 334 36 5,08E‐02 9,76E‐01‐ MAP1053 574 479 24 470 126 10 5,10E‐02 9,76E‐01‐ predicted RNA 4988 4655 4139 12382 5787 6672 5,36E‐02 9,98E‐01‐ MAP0600c 101 443 12 511 509 24 5,43E‐02 9,98E‐01

157









metB MAP1026 408 707 27 761 20 11 5,35E‐02 9,98E‐01‐ MAP1446c 736 598 46 507 227 21 5,25E‐02 9,98E‐01‐ MAP1635c 202 657 38 203 153 15 5,42E‐02 9,98E‐01‐ MAP2095c 152 292 14 126 51 4 5,24E‐02 9,98E‐01‐ MAP2249c 156 253 25 103 51 8 5,42E‐02 9,98E‐01‐ MAP2339c 450 616 69 406 151 30 5,29E‐02 9,98E‐01‐ MAP2764c 51 51 6 253 126 21 5,39E‐02 9,98E‐01nrdI MAP3101c 3403 3913 467 10793 4324 806 5,30E‐02 9,98E‐01‐ MAP3754 5041 6888 1523 14006 7486 2455 5,33E‐02 9,98E‐01‐ MAP4138c 3309 5150 639 4541 1481 369 5,27E‐02 9,98E‐01dnaA MAP0001 1872 2401 80 2959 1979 87 7,99E‐01 1,00E+00‐ predicted RNA 9125 8802 6452 13368 6224 6035 8,65E‐01 1,00E+00dnaN MAP0002 5342 5396 260 7912 2743 208 6,94E‐01 1,00E+00recF MAP0003 1192 1919 76 2907 1030 80 7,43E‐01 1,00E+00‐ MAP0004 654 985 93 1163 356 69 5,57E‐01 1,00E+00gyrB MAP0005 33766 41298 1065 55454 22383 926 3,13E‐01 1,00E+00gyrA MAP0006 13731 16385 345 25941 8312 314 4,19E‐01 1,00E+00‐ MAP0007 4156 6167 346 6948 3627 317 9,63E‐01 1,00E+00‐ MAP0008c 233 550 38 251 301 29 6,13E‐01 1,00E+00‐ MAP0009 153 0 3 449 0 5 6,09E‐01 1,00E+00‐ MAP0010c 120 100 14 220 76 15 6,87E‐01 1,00E+00‐ MAP0012c 502 388 61 632 288 53 8,82E‐01 1,00E+00‐ MAP0013c 853 819 172 1086 436 130 5,79E‐01 1,00E+00‐ MAP0014 370 435 31 571 152 21 4,62E‐01 1,00E+00pknB MAP0016c 4224 4644 136 5652 2056 97 3,51E‐01 1,00E+00‐ MAP0017c 549 424 56 893 379 61 6,41E‐01 1,00E+00pknA MAP0018c 1526 2146 138 2993 802 111 5,92E‐01 1,00E+00pbpA MAP0019c 3999 5193 178 6289 2590 145 6,81E‐01 1,00E+00rodA MAP0020c 1265 2259 71 2171 1214 62 8,06E‐01 1,00E+00ppp MAP0021c 3323 4699 153 6270 1578 115 3,84E‐01 1,00E+00

158









‐ MAP0022c 1397 1626 186 2162 656 137 4,79E‐01 1,00E+00‐ MAP0023c 8283 10649 333 13885 5626 289 9,81E‐01 1,00E+00‐ MAP0024c 0 51 2 51 0 1 5,64E‐01 1,00E+00‐ MAP0025 172 255 46 385 173 52 6,64E‐01 1,00E+00fadD33_1 MAP0026 767 862 30 1578 646 34 6,04E‐01 1,00E+00‐ MAP0027 2353 3671 90 5760 1840 92 8,48E‐01 1,00E+00‐ MAP0028c 346 545 20 1333 587 38 5,69E‐02 1,00E+00‐ MAP0029c 1928 2012 91 4999 1156 107 6,18E‐01 1,00E+00‐ MAP0030c 2097 625 251 3209 781 265 7,19E‐01 1,00E+00‐ MAP0031c 2181 1006 96 3306 665 85 8,23E‐01 1,00E+00fadE25_1 MAP0032c 1276 552 39 2702 796 57 2,10E‐01 1,00E+00‐ MAP0033c 94 18 8 176 82 15 5,60E‐01 1,00E+00‐ MAP0034 445 862 30 861 294 22 5,59E‐01 1,00E+00‐ MAP0035 2486 2776 193 4404 1636 182 8,73E‐01 1,00E+00‐ MAP0036 155 179 11 188 204 14 4,98E‐01 1,00E+00‐ MAP0037 675 439 90 866 331 78 9,10E‐01 1,00E+00‐ MAP0038 1332 1526 56 1462 718 37 2,97E‐01 1,00E+00‐ MAP0039 703 672 126 530 259 62 7,58E‐02 1,00E+00‐ MAP0040 101 382 42 270 79 25 2,71E‐01 1,00E+00‐ MAP0041 1313 1643 52 2051 746 40 5,87E‐01 1,00E+00‐ MAP0042 1118 834 177 1541 485 144 6,66E‐01 1,00E+00‐ MAP0043c 301 539 30 786 90 22 5,19E‐01 1,00E+00‐ MAP0044c 456 479 21 1452 151 24 5,47E‐01 1,00E+00‐ MAP0045 666 736 67 1646 407 74 6,65E‐01 1,00E+00‐ MAP0046c 359 827 97 841 84 52 1,47E‐01 1,00E+00‐ MAP0047c 2778 2795 132 4079 2082 128 9,37E‐01 1,00E+00leuS MAP0048 3455 4724 80 6635 1963 67 6,72E‐01 1,00E+00‐ MAP0049c 599 629 53 637 357 38 5,42E‐01 1,00E+00‐ MAP0050c 1197 1461 139 2676 894 151 6,73E‐01 1,00E+00gluA MAP0051c 408 275 27 459 151 18 4,83E‐01 1,00E+00

159









glnQ MAP0052c 490 755 20 795 692 24 5,21E‐01 1,00E+00‐ MAP0053c 1494 1830 129 2215 779 95 4,45E‐01 1,00E+00‐ MAP0054c 1073 2303 120 2036 501 70 1,35E‐01 1,00E+00‐ MAP0055c 633 996 50 986 457 39 6,30E‐01 1,00E+00‐ MAP0056c 51 283 7 0 0 0 1,00E+00 1,00E+00‐ MAP0057c 0 19 0 51 0 1 5,45E‐01 1,00E+00‐ MAP0058c 352 407 19 656 50 11 2,93E‐01 1,00E+00‐ MAP0059c 152 406 13 451 150 12 9,05E‐01 1,00E+00‐ MAP0060c 16528 14902 830 35446 12012 1001 1,03E‐01 1,00E+00‐ MAP0061c 5786 7210 690 10616 4879 710 7,90E‐01 1,00E+00‐ MAP0062c 441 705 36 458 243 20 1,69E‐01 1,00E+00‐ MAP0063 2158 2812 343 5154 1684 380 7,13E‐01 1,00E+00ponA_1 MAP0064 9661 16506 282 17198 9662 264 4,69E‐01 1,00E+00‐ MAP0065 858 1633 43 2094 501 34 6,49E‐01 1,00E+00‐ MAP0066 367 522 39 686 223 32 7,50E‐01 1,00E+00rpsF MAP0067 1463 1465 292 2707 992 301 7,81E‐01 1,00E+00ssb MAP0068 2031 2053 234 2390 779 144 1,56E‐01 1,00E+00rpsR MAP0069 4033 5986 1124 5927 1785 690 1,52E‐01 1,00E+00rplI MAP0070 938 1279 138 1855 708 133 9,44E‐01 1,00E+00dnaB MAP0071 7462 13249 223 10512 7086 181 8,46E‐01 1,00E+00‐ MAP0072c 54196 64901 3874 80978 35749 3242 3,06E‐01 1,00E+00‐ MAP0073c 14018 17558 1124 22202 8676 916 6,19E‐01 1,00E+00‐ MAP0074 0 3 0 49 0 1 2,23E‐21 1,00E+00mmpL4_1 MAP0076 433 710 11 1366 531 15 2,76E‐01 1,00E+00‐ MAP0077 504 461 25 690 505 29 5,22E‐01 1,00E+00‐ MAP0078 333 642 100 538 339 84 8,37E‐01 1,00E+00‐ MAP0079 355 1127 55 1126 485 53 9,47E‐01 1,00E+00‐ MAP0080c 0 0 0 0 50 3 0,00E+00 1,00E+00‐ MAP0081 1071 2349 73 2190 1132 64 8,12E‐01 1,00E+00‐ predicted RNA 7004 3027 5916 10699 2533 5669 9,41E‐01 1,00E+00

160









‐ MAP0082 424 179 26 578 51 17 4,18E‐01 1,00E+00‐ MAP0083c 284 521 51 458 100 27 1,63E‐01 1,00E+00‐ MAP0084c 683 934 53 1155 416 42 6,93E‐01 1,00E+00LysR MAP0085c 69 0 2 0 0 0 1,00E+00 1,00E+00‐ MAP0086 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP0087 196 51 10 102 51 5 2,55E‐01 1,00E+00‐ MAP0088 165 279 28 503 102 29 8,42E‐01 1,00E+00‐ MAP0089 246 608 41 762 277 42 8,09E‐01 1,00E+00‐ MAP0090c 165 245 18 220 288 24 3,98E‐01 1,00E+00‐ MAP0091c 284 263 23 141 93 9 6,54E‐02 1,00E+00‐ MAP0092 51 0 1 0 36 1 4,82E‐01 1,00E+00‐ MAP0093 4 179 9 182 49 9 5,03E‐01 1,00E+00‐ MAP0094 51 49 10 0 0 0 1,00E+00 1,00E+00nuoI_1 MAP0095c 857 603 81 2095 376 97 5,28E‐01 1,00E+00‐ MAP0096c 305 247 48 493 187 48 8,99E‐01 1,00E+00‐ MAP0097c 324 771 52 561 462 49 9,22E‐01 1,00E+00‐ MAP0098c 1345 1922 121 2008 568 75 1,99E‐01 1,00E+00‐ predicted RNA 3490 3640 4818 2829 2687 3734 3,79E‐01 1,00E+00‐ MAP0099 2855 4214 1163 4819 2906 1171 8,67E‐01 1,00E+00‐ MAP0100 506 962 83 980 357 63 6,21E‐01 1,00E+00‐ MAP0101 109 198 13 175 44 7 2,64E‐01 1,00E+00‐ predicted RNA 8719 13649 11618 13506 7606 9978 9,59E‐01 1,00E+00‐ MAP0102 3191 4400 432 6606 2787 455 7,70E‐01 1,00E+00‐ MAP0103c 24240 26648 2672 40602 14214 2335 2,87E‐01 1,00E+00‐ predicted RNA 884 1445 3906 1569 1063 4190 7,11E‐01 1,00E+00‐ predicted RNA 49973 55033 13590 70397 37065 12290 2,78E‐01 1,00E+00‐ MAP0104 841 1239 48 1284 697 41 7,69E‐01 1,00E+00‐ predicted RNA 15740 13528 10992 24265 8206 9723 4,75E‐01 1,00E+00‐ MAP0105c 1201 1715 31 1978 1217 31 8,28E‐01 1,00E+00‐ MAP0106c 3017 4598 211 5047 2232 174 5,94E‐01 1,00E+00

161









‐ MAP0107 255 441 55 407 101 31 2,30E‐01 1,00E+00‐ MAP0108 55 403 8 251 47 4 1,63E‐01 1,00E+00mce1B MAP0109 152 356 13 102 51 3 1,36E‐02 1,00E+00‐ MAP0110 50 144 5 0 0 0 1,00E+00 1,00E+00‐ MAP0111 50 249 7 241 35 5 3,48E‐01 1,00E+00‐ MAP0112 50 0 1 87 65 3 8,35E‐01 1,00E+00‐ MAP0113 153 93 5 196 100 6 4,55E‐01 1,00E+00‐ MAP0114 287 251 26 353 102 17 4,12E‐01 1,00E+00‐ MAP0115 0 87 2 86 0 1 5,84E‐01 1,00E+00‐ MAP0116 386 812 25 1016 294 22 9,24E‐01 1,00E+00‐ MAP0117 322 457 99 531 153 68 4,59E‐01 1,00E+00‐ predicted RNA 6554 4114 4458 17486 3624 6352 9,57E‐02 1,00E+00‐ MAP0119c 140 51 7 247 45 7 5,01E‐01 1,00E+00‐ MAP0120c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP0121 0 0 0 0 51 3 0,00E+00 1,00E+00PE_1 MAP0122 0 0 0 0 51 6 0,00E+00 1,00E+00‐ MAP0123 51 51 3 0 0 0 1,00E+00 1,00E+00‐ MAP0124 58 67 5 0 0 0 1,00E+00 1,00E+00‐ MAP0125c 0 51 1 0 0 0 1,00E+00 1,00E+00‐ MAP0126 503 344 59 1005 202 60 7,89E‐01 1,00E+00‐ MAP0127 103 50 2 102 151 5 4,07E‐01 1,00E+00‐ MAP0128c 124 0 4 153 50 5 5,15E‐01 1,00E+00‐ MAP0129 398 444 23 405 252 16 5,06E‐01 1,00E+00‐ MAP0130 3848 1108 328 7040 1015 355 7,56E‐01 1,00E+00‐ MAP0131c 422 196 13 1326 241 24 9,72E‐02 1,00E+00phoY2_1 MAP0132c 20 26 2 82 0 2 5,01E‐01 1,00E+00‐ MAP0133c 778 540 25 1307 255 21 8,21E‐01 1,00E+00‐ MAP0134c 340 717 53 790 81 30 2,16E‐01 1,00E+00cmaA1 MAP0135 3231 4383 247 5552 1882 196 4,82E‐01 1,00E+00‐ MAP0136 400 633 69 883 470 82 5,08E‐01 1,00E+00

162









‐ MAP0137c 51 145 20 184 0 11 8,22E‐01 1,00E+00‐ MAP0138c 47 383 13 332 255 18 3,51E‐01 1,00E+00‐ MAP0139c 179 201 17 97 152 12 5,35E‐01 1,00E+00‐ MAP0140 562 815 93 1004 546 94 8,37E‐01 1,00E+00‐ MAP0141 1056 559 46 1457 610 48 7,97E‐01 1,00E+00‐ MAP0142c 102 0 2 148 49 3 5,37E‐01 1,00E+00‐ MAP0143 14615 5007 1870 31435 4721 2314 1,70E‐01 1,00E+00‐ MAP0144 304 267 21 503 230 23 7,67E‐01 1,00E+00‐ MAP0145 604 664 38 1554 204 36 9,39E‐01 1,00E+00‐ MAP0146 51 51 4 302 0 7 8,61E‐01 1,00E+00‐ MAP0147c 102 0 3 50 100 5 6,88E‐01 1,00E+00‐ MAP0148c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP0149c 561 550 32 875 640 41 3,82E‐01 1,00E+00fadE25_2 MAP0150c 15285 17575 784 25827 11082 746 3,53E‐01 1,00E+00‐ MAP0151c 6408 7901 911 11244 4272 819 7,73E‐01 1,00E+00‐ MAP0152c 639 654 169 1226 712 228 3,43E‐01 1,00E+00‐ MAP0153 1554 1708 71 2899 1182 74 7,53E‐01 1,00E+00‐ MAP0154 58 74 4 160 7 3 5,36E‐01 1,00E+00‐ MAP0155 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP0156 152 213 26 207 60 15 2,41E‐01 1,00E+00‐ predicted RNA 7784 4374 7103 10322 2700 5679 5,37E‐01 1,00E+00PE_2 MAP0157 2941 2329 496 5391 1625 513 8,75E‐01 1,00E+00‐ MAP0158 2386 2780 125 5201 1494 127 9,39E‐01 1,00E+00‐ MAP0159c 1101 1127 53 1448 463 36 3,57E‐01 1,00E+00‐ MAP0160 6620 6808 1288 12735 3988 1269 9,40E‐01 1,00E+00‐ MAP0161 4587 3256 804 8099 2034 776 9,66E‐01 1,00E+00‐ MAP0162 1431 1988 118 2476 1196 111 9,85E‐01 1,00E+00‐ MAP0163 2438 2578 141 3173 1171 100 3,51E‐01 1,00E+00‐ MAP0164 2596 3161 108 3284 1536 78 3,40E‐01 1,00E+00‐ MAP0165 1014 1101 36 1953 506 32 8,54E‐01 1,00E+00

163









‐ MAP0166 1122 1780 51 2536 744 46 8,89E‐01 1,00E+00‐ MAP0167 2097 2818 76 3319 1199 58 4,63E‐01 1,00E+00‐ MAP0168c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP0169c 0 0 0 50 50 3 0,00E+00 1,00E+00sigI MAP0170 43 119 5 104 51 4 5,16E‐01 1,00E+00‐ MAP0171c 203 253 11 553 0 8 5,63E‐01 1,00E+00‐ predicted RNA 2548 3599 4101 3783 3090 4505 6,15E‐01 1,00E+00gltB MAP0172 18653 24067 268 36260 13599 259 2,22E‐01 1,00E+00gltD MAP0173 5746 8604 278 10313 3466 217 3,76E‐01 1,00E+00‐ MAP0174 705 644 262 1587 301 265 8,45E‐01 1,00E+00‐ MAP0175c 202 547 24 967 331 35 2,55E‐01 1,00E+00‐ MAP0176 252 126 25 451 51 22 9,02E‐01 1,00E+00‐ MAP0177 250 198 13 650 102 15 5,50E‐01 1,00E+00‐ MAP0178c 0 50 1 51 51 2 6,75E‐01 1,00E+00‐ MAP0180 3559 2284 117 5309 1169 95 4,93E‐01 1,00E+00menG MAP0181c 270 572 49 400 292 39 6,74E‐01 1,00E+00‐ MAP0182c 1310 2433 258 3592 2047 357 2,89E‐01 1,00E+00‐ MAP0183c 116 301 18 599 50 19 7,65E‐01 1,00E+00‐ MAP0184c 951 1133 87 1974 485 78 8,75E‐01 1,00E+00‐ MAP0185c 911 1536 174 2548 880 201 5,63E‐01 1,00E+00‐ MAP0186c 380 165 30 433 125 23 6,49E‐01 1,00E+00sodA MAP0187c 61330 51632 5307 106661 34132 5212 2,21E‐01 1,00E+00‐ MAP0188c 1430 2303 591 3447 1627 705 5,46E‐01 1,00E+00‐ MAP0189 783 1347 60 1893 813 66 6,60E‐01 1,00E+00glpQ1 MAP0190 440 558 35 689 152 22 3,36E‐01 1,00E+00pheA MAP0193 200 252 13 368 152 13 9,30E‐01 1,00E+00‐ MAP0194 407 531 38 588 326 34 9,09E‐01 1,00E+00‐ MAP0195c 348 382 60 357 304 53 8,54E‐01 1,00E+00‐ MAP0196c 948 1469 51 1864 656 43 7,99E‐01 1,00E+00serS MAP0197 248 203 10 219 51 4 1,17E‐01 1,00E+00

164









‐ MAP0198c 53 152 7 0 0 0 1,00E+00 1,00E+00‐ MAP0199 151 51 10 199 0 5 7,89E‐01 1,00E+00‐ MAP0200c 50 41 5 51 0 1 4,51E‐01 1,00E+00‐ MAP0201 0 0 0 101 51 6 0,00E+00 1,00E+00‐ MAP0202 50 0 1 152 0 1 5,80E‐01 1,00E+00‐ MAP0203c 164 336 42 371 355 62 2,82E‐01 1,00E+00‐ MAP0204c 1280 1799 57 3349 982 63 6,03E‐01 1,00E+00‐ MAP0205 854 1699 95 1104 1117 86 9,32E‐01 1,00E+00‐ MAP0206 1793 2153 146 2662 1527 140 9,77E‐01 1,00E+00‐ MAP0207 509 899 50 1529 285 48 9,59E‐01 1,00E+00‐ MAP0208 101 110 7 251 101 10 3,49E‐01 1,00E+00csp MAP0209c 1979 3269 92 4055 1768 88 9,13E‐01 1,00E+00pirG MAP0210c 7630 8623 465 15165 4878 458 8,26E‐01 1,00E+00glf MAP0211 2752 4084 161 3309 2042 117 2,69E‐01 1,00E+00‐ MAP0212 2616 2884 84 3720 1230 60 3,53E‐01 1,00E+00‐ MAP0213 450 801 70 853 517 72 8,11E‐01 1,00E+00‐ MAP0214 1497 2093 112 2230 886 81 4,02E‐01 1,00E+00‐ MAP0215 2108 2134 64 3895 1338 63 9,80E‐01 1,00E+00‐ predicted RNA 10276 15353 13840 18276 8678 12742 5,40E‐01 1,00E+00‐ predicted RNA 6851 5704 6242 14141 7370 9320 1,09E‐01 1,00E+00fbpA MAP0216 7072 7048 393 11096 3100 306 3,63E‐01 1,00E+00fbpC1 MAP0217 4456 3891 270 7127 2077 231 7,56E‐01 1,00E+00‐ MAP0218 3174 3350 187 4021 2146 156 5,56E‐01 1,00E+00fadD32 MAP0219 9864 12623 341 17225 6361 295 9,19E‐01 1,00E+00pks13 MAP0220 20159 24627 242 38563 12348 220 3,19E‐01 1,00E+00accD4_1 MAP0221 6236 7466 251 11422 3907 227 7,81E‐01 1,00E+00‐ MAP0222c 152 51 6 204 51 6 5,19E‐01 1,00E+00‐ MAP0223c 50 50 3 153 0 3 5,24E‐01 1,00E+00fadE35 MAP0224c 608 479 18 862 408 17 8,23E‐01 1,00E+00‐ MAP0225c 0 51 1 102 102 5 3,21E‐02 1,00E+00

165









‐ MAP0226 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP0227c 272 298 32 620 131 31 9,52E‐01 1,00E+00embB MAP0228c 1491 2102 32 2498 1141 28 8,04E‐01 1,00E+00embA MAP0229c 890 1690 21 1422 1116 21 9,23E‐01 1,00E+00embR_1 MAP0230 101 202 7 483 101 10 2,60E‐01 1,00E+00‐ MAP0231c 360 384 31 862 457 49 1,79E‐01 1,00E+00embC MAP0232c 1628 1461 27 2704 856 25 8,97E‐01 1,00E+00‐ MAP0233c 369 1163 20 1480 290 17 8,83E‐01 1,00E+00‐ MAP0234c 926 2027 108 1830 1036 97 8,79E‐01 1,00E+00‐ MAP0235c 1003 1205 45 1376 919 44 9,25E‐01 1,00E+00‐ MAP0236c 134 164 23 243 88 21 9,94E‐01 1,00E+00‐ MAP0237c 1113 1034 131 1739 627 117 8,66E‐01 1,00E+00‐ MAP0239c 1422 1098 89 1437 965 78 8,54E‐01 1,00E+00rfbE MAP0240c 570 1432 61 1834 700 66 6,94E‐01 1,00E+00‐ MAP0241c 511 1098 56 891 596 49 8,88E‐01 1,00E+00‐ MAP0242c 4355 4726 519 8190 2821 509 9,10E‐01 1,00E+00‐ MAP0243c 3309 5593 128 3866 2623 89 2,80E‐01 1,00E+00‐ MAP0244 1622 2001 87 4918 1204 112 4,03E‐01 1,00E+00‐ MAP0245c 1415 1383 83 1948 550 57 3,61E‐01 1,00E+00‐ MAP0246c 763 265 27 1452 51 24 9,18E‐01 1,00E+00‐ MAP0247c 2976 1928 756 3900 1004 566 4,40E‐01 1,00E+00lipE MAP0248c 725 490 28 934 513 30 7,70E‐01 1,00E+00‐ MAP0250 183 245 20 182 94 11 2,22E‐01 1,00E+00‐ MAP0251c 3990 5299 578 6554 2302 451 5,82E‐01 1,00E+00hisC2 MAP0252c 4937 6607 310 7771 3717 269 8,29E‐01 1,00E+00‐ MAP0253 1937 2831 114 3936 1488 109 9,04E‐01 1,00E+00‐ MAP0254c 241 232 43 76 126 20 1,31E‐01 1,00E+00‐ MAP0255c 1061 1675 72 1833 576 51 4,08E‐01 1,00E+00‐ MAP0256 433 562 30 921 602 43 2,38E‐01 1,00E+00‐ MAP0257 3789 1973 717 4594 629 437 1,37E‐01 1,00E+00

166









‐ MAP0259 841 895 68 2271 473 79 5,51E‐01 1,00E+00‐ MAP0260 102 353 8 305 102 6 6,34E‐01 1,00E+00‐ MAP0261c 4355 3974 500 6783 2713 472 9,92E‐01 1,00E+00‐ MAP0262 1519 1957 53 3384 609 44 6,77E‐01 1,00E+00‐ MAP0263c 223 369 17 215 101 8 1,17E‐01 1,00E+00‐ MAP0264c 234 34 13 130 51 6 2,49E‐01 1,00E+00fadE1_1 MAP0265c 302 385 15 772 203 16 7,47E‐01 1,00E+00‐ MAP0266c 203 91 11 105 51 5 1,74E‐01 1,00E+00‐ MAP0267c 387 487 23 550 117 13 2,28E‐01 1,00E+00‐ MAP0268c 425 244 29 448 123 18 3,68E‐01 1,00E+00‐ MAP0269 59 79 6 237 0 6 5,00E‐01 1,00E+00fadE36 MAP0270 513 1143 44 713 431 28 3,55E‐01 1,00E+00proX MAP0271 496 868 38 967 261 27 5,03E‐01 1,00E+00‐ MAP0272 45 29 8 93 58 15 5,83E‐01 1,00E+00‐ MAP0273 1 102 3 112 86 6 8,86E‐01 1,00E+00proW MAP0274 32 0 1 102 0 2 5,60E‐01 1,00E+00proZ MAP0275 50 0 2 95 51 5 3,54E‐01 1,00E+00‐ MAP0276 1475 2430 185 2657 830 133 3,58E‐01 1,00E+00tyrA MAP0277c 201 710 25 292 190 13 1,43E‐01 1,00E+00‐ MAP0278 541 828 74 1290 759 103 3,10E‐01 1,00E+00‐ MAP0279 0 246 14 354 0 13 5,19E‐01 1,00E+00celA MAP0280 416 151 17 459 356 22 4,25E‐01 1,00E+00‐ MAP0281 2145 2586 288 2555 858 167 1,00E‐01 1,00E+00‐ MAP0282c 11933 12981 912 17236 6208 700 8,68E‐01 1,00E+00‐ MAP0283c 668 1217 104 1413 561 92 8,59E‐01 1,00E+00‐ MAP0284c 4596 6630 198 7267 3736 172 8,57E‐01 1,00E+00‐ MAP0285c 713 838 39 702 654 34 8,73E‐01 1,00E+00‐ MAP0286 525 809 146 584 311 88 2,45E‐01 1,00E+00‐ MAP0287 271 168 14 262 167 13 9,03E‐01 1,00E+00‐ MAP0288 0 35 3 0 0 0 0,00E+00 1,00E+00

167









‐ MAP0289 0 47 1 0 0 0 1,00E+00 1,00E+00‐ MAP0290 0 51 2 51 0 1 5,64E‐01 1,00E+00‐ MAP0291 88 106 12 0 0 0 1,00E+00 1,00E+00‐ MAP0292 81 322 9 405 204 13 3,56E‐01 1,00E+00‐ MAP0293 204 255 14 204 51 6 1,05E‐01 1,00E+00pca MAP0294c 1553 2278 32 4078 1343 37 6,34E‐01 1,00E+00gltA1 MAP0295c 51 150 4 50 0 0 1,26E‐04 1,00E+00‐ MAP0296c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP0297c 95 51 2 201 0 2 5,27E‐01 1,00E+00‐ MAP0298 153 255 7 334 101 6 8,67E‐01 1,00E+00‐ MAP0299c 388 3 13 701 102 18 4,28E‐01 1,00E+00‐ MAP0300 366 748 24 1025 485 29 4,86E‐01 1,00E+00‐ MAP0301 920 904 77 2020 594 86 6,26E‐01 1,00E+00‐ MAP0302c 102 51 3 174 101 6 7,90E‐01 1,00E+00‐ MAP0303c 432 903 38 1316 255 34 8,97E‐01 1,00E+00‐ MAP0304c 386 255 27 582 259 29 7,60E‐01 1,00E+00‐ MAP0305c 665 689 30 1795 289 32 7,01E‐01 1,00E+00gshA MAP0306c 851 787 36 1356 446 31 8,57E‐01 1,00E+00‐ MAP0307c 2137 2334 183 2793 1100 132 3,81E‐01 1,00E+00‐ MAP0308c 102 202 15 268 102 16 6,94E‐01 1,00E+00‐ MAP0309c 98 31 3 203 51 5 2,32E‐01 1,00E+00asd MAP0310c 790 878 46 1410 298 35 5,86E‐01 1,00E+00ask MAP0311c 2547 3261 132 4212 1215 97 3,57E‐01 1,00E+00leuA MAP0312 4268 3561 135 5334 2622 118 7,83E‐01 1,00E+00dnaQ MAP0313c 355 786 32 1113 377 35 6,71E‐01 1,00E+00‐ MAP0314 146 51 4 408 190 11 6,71E‐02 1,00E+00cobQ2 MAP0315 196 249 18 533 89 18 8,72E‐01 1,00E+00recR MAP0316c 239 154 19 834 153 33 6,39E‐02 1,00E+00‐ MAP0317c 666 498 97 483 294 58 2,37E‐01 1,00E+00‐ MAP0318 1584 2023 134 3408 1164 138 8,23E‐01 1,00E+00

168









‐ MAP0319c 1485 1249 183 1662 575 119 2,75E‐01 1,00E+00‐ MAP0320 2330 2714 102 3505 1317 80 5,27E‐01 1,00E+00‐ MAP0321 1959 3287 113 3088 1775 96 6,58E‐01 1,00E+00dnaZX MAP0322c 916 1365 35 1640 306 22 2,51E‐01 1,00E+00‐ MAP0323c 1526 2136 81 1715 764 47 1,27E‐01 1,00E+00‐ MAP0324 6213 7551 476 11816 5529 519 6,41E‐01 1,00E+00‐ MAP0325c 628 535 90 726 124 46 1,19E‐01 1,00E+00‐ MAP0326 0 50 2 100 0 3 5,31E‐01 1,00E+00‐ MAP0327 301 344 11 445 102 7 3,63E‐01 1,00E+00‐ MAP0328 50 51 2 152 51 3 6,12E‐01 1,00E+00‐ MAP0329c 8 0 0 0 0 0 5,35E‐100 1,00E+00‐ MAP0330 423 240 14 506 0 6 8,34E‐02 1,00E+00‐ MAP0331 125 226 8 326 51 6 6,07E‐01 1,00E+00‐ MAP0332 51 138 4 280 88 7 3,16E‐01 1,00E+00‐ MAP0333 547 365 42 823 51 25 2,91E‐01 1,00E+00‐ MAP0334 1825 1689 103 3926 962 108 7,81E‐01 1,00E+00‐ MAP0335 101 246 16 377 203 25 2,40E‐01 1,00E+00‐ MAP0336c 318 412 17 408 57 7 8,39E‐02 1,00E+00‐ MAP0338c 2374 2046 77 2570 751 45 1,01E‐01 1,00E+00‐ MAP0339c 944 866 25 1267 288 16 3,10E‐01 1,00E+00‐ MAP0340c 949 1561 69 1528 681 53 5,35E‐01 1,00E+00ligC MAP0341 162 260 10 251 51 5 1,88E‐01 1,00E+00‐ MAP0342c 101 99 16 102 17 7 6,47E‐01 1,00E+00‐ MAP0343 1953 822 226 3170 642 219 9,36E‐01 1,00E+00‐ MAP0344c 458 440 21 1115 149 20 8,86E‐01 1,00E+00‐ MAP0345c 114 48 5 254 102 9 2,79E‐01 1,00E+00‐ MAP0346c 1220 1686 171 2759 1458 222 3,19E‐01 1,00E+00‐ MAP0347c 1210 1789 63 1265 1039 47 5,33E‐01 1,00E+00‐ MAP0348c 101 36 4 51 51 3 5,46E‐01 1,00E+00‐ MAP0349 307 112 11 204 102 7 3,01E‐01 1,00E+00

169









‐ MAP0350 0 0 0 250 0 5 0,00E+00 1,00E+00‐ MAP0351 0 185 8 102 152 13 4,54E‐01 1,00E+00‐ MAP0352c 341 441 22 583 203 18 7,16E‐01 1,00E+00glpK MAP0353 374 393 14 1300 359 24 1,25E‐01 1,00E+00‐ MAP0354c 148 380 20 523 76 16 7,64E‐01 1,00E+00‐ MAP0356c 813 1157 64 1663 1263 93 2,14E‐01 1,00E+00‐ MAP0357 408 546 27 1206 506 42 1,74E‐01 1,00E+00‐ MAP0358c 50 151 4 285 71 5 5,76E‐01 1,00E+00moxR2 MAP0359c 493 662 33 1259 647 49 2,28E‐01 1,00E+00‐ MAP0360c 346 702 26 889 177 19 6,37E‐01 1,00E+00‐ MAP0361c 305 417 31 264 329 27 8,41E‐01 1,00E+00‐ MAP0362c 835 994 41 1186 509 32 6,36E‐01 1,00E+00‐ MAP0363 2628 4169 417 5892 1622 362 6,78E‐01 1,00E+00‐ MAP0364c 0 0 0 233 0 2 0,00E+00 1,00E+00‐ MAP0365c 0 43 1 51 0 0 5,45E‐01 1,00E+00selD MAP0366 50 0 1 162 102 7 2,79E‐02 1,00E+00‐ MAP0367 3013 2681 286 6327 2662 377 2,55E‐01 1,00E+00‐ MAP0368 1219 1388 28 2259 509 22 6,40E‐01 1,00E+00‐ MAP0369 242 60 9 137 51 4 1,99E‐01 1,00E+00‐ MAP0370 102 0 2 51 0 0 9,06E‐02 1,00E+00‐ MAP0371 1553 755 70 2983 332 65 9,91E‐01 1,00E+00pfpI MAP0372 615 135 41 1329 163 53 4,04E‐01 1,00E+00‐ MAP0373 1346 802 92 3656 581 125 2,71E‐01 1,00E+00‐ MAP0374c 4136 3153 308 10644 1450 349 6,12E‐01 1,00E+00‐ MAP0375c 979 1672 34 1221 399 16 6,23E‐02 1,00E+00‐ MAP0376c 255 399 29 953 131 34 6,36E‐01 1,00E+00‐ MAP0377c 296 140 31 306 136 26 8,14E‐01 1,00E+00‐ MAP0378c 122 239 26 151 102 17 3,06E‐01 1,00E+00rsbR MAP0379c 1359 1476 91 2886 586 81 8,92E‐01 1,00E+00‐ MAP0380 4636 9113 1054 7799 4314 850 4,56E‐01 1,00E+00

170









‐ MAP0381 309 656 52 997 215 49 8,90E‐01 1,00E+00‐ MAP0383 85 76 13 124 16 8 5,70E‐01 1,00E+00‐ MAP0384 99 0 10 127 52 14 5,35E‐01 1,00E+00‐ MAP0385 0 132 5 51 51 5 5,30E‐01 1,00E+00‐ MAP0386c 330 303 26 587 129 22 7,71E‐01 1,00E+00‐ MAP0387 506 557 54 758 390 52 8,99E‐01 1,00E+00‐ MAP0388 486 686 28 650 254 18 3,41E‐01 1,00E+00‐ MAP0389 51 201 6 0 153 6 8,69E‐01 1,00E+00‐ MAP0390c 437 788 31 1448 391 37 5,33E‐01 1,00E+00‐ MAP0391c 1002 1040 62 2221 730 72 5,54E‐01 1,00E+00ponA_2 MAP0392c 7021 9320 193 12789 5473 184 9,12E‐01 1,00E+00whiB4 MAP0393 1980 1601 299 3051 1359 310 8,14E‐01 1,00E+00‐ MAP0394c 1817 2219 101 3185 1317 95 9,25E‐01 1,00E+00‐ MAP0395c 6166 5063 322 7808 3662 280 8,38E‐01 1,00E+00‐ MAP0397 491 534 36 523 164 19 1,64E‐01 1,00E+00‐ MAP0398c 10117 16005 1105 17114 7879 921 8,30E‐01 1,00E+00‐ MAP0399c 1640 2852 322 3840 1474 321 9,81E‐01 1,00E+00nth MAP0400 939 1773 96 1856 662 74 5,84E‐01 1,00E+00‐ MAP0401 1133 761 83 1435 424 63 5,50E‐01 1,00E+00‐ MAP0402 424 611 36 1018 409 42 5,29E‐01 1,00E+00‐ MAP0403 961 927 46 1433 711 45 9,20E‐01 1,00E+00ephE MAP0404c 153 248 11 161 51 5 1,26E‐01 1,00E+00‐ MAP0405c 665 704 73 1311 237 59 7,43E‐01 1,00E+00‐ MAP0406 1448 1770 132 3116 935 132 8,66E‐01 1,00E+00acs MAP0407c 1501 1261 41 2887 1193 50 4,06E‐01 1,00E+00‐ MAP0408 102 140 12 503 49 19 2,62E‐01 1,00E+00dppA MAP0409 203 445 11 305 254 9 8,35E‐01 1,00E+00dppB MAP0410 197 249 13 509 201 18 4,24E‐01 1,00E+00dppC MAP0411 132 200 10 0 153 7 3,12E‐01 1,00E+00dppD_1 MAP0412 185 383 9 53 67 2 2,86E‐03 1,00E+00

171









‐ MAP0413 447 150 23 252 102 11 1,16E‐01 1,00E+00‐ predicted RNA 301135 290737 84167 744133 255966 114331 8,77E‐01 1,00E+00‐ MAP0414c 1213 1194 81 1824 1006 85 7,67E‐01 1,00E+00‐ MAP0415 51 190 6 102 0 1 8,38E‐02 1,00E+00trbB MAP0416 0 0 0 94 0 1 0,00E+00 1,00E+00‐ MAP0417 51 36 3 51 0 1 5,96E‐01 1,00E+00‐ MAP0418 51 0 2 0 0 0 1,00E+00 1,00E+00‐ MAP0419 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP0420 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP0421c 1173 840 57 1574 516 46 6,70E‐01 1,00E+00‐ MAP0422c 505 505 12 936 203 10 8,26E‐01 1,00E+00‐ predicted RNA 155798 145308 65116 299023 88622 65368 8,93E‐01 1,00E+00cspA_1 MAP0423 51767 54369 15113 61204 24744 10204 6,96E‐01 1,00E+00‐ MAP0424 847 1546 114 1907 381 82 4,15E‐01 1,00E+00‐ predicted RNA 6367 6627 9936 12429 5117 11225 5,25E‐01 1,00E+00topA MAP0425 6285 7700 144 9818 4233 123 5,98E‐01 1,00E+00‐ MAP0426c 507 733 21 1218 426 23 6,86E‐01 1,00E+00‐ MAP0427 653 1876 58 2329 839 62 7,36E‐01 1,00E+00‐ MAP0428 1490 1346 69 2478 930 68 9,12E‐01 1,00E+00‐ MAP0429c 167 248 6 196 45 2 1,31E‐01 1,00E+00rmlB2 MAP0430 591 1063 49 1041 200 27 1,76E‐01 1,00E+00‐ MAP0431c 616 819 120 1424 336 112 9,97E‐01 1,00E+00‐ MAP0432c 1835 2883 191 3042 1284 150 5,33E‐01 1,00E+00‐ MAP0433c 667 350 23 641 457 22 8,19E‐01 1,00E+00‐ MAP0434 2115 3107 138 4188 2313 155 6,34E‐01 1,00E+00ppa MAP0435c 2967 2905 349 4031 1630 280 4,85E‐01 1,00E+00‐ MAP0436 1404 1303 57 1736 650 41 4,36E‐01 1,00E+00‐ MAP0437 439 517 25 727 236 20 7,36E‐01 1,00E+00mesJ MAP0438 189 134 9 617 234 21 7,12E‐02 1,00E+00hpt MAP0439 347 449 37 893 326 47 4,33E‐01 1,00E+00

172









lpqG MAP0440c 285 673 35 1466 281 49 2,92E‐01 1,00E+00PE_3 MAP0441 141 0 14 27 88 13 5,07E‐01 1,00E+00‐ MAP0442 0 51 1 51 0 0 5,64E‐01 1,00E+00‐ MAP0443c 286 414 12 423 196 9 6,26E‐01 1,00E+00‐ MAP0444c 846 1060 54 1497 460 44 6,91E‐01 1,00E+00‐ MAP0445c 1706 1512 79 2291 874 63 6,12E‐01 1,00E+00ephA MAP0446c 805 1019 53 1793 610 57 7,34E‐01 1,00E+00‐ MAP0447 0 240 15 83 152 18 4,48E‐01 1,00E+00ftsH MAP0448 10634 14638 302 19831 8331 286 4,74E‐01 1,00E+00folE MAP0449 880 1050 90 1362 685 84 9,50E‐01 1,00E+00folP MAP0450 1870 1591 124 3206 1165 127 8,32E‐01 1,00E+00folX MAP0451 375 164 40 649 258 54 4,07E‐01 1,00E+00folK MAP0452 428 442 46 852 318 50 6,36E‐01 1,00E+00‐ MAP0453 337 201 33 647 238 44 4,56E‐01 1,00E+00‐ MAP0454 1956 1167 66 2536 1219 67 8,16E‐01 1,00E+00‐ MAP0455 100 102 6 189 153 10 2,70E‐01 1,00E+00panC MAP0456 534 664 37 896 152 23 2,98E‐01 1,00E+00panD MAP0457 876 1289 143 1833 633 133 9,73E‐01 1,00E+00‐ MAP0458 815 478 47 1051 478 46 8,86E‐01 1,00E+00lysS MAP0459 1368 1926 63 2400 1191 60 9,56E‐01 1,00E+00lsr2 MAP0460 5340 5530 932 9770 3508 925 8,63E‐01 1,00E+00clpC MAP0461 31792 38199 798 60003 19929 734 2,77E‐01 1,00E+00‐ MAP0462 95 142 31 102 93 26 9,25E‐01 1,00E+00‐ MAP0463 108 102 8 0 0 0 1,00E+00 1,00E+00‐ MAP0464 0 101 4 22 0 0 3,11E‐06 1,00E+00‐ MAP0465 954 1521 49 2153 1002 54 6,35E‐01 1,00E+00lpqF MAP0466c 836 1217 45 2137 827 55 4,71E‐01 1,00E+00‐ MAP0467c 2391 3625 536 3888 1862 449 5,73E‐01 1,00E+00‐ MAP0468 95 202 10 102 0 2 2,08E‐02 1,00E+00mutY MAP0469c 216 313 16 255 102 9 2,42E‐01 1,00E+00

173









‐ MAP0470 14552 15804 1424 29727 7493 1330 3,76E‐01 1,00E+00‐ MAP0471 4774 6108 375 9348 3655 375 8,54E‐01 1,00E+00‐ MAP0472c 811 609 38 967 612 39 8,51E‐01 1,00E+00radA MAP0473c 103 321 8 696 87 10 4,25E‐01 1,00E+00lpqE MAP0474c 528 1117 81 1331 527 79 9,47E‐01 1,00E+00‐ MAP0475 46084 80411 7357 72132 46772 6518 2,71E‐01 1,00E+00ispD MAP0476 2665 3589 253 5444 2844 299 4,61E‐01 1,00E+00cysS MAP0478 2697 4041 137 4684 1243 93 2,07E‐01 1,00E+00‐ MAP0479 891 1315 67 1857 675 64 9,79E‐01 1,00E+00‐ MAP0480 720 1207 61 1598 439 51 7,27E‐01 1,00E+00‐ MAP0481c 0 37 0 25 0 0 8,74E‐01 1,00E+00‐ MAP0482 203 350 10 365 0 4 6,90E‐02 1,00E+00absR2 MAP0483 153 196 8 153 147 7 8,92E‐01 1,00E+00arsB2 MAP0484c 100 89 4 96 51 3 6,99E‐01 1,00E+00‐ MAP0486c 256 489 27 410 109 15 2,00E‐01 1,00E+00‐ MAP0490 305 204 12 814 373 24 6,05E‐02 1,00E+00‐ MAP0491c 505 574 41 1198 396 49 5,04E‐01 1,00E+00fadE34 MAP0492 151 225 5 204 51 2 2,03E‐01 1,00E+00‐ MAP0493c 144 51 10 96 101 10 4,90E‐01 1,00E+00‐ MAP0494 279 115 12 421 102 12 9,17E‐01 1,00E+00‐ MAP0495c 1019 1103 109 1276 633 86 5,87E‐01 1,00E+00‐ MAP0496c 102 5 3 169 50 4 6,27E‐01 1,00E+00‐ MAP0497 772 693 36 1200 146 22 3,07E‐01 1,00E+00‐ MAP0498 1450 1374 93 2809 888 96 7,76E‐01 1,00E+00‐ MAP0499 684 915 50 889 287 29 2,43E‐01 1,00E+00‐ MAP0500 153 401 27 264 152 19 5,10E‐01 1,00E+00nhoA MAP0501 101 198 10 133 51 5 2,41E‐01 1,00E+00aspB MAP0502c 46 119 3 0 51 1 6,74E‐01 1,00E+00fadE33 MAP0503c 51 193 7 300 101 9 3,25E‐01 1,00E+00fadE32 MAP0504c 101 47 4 105 153 8 3,00E‐01 1,00E+00

174









fadE31 MAP0505c 153 227 9 342 248 14 2,75E‐01 1,00E+00fadD3_1 MAP0506c 50 0 1 51 0 0 5,81E‐01 1,00E+00fadE30 MAP0507 224 404 15 596 275 18 5,69E‐01 1,00E+00‐ MAP0508 101 54 5 223 79 9 8,43E‐01 1,00E+00‐ MAP0509 892 1175 97 1348 495 71 4,94E‐01 1,00E+00fadA6_1 MAP0510 432 354 19 717 297 21 7,40E‐01 1,00E+00‐ MAP0511c 0 100 3 102 0 2 5,80E‐01 1,00E+00‐ MAP0512c 0 51 2 101 50 5 7,02E‐01 1,00E+00‐ MAP0513c 318 310 16 319 169 11 4,58E‐01 1,00E+00‐ MAP0514c 51 100 5 0 0 0 1,00E+00 1,00E+00‐ MAP0515c 305 152 15 356 250 18 5,72E‐01 1,00E+00echA20 MAP0516c 153 204 13 381 95 13 7,96E‐01 1,00E+00‐ MAP0517 401 405 29 1231 356 45 1,93E‐01 1,00E+00‐ MAP0518 104 336 13 517 194 18 3,66E‐01 1,00E+00‐ MAP0519c 0 101 6 153 51 10 6,34E‐01 1,00E+00‐ MAP0520c 0 51 3 59 0 2 5,47E‐01 1,00E+00fadA5 MAP0521c 141 132 6 177 48 4 3,29E‐01 1,00E+00‐ MAP0522 1030 1009 47 2094 473 44 9,74E‐01 1,00E+00fadE29 MAP0524 1289 1129 60 1883 741 54 8,95E‐01 1,00E+00‐ MAP0525 285 219 15 233 51 6 8,37E‐02 1,00E+00‐ MAP0526 102 102 14 318 0 13 5,17E‐01 1,00E+00ltp2_1 MAP0527 198 607 19 362 204 12 3,87E‐01 1,00E+00‐ MAP0528 50 0 1 0 51 2 5,47E‐01 1,00E+00ufaA2 MAP0529c 51 421 14 355 252 19 4,62E‐01 1,00E+00‐ MAP0530c 406 629 17 654 152 10 2,63E‐01 1,00E+00‐ MAP0531 384 413 29 1179 477 51 9,88E‐02 1,00E+00‐ MAP0532 782 927 53 1204 370 39 5,21E‐01 1,00E+00‐ MAP0533 1131 1401 68 2666 783 74 7,11E‐01 1,00E+00‐ MAP0534 373 1209 143 1065 407 115 7,03E‐01 1,00E+00‐ MAP0535 759 1163 48 1993 966 66 2,93E‐01 1,00E+00

175









‐ MAP0536 744 694 53 891 510 46 8,64E‐01 1,00E+00‐ MAP0537 348 965 32 506 243 16 1,01E‐01 1,00E+00‐ MAP0538c 51 3 3 0 51 4 5,34E‐01 1,00E+00‐ MAP0539 0 0 0 51 51 3 0,00E+00 1,00E+00‐ MAP0540 150 342 26 188 204 22 8,28E‐01 1,00E+00‐ MAP0541c 213 176 27 200 83 16 2,50E‐01 1,00E+00‐ MAP0542c 339 349 16 395 220 13 6,86E‐01 1,00E+00‐ MAP0543c 151 165 8 473 153 13 2,13E‐01 1,00E+00‐ MAP0544c 295 253 15 404 102 10 4,99E‐01 1,00E+00‐ MAP0545 1027 1053 58 2045 663 60 7,76E‐01 1,00E+00‐ MAP0546c 525 519 42 1028 304 41 8,05E‐01 1,00E+00‐ MAP0547 280 342 14 510 153 12 7,89E‐01 1,00E+00‐ MAP0548c 0 54 1 136 50 5 3,24E‐01 1,00E+00echA19 MAP0549c 942 1448 84 1328 565 56 3,38E‐01 1,00E+00fadD19_1 MAP0550 662 635 23 1522 407 26 6,14E‐01 1,00E+00‐ MAP0551 0 0 0 0 51 2 0,00E+00 1,00E+00‐ MAP0552 109 214 11 95 0 1 5,45E‐03 1,00E+00ilvX MAP0553 95 180 6 221 51 4 3,93E‐01 1,00E+00‐ MAP0554c 102 333 15 397 102 14 9,86E‐01 1,00E+00‐ MAP0555c 0 0 0 0 0 0 1,00E+00 1,00E+00fadD17 MAP0556c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP0557c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP0558c 0 50 1 218 51 6 2,72E‐02 1,00E+00fdxD MAP0560 3990 3951 1204 5836 2128 983 6,12E‐01 1,00E+00fabG MAP0561 1404 2611 124 3007 1284 114 8,93E‐01 1,00E+00‐ MAP0562 911 674 61 955 316 38 3,24E‐01 1,00E+00‐ MAP0563 2050 2757 163 3470 1514 145 7,66E‐01 1,00E+00mce4 MAP0564 659 1640 56 961 598 36 2,82E‐01 1,00E+00‐ MAP0565 1077 2953 107 2610 907 78 3,89E‐01 1,00E+00‐ MAP0566 1369 1629 81 1561 516 45 1,03E‐01 1,00E+00

176









‐ MAP0567 1063 1653 54 1900 615 40 5,20E‐01 1,00E+00lprN MAP0568 659 1329 48 1548 301 33 4,19E‐01 1,00E+00‐ MAP0569 399 1159 27 1263 601 29 7,32E‐01 1,00E+00‐ MAP0570 724 1558 87 1745 536 71 6,50E‐01 1,00E+00‐ MAP0571 911 937 108 1004 265 57 1,22E‐01 1,00E+00‐ MAP0572c 3928 4042 400 5149 2278 316 5,28E‐01 1,00E+00otsA MAP0573c 1561 1492 60 2551 996 57 9,65E‐01 1,00E+00‐ MAP0575 91 102 7 153 192 13 2,03E‐01 1,00E+00echA13 MAP0576 171 547 21 639 250 22 7,94E‐01 1,00E+00‐ MAP0577 204 102 10 281 49 8 3,89E‐01 1,00E+00‐ MAP0578 0 51 1 0 0 0 1,00E+00 1,00E+00cpsA MAP0579c 3449 3644 131 5444 2832 135 8,23E‐01 1,00E+00‐ MAP0580c 35 83 13 238 51 25 6,31E‐01 1,00E+00‐ MAP0581c 150 485 11 587 153 10 9,63E‐01 1,00E+00bpoA MAP0582 204 452 23 496 231 23 9,56E‐01 1,00E+00‐ MAP0583 836 915 75 1259 538 65 8,26E‐01 1,00E+00‐ MAP0584 5160 2737 500 11203 2380 618 4,75E‐01 1,00E+00‐ MAP0585 2940 2320 150 7938 1387 189 3,32E‐01 1,00E+00‐ MAP0586c 598 702 39 1119 778 54 3,15E‐01 1,00E+00‐ MAP0587 300 550 50 881 642 88 9,04E‐02 1,00E+00‐ MAP0588 1087 1715 42 1587 763 31 4,88E‐01 1,00E+00‐ MAP0589c 1059 901 48 1797 596 46 9,49E‐01 1,00E+00‐ MAP0590 8 50 2 0 0 0 1,00E+00 1,00E+00phoP MAP0591 5600 5566 451 6042 2707 300 3,38E‐01 1,00E+00phoR MAP0592 1645 2569 83 3256 530 54 1,98E‐01 1,00E+00‐ MAP0593c 2273 2498 341 3545 1208 274 5,75E‐01 1,00E+00‐ MAP0594c 441 962 96 1309 671 122 4,30E‐01 1,00E+00adhB MAP0595c 4651 4016 225 7219 1826 177 5,81E‐01 1,00E+00‐ predicted RNA 5816 4365 6248 8135 2177 4798 6,02E‐01 1,00E+00‐ MAP0596c 1695 1925 190 3208 953 172 8,74E‐01 1,00E+00

177









‐ MAP0597c 220 244 64 644 201 92 3,33E‐01 1,00E+00‐ MAP0598c 1357 1459 60 2457 723 53 8,61E‐01 1,00E+00‐ MAP0599c 113 483 19 506 204 20 8,32E‐01 1,00E+00‐ MAP0601c 273 101 17 254 51 10 2,23E‐01 1,00E+00aldA_1 MAP0602 155 133 5 322 49 5 9,39E‐01 1,00E+00‐ MAP0603 271 405 25 518 376 32 4,62E‐01 1,00E+00‐ MAP0604 777 798 52 1797 489 58 6,56E‐01 1,00E+00‐ MAP0605 293 302 39 458 265 42 7,69E‐01 1,00E+00purD MAP0606 143 100 5 452 256 14 4,02E‐02 1,00E+00ggtA MAP0607c 655 844 26 1016 302 18 4,70E‐01 1,00E+00‐ MAP0608c 337 200 16 244 225 14 8,10E‐01 1,00E+00‐ MAP0609 735 1206 89 832 406 50 1,73E‐01 1,00E+00‐ MAP0610c 0 41 1 148 0 3 8,59E‐01 1,00E+00purB MAP0611 511 818 26 1915 651 42 1,38E‐01 1,00E+00‐ MAP0612 681 1477 48 3196 1066 79 8,37E‐02 1,00E+00‐ MAP0613c 0 6 0 50 0 1 5,24E‐04 1,00E+00hemH MAP0614 638 793 46 876 406 35 6,50E‐01 1,00E+00ptrBa MAP0615 1288 1680 39 2012 877 32 7,19E‐01 1,00E+00‐ MAP0616c 51 103 9 51 35 5 5,92E‐01 1,00E+00‐ MAP0617 51 51 5 0 0 0 1,00E+00 1,00E+00‐ MAP0618c 4301 5361 172 7638 2810 153 8,96E‐01 1,00E+00‐ MAP0619c 356 703 18 554 356 15 7,70E‐01 1,00E+00‐ MAP0620 100 50 6 178 0 4 5,50E‐01 1,00E+00‐ MAP0621 1351 1311 46 1895 928 43 9,54E‐01 1,00E+00‐ MAP0622c 89 239 23 200 51 14 2,85E‐01 1,00E+00‐ MAP0623 506 535 134 637 203 86 3,41E‐01 1,00E+00‐ MAP0624 271 450 27 609 0 14 1,47E‐01 1,00E+00‐ MAP0625 2009 2795 574 2806 1609 480 6,47E‐01 1,00E+00purQ MAP0626 527 706 52 909 380 46 9,27E‐01 1,00E+00‐ MAP0627c 408 752 63 540 228 36 1,96E‐01 1,00E+00

178









‐ MAP0628c 763 860 57 1968 709 77 2,99E‐01 1,00E+00‐ MAP0629c 199 578 46 608 288 47 8,40E‐01 1,00E+00‐ MAP0630c 2055 1894 144 3154 729 105 3,89E‐01 1,00E+00‐ MAP0631c 564 815 37 1056 197 24 4,01E‐01 1,00E+00pepC MAP0632 51 100 3 0 0 0 1,00E+00 1,00E+00‐ MAP0633 743 1810 206 2538 943 238 5,49E‐01 1,00E+00‐ MAP0634c 665 302 113 1490 190 131 5,42E‐01 1,00E+00purL MAP0635 1788 2181 49 4172 764 45 8,42E‐01 1,00E+00‐ MAP0636 0 50 2 0 43 2 5,39E‐01 1,00E+00‐ MAP0637 0 104 6 0 51 5 5,53E‐01 1,00E+00purF MAP0638 2923 3820 117 5101 1396 87 3,25E‐01 1,00E+00purM MAP0639 5496 6876 325 10195 4485 330 8,13E‐01 1,00E+00‐ MAP0640c 954 1756 413 2371 950 431 7,64E‐01 1,00E+00‐ predicted RNA 2546 3311 5620 2956 1623 3946 2,92E‐01 1,00E+00‐ MAP0641c 1300 964 60 2408 905 72 5,18E‐01 1,00E+00pabC MAP0642 119 238 11 408 254 20 1,55E‐01 1,00E+00‐ predicted RNA 5703 7557 7479 6918 3922 5533 3,47E‐01 1,00E+00‐ MAP0643c 1484 1755 132 2841 1324 146 6,21E‐01 1,00E+00sseC MAP0644c 8064 6315 1395 19029 4598 1710 4,12E‐01 1,00E+00cysA3 MAP0645c 14242 15581 1036 34325 10783 1245 1,25E‐01 1,00E+00‐ MAP0646c 616 981 96 1771 1050 157 1,04E‐01 1,00E+00thiX MAP0647c 0 130 8 101 51 9 5,09E‐01 1,00E+00‐ MAP0648c 102 176 9 153 125 9 6,79E‐01 1,00E+00‐ MAP0649 1895 2411 158 5118 2068 222 2,30E‐01 1,00E+00‐ MAP0650 239 831 31 1338 363 40 3,76E‐01 1,00E+00phoS2_1 MAP0651 843 1245 54 1966 326 43 6,12E‐01 1,00E+00pstC2_1 MAP0652 450 460 26 614 408 27 7,27E‐01 1,00E+00pstA1_1 MAP0653 1944 1733 117 2779 814 89 4,61E‐01 1,00E+00phoT MAP0654 2516 3449 220 4854 2705 252 5,19E‐01 1,00E+00phoY2_2 MAP0655c 3459 4695 350 7834 2308 344 9,20E‐01 1,00E+00

179









‐ MAP0656c 2165 3845 84 5552 2218 92 6,19E‐01 1,00E+00‐ MAP0657c 2496 1746 110 3522 938 87 5,56E‐01 1,00E+00desA1 MAP0658c 16356 15700 913 27355 8514 805 4,62E‐01 1,00E+00‐ MAP0659c 270 353 29 438 254 29 9,04E‐01 1,00E+00‐ MAP0660 204 275 12 429 151 12 9,05E‐01 1,00E+00‐ MAP0662c 558 1014 89 1004 560 80 9,45E‐01 1,00E+00‐ MAP0663 201 264 16 357 158 15 9,74E‐01 1,00E+00‐ MAP0664c 2818 4019 165 7370 2426 191 5,24E‐01 1,00E+00‐ MAP0665c 434 232 23 844 355 34 2,41E‐01 1,00E+00‐ MAP0666c 788 597 62 962 250 41 3,90E‐01 1,00E+00‐ MAP0667 17 24 5 98 0 7 5,42E‐01 1,00E+00‐ MAP0668 153 223 8 361 194 11 4,11E‐01 1,00E+00‐ predicted RNA 1658 2785 5062 2066 1353 3674 3,85E‐01 1,00E+00‐ predicted RNA 3046 5401 4899 6725 2643 4603 9,79E‐01 1,00E+00cspA_2 MAP0669 48953 52176 14391 80784 29270 12775 2,92E‐01 1,00E+00lpqR MAP0670 847 1007 72 1177 459 53 5,14E‐01 1,00E+00‐ MAP0671 123 112 7 305 229 15 1,01E‐01 1,00E+00‐ MAP0672c 166 0 6 118 0 2 8,08E‐01 1,00E+00‐ MAP0673 748 809 28 1063 404 22 6,43E‐01 1,00E+00mcmA2 MAP0674 28 0 2 77 102 12 2,28E‐04 1,00E+00‐ MAP0675 243 51 9 293 209 14 2,39E‐01 1,00E+00‐ MAP0677c 447 509 21 263 253 11 1,91E‐01 1,00E+00‐ MAP0678c 102 238 30 407 50 28 9,24E‐01 1,00E+00fdxB MAP0679c 180 308 40 346 165 37 9,70E‐01 1,00E+00‐ MAP0680 100 102 4 58 51 2 8,89E‐01 1,00E+00‐ MAP0681 152 51 6 502 0 9 3,44E‐01 1,00E+00‐ MAP0682 253 147 10 457 203 15 3,76E‐01 1,00E+00‐ MAP0683 51 153 7 98 26 3 9,05E‐01 1,00E+00‐ MAP0684c 153 98 8 303 99 10 3,54E‐01 1,00E+00‐ MAP0685 0 101 5 112 142 14 1,14E‐01 1,00E+00

180









‐ MAP0686 275 182 11 609 101 12 7,50E‐01 1,00E+00‐ MAP0687 51 51 3 51 0 0 1,28E‐01 1,00E+00‐ MAP0688 51 45 3 382 0 7 2,53E‐01 1,00E+00narL_1 MAP0689c 503 926 62 1148 456 59 9,55E‐01 1,00E+00‐ MAP0690 50 153 4 101 101 4 4,97E‐01 1,00E+00‐ MAP0691c 204 203 7 306 51 4 2,97E‐01 1,00E+00‐ MAP0692c 0 105 4 101 100 8 6,36E‐01 1,00E+00‐ MAP0693 176 618 25 550 94 15 2,91E‐01 1,00E+00mhpA MAP0694 295 226 8 739 255 13 2,44E‐01 1,00E+00mhpB MAP0695 153 152 9 152 49 4 2,37E‐01 1,00E+00‐ MAP0696 478 852 21 1471 463 25 5,56E‐01 1,00E+00‐ MAP0697 3392 3227 147 4853 2157 132 7,83E‐01 1,00E+00‐ MAP0698 367 560 32 864 286 32 7,90E‐01 1,00E+00‐ MAP0699 1108 831 57 1322 799 56 9,24E‐01 1,00E+00‐ MAP0700 39 218 8 92 181 11 3,50E‐01 1,00E+00‐ MAP0701c 0 250 4 304 148 7 2,15E‐01 1,00E+00‐ MAP0702 0 29 0 32 51 3 7,56E‐02 1,00E+00‐ MAP0703 50 51 4 202 51 8 8,64E‐01 1,00E+00‐ MAP0704 309 475 17 818 219 18 8,28E‐01 1,00E+00‐ MAP0705 1179 1151 57 1888 647 50 8,37E‐01 1,00E+00‐ MAP0706 401 357 18 459 412 21 6,41E‐01 1,00E+00‐ MAP0707 206 254 11 356 100 9 6,82E‐01 1,00E+00‐ MAP0708 198 0 2 102 102 2 4,85E‐01 1,00E+00‐ MAP0709 101 23 4 255 153 13 7,25E‐02 1,00E+00‐ MAP0710c 254 250 17 606 203 22 4,96E‐01 1,00E+00‐ MAP0711c 1475 1314 96 1550 954 78 6,89E‐01 1,00E+00‐ MAP0712c 1082 1613 118 1699 1018 109 9,79E‐01 1,00E+00‐ MAP0713 297 192 11 390 102 9 6,33E‐01 1,00E+00‐ MAP0714c 51 51 10 50 0 3 8,54E‐02 1,00E+00‐ MAP0715c 85 102 7 308 0 7 4,93E‐01 1,00E+00

181









‐ MAP0716c 656 357 27 757 318 24 9,20E‐01 1,00E+00‐ MAP0717c 29 302 20 519 102 29 2,65E‐01 1,00E+00‐ MAP0718c 909 1058 46 1577 435 36 6,33E‐01 1,00E+00‐ MAP0719c 1477 1465 259 2881 1070 284 6,31E‐01 1,00E+00‐ MAP0720c 3142 2641 132 4166 1699 110 5,78E‐01 1,00E+00‐ MAP0722 2170 1692 87 3175 785 67 4,84E‐01 1,00E+00fadE12_1 MAP0723 991 612 40 1213 664 41 8,49E‐01 1,00E+00fadA6_2 MAP0724 425 428 21 908 303 24 5,88E‐01 1,00E+00‐ MAP0725 0 97 4 0 45 3 5,63E‐01 1,00E+00‐ MAP0726 8 43 2 145 0 4 5,88E‐01 1,00E+00‐ MAP0727 561 466 23 614 378 20 9,31E‐01 1,00E+00‐ MAP0728 244 47 30 317 142 38 3,98E‐01 1,00E+00‐ MAP0729c 125 220 48 577 0 49 8,07E‐01 1,00E+00‐ MAP0730c 905 701 39 1606 353 35 9,03E‐01 1,00E+00‐ MAP0731c 39 0 1 51 51 3 9,35E‐01 1,00E+00‐ MAP0732c 0 89 2 51 81 4 5,83E‐01 1,00E+00‐ MAP0733c 36 187 3 167 25 2 4,82E‐01 1,00E+00‐ MAP0734 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP0735 403 665 28 811 153 18 3,93E‐01 1,00E+00‐ MAP0736 51 117 6 100 0 2 9,19E‐01 1,00E+00‐ MAP0737 51 51 3 297 0 5 8,08E‐01 1,00E+00‐ MAP0738c 519 704 26 620 336 18 4,81E‐01 1,00E+00‐ MAP0739 51 357 23 102 50 8 6,36E‐02 1,00E+00‐ MAP0740c 755 1509 73 1313 565 53 4,36E‐01 1,00E+00‐ MAP0741c 1215 3533 387 3226 1375 329 6,89E‐01 1,00E+00‐ MAP0742c 3004 3467 163 5089 2862 180 6,14E‐01 1,00E+00‐ MAP0743c 891 858 46 1302 525 40 8,25E‐01 1,00E+00‐ MAP0744c 0 0 0 255 0 4 0,00E+00 1,00E+00‐ MAP0745c 149 102 14 202 51 10 5,20E‐01 1,00E+00‐ MAP0746 51 127 7 125 74 8 5,02E‐01 1,00E+00

182









‐ MAP0747 0 195 4 152 87 5 5,73E‐01 1,00E+00‐ MAP0748 152 152 7 151 0 2 6,53E‐02 1,00E+00‐ MAP0749c 197 0 4 0 0 0 1,00E+00 1,00E+00‐ MAP0750c 554 896 73 564 350 43 2,21E‐01 1,00E+00‐ MAP0752c 939 1037 46 1397 524 36 6,43E‐01 1,00E+00‐ MAP0753c 776 332 165 824 143 99 2,47E‐01 1,00E+00‐ MAP0754c 395 153 23 468 200 23 9,26E‐01 1,00E+00aldA_2 MAP0755 606 752 24 901 245 16 3,73E‐01 1,00E+00‐ MAP0756 576 1271 43 1183 266 26 2,48E‐01 1,00E+00‐ MAP0757 1093 1513 95 1161 889 72 5,43E‐01 1,00E+00‐ MAP0758 1359 2493 129 2155 974 91 3,37E‐01 1,00E+00‐ MAP0759 3072 4906 180 4798 2392 144 5,41E‐01 1,00E+00‐ MAP0760 3188 4868 225 4037 2619 174 4,62E‐01 1,00E+00‐ MAP0761 3369 5168 218 5843 2766 192 8,36E‐01 1,00E+00‐ MAP0762 1597 1885 140 3117 1614 169 5,07E‐01 1,00E+00‐ MAP0763 341 384 31 465 38 14 9,12E‐02 1,00E+00‐ MAP0764 197 175 8 216 0 2 6,24E‐02 1,00E+00‐ MAP0765 743 424 20 698 254 13 3,46E‐01 1,00E+00‐ MAP0766c 3100 3165 349 4504 2165 320 8,30E‐01 1,00E+00‐ MAP0767c 359 1028 57 693 408 42 5,94E‐01 1,00E+00‐ MAP0768c 1418 1773 102 2943 1051 105 7,94E‐01 1,00E+00‐ MAP0769 6679 7914 1004 10502 3984 824 5,07E‐01 1,00E+00‐ MAP0770c 333 374 38 385 246 31 7,36E‐01 1,00E+00‐ MAP0771 0 99 3 204 102 11 1,17E‐01 1,00E+00‐ MAP0772 51 140 7 81 102 8 5,00E‐01 1,00E+00‐ MAP0773 275 282 27 115 153 14 1,65E‐01 1,00E+00‐ MAP0774c 1362 2214 73 1727 1082 53 4,13E‐01 1,00E+00‐ MAP0775 890 1079 77 1550 921 88 5,73E‐01 1,00E+00‐ MAP0776c 680 740 92 708 539 77 7,97E‐01 1,00E+00‐ MAP0777c 995 1299 87 1049 773 66 5,20E‐01 1,00E+00

183









‐ MAP0778 522 858 74 1200 436 73 8,91E‐01 1,00E+00‐ MAP0779 3031 2736 141 4649 2209 144 8,67E‐01 1,00E+00fadD3_2 MAP0780 240 306 10 162 261 9 8,50E‐01 1,00E+00fadD16 MAP0781 215 46 12 465 212 26 8,87E‐02 1,00E+00‐ MAP0782 0 2 0 31 0 2 2,09E‐30 1,00E+00pdc MAP0783c 1117 1621 46 2146 971 45 8,98E‐01 1,00E+00‐ MAP0784 11137 12523 1543 14208 4872 1006 4,64E‐01 1,00E+00far MAP0785 1102 853 53 1718 397 42 6,42E‐01 1,00E+00‐ MAP0786 8128 16098 1474 12982 6810 1089 7,23E‐01 1,00E+00‐ MAP0787 1836 2946 299 2776 1004 196 2,32E‐01 1,00E+00‐ MAP0788c 152 545 16 1018 153 20 5,17E‐01 1,00E+00fadA_1 MAP0789 9697 10865 491 16690 5245 416 9,53E‐01 1,00E+00fadB_1 MAP0790 36116 42410 1056 60092 18665 842 3,65E‐01 1,00E+00‐ MAP0791c 554 239 39 392 255 28 5,30E‐01 1,00E+00‐ MAP0792c 217 419 20 255 134 11 2,16E‐01 1,00E+00‐ MAP0793c 138 143 6 301 64 6 8,22E‐01 1,00E+00‐ MAP0794 210 635 42 233 141 17 5,88E‐02 1,00E+00‐ MAP0795 342 247 18 692 186 20 7,14E‐01 1,00E+00‐ MAP0796c 53 573 57 560 371 85 2,55E‐01 1,00E+00‐ MAP0797 47 100 9 44 0 1 1,49E‐03 1,00E+00‐ MAP0798 357 407 19 555 51 10 1,66E‐01 1,00E+00‐ MAP0799c 1955 3333 91 4080 1251 74 5,69E‐01 1,00E+00‐ MAP0800c 778 1326 26 1293 743 23 8,46E‐01 1,00E+00‐ MAP0801 508 696 131 829 532 137 7,42E‐01 1,00E+00moaC MAP0802 834 611 80 974 351 59 5,60E‐01 1,00E+00mog MAP0803 85 394 27 302 102 19 5,43E‐01 1,00E+00moaE2 MAP0804 204 347 36 293 153 26 5,65E‐01 1,00E+00‐ MAP0805c 559 1312 69 2066 680 84 4,64E‐01 1,00E+00‐ predicted RNA 2314 5174 4304 2783 2010 2684 9,99E‐02 1,00E+00moaD2 MAP0806c 430 1416 181 953 655 154 7,88E‐01 1,00E+00

184









‐ MAP0807c 543 803 61 1325 795 88 2,35E‐01 1,00E+00‐ MAP0808 0 51 2 0 0 0 1,00E+00 1,00E+00‐ MAP0809c 1274 1460 193 1985 1097 195 8,44E‐01 1,00E+00cspB MAP0810 3115 3161 437 4975 1978 402 8,30E‐01 1,00E+00fadE10 MAP0811 1760 1484 49 4499 659 54 6,45E‐01 1,00E+00‐ MAP0812 904 1176 59 2133 611 61 7,78E‐01 1,00E+00‐ MAP0813c 153 204 10 152 102 7 3,05E‐01 1,00E+00‐ MAP0814c 235 411 36 301 57 15 6,90E‐02 1,00E+00‐ MAP0815c 721 1014 29 756 755 26 8,86E‐01 1,00E+00‐ MAP0816 1037 741 56 2299 438 61 6,68E‐01 1,00E+00‐ MAP0819 298 285 39 384 51 20 1,59E‐01 1,00E+00‐ MAP0820 266 728 31 874 484 40 3,96E‐01 1,00E+00‐ MAP0821 142 400 50 178 243 43 8,59E‐01 1,00E+00‐ MAP0822c 5183 6553 442 8402 3437 375 7,63E‐01 1,00E+00serC MAP0823c 1635 1305 76 2915 709 70 9,31E‐01 1,00E+00‐ MAP0824 40023 28543 1972 75155 17831 1981 2,38E‐01 1,00E+00fprB MAP0825 2159 1511 63 4322 867 64 8,71E‐01 1,00E+00‐ MAP0826c 255 269 31 211 102 16 1,68E‐01 1,00E+00citA MAP0827c 507 650 29 902 204 21 5,26E‐01 1,00E+00pdxH MAP0828 1243 880 94 1528 799 89 9,80E‐01 1,00E+00gltA MAP0829 9066 10641 439 14547 5319 363 8,87E‐01 1,00E+00‐ MAP0830c 357 568 17 763 608 24 2,23E‐01 1,00E+00‐ MAP0831c 365 394 83 1052 303 116 3,01E‐01 1,00E+00IS1601_B_1 MAP0832c 396 616 23 711 235 17 6,25E‐01 1,00E+00‐ MAP0833c 779 789 33 1009 560 29 9,03E‐01 1,00E+00‐ MAP0834c 780 1207 80 1283 799 78 9,40E‐01 1,00E+00‐ MAP0835c 0 0 0 0 48 1 0,00E+00 1,00E+00‐ MAP0836 139 0 3 102 72 3 5,07E‐01 1,00E+00‐ MAP0837 102 102 2 247 0 1 7,28E‐01 1,00E+00‐ MAP0838c 0 0 0 43 0 1 0,00E+00 1,00E+00

185









accD3 MAP0839c 153 0 3 355 51 5 3,82E‐01 1,00E+00echA6 MAP0840 828 1018 72 1378 609 66 9,27E‐01 1,00E+00‐ MAP0841 552 659 31 1071 422 32 7,89E‐01 1,00E+00‐ MAP0842 708 813 27 926 712 28 8,03E‐01 1,00E+00ctpE MAP0843 1021 966 24 2079 414 22 9,08E‐01 1,00E+00‐ MAP0845 802 1267 127 1586 745 126 8,98E‐01 1,00E+00‐ MAP0846 178 224 26 240 181 26 8,27E‐01 1,00E+00‐ MAP0847 10135 16287 465 18825 8522 418 5,67E‐01 1,00E+00‐ MAP0848 604 1136 127 1059 257 74 2,25E‐01 1,00E+00‐ MAP0849c 561 324 21 1170 390 29 2,87E‐01 1,00E+00‐ MAP0850c 711 1092 43 2502 908 67 1,29E‐01 1,00E+00‐ MAP0851 19 148 5 102 72 5 5,03E‐01 1,00E+00‐ MAP0852 1814 3103 256 2826 1202 180 3,41E‐01 1,00E+00‐ MAP0853 603 721 57 1195 493 62 7,24E‐01 1,00E+00‐ MAP0854 6245 8979 276 13228 6395 312 5,65E‐01 1,00E+00‐ MAP0855 8014 10396 560 15572 5272 515 8,99E‐01 1,00E+00‐ MAP0856c 3310 3869 120 6704 2920 137 5,87E‐01 1,00E+00‐ MAP0857c 0 0 0 30 0 1 0,00E+00 1,00E+00‐ MAP0858 447 441 47 593 485 55 5,19E‐01 1,00E+00‐ MAP0859c 2165 3589 269 3897 2002 246 7,94E‐01 1,00E+00‐ MAP0860c 4927 6634 372 8019 3373 312 7,55E‐01 1,00E+00‐ MAP0861 506 120 56 522 469 83 2,30E‐01 1,00E+00‐ MAP0862 1806 3747 144 4215 1877 139 9,17E‐01 1,00E+00‐ MAP0863 2237 1666 170 5118 1651 232 3,21E‐01 1,00E+00‐ MAP0864 333 681 67 670 322 58 9,12E‐01 1,00E+00‐ MAP0865 939 994 44 2636 1145 73 7,77E‐02 1,00E+00‐ MAP0866 1733 1695 124 2810 901 106 7,51E‐01 1,00E+00‐ MAP0867c 2333 2767 179 3338 702 105 1,13E‐01 1,00E+00‐ MAP0868c 1740 2007 100 3008 1153 92 9,02E‐01 1,00E+00nramp MAP0869c 272 904 25 786 255 18 5,75E‐01 1,00E+00

186









‐ MAP0870c 134 125 7 354 202 13 1,34E‐01 1,00E+00‐ MAP0871c 128 94 8 75 49 4 5,05E‐01 1,00E+00phoS2_2 MAP0872 2404 2088 118 5253 1335 131 7,45E‐01 1,00E+00pstC2_2 MAP0873 1331 1282 77 1588 696 57 4,82E‐01 1,00E+00pstA1_2 MAP0874 456 387 27 1121 304 35 3,88E‐01 1,00E+00‐ MAP0875c 4058 4839 282 8797 3008 303 7,24E‐01 1,00E+00‐ MAP0876c 202 348 17 339 51 8 1,56E‐01 1,00E+00‐ MAP0877c 205 583 15 588 551 23 2,18E‐01 1,00E+00‐ MAP0878c 153 303 14 509 186 19 4,80E‐01 1,00E+00‐ MAP0879c 804 1366 40 1372 632 32 6,41E‐01 1,00E+00‐ MAP0880 1026 765 22 1644 883 28 4,36E‐01 1,00E+00‐ MAP0881 280 503 11 499 278 10 8,89E‐01 1,00E+00‐ MAP0882c 50 101 4 101 0 1 6,67E‐01 1,00E+00echA12_1 MAP0883 3442 5185 285 5835 3905 304 7,43E‐01 1,00E+00‐ MAP0884c 464 885 44 1025 378 38 8,75E‐01 1,00E+00‐ MAP0885c 1079 1535 98 2032 1005 100 8,12E‐01 1,00E+00‐ MAP0886c 813 1387 68 939 710 49 4,64E‐01 1,00E+00‐ MAP0887c 5294 4009 296 7623 2861 270 9,44E‐01 1,00E+00‐ MAP0888 254 709 32 835 255 30 9,67E‐01 1,00E+00‐ MAP0889 670 967 54 1091 586 49 9,58E‐01 1,00E+00‐ MAP0890 865 1095 74 1720 254 52 4,49E‐01 1,00E+00pgi MAP0891c 1250 1116 41 2099 865 43 7,72E‐01 1,00E+00‐ MAP0892c 2539 3654 553 4755 1741 480 6,53E‐01 1,00E+00uvrD MAP0893 2384 3324 70 4444 2064 69 9,87E‐01 1,00E+00‐ MAP0894c 1437 2486 178 2694 1283 159 8,26E‐01 1,00E+00‐ MAP0895c 2982 3596 168 3856 2497 150 7,71E‐01 1,00E+00sucC MAP0896 2163 2491 110 3201 987 78 3,61E‐01 1,00E+00sucD MAP0897 1557 2305 122 2445 560 72 1,31E‐01 1,00E+00‐ MAP0898 102 384 8 356 153 8 9,85E‐01 1,00E+00‐ MAP0899c 45 95 4 407 0 8 5,64E‐01 1,00E+00

187









‐ MAP0900 1890 2284 134 3737 1372 135 9,46E‐01 1,00E+00‐ MAP0901 1021 1263 47 1938 1247 60 3,49E‐01 1,00E+00purN MAP0902 1527 1382 134 2281 1564 165 4,10E‐01 1,00E+00purH MAP0903 882 1421 41 1632 722 36 8,54E‐01 1,00E+00‐ MAP0904 13851 9369 927 22136 6424 873 5,73E‐01 1,00E+00‐ MAP0905 2361 2741 106 4909 1570 107 9,42E‐01 1,00E+00‐ MAP0906 4712 5253 145 6699 2989 120 7,54E‐01 1,00E+00‐ MAP0907 1882 2422 146 3218 1397 133 8,49E‐01 1,00E+00‐ MAP0908c 2552 2999 251 3681 1289 182 3,63E‐01 1,00E+00echA7 MAP0909c 253 307 20 232 247 18 8,78E‐01 1,00E+00fadE12_2 MAP0910c 1110 944 51 1860 710 52 8,10E‐01 1,00E+00accA2 MAP0911c 2644 1808 66 3525 1519 62 8,94E‐01 1,00E+00accD2 MAP0912c 1088 1695 49 2588 1289 61 3,92E‐01 1,00E+00fadE13 MAP0913c 550 575 28 890 406 28 8,49E‐01 1,00E+00‐ MAP0914c 557 681 20 952 158 13 3,29E‐01 1,00E+00rpmF MAP0915 956 754 288 1249 816 318 6,72E‐01 1,00E+00‐ MAP0916 2081 3700 239 4934 1864 236 9,93E‐01 1,00E+00‐ MAP0917 3275 3760 132 6175 2243 129 9,38E‐01 1,00E+00‐ MAP0918 5035 5113 201 8796 3000 188 9,93E‐01 1,00E+00moaB2 MAP0919 2686 3418 315 5583 1789 305 9,87E‐01 1,00E+00mscL MAP0920c 871 1533 149 3055 609 170 5,96E‐01 1,00E+00‐ MAP0921c 340 293 27 632 567 50 7,32E‐02 1,00E+00‐ MAP0922c 320 356 59 957 257 82 3,17E‐01 1,00E+00‐ MAP0923c 99 50 6 150 85 8 6,63E‐01 1,00E+00galU MAP0924 5613 6585 387 10497 4295 395 7,93E‐01 1,00E+00moeA MAP0925 1252 1536 62 1659 851 50 6,43E‐01 1,00E+00rimJ MAP0926 668 1362 87 1379 931 95 6,74E‐01 1,00E+00‐ MAP0927 4387 5811 261 10094 3035 267 8,15E‐01 1,00E+00‐ MAP0928 1126 1217 444 1696 802 408 9,57E‐01 1,00E+00‐ MAP0929 110 308 68 266 41 36 1,95E‐01 1,00E+00

188









‐ MAP0930 146 373 23 317 149 18 7,28E‐01 1,00E+00‐ MAP0931 236 54 17 252 59 13 3,86E‐01 1,00E+00‐ MAP0932c 349 508 39 309 203 22 2,13E‐01 1,00E+00‐ MAP0933 160 100 6 152 51 3 3,56E‐01 1,00E+00‐ MAP0934 424 409 21 1874 204 35 1,17E‐01 1,00E+00‐ MAP0935 560 811 38 611 607 35 9,55E‐01 1,00E+00gmhA MAP0936 408 226 31 557 101 22 5,45E‐01 1,00E+00‐ MAP0937 51 47 5 50 30 3 5,61E‐01 1,00E+00‐ MAP0938 218 300 14 78 232 11 5,99E‐01 1,00E+00‐ MAP0939 0 83 2 204 0 4 5,67E‐01 1,00E+00‐ MAP0940 203 134 14 287 51 10 3,69E‐01 1,00E+00‐ MAP0941 172 72 13 254 87 14 4,29E‐01 1,00E+00arcA MAP0942 1008 1143 51 1578 659 45 8,18E‐01 1,00E+00‐ MAP0943c 509 1190 31 608 455 19 2,86E‐01 1,00E+00‐ MAP0944 136 341 15 670 150 21 4,38E‐01 1,00E+00pabB MAP0945c 994 1102 46 1698 555 40 7,76E‐01 1,00E+00‐ MAP0946c 186 49 7 350 51 8 4,15E‐01 1,00E+00‐ MAP0947c 0 0 0 101 0 1 0,00E+00 1,00E+00‐ MAP0948 966 1447 40 1668 407 26 3,02E‐01 1,00E+00‐ MAP0949 1677 1649 52 2123 965 41 5,67E‐01 1,00E+00‐ MAP0950c 133 194 11 273 0 5 2,10E‐01 1,00E+00‐ MAP0951 229 528 13 444 292 12 9,33E‐01 1,00E+00‐ MAP0952 1188 2038 62 2188 1320 63 8,33E‐01 1,00E+00‐ MAP0953 1872 3212 97 3361 1691 85 7,49E‐01 1,00E+00‐ MAP0954 325 281 17 619 112 15 8,27E‐01 1,00E+00‐ MAP0955 102 189 8 130 69 5 3,15E‐01 1,00E+00‐ MAP0956 680 1137 30 1118 201 16 1,33E‐01 1,00E+00‐ MAP0957c 253 623 27 255 255 16 3,01E‐01 1,00E+00‐ MAP0958c 568 1032 39 790 439 27 4,74E‐01 1,00E+00‐ MAP0959 49 51 6 51 51 6 5,00E‐01 1,00E+00

189









CpsH MAP0960 35 219 14 0 0 0 1,00E+00 1,00E+00‐ MAP0961c 198 102 8 151 51 4 2,38E‐01 1,00E+00‐ MAP0962c 102 351 6 775 102 9 3,62E‐01 1,00E+00‐ MAP0963c 153 305 8 499 303 14 1,92E‐01 1,00E+00‐ MAP0964c 94 102 3 253 51 4 7,18E‐01 1,00E+00‐ MAP0965c 201 204 20 203 51 9 1,55E‐01 1,00E+00‐ MAP0966c 100 151 5 27 101 3 6,16E‐01 1,00E+00‐ MAP0967 669 896 36 978 338 25 4,43E‐01 1,00E+00‐ MAP0968 634 1236 73 1922 594 79 6,85E‐01 1,00E+00cprA MAP0969 230 386 25 666 169 26 8,32E‐01 1,00E+00‐ MAP0970 1345 1347 37 2444 811 36 9,40E‐01 1,00E+00‐ MAP0971 204 201 11 322 204 13 5,78E‐01 1,00E+00metG MAP0972c 2212 3080 97 3441 1940 89 8,18E‐01 1,00E+00‐ predicted RNA 1164 1462 4205 1895 1238 4673 6,18E‐01 1,00E+00‐ MAP0974 4133 5145 239 7534 2702 216 9,20E‐01 1,00E+00ksgA MAP0975 376 1114 43 1426 735 57 3,52E‐01 1,00E+00‐ MAP0976 373 710 32 1047 559 43 3,15E‐01 1,00E+00pks16 MAP0977 6296 7015 235 9783 3360 188 4,48E‐01 1,00E+00pth MAP0978c 101 101 10 203 48 9 5,15E‐01 1,00E+00rplY MAP0979c 970 1096 90 1829 491 78 7,92E‐01 1,00E+00‐ MAP0980c 159 342 16 102 99 6 9,08E‐02 1,00E+00lpqT MAP0981c 306 1005 55 844 519 54 8,68E‐01 1,00E+00arsC MAP0982c 822 1119 160 951 304 83 1,10E‐01 1,00E+00prsA MAP0983c 4413 3744 243 5978 2363 204 7,04E‐01 1,00E+00glmU MAP0984c 1179 1729 56 2001 627 41 4,57E‐01 1,00E+00‐ MAP0985 1570 1840 160 3133 980 153 9,69E‐01 1,00E+00lysA_1 MAP0986c 0 0 0 102 0 1 0,00E+00 1,00E+00mfd MAP0987 2818 3650 50 6020 2441 55 6,18E‐01 1,00E+00‐ MAP0988 821 1239 58 1624 510 49 7,11E‐01 1,00E+00lpqU MAP0989 1683 2044 135 2394 1399 125 9,16E‐01 1,00E+00

190









eno MAP0990 1462 2423 85 2908 961 69 6,12E‐01 1,00E+00‐ MAP0991 0 245 9 220 254 21 9,98E‐02 1,00E+00‐ MAP0992 1055 2164 186 1908 1162 166 8,52E‐01 1,00E+00‐ MAP0993 1843 2638 135 3021 1360 114 6,81E‐01 1,00E+00‐ MAP0994 101 152 22 204 0 10 2,38E‐01 1,00E+00kdpE MAP0995c 405 543 40 822 312 39 8,09E‐01 1,00E+00kdpD MAP0996c 1479 1673 35 2321 956 30 7,97E‐01 1,00E+00kdpC MAP0997c 270 273 18 253 102 9 2,02E‐01 1,00E+00‐ MAP0998c 0 51 2 159 55 7 8,88E‐02 1,00E+00‐ MAP0999c 542 175 14 1035 203 17 5,21E‐01 1,00E+00kdpA MAP1000c 1660 637 41 1926 302 27 2,97E‐01 1,00E+00‐ MAP1001c 7689 8689 308 14392 4897 293 9,05E‐01 1,00E+00‐ MAP1002c 20162 22425 1594 43618 14115 1727 1,65E‐01 1,00E+00‐ predicted RNA 35430 32640 11835 55444 16995 9879 3,15E‐01 1,00E+00‐ predicted RNA 21692 23065 15847 44176 10043 14348 3,29E‐01 1,00E+00PE MAP1003c 5643 5856 159 6993 1496 87 7,69E‐02 1,00E+00‐ MAP1004 254 597 19 605 399 22 6,13E‐01 1,00E+00‐ MAP1007 756 726 36 1248 153 23 3,54E‐01 1,00E+00fadD14 MAP1008 1202 1648 49 2264 765 42 8,12E‐01 1,00E+00‐ MAP1010 101 354 14 243 51 7 1,58E‐01 1,00E+00‐ MAP1011 51 148 6 114 0 2 4,92E‐01 1,00E+00‐ MAP1012c 304 347 17 516 99 12 4,64E‐01 1,00E+00lpqV MAP1013c 177 173 22 323 100 21 9,26E‐01 1,00E+00‐ MAP1014 647 1002 80 2398 262 88 6,80E‐01 1,00E+00‐ MAP1016c 1068 1850 46 1727 677 32 3,78E‐01 1,00E+00echA8_1 MAP1017c 671 952 58 827 352 36 2,99E‐01 1,00E+00echA9 MAP1018c 1667 1238 81 2189 415 52 2,42E‐01 1,00E+00‐ MAP1019 4234 3351 261 7560 3044 301 5,91E‐01 1,00E+00‐ MAP1020c 153 216 28 631 51 34 5,22E‐01 1,00E+00‐ MAP1021c 2729 4247 236 5206 1229 166 2,25E‐01 1,00E+00

191









‐ MAP1022c 1213 1869 90 2558 1110 92 7,95E‐01 1,00E+00lipU MAP1023 845 998 49 1508 439 41 7,29E‐01 1,00E+00cysM2 MAP1024 558 1020 31 1476 454 31 8,94E‐01 1,00E+00pra MAP1025 1906 1441 135 2136 1011 108 5,82E‐01 1,00E+00greA MAP1027c 10171 11021 1242 15959 6067 1064 9,96E‐01 1,00E+00‐ MAP1028c 0 250 15 104 55 9 7,18E‐01 1,00E+00‐ MAP1029 2323 2396 153 2651 918 93 1,43E‐01 1,00E+00‐ MAP1030 3813 4505 319 6615 2891 310 9,39E‐01 1,00E+00speE MAP1031c 201 51 4 152 0 1 1,23E‐01 1,00E+00‐ MAP1032c 98 218 19 151 0 5 6,32E‐02 1,00E+00‐ MAP1033 405 426 19 1171 486 33 1,18E‐01 1,00E+00‐ MAP1034c 0 51 2 0 51 4 5,68E‐01 1,00E+00‐ MAP1035c 258 175 20 651 113 25 5,22E‐01 1,00E+00ruvC MAP1036 1031 2069 154 2132 1275 158 7,96E‐01 1,00E+00ruvA MAP1037 202 143 16 133 171 15 9,85E‐01 1,00E+00ruvB MAP1038 273 147 11 411 153 12 7,57E‐01 1,00E+00‐ MAP1039 4201 4600 270 10874 2541 309 6,04E‐01 1,00E+00fadD9 MAP1040c 457 785 10 760 254 6 3,95E‐01 1,00E+00gabT MAP1041c 455 646 23 1444 254 26 6,06E‐01 1,00E+00yajC MAP1042 490 322 73 294 142 33 8,47E‐02 1,00E+00secD MAP1043 1945 2644 72 3375 1014 54 4,71E‐01 1,00E+00secF MAP1044 812 1475 49 1966 610 45 9,25E‐01 1,00E+00‐ MAP1045 765 1012 30 1075 559 24 7,13E‐01 1,00E+00apt MAP1046 205 659 44 592 305 42 9,77E‐01 1,00E+00relA MAP1047 6637 9447 194 11973 4612 168 7,74E‐01 1,00E+00‐ MAP1048c 153 152 8 200 252 14 2,18E‐01 1,00E+00pknE MAP1049c 337 944 21 497 290 12 1,91E‐01 1,00E+00ppiB MAP1050c 2922 2390 165 3603 1013 110 2,53E‐01 1,00E+00‐ MAP1051 663 435 49 818 203 34 4,51E‐01 1,00E+00hisS MAP1052 850 672 35 1403 601 38 6,93E‐01 1,00E+00

192









‐ MAP1054 0 51 1 208 98 7 3,66E‐03 1,00E+00‐ MAP1055c 94 152 4 203 0 2 2,69E‐01 1,00E+00‐ MAP1056 1378 1768 185 1929 457 106 1,21E‐01 1,00E+00‐ MAP1057c 51 79 6 77 0 2 9,23E‐01 1,00E+00‐ MAP1058 713 521 45 1108 290 38 8,51E‐01 1,00E+00dapA_1 MAP1059 0 116 3 392 143 14 8,24E‐03 1,00E+00‐ MAP1060c 509 694 39 1523 436 50 4,05E‐01 1,00E+00‐ MAP1061c 946 1075 117 1018 404 68 2,00E‐01 1,00E+00‐ MAP1062c 204 354 19 273 150 13 4,84E‐01 1,00E+00aspS MAP1063 1284 1447 44 2044 1122 46 7,80E‐01 1,00E+00‐ MAP1064 2964 5713 528 5610 2102 395 4,36E‐01 1,00E+00‐ predicted RNA 20063 23543 24721 21581 14203 18871 8,94E‐01 1,00E+00‐ MAP1065 573 635 81 1232 463 93 5,74E‐01 1,00E+00‐ MAP1066 240 121 10 120 85 5 1,98E‐01 1,00E+00‐ MAP1067c 561 679 91 1069 353 84 1,00E+00 1,00E+00‐ MAP1068 1221 956 68 2398 712 75 6,46E‐01 1,00E+00‐ MAP1069 1529 1248 79 3045 916 88 6,06E‐01 1,00E+00‐ MAP1070c 406 535 10 714 458 11 5,35E‐01 1,00E+00‐ MAP1071c 389 393 23 609 0 10 8,95E‐02 1,00E+00‐ MAP1072 172 246 8 374 226 11 4,23E‐01 1,00E+00‐ MAP1073 112 84 17 82 83 14 5,24E‐01 1,00E+00‐ MAP1074c 334 313 61 433 0 24 5,67E‐02 1,00E+00‐ MAP1075c 527 184 80 541 239 72 8,62E‐01 1,00E+00‐ MAP1076 697 1241 137 1260 643 120 8,28E‐01 1,00E+00alaS MAP1077 5462 6336 126 9818 3595 117 9,48E‐01 1,00E+00‐ MAP1078 50 107 8 204 47 10 5,20E‐01 1,00E+00‐ MAP1079 2870 3795 153 4262 1620 112 2,94E‐01 1,00E+00aroE MAP1080 97 190 9 253 58 8 5,50E‐01 1,00E+00‐ MAP1081 28 0 2 0 51 4 9,39E‐01 1,00E+00‐ MAP1082c 92 138 6 384 177 12 1,13E‐01 1,00E+00

193









‐ MAP1083c 644 771 32 2382 508 49 1,69E‐01 1,00E+00‐ MAP1084c 51 51 3 51 0 0 1,28E‐01 1,00E+00‐ MAP1085 354 352 16 701 97 13 6,51E‐01 1,00E+00‐ MAP1086 141 489 10 839 305 17 1,95E‐01 1,00E+00‐ MAP1088 51 0 3 116 101 12 6,50E‐02 1,00E+00‐ MAP1089 0 51 1 196 0 4 8,24E‐01 1,00E+00dppD_2 MAP1090 0 51 0 82 0 0 5,00E‐01 1,00E+00aroF MAP1091 1069 577 40 1456 458 36 8,98E‐01 1,00E+00aroK MAP1092 835 802 89 1195 508 78 8,54E‐01 1,00E+00aroB MAP1093 594 851 37 1729 755 55 1,97E‐01 1,00E+00aroD MAP1094 125 276 26 573 109 33 4,73E‐01 1,00E+00‐ MAP1095c 1969 1876 166 2587 916 122 3,99E‐01 1,00E+00pepQ MAP1096 1313 2125 88 1881 537 49 9,11E‐02 1,00E+00efp MAP1097 2245 1590 200 4508 1393 240 5,71E‐01 1,00E+00nusB MAP1098 380 808 71 721 466 67 9,29E‐01 1,00E+00‐ MAP1099 642 1473 152 1047 297 77 9,29E‐02 1,00E+00adi MAP1100 3688 5371 90 6455 2217 71 5,77E‐01 1,00E+00‐ MAP1101 99 153 5 203 151 6 3,20E‐01 1,00E+00tcrA MAP1102c 253 309 24 880 197 34 3,08E‐01 1,00E+00‐ MAP1103c 51 2 5 117 0 6 5,27E‐01 1,00E+00‐ MAP1104c 343 399 26 750 102 21 6,79E‐01 1,00E+00‐ MAP1105 102 51 4 226 0 4 5,18E‐01 1,00E+00‐ MAP1106 100 0 13 151 13 13 4,93E‐01 1,00E+00‐ MAP1107 0 50 2 354 12 12 1,09E‐02 1,00E+00‐ MAP1108 0 41 1 152 0 2 9,44E‐01 1,00E+00‐ MAP1109 102 0 3 153 0 3 5,41E‐01 1,00E+00‐ MAP1110 0 0 0 102 0 2 0,00E+00 1,00E+00frdA MAP1111 203 50 2 355 51 3 4,48E‐01 1,00E+00‐ MAP1112c 0 239 11 392 133 22 1,63E‐01 1,00E+00‐ MAP1113c 293 235 13 442 178 13 9,58E‐01 1,00E+00

194









pyrR MAP1114 85 234 15 330 78 15 7,87E‐01 1,00E+00pyrB MAP1115 184 100 8 447 51 10 4,66E‐01 1,00E+00pyrC MAP1116 194 249 9 360 102 8 7,81E‐01 1,00E+00‐ MAP1117 145 258 22 869 51 33 2,81E‐01 1,00E+00carA MAP1118 212 206 10 495 101 11 7,96E‐01 1,00E+00carB MAP1119 1294 2473 31 2261 703 20 2,14E‐01 1,00E+00pyrF MAP1120 77 51 4 90 51 4 5,06E‐01 1,00E+00‐ MAP1121c 431 529 55 650 343 51 9,76E‐01 1,00E+00mIHF MAP1122 17358 16411 2932 28417 7948 2437 5,63E‐01 1,00E+00gmk MAP1123 1391 1938 142 3096 1509 172 4,63E‐01 1,00E+00‐ MAP1124 2663 4615 633 5164 2017 528 5,84E‐01 1,00E+00dfp MAP1125 3971 7491 257 9264 3274 233 9,37E‐01 1,00E+00metK MAP1126 3428 5386 207 5904 2205 159 5,17E‐01 1,00E+00‐ MAP1127c 1518 1477 58 3121 937 62 7,08E‐01 1,00E+00lipI MAP1128c 449 574 30 611 296 23 6,65E‐01 1,00E+00‐ MAP1129 134 477 21 389 305 24 6,90E‐01 1,00E+00priA MAP1130 192 140 4 444 16 4 8,21E‐01 1,00E+00‐ MAP1131 101 102 12 488 63 22 1,99E‐01 1,00E+00‐ MAP1132c 56 96 5 54 60 4 5,28E‐01 1,00E+00fmt MAP1133 30 0 0 356 101 10 1,10E‐12 1,00E+00fmu MAP1134 51 302 6 149 117 5 5,56E‐01 1,00E+00rpe MAP1135 1400 1916 136 2207 897 107 5,72E‐01 1,00E+00ribG MAP1136 218 348 15 499 173 15 9,45E‐01 1,00E+00‐ MAP1137c 3437 5404 157 9472 2811 174 6,67E‐01 1,00E+00lprG MAP1138c 7740 9032 676 14401 4704 618 9,85E‐01 1,00E+00ribC MAP1139 198 387 27 711 354 44 1,56E‐01 1,00E+00ribA2 MAP1140 15539 18907 778 27539 11715 751 3,45E‐01 1,00E+00ribH MAP1141 458 417 52 630 227 41 6,71E‐01 1,00E+00‐ MAP1142 225 975 71 940 451 75 7,25E‐01 1,00E+00‐ MAP1143c 14437 13645 2438 28509 6240 2229 4,34E‐01 1,00E+00

195









‐ MAP1144c 0 0 0 96 42 2 0,00E+00 1,00E+00‐ MAP1145c 985 628 40 2141 832 60 1,75E‐01 1,00E+00uvrC MAP1146 1164 2271 50 2962 1076 49 9,06E‐01 1,00E+00‐ MAP1147 479 441 28 949 383 34 4,79E‐01 1,00E+00‐ MAP1148 2748 2385 139 3278 1160 97 3,19E‐01 1,00E+00‐ MAP1149 903 1484 69 1802 669 60 8,08E‐01 1,00E+00‐ MAP1150c 674 568 29 942 427 27 9,85E‐01 1,00E+00‐ MAP1151c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP1152 504 493 23 1193 54 18 6,83E‐01 1,00E+00‐ MAP1153 1757 1135 62 3078 1040 70 5,84E‐01 1,00E+00‐ MAP1154 1580 959 213 3434 444 218 8,07E‐01 1,00E+00‐ MAP1155 511 595 33 975 193 25 6,74E‐01 1,00E+00‐ MAP1156 2972 3815 140 7096 1963 145 7,70E‐01 1,00E+00‐ MAP1157c 100 47 6 97 51 5 5,14E‐01 1,00E+00lipO MAP1158c 450 947 31 582 348 19 2,91E‐01 1,00E+00fadD12_1 MAP1159c 1363 2005 59 2394 953 49 6,91E‐01 1,00E+00‐ MAP1160c 405 448 30 640 496 39 4,00E‐01 1,00E+00‐ MAP1161 653 195 68 644 0 29 6,12E‐02 1,00E+00‐ MAP1162 140 445 9 517 501 17 8,42E‐02 1,00E+00‐ MAP1163 171 130 6 224 199 8 3,16E‐01 1,00E+00gap MAP1164 5743 5049 309 10728 2693 290 9,88E‐01 1,00E+00pgk MAP1165 1181 1520 62 2802 660 60 9,27E‐01 1,00E+00tpiA MAP1166 1203 2484 132 3279 966 122 9,33E‐01 1,00E+00secG MAP1167 1261 1946 391 1515 1233 330 7,21E‐01 1,00E+00‐ MAP1168c 51 50 3 148 102 7 2,05E‐01 1,00E+00ppc MAP1169 606 610 12 1683 336 15 4,96E‐01 1,00E+00‐ MAP1170 102 138 8 252 102 10 3,77E‐01 1,00E+00‐ MAP1171 457 671 32 430 253 18 1,79E‐01 1,00E+00‐ MAP1172c 451 489 29 447 204 17 2,75E‐01 1,00E+00‐ MAP1173c 2211 2269 326 3087 1858 326 9,74E‐01 1,00E+00

196









devB MAP1174c 658 1496 80 1755 651 75 9,98E‐01 1,00E+00opcA MAP1175c 1096 1717 88 1542 743 62 4,24E‐01 1,00E+00zwf2 MAP1176c 3032 5125 150 6626 2947 153 8,44E‐01 1,00E+00tal MAP1177c 7081 7236 371 13205 3554 333 7,85E‐01 1,00E+00tkt MAP1178c 7127 7053 196 11540 4389 181 8,60E‐01 1,00E+00ctaB MAP1179 2659 3868 201 4374 1554 150 3,33E‐01 1,00E+00qor MAP1180c 354 576 26 763 204 21 7,39E‐01 1,00E+00‐ MAP1181 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP1182c 153 250 12 255 102 9 6,20E‐01 1,00E+00‐ MAP1183c 567 944 55 536 297 27 8,30E‐02 1,00E+00‐ MAP1184c 621 795 43 852 397 33 6,29E‐01 1,00E+00‐ MAP1185c 543 815 22 1018 483 22 9,25E‐01 1,00E+00‐ MAP1186 950 973 66 1795 767 74 6,12E‐01 1,00E+00‐ MAP1188 3397 5619 215 9112 6137 346 6,39E‐02 1,00E+00‐ MAP1189 3005 4951 289 6714 4745 399 3,01E‐01 1,00E+00‐ MAP1190 737 1122 42 2513 1060 69 8,75E‐02 1,00E+00‐ MAP1191 1207 1715 174 2209 2205 270 1,22E‐01 1,00E+00‐ MAP1193c 153 204 13 234 105 11 7,57E‐01 1,00E+00‐ MAP1194c 1152 890 77 2811 345 80 7,66E‐01 1,00E+00fadE15 MAP1195c 1391 1541 46 2721 800 43 9,86E‐01 1,00E+00trxB MAP1196 5175 6879 979 8811 5326 1054 6,06E‐01 1,00E+00echA12_2 MAP1197 1892 1972 138 2124 763 84 1,54E‐01 1,00E+00‐ MAP1198 762 1099 32 1952 631 36 6,21E‐01 1,00E+00‐ MAP1199 2753 2375 758 2422 1314 486 2,08E‐01 1,00E+00‐ MAP1200c 200 252 22 399 116 20 9,37E‐01 1,00E+00acn MAP1201c 6293 6747 134 8334 2614 89 2,23E‐01 1,00E+00‐ MAP1202 400 460 39 856 456 53 3,23E‐01 1,00E+00‐ MAP1203 5983 7492 274 9285 5559 276 8,72E‐01 1,00E+00‐ MAP1204 1934 3112 195 3053 1410 151 4,94E‐01 1,00E+00moxR MAP1205 6584 6829 341 13663 3212 322 9,18E‐01 1,00E+00

197









‐ MAP1206 513 758 38 1372 320 38 8,25E‐01 1,00E+00‐ MAP1207 2530 3180 163 5095 1904 165 9,09E‐01 1,00E+00‐ MAP1208 0 83 2 148 0 3 5,18E‐01 1,00E+00fabG1 MAP1209 1648 2493 154 2783 1133 123 5,76E‐01 1,00E+00inhA MAP1210 2355 2445 172 4697 1548 179 8,88E‐01 1,00E+00hemH MAP1211 153 273 11 127 59 4 8,51E‐02 1,00E+00‐ MAP1212c 444 489 27 981 336 31 5,60E‐01 1,00E+00‐ MAP1213 203 609 50 1058 353 74 2,52E‐01 1,00E+00‐ MAP1214 203 239 11 730 168 17 2,65E‐01 1,00E+00‐ MAP1215 136 151 23 379 37 22 8,08E‐01 1,00E+00lpqQ MAP1216c 2157 3224 513 3050 958 307 1,34E‐01 1,00E+00‐ MAP1217c 2744 4008 247 4177 2457 223 7,96E‐01 1,00E+00‐ MAP1218c 333 254 58 456 310 70 6,01E‐01 1,00E+00‐ MAP1220c 0 51 4 0 0 0 1,00E+00 1,00E+00‐ MAP1221 70 0 3 51 0 1 8,72E‐01 1,00E+00‐ MAP1222 36 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP1223c 152 328 16 153 51 5 5,58E‐02 1,00E+00‐ MAP1224c 358 334 26 751 346 35 3,47E‐01 1,00E+00mutA MAP1225 263 619 13 679 371 14 6,60E‐01 1,00E+00mutB MAP1226 1550 1703 41 2300 889 33 6,28E‐01 1,00E+00‐ MAP1227 951 1807 79 1447 661 53 3,10E‐01 1,00E+00lipL MAP1228 1353 1652 67 2160 951 59 8,36E‐01 1,00E+00‐ MAP1229 518 828 32 908 626 34 7,04E‐01 1,00E+00‐ MAP1230 1551 1543 73 2144 526 48 2,69E‐01 1,00E+00gmdA MAP1231 2806 5017 215 4798 2449 178 6,28E‐01 1,00E+00epiA MAP1232 4709 7401 359 8300 3478 298 6,85E‐01 1,00E+00‐ MAP1233 24901 33397 2318 39886 16038 1871 3,32E‐01 1,00E+00‐ MAP1234 13225 23244 1294 22629 11450 1080 5,62E‐01 1,00E+00‐ MAP1235 16295 19533 775 30764 9496 691 4,59E‐01 1,00E+00drrC MAP1236c 1453 1916 122 1301 1160 89 4,29E‐01 1,00E+00

198









drrB MAP1237c 971 1648 100 1312 734 71 4,08E‐01 1,00E+00drrA MAP1238c 1911 2748 140 3676 1455 130 8,60E‐01 1,00E+00mmpL4_2 MAP1239c 20870 33872 534 34889 17985 461 2,80E‐01 1,00E+00mmpL4_3 MAP1240c 30665 48324 780 49266 21649 604 4,13E‐01 1,00E+00mmpS4 MAP1241c 6224 7647 953 10497 4778 903 9,33E‐01 1,00E+00‐ predicted RNA 4098 9152 4552 8424 5184 4398 9,99E‐01 1,00E+00‐ predicted RNA 18182 19709 6542 35483 10298 6178 3,63E‐01 1,00E+00pstA MAP1242 35550 47377 197 67675 21764 171 3,20E‐01 1,00E+00‐ MAP1243 843 747 81 1513 606 89 6,88E‐01 1,00E+00‐ MAP1244 1190 2104 83 3516 1040 92 6,27E‐01 1,00E+00‐ predicted RNA 5854 10008 6946 11640 5672 6710 9,16E‐01 1,00E+00‐ predicted RNA 2904 2985 4505 5097 2442 4980 6,02E‐01 1,00E+00‐ predicted RNA 12402 20084 17486 12713 10844 12646 9,41E‐01 1,00E+00‐ MAP1245 0 110 12 193 37 20 6,66E‐01 1,00E+00ileS MAP1246 2612 2944 50 3377 1215 34 2,59E‐01 1,00E+00‐ MAP1247 561 908 48 958 558 46 9,70E‐01 1,00E+00dinX MAP1248 73 151 4 454 51 7 2,74E‐01 1,00E+00ansA MAP1249c 352 374 21 218 204 12 2,51E‐01 1,00E+00lspA MAP1250 51 203 12 306 153 20 2,19E‐01 1,00E+00‐ MAP1251 254 249 15 357 100 11 5,18E‐01 1,00E+00glbN MAP1253c 153 101 18 94 51 9 2,38E‐01 1,00E+00‐ MAP1254 1806 2787 139 2474 953 87 1,65E‐01 1,00E+00‐ MAP1255 1069 1809 101 1429 611 62 1,86E‐01 1,00E+00‐ MAP1256 146 144 19 470 102 28 2,58E‐01 1,00E+00dnaE MAP1257 9298 15301 198 14514 8102 166 9,14E‐01 1,00E+00‐ MAP1258c 51 0 3 0 50 4 5,39E‐01 1,00E+00‐ MAP1259 349 345 42 651 244 44 8,20E‐01 1,00E+00fadD11_1 MAP1260 152 140 4 392 130 6 2,74E‐01 1,00E+00plsB1 MAP1261 352 819 17 849 254 13 6,47E‐01 1,00E+00‐ MAP1262 76 235 10 153 153 11 6,80E‐01 1,00E+00

199









‐ MAP1263 2107 1944 270 3408 1382 265 9,93E‐01 1,00E+00ilvA MAP1264 304 724 22 427 487 21 8,79E‐01 1,00E+00‐ MAP1265 51 50 4 0 0 0 1,00E+00 1,00E+00‐ MAP1266c 284 774 37 571 341 30 7,66E‐01 1,00E+00‐ MAP1267 151 85 5 51 0 0 6,10E‐06 1,00E+00glgZ MAP1268c 1772 1048 47 3338 910 53 5,57E‐01 1,00E+00glgY MAP1269c 1391 918 29 2516 608 29 8,51E‐01 1,00E+00glgX_1 MAP1270c 5523 8565 183 11479 4724 179 9,62E‐01 1,00E+00‐ MAP1271c 2127 2224 58 3577 1696 60 8,79E‐01 1,00E+00‐ MAP1272c 4169 5204 284 8405 3219 292 8,09E‐01 1,00E+00‐ predicted RNA 4322 5464 6410 5881 2227 4403 3,43E‐01 1,00E+00‐ MAP1273c 255 516 75 701 354 93 4,85E‐01 1,00E+00bioA MAP1274 441 295 16 357 153 9 2,37E‐01 1,00E+00bioF MAP1275 238 685 22 945 0 14 3,41E‐01 1,00E+00bioD MAP1276 30 236 10 161 0 3 1,70E‐01 1,00E+00‐ MAP1277 255 494 41 398 238 32 6,64E‐01 1,00E+00‐ MAP1278c 2289 2009 113 6675 1196 147 3,72E‐01 1,00E+00‐ MAP1279c 4432 3433 105 8994 1887 106 8,70E‐01 1,00E+00‐ MAP1280c 163 108 5 225 134 6 3,82E‐01 1,00E+00‐ MAP1281c 150 236 30 357 0 16 2,16E‐01 1,00E+00‐ MAP1282c 1549 1364 46 3970 784 54 4,78E‐01 1,00E+00bioB MAP1283 2341 2153 126 4122 1236 118 8,74E‐01 1,00E+00‐ MAP1284 1586 2378 478 3205 1336 467 9,84E‐01 1,00E+00‐ MAP1285 134 600 34 293 153 19 2,27E‐01 1,00E+00‐ MAP1286c 1848 2740 97 3281 847 68 3,21E‐01 1,00E+00IS1601_B_3 MAP1287 184 149 7 337 136 9 5,55E‐01 1,00E+00‐ MAP1288c 606 427 42 627 268 30 5,21E‐01 1,00E+00nadA MAP1289 1957 2195 114 3387 862 89 5,24E‐01 1,00E+00nadB MAP1290 434 253 12 868 406 19 1,86E‐01 1,00E+00nadC MAP1291 458 1067 50 1430 407 48 9,29E‐01 1,00E+00

200









‐ MAP1292c 102 124 15 88 196 23 2,96E‐01 1,00E+00hisD MAP1293 407 354 15 405 151 9 2,70E‐01 1,00E+00hisC MAP1294 474 261 18 596 341 20 6,74E‐01 1,00E+00hisB MAP1295 946 840 83 884 669 69 7,24E‐01 1,00E+00hisH MAP1296 882 1532 110 2088 777 109 8,70E‐01 1,00E+00hisA MAP1297 872 785 66 1198 702 68 8,32E‐01 1,00E+00impA MAP1298 226 247 17 202 64 7 1,14E‐01 1,00E+00hisF MAP1299 641 210 32 995 306 37 5,48E‐01 1,00E+00hisI MAP1300 433 539 80 1006 412 98 4,40E‐01 1,00E+00chaA MAP1301 556 798 35 913 203 21 2,89E‐01 1,00E+00bcpB MAP1302c 1246 1746 153 3589 1094 192 3,82E‐01 1,00E+00trpE MAP1303 1001 1420 45 2527 750 48 7,11E‐01 1,00E+00‐ MAP1304 243 483 47 848 204 53 6,85E‐01 1,00E+00trpC MAP1305 3421 3694 252 5304 2470 236 9,51E‐01 1,00E+00trpB MAP1306 2020 2109 94 2908 1446 87 8,65E‐01 1,00E+00trpA MAP1307 1324 1947 114 1688 582 65 1,09E‐01 1,00E+00lgt MAP1308 1913 1988 88 3201 1047 76 7,59E‐01 1,00E+00‐ MAP1309 552 515 74 497 416 61 8,24E‐01 1,00E+00pykA MAP1310 4620 6576 226 9864 4032 237 6,99E‐01 1,00E+00tesB1 MAP1311 797 932 55 1676 840 70 3,80E‐01 1,00E+00‐ MAP1312 4527 4418 179 9243 2368 177 8,95E‐01 1,00E+00cydC MAP1313c 1363 2802 69 2234 686 39 9,55E‐02 1,00E+00cydD MAP1314c 1205 1852 54 1910 919 44 6,66E‐01 1,00E+00cydB MAP1315c 8636 10217 523 16010 5788 495 8,22E‐01 1,00E+00appC MAP1316c 16128 19735 702 30222 12426 703 2,71E‐01 1,00E+00‐ MAP1317c 3487 3595 346 5400 2119 304 7,52E‐01 1,00E+00‐ MAP1318c 2271 2834 110 4211 1845 111 9,45E‐01 1,00E+00‐ MAP1319 1340 847 103 2451 795 120 5,61E‐01 1,00E+00‐ MAP1320c 335 390 17 708 202 16 9,63E‐01 1,00E+00polA MAP1322 1503 2230 38 3263 1170 37 9,44E‐01 1,00E+00

201









‐ MAP1323 152 100 11 102 0 2 4,59E‐02 1,00E+00‐ MAP1324 439 426 16 504 256 12 6,09E‐01 1,00E+00rpsA MAP1325 31495 45815 1535 58070 22468 1339 3,14E‐01 1,00E+00coaE MAP1326 848 1101 45 1560 252 30 3,53E‐01 1,00E+00‐ MAP1327c 153 336 33 558 200 43 4,70E‐01 1,00E+00‐ MAP1328c 172 364 19 287 101 11 3,07E‐01 1,00E+00‐ MAP1329c 958 1574 67 1901 1460 87 3,23E‐01 1,00E+00‐ MAP1330c 749 982 107 585 533 69 3,41E‐01 1,00E+00‐ MAP1331c 742 488 14 952 346 11 8,29E‐01 1,00E+00pknF MAP1332 140 146 4 102 50 2 1,94E‐01 1,00E+00‐ MAP1333 101 398 17 249 262 19 7,22E‐01 1,00E+00‐ MAP1334 1045 1383 200 2407 1087 248 4,10E‐01 1,00E+00uvrB MAP1335 3502 5502 118 6407 3600 119 8,46E‐01 1,00E+00‐ MAP1336 534 300 23 822 153 19 7,34E‐01 1,00E+00‐ MAP1337c 602 486 44 1185 454 54 4,52E‐01 1,00E+00‐ MAP1338c 553 1394 29 1405 797 30 7,67E‐01 1,00E+00‐ MAP1339 6391 8812 983 11217 4173 825 6,13E‐01 1,00E+00‐ MAP1340c 305 346 24 623 151 21 8,98E‐01 1,00E+00uvrA MAP1341 4198 4623 87 6765 3591 91 7,90E‐01 1,00E+00‐ MAP1342c 101 142 29 148 90 26 5,96E‐01 1,00E+00‐ MAP1343 3067 2362 218 4851 1627 206 8,77E‐01 1,00E+00‐ MAP1344 905 647 33 983 355 23 4,51E‐01 1,00E+00‐ MAP1345 1951 1629 175 1930 1229 140 5,89E‐01 1,00E+00‐ MAP1346c 743 2281 87 2077 797 71 6,89E‐01 1,00E+00‐ MAP1347c 670 1176 58 1077 737 55 9,68E‐01 1,00E+00moeY MAP1348c 1072 2393 45 2186 456 26 1,22E‐01 1,00E+00‐ MAP1349c 151 153 13 256 153 16 4,38E‐01 1,00E+00‐ MAP1350c 912 1028 37 1559 762 39 7,79E‐01 1,00E+00lysS MAP1351c 2844 5514 66 6002 2366 57 7,30E‐01 1,00E+00‐ predicted RNA 975 1431 5301 2535 731 5689 7,13E‐01 1,00E+00

202









infC MAP1352 21084 24261 2364 42669 15922 2515 1,87E‐01 1,00E+00rpmI MAP1353 9053 12931 3232 15523 6009 2650 9,06E‐01 1,00E+00rplT MAP1354 5114 6692 858 9979 3642 815 9,96E‐01 1,00E+00tsnR MAP1355 283 134 15 705 14 16 8,48E‐01 1,00E+00‐ MAP1356c 1248 1666 78 2715 868 77 8,92E‐01 1,00E+00‐ MAP1357 812 1181 58 1921 984 76 3,59E‐01 1,00E+00‐ MAP1358 1757 2210 139 3648 1137 134 9,81E‐01 1,00E+00pheS MAP1359 363 259 17 822 245 23 4,04E‐01 1,00E+00pheT MAP1360 730 858 18 1032 305 12 3,90E‐01 1,00E+00argC MAP1361 627 563 33 559 268 19 2,32E‐01 1,00E+00argJ MAP1362 123 367 11 253 0 3 3,47E‐02 1,00E+00argB MAP1363 1123 688 60 845 309 30 9,92E‐02 1,00E+00argR MAP1366 177 893 59 390 254 34 2,55E‐01 1,00E+00argG MAP1367 1437 1638 74 2184 981 65 8,21E‐01 1,00E+00argH MAP1368 342 492 16 929 106 14 7,84E‐01 1,00E+00pks10 MAP1369 993 1492 66 1516 677 51 5,33E‐01 1,00E+00pks7 MAP1370 4645 4891 45 7656 2270 37 7,00E‐01 1,00E+00pks8 MAP1371 1678 1790 30 4629 1517 43 2,46E‐01 1,00E+00‐ predicted RNA 2224 3787 8149 5256 1805 7877 9,58E‐01 1,00E+00pks11 MAP1372 4449 6443 293 10327 4127 328 5,35E‐01 1,00E+00‐ MAP1373c 203 301 11 457 222 13 6,11E‐01 1,00E+00‐ MAP1374c 399 671 17 1553 305 22 3,69E‐01 1,00E+00‐ MAP1375c 1091 786 48 1824 357 40 7,26E‐01 1,00E+00‐ MAP1376c 449 515 29 544 466 30 7,35E‐01 1,00E+00‐ MAP1377 315 412 26 708 203 26 9,55E‐01 1,00E+00‐ MAP1378 174 100 11 152 71 7 3,51E‐01 1,00E+00‐ MAP1379 74 101 4 295 175 11 1,01E‐01 1,00E+00‐ MAP1380 51 64 4 147 9 3 5,29E‐01 1,00E+00‐ MAP1381 102 233 12 300 79 10 9,48E‐01 1,00E+00‐ MAP1382c 319 272 15 665 169 16 8,10E‐01 1,00E+00

203









‐ MAP1383c 165 153 9 568 50 11 4,16E‐01 1,00E+00‐ MAP1384c 343 248 9 498 204 9 9,53E‐01 1,00E+00‐ MAP1385c 689 286 17 1271 50 14 7,69E‐01 1,00E+00‐ MAP1387c 2288 2691 195 7399 1748 271 1,87E‐01 1,00E+00‐ MAP1388 604 1090 121 829 361 73 2,71E‐01 1,00E+00‐ MAP1389 1262 1223 24 2433 509 21 8,36E‐01 1,00E+00‐ MAP1390 343 574 120 465 162 68 2,23E‐01 1,00E+00‐ MAP1391c 179 238 19 498 200 27 3,45E‐01 1,00E+00‐ MAP1392c 102 51 6 0 51 3 6,54E‐01 1,00E+00‐ MAP1393c 101 97 7 102 0 2 1,52E‐01 1,00E+00amt_1 MAP1394c 193 51 5 72 101 4 5,36E‐01 1,00E+00‐ MAP1395 125 55 8 51 45 4 9,00E‐01 1,00E+00tyrS MAP1396 355 651 22 1016 304 23 6,94E‐01 1,00E+00lprJ MAP1397 471 780 96 1651 560 140 2,43E‐01 1,00E+00‐ MAP1398 0 251 8 407 48 11 3,44E‐01 1,00E+00‐ MAP1399 0 204 5 51 107 5 4,92E‐01 1,00E+00‐ MAP1400 203 384 89 636 403 149 1,38E‐01 1,00E+00tlyA MAP1401 677 1046 60 1592 153 41 4,18E‐01 1,00E+00ppnK MAP1402 805 1318 65 2287 819 79 4,71E‐01 1,00E+00recN MAP1403 538 913 23 1122 280 17 5,92E‐01 1,00E+00‐ MAP1404 4847 6089 266 9780 3098 251 9,79E‐01 1,00E+00‐ MAP1405 2819 5104 235 5149 2151 186 5,00E‐01 1,00E+00pyrG MAP1406 3880 5776 157 7495 2496 132 7,70E‐01 1,00E+00‐ MAP1407 742 1388 96 1278 1027 103 7,05E‐01 1,00E+00‐ MAP1410 1504 1956 105 1752 1012 76 4,08E‐01 1,00E+00‐ MAP1411 2996 5396 291 5493 2719 253 7,89E‐01 1,00E+00‐ MAP1412 954 2018 118 2118 1282 126 6,89E‐01 1,00E+00‐ MAP1413 1333 2502 146 2764 1167 129 8,09E‐01 1,00E+00cmk MAP1414 461 1122 64 853 384 44 4,53E‐01 1,00E+00engA MAP1415 1686 2366 82 2940 994 65 5,47E‐01 1,00E+00

204









‐ MAP1416c 1012 877 83 1931 562 84 8,29E‐01 1,00E+00‐ MAP1417c 40 51 6 101 51 8 5,57E‐01 1,00E+00‐ MAP1418c 254 203 17 557 223 23 3,68E‐01 1,00E+00mbtH_1 MAP1419 2071 1952 536 3957 1287 554 8,77E‐01 1,00E+00‐ MAP1420 58324 79862 207 111517 35592 177 3,26E‐01 1,00E+00asnB_1 MAP1421 3437 4514 126 5644 2474 110 7,80E‐01 1,00E+00‐ MAP1422 3649 6007 153 7234 4074 164 7,37E‐01 1,00E+00‐ MAP1423 1291 2366 74 2528 1064 62 7,11E‐01 1,00E+00‐ MAP1424c 349 101 29 167 153 20 4,54E‐01 1,00E+00‐ MAP1425c 102 77 7 101 169 12 2,92E‐01 1,00E+00‐ MAP1426c 51 51 4 152 51 7 6,07E‐01 1,00E+00‐ MAP1427 217 605 15 576 188 12 6,19E‐01 1,00E+00‐ MAP1428c 230 50 7 50 51 2 1,07E‐01 1,00E+00‐ MAP1429 0 0 0 51 0 0 0,00E+00 1,00E+00‐ MAP1430c 195 309 16 378 102 12 6,13E‐01 1,00E+00‐ MAP1431 1119 2777 160 4024 1640 201 4,63E‐01 1,00E+00‐ MAP1432 536 605 22 1150 341 22 7,75E‐01 1,00E+00‐ MAP1433c 139 184 5 304 204 7 2,66E‐01 1,00E+00‐ MAP1435 304 204 21 408 54 12 3,30E‐01 1,00E+00‐ MAP1436c 51 51 3 0 102 5 5,41E‐01 1,00E+00‐ MAP1437c 102 51 4 184 102 7 6,91E‐01 1,00E+00lipH MAP1438c 0 0 0 153 0 2 0,00E+00 1,00E+00‐ MAP1439c 91 34 4 202 0 4 5,15E‐01 1,00E+00‐ MAP1441 83 249 4 102 152 4 8,87E‐01 1,00E+00‐ MAP1442 0 66 1 204 41 5 2,13E‐01 1,00E+00‐ MAP1444c 100 166 18 402 102 27 2,65E‐01 1,00E+00‐ MAP1445c 51 69 3 100 49 4 5,07E‐01 1,00E+00‐ MAP1447c 2025 2830 92 3646 1016 69 4,55E‐01 1,00E+00‐ MAP1448c 1576 1198 68 1484 391 35 6,71E‐02 1,00E+00‐ MAP1449c 77 98 6 243 64 8 9,48E‐01 1,00E+00

205









‐ MAP1451 0 51 1 75 0 1 5,13E‐01 1,00E+00‐ MAP1452c 578 830 44 786 457 36 7,23E‐01 1,00E+00‐ MAP1453c 2571 2110 89 4821 1618 97 7,66E‐01 1,00E+00‐ MAP1454 1161 884 67 1258 793 60 8,99E‐01 1,00E+00‐ MAP1455c 102 101 9 0 0 0 1,00E+00 1,00E+00‐ MAP1456 203 221 11 724 204 19 1,62E‐01 1,00E+00‐ MAP1457 4094 5092 103 5983 2438 79 5,52E‐01 1,00E+00‐ MAP1458 239 110 8 335 184 11 4,56E‐01 1,00E+00‐ MAP1459 299 768 26 561 293 19 5,50E‐01 1,00E+00‐ MAP1460 58 127 10 0 0 0 1,00E+00 1,00E+00‐ MAP1462 51 224 6 204 101 6 5,00E‐01 1,00E+00‐ MAP1463 252 668 15 836 148 12 6,82E‐01 1,00E+00fadD1_1 MAP1464 153 612 13 559 560 20 1,85E‐01 1,00E+00‐ MAP1465c 558 797 26 1648 743 40 1,71E‐01 1,00E+00‐ MAP1466c 812 374 31 469 677 32 8,09E‐01 1,00E+00‐ MAP1467c 1251 1291 63 2197 722 57 9,59E‐01 1,00E+00‐ MAP1468c 398 592 29 687 205 21 5,13E‐01 1,00E+00‐ MAP1469c 522 1136 38 1886 301 36 9,58E‐01 1,00E+00‐ MAP1470c 251 144 16 575 0 13 7,53E‐01 1,00E+00‐ MAP1471 141 126 18 183 60 13 3,79E‐01 1,00E+00‐ MAP1472c 880 819 100 1248 408 78 6,21E‐01 1,00E+00‐ MAP1473c 975 1323 108 1563 752 95 8,46E‐01 1,00E+00sigF_1 MAP1474c 1939 3282 183 4221 1167 149 5,79E‐01 1,00E+00‐ MAP1475 92 51 4 102 0 1 6,86E‐01 1,00E+00‐ MAP1476c 100 51 6 358 51 11 2,88E‐01 1,00E+00‐ MAP1477c 1086 690 78 1616 715 85 6,82E‐01 1,00E+00‐ MAP1478 291 51 5 102 153 4 6,38E‐01 1,00E+00‐ MAP1479c 25 109 6 51 0 1 4,32E‐02 1,00E+00‐ MAP1480 0 0 0 51 0 1 0,00E+00 1,00E+00‐ MAP1481c 1078 771 36 1644 897 43 4,80E‐01 1,00E+00

206









‐ MAP1482 3203 3398 211 4734 2336 197 9,13E‐01 1,00E+00‐ MAP1483c 0 152 2 136 0 1 5,88E‐01 1,00E+00‐ MAP1484c 246 151 8 361 105 7 9,53E‐01 1,00E+00‐ MAP1485c 208 163 8 151 30 3 7,07E‐02 1,00E+00‐ MAP1486c 455 955 45 1359 490 50 6,85E‐01 1,00E+00‐ MAP1487c 329 327 18 330 164 12 3,94E‐01 1,00E+00‐ MAP1488c 51 102 4 508 101 13 5,08E‐02 1,00E+00‐ MAP1489c 80 223 9 192 144 10 5,48E‐01 1,00E+00‐ MAP1490 32 70 3 169 150 10 6,42E‐02 1,00E+00‐ MAP1491 0 0 0 94 0 5 0,00E+00 1,00E+00‐ MAP1492 1054 1511 255 2904 997 317 3,89E‐01 1,00E+00‐ MAP1493c 153 263 6 551 102 7 6,22E‐01 1,00E+00‐ MAP1495 1257 924 141 3371 397 163 5,64E‐01 1,00E+00‐ MAP1496c 0 0 0 221 0 13 0,00E+00 1,00E+00‐ MAP1497c 399 726 16 704 253 11 4,95E‐01 1,00E+00‐ MAP1498c 51 74 7 204 51 11 8,93E‐01 1,00E+00‐ MAP1499c 49 199 7 330 51 8 4,24E‐01 1,00E+00‐ MAP1500c 243 209 6 405 98 5 8,08E‐01 1,00E+00‐ MAP1501 2628 2065 90 4921 1526 97 8,12E‐01 1,00E+00‐ MAP1502 10655 14208 171 20604 7122 155 6,20E‐01 1,00E+00‐ MAP1503c 561 862 30 1023 565 31 8,43E‐01 1,00E+00‐ MAP1504 179 196 55 356 162 65 5,77E‐01 1,00E+00‐ MAP1505 492 685 26 1352 667 40 1,94E‐01 1,00E+00‐ MAP1506 8347 7602 380 20549 6620 513 1,76E‐01 1,00E+00‐ predicted RNA 1570 2081 5001 2945 851 4095 6,34E‐01 1,00E+00PE_4 MAP1507 16754 16504 3229 23456 8890 2576 6,43E‐01 1,00E+00‐ MAP1508 52826 48440 9961 84203 23155 8114 3,35E‐01 1,00E+00‐ MAP1509 2591 4001 208 5276 1896 187 7,79E‐01 1,00E+00‐ MAP1510 2807 3520 120 4909 1793 105 6,63E‐01 1,00E+00‐ MAP1511 12094 13891 411 21253 7690 375 5,33E‐01 1,00E+00

207









‐ MAP1512 2768 2572 128 5324 1314 120 8,55E‐01 1,00E+00‐ MAP1513 11052 14328 398 18405 7200 336 8,30E‐01 1,00E+00‐ MAP1515 51 0 1 0 0 0 1,00E+00 1,00E+00‐ MAP1516 102 51 3 153 0 2 5,78E‐01 1,00E+00‐ MAP1517 51 0 4 102 0 4 5,08E‐01 1,00E+00‐ MAP1518 102 85 4 100 70 3 5,20E‐01 1,00E+00‐ MAP1519 0 102 1 153 102 4 1,80E‐01 1,00E+00‐ MAP1521 34801 27102 1462 70672 21443 1691 1,56E‐01 1,00E+00‐ MAP1522 6204 8826 311 13570 5121 322 7,66E‐01 1,00E+00‐ MAP1523 6022 9785 1404 12217 5571 1376 8,78E‐01 1,00E+00mgtC MAP1524 1050 1552 103 3027 1054 133 3,28E‐01 1,00E+00‐ MAP1525 1354 1848 103 2550 1209 106 7,97E‐01 1,00E+00‐ MAP1526 1107 1716 118 2010 1471 141 4,64E‐01 1,00E+00‐ MAP1527c 439 565 55 623 245 40 5,28E‐01 1,00E+00‐ MAP1528 236 457 27 402 151 18 4,25E‐01 1,00E+00‐ MAP1529 213 245 34 621 84 36 7,70E‐01 1,00E+00‐ MAP1530 248 306 10 710 250 15 3,37E‐01 1,00E+00‐ MAP1531c 925 1608 37 1779 962 36 8,99E‐01 1,00E+00‐ MAP1532 552 303 39 714 301 38 8,92E‐01 1,00E+00‐ MAP1533 503 190 20 884 153 21 8,64E‐01 1,00E+00secA2 MAP1534 1693 2656 53 3870 1498 55 8,91E‐01 1,00E+00‐ MAP1536 814 1521 71 1092 392 37 1,03E‐01 1,00E+00‐ MAP1537 0 101 8 136 51 13 5,64E‐01 1,00E+00‐ MAP1538 593 1087 56 940 450 41 5,30E‐01 1,00E+00gcvH MAP1539 1066 1377 176 1005 696 115 2,94E‐01 1,00E+00‐ predicted RNA 4325 7101 4176 8167 5753 4871 3,84E‐01 1,00E+00‐ MAP1540 15625 20922 2189 32392 12674 2258 1,97E‐01 1,00E+00‐ MAP1541 4865 6364 429 6798 2723 305 4,61E‐01 1,00E+00‐ MAP1542 6754 10631 1003 13535 5040 893 9,76E‐01 1,00E+00‐ predicted RNA 2582 4669 4477 2908 1977 2876 1,26E‐01 1,00E+00

208









‐ MAP1543 8546 12450 887 18493 5968 834 7,63E‐01 1,00E+00‐ MAP1544 1625 2551 484 3752 1526 520 8,10E‐01 1,00E+00gcvB MAP1545 1468 1972 34 3671 945 36 7,93E‐01 1,00E+00‐ MAP1546c 102 253 14 145 302 21 2,53E‐01 1,00E+00‐ MAP1547c 99 44 4 215 100 8 3,79E‐01 1,00E+00‐ MAP1548c 1748 2827 63 3331 1068 49 5,19E‐01 1,00E+00glcB MAP1549c 7883 7924 208 13662 5167 203 8,65E‐01 1,00E+00‐ MAP1550c 2966 3645 183 4549 1873 149 5,04E‐01 1,00E+00‐ MAP1551c 799 1437 46 2217 731 50 6,95E‐01 1,00E+00‐ MAP1552 398 508 77 710 561 105 3,04E‐01 1,00E+00guaB1 MAP1556c 1142 888 41 2488 1015 59 2,17E‐01 1,00E+00gnd MAP1557c 2333 1572 78 2313 984 54 3,04E‐01 1,00E+00‐ MAP1559c 7605 9488 1173 13545 6170 1165 7,71E‐01 1,00E+00‐ MAP1560 806 503 91 1126 406 85 9,97E‐01 1,00E+00ndh MAP1561c 735 1522 46 1443 246 25 1,31E‐01 1,00E+00‐ MAP1562c 2144 1560 284 2722 1480 282 9,28E‐01 1,00E+00‐ MAP1563c 4034 3547 241 5847 1816 191 4,93E‐01 1,00E+00‐ MAP1564c 1715 1092 122 2239 362 78 2,47E‐01 1,00E+00modA MAP1565 51 100 5 102 51 5 5,11E‐01 1,00E+00‐ MAP1566 6967 8767 422 7577 4655 301 2,50E‐01 1,00E+00modB MAP1567 108 140 9 251 19 6 7,43E‐01 1,00E+00modC MAP1568 0 153 3 122 51 3 5,02E‐01 1,00E+00modD MAP1569 3789 2929 178 4613 1861 141 4,27E‐01 1,00E+00‐ MAP1570 805 737 150 1825 352 153 8,34E‐01 1,00E+00adhA_1 MAP1571 558 555 31 1105 188 25 8,14E‐01 1,00E+00‐ MAP1572c 1947 2071 154 4574 1182 168 7,60E‐01 1,00E+00‐ MAP1573c 1823 2524 51 3673 862 40 5,52E‐01 1,00E+00‐ MAP1574c 195 290 16 230 49 7 1,02E‐01 1,00E+00uppP MAP1575c 236 211 14 419 87 11 7,98E‐01 1,00E+00‐ MAP1576 304 544 9 640 306 9 8,99E‐01 1,00E+00

209









‐ MAP1577 356 197 11 510 51 7 4,19E‐01 1,00E+00‐ MAP1578 629 739 18 966 438 16 8,89E‐01 1,00E+00‐ MAP1579c 1733 2029 88 3726 1681 108 4,96E‐01 1,00E+00‐ MAP1580c 51 354 15 558 111 19 4,56E‐01 1,00E+00‐ MAP1581c 0 13 0 181 51 7 1,72E‐26 1,00E+00‐ MAP1582c 97 134 19 419 101 34 2,12E‐01 1,00E+00‐ MAP1583c 1999 2253 308 2479 787 188 1,42E‐01 1,00E+00‐ MAP1584c 356 1115 17 1411 456 18 7,61E‐01 1,00E+00lldD2 MAP1585c 994 1234 50 1417 535 36 4,47E‐01 1,00E+00‐ MAP1586 152 153 19 293 102 20 6,90E‐01 1,00E+00‐ MAP1587c 664 653 28 2204 631 48 9,33E‐02 1,00E+00ahpD MAP1588c 1687 1191 158 3148 1277 199 3,63E‐01 1,00E+00ahpC MAP1589c 2344 2596 243 5923 2500 350 1,48E‐01 1,00E+00oxyR MAP1590 1277 1353 78 3436 714 90 5,14E‐01 1,00E+00‐ MAP1591 894 921 75 1616 923 94 4,04E‐01 1,00E+00‐ MAP1592 637 709 87 463 385 54 2,75E‐01 1,00E+00‐ MAP1597 955 649 95 1653 348 86 9,21E‐01 1,00E+00‐ MAP1598 146 101 8 266 93 9 4,00E‐01 1,00E+00glnA3 MAP1599 204 0 4 353 0 4 4,83E‐01 1,00E+00‐ MAP1600 0 291 6 102 51 3 2,40E‐01 1,00E+00‐ MAP1602c 91 844 55 281 194 28 1,39E‐01 1,00E+00‐ MAP1603c 728 706 30 2030 254 33 7,09E‐01 1,00E+00lppE MAP1604c 796 1339 143 1827 516 124 7,99E‐01 1,00E+00‐ MAP1605c 1202 1442 91 2164 1086 98 6,86E‐01 1,00E+00‐ MAP1606c 1452 1939 203 2824 1476 229 6,06E‐01 1,00E+00‐ MAP1607c 1494 1528 171 1658 617 105 1,91E‐01 1,00E+00‐ MAP1608c 584 892 83 1295 383 75 9,40E‐01 1,00E+00fbpB MAP1609c 59970 61984 3570 102259 32725 3140 2,75E‐01 1,00E+00‐ MAP1610 2451 5509 383 3255 2938 304 5,12E‐01 1,00E+00‐ MAP1611 509 1221 42 1380 439 36 8,28E‐01 1,00E+00

210









‐ MAP1612c 892 688 81 1317 805 99 4,95E‐01 1,00E+00adhA_2 MAP1613c 557 1273 50 989 492 36 5,08E‐01 1,00E+00‐ MAP1614c 576 656 27 804 304 20 5,91E‐01 1,00E+00‐ MAP1615 903 1344 161 2153 796 175 6,75E‐01 1,00E+00‐ MAP1616 82 281 31 487 95 39 5,08E‐01 1,00E+00‐ MAP1617 51 96 18 221 93 33 3,96E‐01 1,00E+00‐ MAP1618c 625 809 36 1446 363 35 9,29E‐01 1,00E+00‐ MAP1619 47 101 2 101 49 2 5,11E‐01 1,00E+00‐ MAP1620 249 688 12 408 322 10 6,48E‐01 1,00E+00‐ MAP1621 153 50 6 50 51 2 6,58E‐01 1,00E+00‐ MAP1622c 203 937 34 890 375 33 8,36E‐01 1,00E+00‐ MAP1623c 99 234 21 102 100 13 2,95E‐01 1,00E+00‐ MAP1624 1364 1543 275 3318 1012 323 4,85E‐01 1,00E+00cinA MAP1625 842 897 38 1552 798 45 5,11E‐01 1,00E+00nanT MAP1626c 608 536 26 757 202 16 3,24E‐01 1,00E+00‐ MAP1627 3025 3918 187 5470 2402 181 9,58E‐01 1,00E+00‐ MAP1628 2459 2272 354 3084 1156 259 4,05E‐01 1,00E+00aao MAP1629c 555 941 44 1127 357 35 7,12E‐01 1,00E+00‐ MAP1630c 872 1253 97 2504 938 130 2,96E‐01 1,00E+00‐ MAP1631c 570 505 46 964 153 33 5,49E‐01 1,00E+00‐ MAP1632c 51 97 3 50 51 2 5,49E‐01 1,00E+00‐ MAP1633c 0 0 0 100 0 4 0,00E+00 1,00E+00‐ MAP1634 886 1088 62 1087 503 43 4,16E‐01 1,00E+00‐ MAP1636c 51 40 5 129 0 4 5,38E‐01 1,00E+00‐ MAP1637c 498 272 15 1111 185 18 5,67E‐01 1,00E+00‐ MAP1638c 97 253 15 630 234 33 7,43E‐02 1,00E+00‐ MAP1639c 662 201 58 2008 51 81 2,75E‐01 1,00E+00‐ MAP1640c 0 151 9 345 131 27 6,94E‐02 1,00E+00‐ MAP1641c 0 98 8 102 51 11 5,57E‐01 1,00E+00‐ MAP1642 0 46 1 0 0 0 1,00E+00 1,00E+00

211









aceAb MAP1643 7143 8459 196 13129 4567 181 9,46E‐01 1,00E+00‐ MAP1644 279 320 37 1109 107 50 3,83E‐01 1,00E+00‐ MAP1645 2009 2115 102 2240 954 67 2,08E‐01 1,00E+00‐ MAP1646c 902 878 110 1058 406 74 3,92E‐01 1,00E+00fadD31 MAP1647 304 101 6 506 283 11 1,80E‐01 1,00E+00‐ MAP1648 304 575 34 337 293 24 5,20E‐01 1,00E+00‐ MAP1649c 101 157 9 80 165 10 4,14E‐01 1,00E+00‐ MAP1650 454 355 49 561 102 29 2,49E‐01 1,00E+00‐ MAP1651c 51 45 3 135 0 3 5,40E‐01 1,00E+00‐ MAP1652c 124 491 17 463 152 14 7,87E‐01 1,00E+00tpx MAP1653 1881 2880 275 3787 860 203 4,26E‐01 1,00E+00‐ MAP1654c 251 264 15 152 152 9 2,95E‐01 1,00E+00‐ MAP1655c 78 0 6 0 51 5 5,32E‐01 1,00E+00‐ MAP1656 739 845 38 1315 206 26 4,25E‐01 1,00E+00‐ MAP1657 577 551 36 877 256 28 6,96E‐01 1,00E+00‐ MAP1658 1250 1782 56 2656 900 53 9,75E‐01 1,00E+00‐ MAP1659 152 45 7 299 203 17 1,02E‐01 1,00E+00‐ MAP1661c 1853 2226 142 3747 454 100 3,23E‐01 1,00E+00‐ MAP1662c 1070 1080 95 884 407 48 9,11E‐02 1,00E+00‐ MAP1663 411 292 31 510 356 35 6,56E‐01 1,00E+00‐ MAP1664c 544 1009 41 1081 168 23 2,16E‐01 1,00E+00‐ MAP1665c 775 1541 86 1529 660 70 6,74E‐01 1,00E+00‐ MAP1666c 462 555 23 667 303 19 7,86E‐01 1,00E+00‐ MAP1667 1416 930 85 2049 453 66 5,69E‐01 1,00E+00katG MAP1668c 21149 18859 520 42600 12484 556 1,56E‐01 1,00E+00furA MAP1669c 2469 1792 285 3552 1413 271 9,30E‐01 1,00E+00lppS_1 MAP1670c 4520 3060 174 9741 2550 212 4,90E‐01 1,00E+00‐ MAP1671 214 113 12 118 200 13 7,14E‐01 1,00E+00‐ MAP1672 253 101 6 379 152 8 5,49E‐01 1,00E+00‐ MAP1674c 48 156 4 434 102 9 1,57E‐01 1,00E+00

212









‐ predicted RNA 3186 8605 3706 4953 4014 2835 5,89E‐01 1,00E+00‐ MAP1676 204 100 8 154 0 2 5,90E‐02 1,00E+00‐ MAP1678 32 0 1 0 51 2 6,43E‐01 1,00E+00‐ MAP1679c 139 305 18 454 242 27 3,35E‐01 1,00E+00‐ MAP1680c 788 1413 94 1503 607 77 6,63E‐01 1,00E+00‐ MAP1681c 341 253 22 917 152 28 5,08E‐01 1,00E+00‐ MAP1682c 285 355 18 888 164 21 5,93E‐01 1,00E+00‐ MAP1683c 51 152 5 170 153 8 2,80E‐01 1,00E+00hrpA MAP1684 238 736 6 661 407 7 7,15E‐01 1,00E+00‐ MAP1685 34 147 3 0 0 0 1,00E+00 1,00E+00‐ MAP1686 268 420 20 799 251 24 5,17E‐01 1,00E+00‐ MAP1687 2464 2593 59 4101 1011 45 4,76E‐01 1,00E+00‐ MAP1688 333 380 30 1015 254 41 3,39E‐01 1,00E+00‐ MAP1689 1210 792 47 1713 517 41 7,72E‐01 1,00E+00‐ MAP1690c 0 0 0 153 0 3 0,00E+00 1,00E+00‐ MAP1691c 0 97 3 0 0 0 1,00E+00 1,00E+00fabG2_1 MAP1692 34 49 3 267 50 8 1,52E‐01 1,00E+00‐ MAP1693c 664 544 62 943 459 62 8,53E‐01 1,00E+00‐ MAP1695c 272 380 43 317 197 31 5,48E‐01 1,00E+00hsp18_1 MAP1696c 7424 4577 830 12499 2638 756 8,33E‐01 1,00E+00hsp18_2 MAP1698c 366 593 62 664 541 76 4,27E‐01 1,00E+00thiI MAP1699 360 296 15 789 90 14 8,88E‐01 1,00E+00‐ MAP1700c 102 450 12 509 204 14 6,88E‐01 1,00E+00‐ MAP1701c 999 708 34 1420 761 38 6,51E‐01 1,00E+00‐ MAP1702c 50 16 2 153 51 6 8,22E‐01 1,00E+00‐ MAP1703c 228 426 52 934 286 78 2,19E‐01 1,00E+00‐ MAP1704c 1697 1319 220 3840 895 256 5,14E‐01 1,00E+00‐ MAP1705c 247 488 27 842 345 38 3,09E‐01 1,00E+00‐ MAP1706 1808 2453 279 2853 1401 245 7,64E‐01 1,00E+00‐ MAP1707 242 514 30 318 199 19 3,65E‐01 1,00E+00

213









fadD11_2 MAP1709c 51 34 1 102 150 4 8,73E‐02 1,00E+00‐ MAP1710 0 40 1 0 0 0 1,00E+00 1,00E+00‐ MAP1711c 249 347 29 378 128 20 4,80E‐01 1,00E+00‐ MAP1712 153 50 7 238 0 5 9,48E‐01 1,00E+00fadE20_1 MAP1713 253 301 13 506 101 11 7,21E‐01 1,00E+00fadA_2 MAP1714 98 174 6 0 0 0 1,00E+00 1,00E+00fadB_2 MAP1715 141 227 4 144 0 1 1,78E‐02 1,00E+00‐ MAP1716 0 51 1 101 0 2 5,33E‐01 1,00E+00‐ MAP1717 1334 1590 130 1915 779 101 5,77E‐01 1,00E+00‐ MAP1718c 3316 850 279 5730 722 281 9,55E‐01 1,00E+00‐ MAP1719c 51 150 9 153 72 9 4,93E‐01 1,00E+00‐ MAP1720 0 0 0 52 51 2 0,00E+00 1,00E+00‐ MAP1721c 690 1527 92 2364 907 116 4,16E‐01 1,00E+00‐ MAP1722 483 793 29 1039 425 29 8,96E‐01 1,00E+00‐ MAP1723 305 361 28 894 364 45 1,71E‐01 1,00E+00‐ MAP1724c 0 110 5 0 90 6 5,32E‐01 1,00E+00‐ MAP1725c 236 47 8 102 51 3 1,77E‐01 1,00E+00‐ MAP1726c 192 0 10 304 86 15 2,96E‐01 1,00E+00‐ MAP1727 0 66 1 361 51 9 1,28E‐02 1,00E+00yfnB MAP1728c 51 161 8 357 153 17 1,35E‐01 1,00E+00‐ MAP1729c 125 153 9 315 259 19 1,03E‐01 1,00E+00‐ MAP1730c 101 561 17 203 118 8 1,08E‐01 1,00E+00‐ MAP1731c 23 0 2 19 0 1 7,95E‐01 1,00E+00‐ MAP1732c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP1733 0 51 2 50 102 8 8,15E‐02 1,00E+00‐ MAP1734 0 0 0 50 0 0 0,00E+00 1,00E+00‐ MAP1735 0 0 0 7 0 0 1,00E+00 1,00E+00‐ MAP1736 326 337 31 856 399 51 1,51E‐01 1,00E+00mmpS5 MAP1737 79 551 41 885 271 63 2,04E‐01 1,00E+00mmpL5 MAP1738 5258 7045 121 9970 3732 112 8,82E‐01 1,00E+00

214









‐ MAP1740c 596 104 14 893 176 14 8,10E‐01 1,00E+00‐ MAP1741c 33 151 5 253 0 4 5,17E‐01 1,00E+00‐ MAP1742c 51 100 4 102 0 1 6,92E‐01 1,00E+00‐ MAP1743c 103 0 3 79 51 3 5,05E‐01 1,00E+00‐ MAP1744 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP1745c 388 269 51 417 61 25 5,96E‐02 1,00E+00‐ MAP1746c 51 0 1 102 0 1 5,08E‐01 1,00E+00‐ MAP1747c 0 51 1 142 0 2 5,89E‐01 1,00E+00‐ MAP1748c 152 33 4 248 179 9 1,56E‐01 1,00E+00‐ MAP1749 148 130 10 349 102 12 3,40E‐01 1,00E+00‐ MAP1750 50 131 9 153 0 5 7,25E‐01 1,00E+00‐ MAP1751 152 97 6 299 102 8 3,49E‐01 1,00E+00‐ MAP1752c 353 416 22 927 337 30 3,42E‐01 1,00E+00‐ MAP1753 590 490 24 1126 226 21 9,94E‐01 1,00E+00‐ MAP1754c 741 975 55 1478 102 33 2,51E‐01 1,00E+00‐ MAP1755c 91 0 3 202 51 5 8,61E‐01 1,00E+00‐ MAP1756c 204 51 28 250 51 23 4,16E‐01 1,00E+00‐ MAP1757c 51 38 4 75 153 12 1,20E‐01 1,00E+00nrtC MAP1758c 0 88 2 156 0 2 5,18E‐01 1,00E+00‐ MAP1759c 555 838 75 827 500 66 8,85E‐01 1,00E+00‐ MAP1760c 1314 1270 59 1731 555 41 3,82E‐01 1,00E+00‐ MAP1761c 2869 2532 126 3358 1217 86 2,86E‐01 1,00E+00‐ MAP1762c 713 825 27 1350 556 28 7,93E‐01 1,00E+00‐ MAP1764 607 809 141 825 310 94 4,01E‐01 1,00E+00‐ MAP1765c 713 829 46 952 599 42 9,82E‐01 1,00E+00‐ MAP1766c 510 903 37 1936 519 51 3,14E‐01 1,00E+00‐ MAP1767c 221 253 16 317 326 22 3,85E‐01 1,00E+00‐ MAP1768c 296 400 21 306 204 14 4,55E‐01 1,00E+00‐ MAP1769c 204 312 11 452 0 5 1,77E‐01 1,00E+00‐ MAP1770c 45 446 14 153 73 6 1,05E‐01 1,00E+00

215









‐ MAP1771c 828 1222 48 1613 384 35 5,16E‐01 1,00E+00‐ MAP1772 0 22 1 0 0 0 0,00E+00 1,00E+00‐ MAP1773c 527 628 41 1658 482 60 2,35E‐01 1,00E+00pncA MAP1774c 561 879 72 1543 253 65 9,29E‐01 1,00E+00‐ MAP1775 1618 748 66 5108 610 105 9,59E‐02 1,00E+00‐ MAP1776c 50 139 9 51 51 5 7,45E‐01 1,00E+00‐ MAP1777c 647 811 107 1319 455 106 8,84E‐01 1,00E+00‐ MAP1778c 21 26 2 122 85 11 4,17E‐02 1,00E+00‐ MAP1779c 2514 3649 88 4556 1496 70 4,60E‐01 1,00E+00lipT MAP1780c 788 1296 38 2240 495 37 8,77E‐01 1,00E+00lppI MAP1781 407 198 26 304 102 13 1,71E‐01 1,00E+00‐ MAP1782c 50 153 4 235 133 7 2,63E‐01 1,00E+00‐ MAP1783 632 602 57 440 266 29 1,10E‐01 1,00E+00‐ MAP1784c 289 197 23 608 275 35 2,56E‐01 1,00E+00‐ MAP1786c 51 99 3 94 51 3 5,13E‐01 1,00E+00‐ MAP1787c 252 51 10 153 102 7 3,79E‐01 1,00E+00‐ MAP1788 95 427 23 390 102 18 6,45E‐01 1,00E+00‐ MAP1789 29 108 5 197 102 10 2,38E‐01 1,00E+00morD MAP1790 206 100 5 103 102 3 3,12E‐01 1,00E+00norQ MAP1791 0 153 5 74 51 4 5,24E‐01 1,00E+00‐ MAP1792 129 122 13 51 27 3 7,88E‐02 1,00E+00‐ MAP1793c 989 1341 54 1184 619 37 3,63E‐01 1,00E+00‐ MAP1794 0 131 8 50 102 11 6,42E‐01 1,00E+00‐ MAP1795c 573 1024 17 773 287 9 1,71E‐01 1,00E+00pks12 MAP1796c 13420 17343 70 26142 8326 63 4,37E‐01 1,00E+00‐ MAP1797c 80 40 10 102 0 4 6,23E‐01 1,00E+00‐ MAP1798 4693 4916 830 8705 3423 869 7,76E‐01 1,00E+00‐ MAP1799c 1195 2050 114 2563 869 99 7,83E‐01 1,00E+00‐ MAP1800c 1961 2821 72 4941 2285 95 2,93E‐01 1,00E+00‐ MAP1801c 350 507 15 910 408 20 3,51E‐01 1,00E+00

216









fxsA MAP1802c 721 933 92 1429 408 80 8,51E‐01 1,00E+00‐ MAP1803 1379 1354 113 2189 455 80 4,10E‐01 1,00E+00‐ MAP1804c 661 957 121 1897 560 146 4,99E‐01 1,00E+00cobN MAP1805c 1103 1374 19 1409 772 15 6,07E‐01 1,00E+00‐ MAP1806c 101 101 8 340 0 8 4,90E‐01 1,00E+00‐ MAP1807c 352 291 18 786 101 17 9,64E‐01 1,00E+00‐ MAP1808c 316 316 24 475 165 19 7,34E‐01 1,00E+00‐ MAP1809c 495 406 31 599 289 26 8,14E‐01 1,00E+00cobG MAP1810 73 51 3 148 102 6 4,59E‐01 1,00E+00cobH MAP1811 102 150 11 118 17 4 1,68E‐01 1,00E+00cobI MAP1812 382 671 20 946 242 17 9,45E‐01 1,00E+00‐ MAP1813c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP1814 1750 2765 93 3670 1083 78 6,66E‐01 1,00E+00cobK MAP1815c 0 58 2 152 0 3 5,82E‐01 1,00E+00cobM MAP1816c 51 146 7 51 0 1 8,53E‐04 1,00E+00cobL MAP1817c 51 51 2 0 102 3 5,41E‐01 1,00E+00‐ MAP1818c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP1819c 0 0 0 149 0 4 0,00E+00 1,00E+00‐ MAP1820 3536 5277 575 5748 2744 486 7,43E‐01 1,00E+00‐ MAP1821c 815 587 77 848 539 68 9,18E‐01 1,00E+00‐ MAP1822c 1192 2066 30 2104 1195 28 9,52E‐01 1,00E+00pepE MAP1823c 407 600 25 689 210 18 5,05E‐01 1,00E+00‐ MAP1824c 1301 1794 69 1322 888 46 3,16E‐01 1,00E+00‐ MAP1825 342 251 18 661 102 16 8,89E‐01 1,00E+00‐ MAP1826c 5520 5475 404 8005 3065 334 7,56E‐01 1,00E+00‐ MAP1827c 95 104 17 222 79 20 8,72E‐01 1,00E+00helY MAP1828c 1118 1642 32 2449 986 33 7,40E‐01 1,00E+00‐ MAP1829c 1327 1699 91 2780 1102 97 6,80E‐01 1,00E+00tatA MAP1830c 26286 33321 6091 50435 18641 5824 2,34E‐01 1,00E+00‐ MAP1831c 438 1589 57 1234 581 46 6,66E‐01 1,00E+00

217









‐ MAP1832c 1149 1413 70 2619 1217 90 3,20E‐01 1,00E+00‐ MAP1833c 10226 17327 577 22866 10225 602 2,52E‐01 1,00E+00prcA MAP1834c 4831 6116 409 7961 3343 357 8,71E‐01 1,00E+00prcB MAP1835c 2394 4164 204 5192 2307 203 8,88E‐01 1,00E+00‐ MAP1836c 6052 7127 1953 11394 4098 1878 9,80E‐01 1,00E+00‐ MAP1837c 4812 7041 225 7990 3258 180 6,51E‐01 1,00E+00‐ MAP1838 899 937 82 1768 874 103 4,08E‐01 1,00E+00‐ MAP1839 614 701 20 859 504 19 9,82E‐01 1,00E+00lppK MAP1840 411 376 37 752 152 31 7,46E‐01 1,00E+00‐ MAP1841 56 75 12 92 0 5 6,39E‐01 1,00E+00‐ MAP1842c 185 550 24 403 306 23 9,91E‐01 1,00E+00‐ MAP1843 1070 990 66 1748 839 71 6,88E‐01 1,00E+00lpd MAP1844c 788 1305 43 1485 728 40 9,73E‐01 1,00E+00‐ MAP1845c 236 166 21 162 51 8 1,10E‐01 1,00E+00hisG MAP1846c 610 1226 60 1251 414 45 5,47E‐01 1,00E+00hisE MAP1847c 293 92 41 377 190 51 5,26E‐01 1,00E+00‐ MAP1848c 386 516 38 689 388 41 6,65E‐01 1,00E+00‐ predicted RNA 29350 52613 42340 25901 33516 33489 3,70E‐01 1,00E+00‐ MAP1849 341 399 24 817 606 45 7,34E‐02 1,00E+00‐ MAP1850 866 754 54 1347 447 48 8,70E‐01 1,00E+00‐ MAP1851 654 914 28 1587 340 25 9,67E‐01 1,00E+00‐ MAP1852 763 1926 71 2476 864 74 7,75E‐01 1,00E+00‐ MAP1853 151 295 11 275 254 14 5,54E‐01 1,00E+00‐ MAP1854 932 1739 67 2650 768 69 8,14E‐01 1,00E+00‐ MAP1855 458 405 20 524 753 32 1,45E‐01 1,00E+00‐ MAP1856 590 567 26 1063 581 33 4,26E‐01 1,00E+00‐ MAP1857 490 618 46 1289 400 56 4,70E‐01 1,00E+00‐ MAP1858 301 393 26 821 303 34 3,65E‐01 1,00E+00metH MAP1859c 3926 5205 69 6750 2890 62 9,06E‐01 1,00E+00‐ MAP1860 1565 1845 109 2927 814 93 7,36E‐01 1,00E+00

218









‐ MAP1861c 100 248 10 153 102 7 3,41E‐01 1,00E+00‐ MAP1862c 0 50 1 0 0 0 1,00E+00 1,00E+00‐ MAP1863c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP1864c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP1865c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP1866c 0 0 0 0 0 0 1,00E+00 1,00E+00pks5 MAP1867c 0 0 0 0 0 0 1,00E+00 1,00E+00efpA_1 MAP1868c 51 0 1 101 51 2 8,25E‐01 1,00E+00‐ MAP1869c 0 51 2 50 0 1 5,51E‐01 1,00E+00‐ MAP1870c 102 67 1 51 0 0 3,05E‐03 1,00E+00‐ MAP1871c 101 102 2 203 203 5 1,56E‐01 1,00E+00mbtH_2 MAP1872c 0 0 0 51 32 9 0,00E+00 1,00E+00‐ MAP1873c 51 129 2 126 51 2 5,17E‐01 1,00E+00‐ MAP1874c 358 198 6 355 0 2 4,79E‐02 1,00E+00‐ MAP1875c 808 1325 22 1565 917 24 7,08E‐01 1,00E+00cysS MAP1876c 531 549 25 1126 487 31 4,07E‐01 1,00E+00‐ MAP1878c 829 879 60 1018 528 48 6,71E‐01 1,00E+00‐ MAP1879c 3728 4976 425 8023 2396 403 9,84E‐01 1,00E+00‐ MAP1880c 1476 2685 148 2068 1586 127 7,27E‐01 1,00E+00‐ predicted RNA 1096 2509 4227 2104 898 3064 3,98E‐01 1,00E+00lppL MAP1881 137 221 9 633 147 15 1,82E‐01 1,00E+00‐ MAP1882 127 649 78 613 263 79 9,01E‐01 1,00E+00pyrD MAP1883 739 849 41 1801 391 42 8,26E‐01 1,00E+00‐ MAP1884c 56 242 5 179 0 2 1,33E‐01 1,00E+00‐ MAP1885c 975 323 74 1287 486 79 7,24E‐01 1,00E+00dapE2 MAP1886c 1818 2566 92 3042 1338 79 7,16E‐01 1,00E+00‐ MAP1887 1665 1258 120 4037 1004 154 3,31E‐01 1,00E+00‐ MAP1888c 2016 2899 355 3855 2477 427 4,91E‐01 1,00E+00wag31 MAP1889c 41971 59280 3709 77294 32502 3424 2,75E‐01 1,00E+00‐ MAP1890c 842 1477 226 1892 1331 302 2,96E‐01 1,00E+00

219









‐ MAP1891c 9680 10677 914 16835 6627 876 7,33E‐01 1,00E+00‐ MAP1892c 529 1227 62 2034 743 82 3,12E‐01 1,00E+00yfiH MAP1893c 532 834 51 1275 396 50 8,93E‐01 1,00E+00ftsZ MAP1894c 13218 17834 768 22304 9642 675 4,74E‐01 1,00E+00ftsQ MAP1895c 2727 3831 166 4596 1908 140 5,73E‐01 1,00E+00murC MAP1896c 709 1077 34 1239 558 29 8,34E‐01 1,00E+00murG MAP1897c 106 115 5 225 65 5 9,18E‐01 1,00E+00ftsW MAP1898c 5196 5477 170 6515 2869 127 5,52E‐01 1,00E+00murD MAP1899c 1167 2079 62 2040 1392 63 8,33E‐01 1,00E+00murF MAP1901c 991 1802 50 1048 599 27 1,02E‐01 1,00E+00murE MAP1902c 319 178 9 780 153 12 4,43E‐01 1,00E+00pbpB MAP1903c 2280 4546 96 5593 2119 92 9,94E‐01 1,00E+00‐ MAP1904c 267 578 18 610 213 15 6,96E‐01 1,00E+00mraW MAP1905c 992 1753 77 2419 1343 96 3,71E‐01 1,00E+00‐ MAP1906c 2298 4092 420 4781 2892 468 5,82E‐01 1,00E+00‐ MAP1907c 2724 2212 360 5307 2202 454 3,44E‐01 1,00E+00‐ MAP1908 68 18 4 253 14 8 7,29E‐01 1,00E+00lppM MAP1909 454 409 34 831 250 33 8,86E‐01 1,00E+00‐ MAP1910c 246 539 24 512 253 21 8,21E‐01 1,00E+00idsA2_1 MAP1911 520 442 26 811 406 29 6,29E‐01 1,00E+00‐ MAP1912 711 701 27 1138 410 24 9,08E‐01 1,00E+00‐ MAP1913c 2736 4123 422 4840 1786 338 4,54E‐01 1,00E+00pknL MAP1914 51 100 3 147 152 7 2,11E‐01 1,00E+00‐ MAP1915 787 595 28 2111 355 35 4,55E‐01 1,00E+00aroG MAP1916c 7829 9952 368 14999 5739 357 7,99E‐01 1,00E+00‐ MAP1917c 101 151 14 134 0 4 1,21E‐01 1,00E+00‐ MAP1918c 303 556 30 764 203 26 8,71E‐01 1,00E+00‐ MAP1919 667 942 35 2342 509 47 3,19E‐01 1,00E+00‐ MAP1920c 4032 7349 445 8894 4332 458 7,52E‐01 1,00E+00‐ predicted RNA 844 1823 3959 2330 1234 4811 4,26E‐01 1,00E+00

220









‐ MAP1921c 77 132 15 102 50 9 9,47E‐01 1,00E+00‐ MAP1922c 299 312 15 547 204 15 9,05E‐01 1,00E+00‐ MAP1923c 2127 2601 311 4447 1160 284 8,27E‐01 1,00E+00fadD15 MAP1925 3518 4075 121 6303 2312 113 9,30E‐01 1,00E+00‐ MAP1926c 296 301 15 608 51 11 5,43E‐01 1,00E+00‐ MAP1927c 717 1016 61 1269 1296 93 1,57E‐01 1,00E+00‐ MAP1928c 5855 9206 371 10980 6011 379 8,05E‐01 1,00E+00‐ MAP1929c 199 0 22 368 162 47 1,30E‐01 1,00E+00‐ MAP1930 153 90 3 51 50 1 1,90E‐01 1,00E+00ctaE MAP1932 2344 2729 239 4439 1864 251 8,53E‐01 1,00E+00qcrC MAP1933 2960 4570 249 5428 2038 206 5,93E‐01 1,00E+00qcrA MAP1934 8556 9379 409 12419 3927 296 4,52E‐01 1,00E+00qcrB MAP1935 10938 14331 427 20298 6090 353 8,93E‐01 1,00E+00‐ MAP1936c 530 501 58 745 524 67 5,49E‐01 1,00E+00‐ MAP1937c 1061 905 91 1246 323 55 2,33E‐01 1,00E+00mmpS3 MAP1938c 3898 5427 334 6197 2638 270 6,64E‐01 1,00E+00‐ predicted RNA 4411 8791 7324 6141 4191 5492 3,91E‐01 1,00E+00‐ MAP1939c 1871 4018 395 5552 2321 457 4,97E‐01 1,00E+00ctaC MAP1940c 5668 6688 329 11137 3419 308 9,08E‐01 1,00E+00asnB_2 MAP1941 301 542 12 153 152 4 3,47E‐02 1,00E+00cbhK MAP1942c 607 1039 48 1723 692 59 4,30E‐01 1,00E+00‐ MAP1943 1350 900 98 865 459 50 8,11E‐02 1,00E+00‐ MAP1944c 5960 6534 958 11165 3494 892 8,87E‐01 1,00E+00‐ MAP1945c 635 608 31 900 517 32 8,10E‐01 1,00E+00‐ MAP1946 1745 1811 149 2600 835 114 4,91E‐01 1,00E+00cobU MAP1947 286 116 22 479 136 25 6,40E‐01 1,00E+00cobT MAP1948 551 696 34 719 356 25 6,26E‐01 1,00E+00cobS MAP1949 51 0 2 49 0 1 5,70E‐01 1,00E+00ilvE MAP1950c 3552 4157 199 5545 2612 182 8,89E‐01 1,00E+00gcvT MAP1951c 391 789 30 1166 353 31 7,54E‐01 1,00E+00

221









IS1547_1 MAP1952c 851 1261 54 1630 1008 63 5,52E‐01 1,00E+00‐ predicted RNA 5625 4344 6518 8101 5902 8557 2,15E‐01 1,00E+00pepB MAP1953 929 1559 45 2226 398 35 5,60E‐01 1,00E+00‐ MAP1954c 102 204 19 202 60 13 3,41E‐01 1,00E+00ephD MAP1955c 454 278 12 735 322 14 5,32E‐01 1,00E+00dlaT MAP1956 5395 5492 178 7628 2063 122 3,86E‐01 1,00E+00‐ MAP1957 278 151 13 404 254 18 3,89E‐01 1,00E+00lipB MAP1958 689 679 56 664 562 49 8,73E‐01 1,00E+00lipA MAP1959 1178 2596 115 2930 1428 118 8,29E‐01 1,00E+00‐ MAP1960 1712 2525 161 4166 1195 161 9,62E‐01 1,00E+00‐ MAP1961c 508 152 37 560 150 29 6,70E‐01 1,00E+00‐ predicted RNA 1929 2159 5921 2436 815 3788 1,88E‐01 1,00E+00glnA1 MAP1962 16440 19705 726 25822 7782 534 8,09E‐01 1,00E+00‐ MAP1963c 2174 2605 160 5194 1491 175 7,58E‐01 1,00E+00‐ MAP1964c 422 553 50 586 551 59 5,07E‐01 1,00E+00glnE MAP1965c 1756 2190 37 3366 1302 37 9,68E‐01 1,00E+00glnA2 MAP1966c 4898 5516 224 8586 3581 221 8,88E‐01 1,00E+00‐ MAP1967c 754 1629 42 1860 861 43 8,37E‐01 1,00E+00‐ MAP1968c 1920 3391 96 4223 1877 96 9,79E‐01 1,00E+00‐ MAP1969c 1308 1913 66 2159 813 50 5,40E‐01 1,00E+00panB MAP1970 527 470 33 1184 156 31 9,60E‐01 1,00E+00‐ MAP1971 114 352 11 172 182 8 7,67E‐01 1,00E+00‐ MAP1972c 373 598 74 708 399 77 7,21E‐01 1,00E+00‐ MAP1973 297 520 51 412 101 24 1,14E‐01 1,00E+00‐ MAP1974 353 501 15 252 153 6 6,91E‐02 1,00E+00‐ MAP1975 5943 3198 819 14223 3981 1231 9,10E‐02 1,00E+00‐ predicted RNA 992587 897907 200228 2188682 650123 234249 5,14E‐01 1,00E+00‐ MAP1976 356 51 17 608 152 23 4,20E‐01 1,00E+00‐ MAP1978 0 0 0 89 50 6 0,00E+00 1,00E+00‐ MAP1979 547 1206 42 1915 646 51 4,77E‐01 1,00E+00

222









‐ MAP1980c 991 990 50 1513 372 36 4,66E‐01 1,00E+00‐ MAP1981c 1215 1150 93 1960 825 92 8,86E‐01 1,00E+00‐ MAP1982c 629 439 27 1387 521 40 2,35E‐01 1,00E+00cobC MAP1983c 199 254 12 421 120 11 9,91E‐01 1,00E+00‐ MAP1984 89 135 9 509 102 19 1,38E‐01 1,00E+00ptpA MAP1985 0 194 10 219 179 22 1,53E‐01 1,00E+00‐ MAP1986 405 365 27 539 78 15 2,05E‐01 1,00E+00cobD MAP1987c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP1988 923 1080 70 1057 661 55 6,16E‐01 1,00E+00‐ MAP1989c 592 497 26 711 305 20 6,90E‐01 1,00E+00‐ MAP1990 0 0 0 0 0 0 1,00E+00 1,00E+00ahpE MAP1991c 1016 1423 151 1079 764 109 4,22E‐01 1,00E+00‐ MAP1992c 4852 6118 712 10116 3598 728 7,88E‐01 1,00E+00‐ MAP1993c 778 2631 127 2721 1002 118 9,71E‐01 1,00E+00aceE MAP1994 5915 6294 127 8680 2679 93 4,33E‐01 1,00E+00‐ MAP1995 1343 1737 66 2308 580 48 4,32E‐01 1,00E+00fabD MAP1996 19648 16951 1179 39092 8937 1147 3,07E‐01 1,00E+00acpP MAP1997 24036 16981 3480 40577 7168 2858 7,13E‐01 1,00E+00kasA MAP1998 29424 24081 1255 55705 11917 1161 2,53E‐01 1,00E+00kasB_1 MAP1999 14220 11298 566 23662 5389 476 7,93E‐01 1,00E+00accD6 MAP2000 6171 4737 225 11169 3455 236 7,14E‐01 1,00E+00‐ MAP2001c 50 52 1 0 0 0 1,00E+00 1,00E+00glpD1 MAP2002c 79 204 5 153 21 2 1,87E‐01 1,00E+00‐ MAP2003c 51 83 5 102 101 8 9,54E‐01 1,00E+00‐ MAP2004 183 340 9 229 51 3 8,05E‐02 1,00E+00‐ MAP2005 376 416 14 307 162 7 1,60E‐01 1,00E+00‐ MAP2006c 667 749 50 797 655 50 8,65E‐01 1,00E+00‐ MAP2007c 153 118 7 421 102 10 2,66E‐01 1,00E+00adhE2 MAP2008 411 434 22 659 394 25 6,02E‐01 1,00E+00‐ MAP2009 556 499 49 666 441 47 8,66E‐01 1,00E+00

223









‐ MAP2010 165 493 17 376 255 15 9,57E‐01 1,00E+00‐ MAP2011 7028 2535 831 14990 3148 1116 1,89E‐01 1,00E+00‐ MAP2012c 841 1016 32 1407 702 32 8,97E‐01 1,00E+00‐ MAP2013c 731 628 36 817 341 25 5,05E‐01 1,00E+00‐ MAP2014 888 1413 188 3310 690 245 3,38E‐01 1,00E+00‐ MAP2015 1861 1913 83 3787 1369 93 6,96E‐01 1,00E+00‐ MAP2016 377 353 41 840 304 52 4,33E‐01 1,00E+00lppN MAP2017 48 104 8 103 52 8 5,10E‐01 1,00E+00‐ MAP2018c 6895 6494 262 11159 3281 220 5,46E‐01 1,00E+00‐ MAP2019c 41 114 17 187 59 23 5,32E‐01 1,00E+00‐ MAP2020 958 535 55 1403 251 42 6,45E‐01 1,00E+00‐ MAP2021c 229 124 14 236 151 13 8,73E‐01 1,00E+00‐ MAP2022 0 100 2 98 101 5 6,58E‐01 1,00E+00‐ MAP2023c 163 450 29 406 252 30 8,80E‐01 1,00E+00‐ MAP2024c 51 101 8 233 51 12 7,35E‐01 1,00E+00‐ MAP2025c 152 100 16 50 99 10 5,25E‐01 1,00E+00‐ MAP2026 8178 8922 320 12026 5598 284 9,62E‐01 1,00E+00‐ MAP2027c 5969 9326 1071 16376 4815 1180 6,16E‐01 1,00E+00‐ MAP2028c 9155 14703 2608 18630 9045 2669 3,53E‐01 1,00E+00‐ MAP2029c 1179 1438 166 1973 931 160 9,43E‐01 1,00E+00‐ MAP2030 454 222 15 402 305 15 9,92E‐01 1,00E+00‐ MAP2031c 252 292 10 478 121 9 7,96E‐01 1,00E+00‐ MAP2033 95 0 2 102 51 2 5,30E‐01 1,00E+00‐ MAP2034c 656 982 38 1450 576 40 8,00E‐01 1,00E+00nirA_1 MAP2035 2147 5131 122 4720 1549 87 2,31E‐01 1,00E+00cysH_1 MAP2036 246 489 27 503 155 20 5,33E‐01 1,00E+00‐ MAP2037 1 291 14 357 203 26 1,39E‐01 1,00E+00‐ MAP2038c 492 854 40 1045 452 38 9,39E‐01 1,00E+00fdxC_1 MAP2039 1494 1909 299 1580 743 177 1,45E‐01 1,00E+00‐ MAP2040c 0 0 0 50 0 2 0,00E+00 1,00E+00

224









lipM MAP2041 409 660 23 640 407 21 9,67E‐01 1,00E+00‐ MAP2042c 429 200 43 307 128 24 2,28E‐01 1,00E+00yjcE MAP2043 470 631 19 778 306 16 8,11E‐01 1,00E+00‐ MAP2044 194 153 8 153 101 5 3,05E‐01 1,00E+00‐ MAP2045 0 0 0 0 0 0 1,00E+00 1,00E+00sseB MAP2046 218 280 16 634 103 17 7,96E‐01 1,00E+00‐ MAP2047 0 58 2 0 51 2 5,50E‐01 1,00E+00lppO MAP2048 651 408 57 1116 254 54 9,11E‐01 1,00E+00‐ MAP2049 1223 1901 90 2508 1439 104 5,31E‐01 1,00E+00IS1601_B_2 MAP2050 249 252 11 577 102 11 9,46E‐01 1,00E+00‐ MAP2051c 102 188 6 316 51 6 9,85E‐01 1,00E+00‐ MAP2052c 102 51 6 151 51 7 5,03E‐01 1,00E+00‐ MAP2053 0 51 1 102 51 4 5,84E‐01 1,00E+00‐ MAP2054c 302 148 13 145 185 10 6,41E‐01 1,00E+00‐ MAP2055 51 0 1 101 0 1 5,05E‐01 1,00E+00‐ MAP2056c 2081 3752 227 3810 2181 214 8,71E‐01 1,00E+00‐ MAP2057 4111 5394 301 8590 2537 279 9,73E‐01 1,00E+00cysQ_2 MAP2058c 51 381 16 282 32 8 1,86E‐01 1,00E+00‐ MAP2059 204 303 23 557 151 25 7,41E‐01 1,00E+00‐ MAP2060c 0 0 0 110 0 1 0,00E+00 1,00E+00‐ MAP2061 425 364 58 595 145 41 4,82E‐01 1,00E+00‐ MAP2062 225 230 13 528 230 19 3,04E‐01 1,00E+00pknM MAP2064 525 1053 59 772 391 39 3,93E‐01 1,00E+00‐ MAP2066 266 234 8 300 50 4 1,45E‐01 1,00E+00‐ MAP2067c 604 443 30 788 223 22 5,75E‐01 1,00E+00‐ MAP2068c 3023 1676 648 2815 950 406 1,78E‐01 1,00E+00htpG MAP2069c 3058 2961 90 5400 1352 77 5,98E‐01 1,00E+00‐ MAP2070 659 568 57 1027 357 52 9,60E‐01 1,00E+00‐ MAP2071c 0 0 0 0 51 1 0,00E+00 1,00E+00‐ MAP2072c 77 0 2 0 0 0 1,00E+00 1,00E+00

225









‐ MAP2074c 0 0 0 51 0 1 0,00E+00 1,00E+00‐ MAP2075c 831 1159 89 1391 506 70 6,16E‐01 1,00E+00‐ MAP2076c 1120 962 65 1268 535 47 4,58E‐01 1,00E+00‐ MAP2078c 636 1182 19 1390 1395 30 1,16E‐01 1,00E+00‐ MAP2079 1649 3501 15 3935 1550 14 8,00E‐01 1,00E+00‐ MAP2080 190 135 13 195 124 12 9,30E‐01 1,00E+00‐ MAP2081 160 270 7 168 144 5 5,71E‐01 1,00E+00‐ MAP2082 51 0 1 51 80 2 8,60E‐01 1,00E+00‐ MAP2083c 356 610 30 907 458 37 4,03E‐01 1,00E+00‐ MAP2084 2777 2322 102 3561 1206 76 4,25E‐01 1,00E+00‐ MAP2085 0 0 0 102 0 4 0,00E+00 1,00E+00‐ MAP2086c 643 903 88 1476 597 100 6,34E‐01 1,00E+00‐ MAP2087c 807 802 54 2389 610 76 2,31E‐01 1,00E+00‐ MAP2088c 244 303 11 102 50 2 4,76E‐03 1,00E+00‐ MAP2089c 255 759 18 1120 150 16 9,86E‐01 1,00E+00uspA MAP2090 0 153 4 51 0 0 2,19E‐02 1,00E+00uspE MAP2091 51 76 4 152 51 5 5,22E‐01 1,00E+00uspC MAP2092 197 180 8 50 152 5 3,19E‐01 1,00E+00rocE MAP2093c 51 153 3 234 51 4 5,09E‐01 1,00E+00rocD1 MAP2094c 132 101 5 408 102 9 2,29E‐01 1,00E+00‐ MAP2096 54 132 11 163 0 6 7,65E‐01 1,00E+00‐ MAP2097c 219 769 32 803 203 26 7,44E‐01 1,00E+00‐ MAP2098c 1067 1800 38 1926 557 26 3,56E‐01 1,00E+00‐ MAP2099 153 236 22 227 153 21 9,90E‐01 1,00E+00‐ MAP2100 759 1144 30 772 482 18 2,56E‐01 1,00E+00‐ MAP2101 4271 4215 126 6758 2049 103 6,46E‐01 1,00E+00narK3_1 MAP2102c 153 405 10 463 86 7 5,88E‐01 1,00E+00lppP MAP2103c 2557 2812 322 3669 1073 222 3,03E‐01 1,00E+00fdhF MAP2104 355 452 5 237 88 1 1,98E‐02 1,00E+00‐ MAP2105 131 102 24 107 206 37 2,70E‐01 1,00E+00

226









‐ MAP2106c 0 0 0 0 51 4 0,00E+00 1,00E+00‐ MAP2107c 0 0 0 51 0 4 0,00E+00 1,00E+00‐ MAP2108 499 691 27 1519 302 31 6,06E‐01 1,00E+00‐ MAP2110c 110 101 10 140 51 7 7,53E‐01 1,00E+00‐ MAP2111c 232 375 11 738 101 11 9,58E‐01 1,00E+00lprM MAP2112c 0 77 1 534 51 10 1,44E‐03 1,00E+00‐ MAP2113c 100 100 4 153 147 6 3,21E‐01 1,00E+00‐ MAP2114c 252 153 10 458 51 8 7,55E‐01 1,00E+00‐ MAP2115c 128 47 5 524 0 8 2,80E‐01 1,00E+00mce3 MAP2116c 166 237 9 771 153 15 1,71E‐01 1,00E+00‐ MAP2117c 1284 313 63 2326 434 75 5,19E‐01 1,00E+00‐ MAP2118 750 438 43 1579 441 56 4,05E‐01 1,00E+00‐ MAP2119 489 557 24 938 290 22 9,35E‐01 1,00E+00‐ MAP2120c 1760 2402 59 4763 1671 75 4,61E‐01 1,00E+00‐ MAP2121c 3417 4023 232 8312 2546 269 5,72E‐01 1,00E+00‐ predicted RNA 6703 6143 7217 14477 3838 7853 6,23E‐01 1,00E+00‐ MAP2122 11013 8479 443 28276 8955 663 9,32E‐02 1,00E+00cysK MAP2123 3567 4072 237 9517 2299 277 5,57E‐01 1,00E+00cysE MAP2124 2106 2303 185 5109 1313 206 7,39E‐01 1,00E+00‐ MAP2126 202 420 15 493 51 9 3,03E‐01 1,00E+00‐ MAP2127 203 204 8 153 46 3 8,69E‐02 1,00E+00‐ MAP2128c 125 237 16 551 260 31 9,27E‐02 1,00E+00‐ MAP2129 919 1004 182 1695 517 165 8,93E‐01 1,00E+00dnaG MAP2130c 2331 3524 85 3633 1213 57 2,45E‐01 1,00E+00‐ MAP2131c 559 812 63 1667 458 77 5,12E‐01 1,00E+00dgt MAP2132c 597 446 24 760 609 30 4,18E‐01 1,00E+00‐ MAP2133 280 229 10 305 160 8 7,16E‐01 1,00E+00‐ MAP2134 0 0 0 0 43 3 0,00E+00 1,00E+00‐ MAP2135c 4157 5948 670 8863 4083 746 6,32E‐01 1,00E+00‐ MAP2136c 1215 1003 52 2456 1273 77 1,74E‐01 1,00E+00

227









glyS MAP2137c 1492 2905 89 1541 1140 53 1,18E‐01 1,00E+00‐ MAP2140c 153 425 37 284 404 50 4,15E‐01 1,00E+00‐ MAP2141c 1003 1689 86 1878 786 72 7,85E‐01 1,00E+00recO MAP2142c 85 435 17 255 306 21 5,90E‐01 1,00E+00amiA2 MAP2143 240 302 10 294 102 6 1,34E‐01 1,00E+00‐ MAP2144 1157 878 41 1609 381 29 4,70E‐01 1,00E+00era MAP2145c 1269 3181 138 2888 913 97 3,22E‐01 1,00E+00‐ MAP2146c 2422 3956 138 5876 2343 151 6,34E‐01 1,00E+00‐ MAP2147c 961 817 40 1251 646 37 9,50E‐01 1,00E+00‐ MAP2148 51 51 4 51 0 1 1,28E‐01 1,00E+00‐ MAP2149c 0 16 0 20 51 3 4,75E‐04 1,00E+00‐ MAP2150 812 952 41 1040 497 31 5,75E‐01 1,00E+00‐ MAP2151 68 538 37 410 605 73 5,79E‐02 1,00E+00‐ MAP2152c 568 477 81 483 153 39 9,27E‐02 1,00E+00‐ MAP2153 7265 8063 421 13396 5262 426 8,08E‐01 1,00E+00‐ predicted RNA 4542 5727 6577 7628 3797 6426 9,03E‐01 1,00E+00‐ predicted RNA 16596 20630 18198 20896 13499 15616 5,33E‐01 1,00E+00‐ MAP2154c 0 81 3 51 0 1 8,00E‐01 1,00E+00IS6110 MAP2155 51 454 43 202 152 31 5,47E‐01 1,00E+00‐ MAP2156 81 76 4 205 1 3 5,27E‐01 1,00E+00‐ MAP2157 717 870 37 692 286 19 1,10E‐01 1,00E+00‐ MAP2158 1543 1821 167 1504 972 113 3,25E‐01 1,00E+00‐ MAP2159c 3377 5920 495 5496 2277 354 3,88E‐01 1,00E+00phoH MAP2160c 3832 4248 221 7280 2520 217 9,25E‐01 1,00E+00‐ MAP2161c 9 0 0 138 0 3 4,88E‐08 1,00E+00dnaJ2 MAP2162c 1483 1462 74 3006 1321 93 3,89E‐01 1,00E+00hrcA MAP2163c 2095 2753 135 3222 1512 114 6,73E‐01 1,00E+00‐ MAP2164 951 833 165 1603 605 167 8,69E‐01 1,00E+00‐ MAP2166 55 102 4 51 51 3 5,53E‐01 1,00E+00‐ MAP2167c 752 842 88 1130 458 74 7,71E‐01 1,00E+00

228









‐ predicted RNA 2008 2335 5024 3092 1492 4610 8,51E‐01 1,00E+00‐ MAP2168c 7504 8822 878 14288 5967 919 6,90E‐01 1,00E+00mbtH_3 MAP2169c 51 50 13 50 113 25 8,77E‐01 1,00E+00mbtG MAP2170c 27 102 2 197 180 8 5,21E‐02 1,00E+00mbtF MAP2171c 57 100 1 331 859 9 1,58E‐14 1,00E+00mbtA MAP2178 0 0 0 335 317 15 1,00E+00 1,00E+00‐ MAP2179 152 379 32 395 539 63 6,03E‐02 1,00E+00‐ MAP2180c 3061 3129 422 4619 2068 388 8,21E‐01 1,00E+00‐ MAP2181c 704 902 67 1507 515 68 8,35E‐01 1,00E+00‐ MAP2182c 2 0 0 0 0 0 3,67E‐09 1,00E+00‐ MAP2183c 0 51 1 0 0 0 1,00E+00 1,00E+00‐ MAP2184c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP2185c 196 38 5 227 0 3 3,51E‐01 1,00E+00‐ MAP2186c 50 72 8 30 51 6 5,51E‐01 1,00E+00‐ MAP2187c 198 153 9 0 51 1 9,73E‐03 1,00E+00‐ MAP2188c 151 302 8 357 203 9 6,58E‐01 1,00E+00‐ MAP2189 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP2190 0 51 1 0 0 0 1,00E+00 1,00E+00‐ MAP2191 148 0 4 51 0 0 6,55E‐03 1,00E+00‐ MAP2192 50 306 7 353 152 9 4,40E‐01 1,00E+00‐ MAP2193 101 88 4 51 51 2 9,10E‐01 1,00E+00‐ MAP2194 101 249 6 153 51 3 1,91E‐01 1,00E+00‐ MAP2195 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP2196 0 0 0 0 0 0 1,00E+00 1,00E+00lipK MAP2197 101 253 9 204 0 3 8,22E‐02 1,00E+00‐ MAP2198 44 154 6 151 101 8 9,22E‐01 1,00E+00‐ MAP2199 161 101 8 204 51 6 3,80E‐01 1,00E+00‐ MAP2200 101 329 7 375 149 7 7,69E‐01 1,00E+00‐ MAP2201 102 337 13 382 151 13 7,81E‐01 1,00E+00‐ MAP2202c 23 184 10 456 102 21 1,40E‐01 1,00E+00

229









‐ MAP2203c 1101 835 46 2062 266 38 6,77E‐01 1,00E+00‐ MAP2204c 2701 2455 220 5611 1498 232 8,32E‐01 1,00E+00‐ MAP2206 296 401 16 407 151 10 4,05E‐01 1,00E+00hemN MAP2207c 606 1249 44 1550 558 42 9,98E‐01 1,00E+00‐ predicted RNA 438 1377 3368 1869 924 4706 2,49E‐01 1,00E+00nirA_2 MAP2208 4797 7451 209 9426 4344 205 9,21E‐01 1,00E+00cysH_2 MAP2209 1085 1726 107 2330 379 74 3,71E‐01 1,00E+00cysA MAP2210c 2381 1854 114 5138 1185 126 7,58E‐01 1,00E+00cysW MAP2211c 2464 2766 184 7857 2015 267 1,38E‐01 1,00E+00cysT MAP2212c 1143 1316 81 3614 1275 131 8,55E‐02 1,00E+00subI MAP2213c 2383 2953 149 6855 1623 179 4,19E‐01 1,00E+00‐ MAP2214c 254 102 52 367 153 62 3,18E‐01 1,00E+00‐ MAP2215 10286 13521 349 19157 6578 307 7,94E‐01 1,00E+00lppR MAP2216c 561 241 31 539 51 14 9,85E‐02 1,00E+00lepA MAP2217c 1845 3322 74 4423 1516 70 8,89E‐01 1,00E+00‐ MAP2218 842 572 68 1266 556 73 7,31E‐01 1,00E+00‐ MAP2219c 4562 3808 572 6785 3041 566 8,93E‐01 1,00E+00‐ MAP2220 51 186 7 391 51 10 3,48E‐01 1,00E+00‐ MAP2221c 1720 1711 65 3831 1131 73 6,15E‐01 1,00E+00‐ MAP2222c 1585 1256 85 2534 689 73 8,05E‐01 1,00E+00‐ MAP2223c 2163 2985 88 5848 1241 90 9,03E‐01 1,00E+00rpsT MAP2224 1166 2414 387 2177 1511 384 8,98E‐01 1,00E+00‐ MAP2225c 695 344 31 913 203 24 6,75E‐01 1,00E+00‐ MAP2226c 0 0 0 51 0 1 0,00E+00 1,00E+00fadE17 MAP2227 3881 4085 199 7015 1738 166 6,66E‐01 1,00E+00‐ MAP2228 2061 1434 93 2415 651 61 2,71E‐01 1,00E+00‐ MAP2229 27 80 7 252 0 10 5,42E‐01 1,00E+00‐ MAP2230c 17082 17866 91 21369 7873 62 9,92E‐01 1,00E+00papA3_1 MAP2231 8234 11486 398 12889 5943 329 8,88E‐01 1,00E+00mmpL10 MAP2232 1879 2629 52 3798 1267 47 8,32E‐01 1,00E+00

230









‐ MAP2233 204 655 46 904 258 51 6,66E‐01 1,00E+00‐ MAP2234 2305 2021 111 2125 1267 78 3,33E‐01 1,00E+00fadD21_1 MAP2235 2077 2953 83 2672 1281 57 3,04E‐01 1,00E+00‐ MAP2236 101 402 21 683 196 30 3,46E‐01 1,00E+00‐ MAP2237 915 925 48 1853 434 45 9,52E‐01 1,00E+00‐ MAP2238 1017 839 110 1221 509 85 6,01E‐01 1,00E+00mmpL4_4 MAP2239 1907 2727 45 2891 1169 33 4,23E‐01 1,00E+00‐ MAP2240c 51 214 8 185 198 13 2,41E‐01 1,00E+00‐ MAP2242c 508 375 38 715 448 45 4,99E‐01 1,00E+00‐ MAP2243c 394 615 72 747 521 87 4,79E‐01 1,00E+00nadD MAP2244c 522 562 47 1129 600 66 2,59E‐01 1,00E+00‐ MAP2245c 1088 1438 50 2257 904 52 7,56E‐01 1,00E+00‐ MAP2246c 1334 1154 83 2411 473 69 7,55E‐01 1,00E+00proA MAP2247c 1287 1366 58 2617 741 57 8,99E‐01 1,00E+00‐ MAP2250c 946 1346 29 1772 457 22 5,01E‐01 1,00E+00rbsK MAP2251 150 39 5 152 127 8 5,28E‐01 1,00E+00‐ MAP2252c 101 201 11 455 49 12 4,80E‐01 1,00E+00‐ MAP2253 0 100 1 151 0 1 4,92E‐01 1,00E+00‐ MAP2254 82 100 5 0 0 0 1,00E+00 1,00E+00‐ MAP2255 29 0 0 52 0 0 4,86E‐01 1,00E+00‐ MAP2256 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP2257 102 25 7 51 51 6 5,41E‐01 1,00E+00nadE MAP2258c 2713 2730 77 4819 1396 68 7,26E‐01 1,00E+00entB MAP2259 355 355 38 1019 102 40 8,21E‐01 1,00E+00‐ MAP2260 296 623 30 714 204 24 6,94E‐01 1,00E+00‐ MAP2261c 618 558 26 1213 408 28 6,58E‐01 1,00E+00‐ MAP2262 427 401 37 500 174 24 3,87E‐01 1,00E+00proB MAP2263c 142 273 10 408 101 10 9,38E‐01 1,00E+00obgE MAP2264c 443 824 24 1270 313 23 9,09E‐01 1,00E+00rpmA MAP2265c 1206 1389 281 1563 896 240 8,02E‐01 1,00E+00

231









rplU MAP2266c 8201 9373 1630 11087 5497 1344 7,90E‐01 1,00E+00rne MAP2267c 6723 6257 133 10767 3336 113 6,05E‐01 1,00E+00ndk MAP2268c 1495 1856 235 4940 961 303 3,67E‐01 1,00E+00‐ MAP2269c 713 1170 142 1595 559 134 9,79E‐01 1,00E+00folC MAP2270c 824 1470 44 1335 507 30 3,44E‐01 1,00E+00valS MAP2271c 4908 4540 104 8481 2489 94 9,24E‐01 1,00E+00‐ MAP2272c 509 981 33 1499 253 28 8,38E‐01 1,00E+00‐ MAP2273c 102 0 4 49 102 7 7,26E‐01 1,00E+00‐ MAP2274 570 913 34 1389 644 41 5,31E‐01 1,00E+00‐ MAP2275c 578 1230 85 1230 463 68 6,56E‐01 1,00E+00‐ MAP2276c 1577 1508 82 2646 857 74 8,78E‐01 1,00E+00‐ MAP2277c 7219 8941 236 15010 4917 234 8,16E‐01 1,00E+00clpX MAP2278c 41833 50972 2091 72801 26691 1843 3,06E‐01 1,00E+00‐ predicted RNA 1304 2114 4432 1222 728 2332 5,84E‐02 1,00E+00mmuM MAP2279 539 687 38 667 408 30 7,49E‐01 1,00E+00clpP2 MAP2280c 5063 7385 560 8973 3230 453 5,84E‐01 1,00E+00clpP MAP2281c 8985 8636 856 13572 5118 743 9,47E‐01 1,00E+00tig MAP2282c 2021 2679 96 4339 1693 103 8,18E‐01 1,00E+00lipP MAP2283 1202 848 50 1494 1270 65 3,58E‐01 1,00E+00‐ MAP2284c 251 304 19 762 153 24 5,91E‐01 1,00E+00rpi MAP2285c 697 358 65 961 306 60 9,51E‐01 1,00E+00‐ MAP2286c 138 178 14 601 203 30 8,69E‐02 1,00E+00pepD MAP2287 2256 3210 60 4959 1925 63 8,07E‐01 1,00E+00‐ MAP2288c 1392 1618 182 2842 1151 202 6,06E‐01 1,00E+00‐ MAP2289c 3716 4773 1018 6601 2674 936 9,34E‐01 1,00E+00‐ MAP2290c 1175 1328 111 1086 761 77 3,65E‐01 1,00E+00glbO MAP2291 191 750 66 292 455 61 1,00E+00 1,00E+00‐ MAP2292 1302 2515 46 2738 1154 40 8,00E‐01 1,00E+00‐ MAP2293c 552 379 40 906 172 33 7,82E‐01 1,00E+00‐ MAP2294c 3704 5728 55 5885 1866 36 2,39E‐01 1,00E+00

232









‐ MAP2295c 8281 9863 312 14342 6146 299 8,12E‐01 1,00E+00‐ MAP2296c 0 65 3 0 17 1 6,99E‐01 1,00E+00‐ MAP2297c 117 192 4 250 152 5 4,48E‐01 1,00E+00plsB2 MAP2298c 3175 4485 93 4629 1615 62 1,51E‐01 1,00E+00‐ MAP2299c 1649 1752 91 2905 1369 99 6,94E‐01 1,00E+00‐ MAP2300c 1399 1756 61 2424 637 46 5,00E‐01 1,00E+00lipQ MAP2301c 845 971 41 1533 689 43 7,83E‐01 1,00E+00‐ MAP2302 2303 2438 115 5159 2076 147 3,63E‐01 1,00E+00‐ MAP2303c 454 305 72 484 305 68 9,58E‐01 1,00E+00‐ MAP2304 102 135 10 436 204 24 7,07E‐02 1,00E+00‐ MAP2305 727 986 119 1817 485 125 8,00E‐01 1,00E+00echA14 MAP2306 51 0 2 10 0 0 1,15E‐17 1,00E+00pdhC MAP2307c 484 535 25 1100 547 35 2,52E‐01 1,00E+00pdhB MAP2308c 280 534 21 372 153 12 2,01E‐01 1,00E+00pdhA MAP2309c 360 484 22 766 451 29 3,65E‐01 1,00E+00‐ MAP2311c 348 679 58 574 406 53 9,58E‐01 1,00E+00fadE19 MAP2312c 994 1077 51 1698 510 43 7,21E‐01 1,00E+00accA1 MAP2313c 337 555 12 840 353 14 5,66E‐01 1,00E+00accD1 MAP2314c 354 423 13 712 204 12 9,29E‐01 1,00E+00‐ MAP2315 101 83 8 82 0 2 9,17E‐02 1,00E+00‐ MAP2316 1009 745 67 1198 375 47 4,45E‐01 1,00E+00‐ MAP2317c 210 201 8 416 50 6 6,75E‐01 1,00E+00‐ MAP2318 201 203 14 152 204 13 9,53E‐01 1,00E+00‐ MAP2319c 703 555 23 736 524 22 9,90E‐01 1,00E+00‐ MAP2320 923 853 80 2065 506 87 6,92E‐01 1,00E+00‐ MAP2321 86 153 20 254 153 31 2,51E‐01 1,00E+00lppS_2 MAP2322c 1667 2017 86 2454 1317 79 8,90E‐01 1,00E+00‐ MAP2323c 219 51 9 252 43 6 3,72E‐01 1,00E+00‐ MAP2324c 1110 690 22 2435 353 23 7,57E‐01 1,00E+00‐ MAP2325 50 109 3 292 152 9 1,06E‐01 1,00E+00

233









‐ MAP2326 322 346 72 615 406 102 2,87E‐01 1,00E+00‐ MAP2327 408 243 11 857 355 16 2,05E‐01 1,00E+00‐ MAP2328c 3580 4677 910 5359 2853 808 8,34E‐01 1,00E+00bcp MAP2329 388 384 45 672 254 44 9,36E‐01 1,00E+00‐ MAP2330c 2424 2817 106 4667 1757 107 9,43E‐01 1,00E+00acpS MAP2331c 3793 3689 554 6609 1715 470 6,78E‐01 1,00E+00fas MAP2332c 34810 43710 243 76182 25801 256 2,29E‐01 1,00E+00‐ predicted RNA 407 922 2494 740 967 3534 2,71E‐01 1,00E+00‐ predicted RNA 428 1505 3351 469 747 2449 5,07E‐01 1,00E+00‐ MAP2333 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP2334c 428 594 40 1050 407 48 4,88E‐01 1,00E+00‐ MAP2335c 553 1031 49 1170 601 49 8,64E‐01 1,00E+00‐ MAP2336 51 0 1 52 51 2 5,96E‐01 1,00E+00‐ MAP2337c 314 469 16 914 262 19 5,40E‐01 1,00E+00‐ MAP2338 653 485 21 1465 608 31 1,97E‐01 1,00E+00‐ MAP2340c 322 267 32 338 201 26 7,45E‐01 1,00E+00‐ MAP2341c 515 367 61 688 364 63 7,43E‐01 1,00E+00‐ MAP2342c 242 344 10 748 203 13 5,09E‐01 1,00E+00‐ MAP2343c 1717 2092 95 3013 1321 92 9,79E‐01 1,00E+00‐ MAP2344 51 245 6 306 17 4 3,73E‐01 1,00E+00‐ MAP2345c 309 39 56 476 105 65 6,02E‐01 1,00E+00‐ MAP2346c 646 875 17 1758 585 22 4,46E‐01 1,00E+00‐ MAP2347 470 864 46 1639 538 61 3,58E‐01 1,00E+00‐ MAP2348 101 256 13 240 99 11 7,65E‐01 1,00E+00‐ MAP2349c 352 640 33 398 417 28 8,81E‐01 1,00E+00‐ MAP2350 189 50 6 360 203 12 1,20E‐01 1,00E+00‐ MAP2351 0 352 8 398 153 11 3,14E‐01 1,00E+00‐ MAP2352 356 269 16 508 153 13 7,40E‐01 1,00E+00‐ MAP2353 126 120 7 150 102 7 7,90E‐01 1,00E+00‐ MAP2354 151 246 13 156 67 6 1,67E‐01 1,00E+00

234









‐ MAP2355 251 339 25 446 280 28 6,97E‐01 1,00E+00‐ MAP2356 203 387 16 697 289 23 3,02E‐01 1,00E+00‐ MAP2357 1645 1410 74 2784 598 60 6,54E‐01 1,00E+00‐ MAP2358c 26 0 2 51 51 9 5,99E‐02 1,00E+00‐ MAP2359c 1237 1006 44 1773 560 36 6,64E‐01 1,00E+00‐ MAP2360c 0 51 2 150 42 8 2,25E‐01 1,00E+00rsbU MAP2361 1087 588 25 1291 670 25 8,88E‐01 1,00E+00‐ MAP2362c 327 303 14 406 202 12 7,74E‐01 1,00E+00‐ MAP2363c 35 149 4 51 111 4 5,05E‐01 1,00E+00‐ MAP2364c 364 156 16 422 40 9 2,43E‐01 1,00E+00‐ MAP2366 750 1728 43 1796 590 34 6,17E‐01 1,00E+00‐ MAP2367c 191 282 7 463 272 10 3,52E‐01 1,00E+00‐ MAP2368c 72 11 3 170 55 7 9,61E‐01 1,00E+00‐ MAP2369c 102 31 6 102 0 2 6,33E‐01 1,00E+00‐ MAP2370c 152 51 7 50 102 6 5,28E‐01 1,00E+00‐ MAP2371c 0 0 0 0 0 0 1,00E+00 1,00E+00accD4_2 MAP2372 150 153 5 249 203 8 2,72E‐01 1,00E+00‐ MAP2373c 326 536 23 486 348 21 9,83E‐01 1,00E+00‐ MAP2374c 190 586 61 429 353 62 8,69E‐01 1,00E+00‐ MAP2375c 107 146 6 395 102 9 2,58E‐01 1,00E+00‐ MAP2376c 253 325 10 255 51 3 5,96E‐02 1,00E+00‐ MAP2377 146 51 5 79 102 5 5,16E‐01 1,00E+00‐ MAP2378 0 0 0 0 51 3 0,00E+00 1,00E+00‐ MAP2379 20 63 3 48 14 2 5,89E‐01 1,00E+00fadD19_2 MAP2380 227 797 17 503 131 8 1,21E‐01 1,00E+00‐ MAP2381 0 51 1 14 0 0 1,70E‐04 1,00E+00‐ MAP2382 51 4 1 177 50 4 2,31E‐01 1,00E+00‐ MAP2383 610 452 25 1114 607 36 2,52E‐01 1,00E+00‐ MAP2384 153 391 13 34 245 9 5,28E‐01 1,00E+00‐ MAP2385c 203 301 12 505 151 12 8,31E‐01 1,00E+00

235









‐ MAP2386c 102 0 3 286 215 13 4,27E‐03 1,00E+00‐ MAP2387c 75 79 5 172 136 10 2,46E‐01 1,00E+00fadD19_3 MAP2388c 30 230 4 135 51 2 6,00E‐01 1,00E+00‐ MAP2389c 0 0 0 102 0 1 0,00E+00 1,00E+00‐ MAP2390c 0 100 3 32 51 3 4,98E‐01 1,00E+00‐ MAP2391 456 293 66 897 100 58 8,36E‐01 1,00E+00‐ MAP2392c 468 265 21 385 205 14 4,60E‐01 1,00E+00‐ MAP2393c 495 972 52 1240 269 40 6,67E‐01 1,00E+00‐ MAP2394 575 635 43 711 610 46 7,08E‐01 1,00E+00‐ MAP2395c 0 0 0 102 51 4 0,00E+00 1,00E+00‐ MAP2396c 51 152 8 50 0 1 1,08E‐04 1,00E+00echA10 MAP2397 97 143 7 51 46 3 2,01E‐01 1,00E+00‐ MAP2398 153 102 9 509 100 15 1,88E‐01 1,00E+00echA16_1 MAP2399 0 51 1 102 100 7 3,55E‐02 1,00E+00‐ MAP2400 79 47 2 151 51 3 5,19E‐01 1,00E+00fadD35 MAP2401 141 47 3 50 100 3 5,19E‐01 1,00E+00‐ MAP2402 0 50 0 0 51 1 5,66E‐01 1,00E+00‐ MAP2403c 369 851 94 1244 193 80 8,71E‐01 1,00E+00‐ MAP2404c 0 153 5 194 83 9 7,46E‐01 1,00E+00fadE3_1 MAP2405c 447 860 31 978 304 24 7,16E‐01 1,00E+00‐ MAP2406c 99 141 5 153 102 5 4,80E‐01 1,00E+00fadA3 MAP2407c 51 153 4 405 102 9 1,80E‐01 1,00E+00fabG MAP2408c 255 356 23 569 153 21 9,43E‐01 1,00E+00fadE25_3 MAP2409 92 119 5 369 123 9 1,85E‐01 1,00E+00‐ MAP2410 153 186 11 203 153 11 8,09E‐01 1,00E+00‐ MAP2411 143 102 16 395 51 20 3,70E‐01 1,00E+00‐ MAP2415c 546 253 66 941 153 62 9,91E‐01 1,00E+00‐ MAP2416c 1943 1958 67 2829 1425 64 9,60E‐01 1,00E+00lppJ MAP2417c 502 375 49 688 148 34 4,69E‐01 1,00E+00‐ MAP2418 738 1081 132 1476 614 129 9,42E‐01 1,00E+00

236









pks14 MAP2419 430 1215 130 607 583 98 5,92E‐01 1,00E+00‐ MAP2420c 387 776 53 672 388 45 8,50E‐01 1,00E+00‐ MAP2421c 352 520 81 986 254 89 6,43E‐01 1,00E+00rph MAP2422c 963 1647 95 2140 699 84 8,83E‐01 1,00E+00‐ MAP2423c 1766 2676 153 3632 1290 140 8,40E‐01 1,00E+00murI MAP2424c 102 100 7 304 146 13 1,83E‐01 1,00E+00‐ MAP2425c 337 77 28 325 110 22 7,46E‐01 1,00E+00‐ MAP2426c 289 106 54 339 92 44 7,64E‐01 1,00E+00‐ MAP2427c 301 204 14 562 51 11 6,97E‐01 1,00E+00‐ MAP2428c 661 806 72 1196 677 82 6,05E‐01 1,00E+00clpS MAP2429c 3167 4216 667 5768 2306 613 8,92E‐01 1,00E+00dinG MAP2431 290 244 7 509 101 6 7,67E‐01 1,00E+00glgP MAP2432c 1695 2699 47 4876 1398 54 7,05E‐01 1,00E+00‐ MAP2433 7248 8477 212 17285 5003 236 5,88E‐01 1,00E+00glgB MAP2434 4561 3903 112 11838 2346 137 5,03E‐01 1,00E+00‐ MAP2435c 328 618 29 809 400 33 5,62E‐01 1,00E+00fadA4 MAP2436c 3050 2338 135 5440 1818 144 7,61E‐01 1,00E+00‐ MAP2437 5133 5044 637 11063 3544 725 5,45E‐01 1,00E+00‐ MAP2438c 123 234 34 100 51 12 9,92E‐02 1,00E+00‐ MAP2439c 905 1237 90 1257 879 85 9,93E‐01 1,00E+00‐ MAP2440 952 653 29 962 266 16 2,21E‐01 1,00E+00‐ MAP2441c 51 204 5 115 0 1 9,03E‐02 1,00E+00‐ MAP2442 50 51 3 101 0 1 6,01E‐01 1,00E+00alkA MAP2443 441 295 14 684 564 23 1,51E‐01 1,00E+00‐ MAP2444c 1541 908 59 1106 455 31 8,69E‐02 1,00E+00ogt MAP2445 283 173 27 355 49 16 2,89E‐01 1,00E+00‐ MAP2446c 820 1969 157 2915 1640 237 1,35E‐01 1,00E+00‐ predicted RNA 377171811 374034892 4008543 669375318 267645066 4149302 4,74E‐01 1,00E+00‐ predicted RNA 2123086 1617952 34046 4815569 1553315 45556 4,03E‐01 1,00E+00‐ predicted RNA 805 822 3943 2422 775 6155 1,35E‐01 1,00E+00

237









‐ predicted RNA 304281 244174 20630 649347 237026 26917 9,41E‐01 1,00E+00murA MAP2447c 2987 3649 152 6818 2055 161 7,22E‐01 1,00E+00‐ MAP2448 1044 1290 112 1218 597 76 3,45E‐01 1,00E+00‐ MAP2449c 299 557 54 742 150 42 6,36E‐01 1,00E+00atpC MAP2450c 5690 5355 880 9402 2544 730 7,57E‐01 1,00E+00atpD MAP2451c 12810 16413 696 22230 4803 481 7,79E‐01 1,00E+00atpG MAP2452c 10221 14667 779 15353 5588 542 6,20E‐01 1,00E+00atpA MAP2453c 17147 26010 741 32286 12046 634 5,86E‐01 1,00E+00atpH MAP2454c 10800 19403 639 20422 8493 525 6,49E‐01 1,00E+00atpF MAP2455c 4733 5583 558 8904 2472 479 8,32E‐01 1,00E+00atpE MAP2456c 1856 2002 438 3009 892 348 5,57E‐01 1,00E+00atpB MAP2457c 5278 6939 463 7601 3591 369 5,82E‐01 1,00E+00‐ MAP2458c 3076 2838 357 3784 1775 287 4,88E‐01 1,00E+00rfe MAP2459c 1518 1586 73 1835 721 50 3,41E‐01 1,00E+00‐ MAP2460c 145 167 13 568 101 21 2,28E‐01 1,00E+00hemK MAP2461c 834 546 45 1265 480 46 8,24E‐01 1,00E+00prfA MAP2462c 2165 2594 128 3501 1151 100 5,35E‐01 1,00E+00rpmE MAP2463c 3524 5133 1020 6366 2557 888 8,08E‐01 1,00E+00rho MAP2464c 39458 55137 1457 69182 29267 1292 3,02E‐01 1,00E+00‐ MAP2465c 36890 60458 9071 74484 34452 8870 2,54E‐01 1,00E+00thrB MAP2466c 1426 1689 94 1876 1320 92 9,34E‐01 1,00E+00thrC MAP2467c 2189 2873 134 3117 1586 110 6,00E‐01 1,00E+00thrA MAP2468c 1070 1479 55 1757 748 46 7,55E‐01 1,00E+00lysA_2 MAP2469c 1884 2985 97 3356 1741 91 8,73E‐01 1,00E+00argS MAP2470c 1776 1749 62 2707 1239 59 9,91E‐01 1,00E+00‐ MAP2471 872 598 147 1399 318 126 8,33E‐01 1,00E+00‐ MAP2472 4383 5682 266 5909 3272 218 7,32E‐01 1,00E+00‐ MAP2473 272 713 62 383 425 55 9,27E‐01 1,00E+00‐ MAP2475 279 589 34 403 641 47 3,09E‐01 1,00E+00‐ MAP2476 2594 2712 315 4182 1798 300 8,95E‐01 1,00E+00

238









‐ MAP2477c 0 0 0 112 51 6 0,00E+00 1,00E+00‐ MAP2478 115 254 27 385 51 23 8,18E‐01 1,00E+00‐ MAP2479 201 368 9 330 204 8 8,66E‐01 1,00E+00‐ MAP2480c 423 341 36 846 301 43 5,11E‐01 1,00E+00‐ MAP2481c 269 153 12 351 198 14 6,58E‐01 1,00E+00‐ MAP2482 2366 3659 434 3415 1719 328 3,86E‐01 1,00E+00‐ MAP2483c 357 638 58 238 435 45 6,86E‐01 1,00E+00cysN MAP2484c 51 50 1 428 8 4 1,42E‐01 1,00E+00cysD MAP2485c 143 431 16 363 95 10 3,74E‐01 1,00E+00‐ MAP2486 174 0 12 92 51 8 7,00E‐01 1,00E+00‐ MAP2487c 534 562 64 1172 303 66 7,61E‐01 1,00E+00oppB MAP2488 306 139 13 716 129 18 4,42E‐01 1,00E+00oppC MAP2489 202 51 8 150 102 7 7,73E‐01 1,00E+00oppD MAP2490 773 649 22 736 611 20 9,59E‐01 1,00E+00oppA MAP2491 1524 1752 58 2071 663 38 2,96E‐01 1,00E+00‐ MAP2492c 152 357 14 419 251 17 5,50E‐01 1,00E+00‐ MAP2493c 1404 1676 33 2120 397 20 1,52E‐01 1,00E+00‐ MAP2494c 606 472 27 989 363 27 7,88E‐01 1,00E+00‐ MAP2495 453 1108 30 962 435 24 6,79E‐01 1,00E+00‐ MAP2496 102 50 9 23 101 9 5,02E‐01 1,00E+00lprC MAP2497c 4945 5617 536 8010 2881 451 7,97E‐01 1,00E+00lprB MAP2498c 2124 2180 224 3493 1177 195 7,46E‐01 1,00E+00‐ MAP2499 152 101 4 356 102 5 3,00E‐01 1,00E+00‐ MAP2500 493 957 21 484 368 12 1,98E‐01 1,00E+00‐ MAP2501 117 399 41 228 51 17 9,25E‐02 1,00E+00‐ MAP2502 2534 2254 83 5125 2033 103 4,27E‐01 1,00E+00embR_2 MAP2503 418 186 15 318 119 9 2,50E‐01 1,00E+00‐ MAP2504 1562 2125 87 2643 807 65 4,29E‐01 1,00E+00‐ MAP2505 459 928 64 713 353 44 4,52E‐01 1,00E+00‐ MAP2506c 202 151 18 151 100 11 7,34E‐02 1,00E+00

239









‐ predicted RNA 6379 3702 6000 12206 4040 7556 2,75E‐01 1,00E+00‐ MAP2507c 806 1140 48 1406 552 40 7,47E‐01 1,00E+00‐ MAP2508 0 0 0 31 0 1 0,00E+00 1,00E+00amiB2 MAP2509c 51 198 4 347 51 5 4,08E‐01 1,00E+00‐ MAP2510 306 403 46 374 255 39 7,60E‐01 1,00E+00‐ MAP2511 146 361 13 596 188 17 5,09E‐01 1,00E+00‐ MAP2512 0 0 0 51 0 0 0,00E+00 1,00E+00‐ MAP2513c 0 51 1 346 151 11 2,25E‐07 1,00E+00‐ MAP2514c 779 293 28 545 378 22 6,77E‐01 1,00E+00‐ MAP2515c 481 136 19 100 173 9 1,16E‐01 1,00E+00‐ MAP2516 286 224 12 302 102 7 3,59E‐01 1,00E+00‐ MAP2517 861 1266 44 2580 605 50 5,80E‐01 1,00E+00‐ MAP2518 230 151 9 102 255 10 7,00E‐01 1,00E+00‐ MAP2519 100 51 7 101 51 6 5,16E‐01 1,00E+00‐ MAP2520c 323 1243 38 893 624 36 9,57E‐01 1,00E+00deaD MAP2521c 4237 4635 151 7188 2371 130 8,05E‐01 1,00E+00‐ MAP2523c 196 220 11 339 51 7 3,98E‐01 1,00E+00‐ MAP2524c 83 112 6 5 0 0 0,00E+00 1,00E+00‐ MAP2525c 181 504 14 241 235 10 5,43E‐01 1,00E+00‐ MAP2526c 28 240 9 140 180 13 3,16E‐01 1,00E+00‐ MAP2527c 394 402 36 773 256 37 8,14E‐01 1,00E+00‐ MAP2528 102 51 5 153 36 4 5,10E‐01 1,00E+00‐ MAP2529 102 51 7 88 0 2 6,42E‐01 1,00E+00‐ MAP2530 176 328 18 304 151 14 7,38E‐01 1,00E+00‐ MAP2531 429 204 34 514 148 27 6,75E‐01 1,00E+00‐ MAP2532 356 591 40 457 101 17 7,35E‐02 1,00E+00‐ MAP2533 449 1653 17 1236 408 11 3,31E‐01 1,00E+00‐ MAP2534c 578 553 16 1258 408 19 5,39E‐01 1,00E+00‐ MAP2535 3560 4641 304 5828 2290 252 6,60E‐01 1,00E+00kgd MAP2536 15613 19837 272 28368 11648 259 3,70E‐01 1,00E+00

240









‐ MAP2537 3868 4647 298 6104 1962 226 4,71E‐01 1,00E+00‐ MAP2538 1029 1643 89 2173 531 69 5,99E‐01 1,00E+00lpqZ MAP2539c 153 292 14 515 153 17 5,62E‐01 1,00E+00‐ MAP2540c 3738 5215 212 6547 3201 202 9,62E‐01 1,00E+00mdh MAP2541c 2474 2724 152 3459 983 101 2,55E‐01 1,00E+00corA MAP2542 989 1377 61 1773 866 60 9,01E‐01 1,00E+00‐ MAP2543 0 102 3 0 0 0 1,00E+00 1,00E+00‐ MAP2544c 51 0 3 51 14 3 5,23E‐01 1,00E+00sugC MAP2545c 1345 1346 66 1761 995 60 9,47E‐01 1,00E+00sugB MAP2546c 446 675 39 817 71 21 1,46E‐01 1,00E+00sugA MAP2547c 153 488 19 641 151 18 9,70E‐01 1,00E+00lpqY MAP2548c 485 996 29 961 100 14 7,34E‐02 1,00E+00‐ MAP2549c 2588 2870 301 4697 1535 275 7,90E‐01 1,00E+00‐ MAP2550 1305 1911 70 2447 632 52 4,78E‐01 1,00E+00‐ MAP2551 429 731 60 732 556 65 6,78E‐01 1,00E+00‐ MAP2552 2936 2691 120 5444 2022 130 6,87E‐01 1,00E+00mrp MAP2553 2317 2605 122 4320 1470 116 8,98E‐01 1,00E+00‐ MAP2554c 405 846 89 1190 555 109 4,68E‐01 1,00E+00htrA MAP2555c 7084 9173 308 13316 4947 286 9,84E‐01 1,00E+00‐ MAP2556c 1505 3137 326 3583 1130 270 6,39E‐01 1,00E+00sigE MAP2557c 12220 10035 864 21813 5582 802 6,96E‐01 1,00E+00‐ MAP2558 558 595 45 1187 251 41 9,83E‐01 1,00E+00‐ MAP2559 21256 21451 1545 32675 12296 1334 5,46E‐01 1,00E+00‐ MAP2560 19998 19339 1481 35172 10160 1326 4,86E‐01 1,00E+00‐ MAP2561 13278 15410 504 29595 8280 518 2,58E‐01 1,00E+00‐ MAP2562 6402 8535 633 14314 4665 649 7,96E‐01 1,00E+00‐ MAP2563 2369 4318 112 4793 1731 91 4,90E‐01 1,00E+00glgC MAP2564c 1844 1728 85 2742 1300 83 9,57E‐01 1,00E+00‐ MAP2565 374 453 20 960 518 32 1,56E‐01 1,00E+00‐ MAP2566 3058 2968 104 5643 1745 101 9,74E‐01 1,00E+00

241









‐ predicted RNA 4533 5613 5738 7052 3876 5541 9,29E‐01 1,00E+00tagA MAP2567c 479 1224 82 828 479 58 4,94E‐01 1,00E+00‐ MAP2568c 1440 920 199 1271 851 163 6,87E‐01 1,00E+00‐ MAP2569c 440 418 25 1539 354 41 1,25E‐01 1,00E+00folP2 MAP2570c 416 412 26 550 507 33 4,18E‐01 1,00E+00fadD6 MAP2571c 850 937 29 1303 353 20 4,79E‐01 1,00E+00‐ MAP2572c 573 868 73 1081 280 53 5,58E‐01 1,00E+00‐ MAP2573 0 100 1 219 0 2 5,52E‐01 1,00E+00dapE MAP2574c 395 376 21 657 355 24 5,83E‐01 1,00E+00‐ MAP2575c 153 99 6 337 75 7 3,79E‐01 1,00E+00PE_6 MAP2576c 78 53 4 151 2 3 5,61E‐01 1,00E+00‐ MAP2577 655 789 34 878 717 36 7,23E‐01 1,00E+00‐ MAP2578 514 409 28 688 355 27 8,40E‐01 1,00E+00‐ MAP2579c 803 753 34 1307 727 39 5,79E‐01 1,00E+00fadD36 MAP2580c 51 101 3 247 18 3 5,14E‐01 1,00E+00‐ MAP2581c 595 1029 50 866 353 32 3,41E‐01 1,00E+00‐ MAP2582c 4664 3619 106 9530 1817 104 9,15E‐01 1,00E+00‐ MAP2583c 20197 11010 637 47874 8345 800 9,01E‐02 1,00E+00‐ MAP2584 1801 1800 87 3181 1427 95 7,13E‐01 1,00E+00fadE26_2 MAP2585 3023 3910 168 5841 1361 132 4,07E‐01 1,00E+00‐ MAP2586 1018 649 90 1106 405 65 5,09E‐01 1,00E+00‐ MAP2587 733 928 118 1892 298 110 9,89E‐01 1,00E+00‐ MAP2588 1990 1305 86 3522 468 71 6,37E‐01 1,00E+00‐ MAP2589 895 731 103 1053 480 82 6,82E‐01 1,00E+00ltp2_2 MAP2590 1333 1812 77 2451 809 64 7,11E‐01 1,00E+00‐ MAP2591 165 232 18 328 89 15 7,87E‐01 1,00E+00‐ MAP2592c 0 122 3 51 152 7 2,06E‐01 1,00E+00rocA MAP2593c 51 0 0 396 152 8 2,71E‐06 1,00E+00‐ MAP2594 51 0 1 51 49 1 5,92E‐01 1,00E+00‐ MAP2595 0 0 0 33 51 1 0,00E+00 1,00E+00

242









fadD21_2 MAP2596 203 244 7 394 153 7 8,49E‐01 1,00E+00‐ MAP2597c 2372 1885 375 3982 829 308 6,27E‐01 1,00E+00sat MAP2598c 3448 2964 149 5700 1685 133 7,56E‐01 1,00E+00‐ MAP2599c 545 572 46 943 518 54 5,44E‐01 1,00E+00‐ MAP2600 78 131 5 102 45 3 9,62E‐01 1,00E+00‐ MAP2601 0 0 0 50 0 0 0,00E+00 1,00E+00‐ MAP2602 0 0 0 66 28 9 0,00E+00 1,00E+00‐ MAP2603c 298 296 4 402 102 2 3,86E‐01 1,00E+00‐ MAP2604c 407 330 9 612 101 6 4,36E‐01 1,00E+00‐ MAP2605c 1911 3112 59 3481 1191 45 4,76E‐01 1,00E+00‐ MAP2606c 539 970 38 1156 386 32 7,90E‐01 1,00E+00fdxC_2 MAP2607c 10380 9027 1737 19420 4284 1564 9,25E‐01 1,00E+00‐ MAP2608 202 288 14 374 153 12 9,45E‐01 1,00E+00‐ MAP2609 12379 13154 2226 21980 8323 2174 3,76E‐01 1,00E+00‐ MAP2610c 336 321 26 761 356 38 2,54E‐01 1,00E+00fbiC MAP2611c 3362 6244 104 6114 3136 90 8,25E‐01 1,00E+00‐ MAP2612c 761 1488 130 2352 748 146 6,16E‐01 1,00E+00‐ MAP2613c 244 230 15 202 133 9 4,02E‐01 1,00E+00‐ MAP2614 203 155 15 349 251 23 2,30E‐01 1,00E+00lpqW MAP2615c 750 918 24 847 405 16 3,58E‐01 1,00E+00‐ MAP2616c 675 696 19 1199 456 19 8,77E‐01 1,00E+00narI MAP2617c 150 324 18 611 194 25 3,81E‐01 1,00E+00narJ MAP2618c 51 205 11 286 101 14 3,52E‐01 1,00E+00narH MAP2619c 985 2230 55 1976 455 32 1,34E‐01 1,00E+00narG MAP2620c 1402 2082 27 2260 846 20 4,43E‐01 1,00E+00mutT2 MAP2621c 0 89 6 51 0 2 6,97E‐01 1,00E+00‐ MAP2622 5096 6385 350 10473 3354 338 9,39E‐01 1,00E+00phhB MAP2623 2827 2984 511 5458 1962 531 7,98E‐01 1,00E+00pimE MAP2624c 451 750 26 1072 153 18 5,39E‐01 1,00E+00‐ MAP2625 3150 1806 211 3819 1436 179 6,62E‐01 1,00E+00

243









‐ MAP2626 698 1245 50 1698 785 56 6,17E‐01 1,00E+00‐ MAP2627c 1099 782 377 1075 457 255 3,77E‐01 1,00E+00‐ MAP2628c 4875 7129 597 9370 3668 544 8,84E‐01 1,00E+00‐ MAP2629c 710 499 158 794 601 171 6,94E‐01 1,00E+00‐ MAP2630c 384 903 81 852 357 66 7,66E‐01 1,00E+00‐ MAP2631 50 113 8 183 41 8 5,04E‐01 1,00E+00‐ MAP2632c 737 646 110 1526 301 105 9,50E‐01 1,00E+00‐ MAP2633 540 500 42 558 457 40 9,11E‐01 1,00E+00‐ MAP2635c 451 511 11 425 250 7 3,50E‐01 1,00E+00‐ MAP2636 647 1380 389 3093 967 635 8,56E‐02 1,00E+00‐ MAP2637c 124 182 11 202 67 8 3,49E‐01 1,00E+00mcr MAP2638c 611 470 29 859 356 27 9,48E‐01 1,00E+00echA11 MAP2639 304 227 19 305 130 13 4,68E‐01 1,00E+00‐ MAP2640c 204 204 16 407 153 18 6,69E‐01 1,00E+00‐ MAP2641c 446 519 20 955 354 22 5,95E‐01 1,00E+00‐ MAP2642 102 102 5 114 0 1 2,06E‐01 1,00E+00‐ MAP2643 1715 2328 231 3487 1211 220 9,47E‐01 1,00E+00‐ MAP2644 90 0 2 51 0 0 2,10E‐01 1,00E+00echA1_1 MAP2645c 51 136 6 255 195 15 1,06E‐01 1,00E+00fadA6_3 MAP2646c 2619 1680 110 3448 621 74 2,44E‐01 1,00E+00‐ MAP2647c 385 254 42 440 252 40 9,93E‐01 1,00E+00‐ MAP2648c 1017 765 49 1854 182 37 5,56E‐01 1,00E+00‐ MAP2649c 101 102 4 180 0 2 8,55E‐01 1,00E+00‐ MAP2650c 50 50 2 62 0 1 9,58E‐01 1,00E+00‐ MAP2651c 0 49 1 51 51 2 7,40E‐01 1,00E+00‐ MAP2652c 0 0 0 0 0 0 1,00E+00 1,00E+00nirQ MAP2653c 0 51 1 43 51 3 6,07E‐01 1,00E+00‐ MAP2654c 0 51 0 51 0 0 5,64E‐01 1,00E+00‐ MAP2655 532 1145 40 1018 595 36 9,00E‐01 1,00E+00‐ MAP2656 255 388 16 356 171 12 5,29E‐01 1,00E+00

244









‐ MAP2657 693 743 64 1476 659 81 4,31E‐01 1,00E+00‐ MAP2658 403 428 18 1014 306 23 4,40E‐01 1,00E+00‐ MAP2659 601 377 34 761 238 27 7,10E‐01 1,00E+00‐ MAP2660 20 188 8 303 95 14 2,87E‐01 1,00E+00metE MAP2661 975 695 21 2015 558 25 5,41E‐01 1,00E+00‐ MAP2662c 1057 1489 41 1279 402 22 9,60E‐02 1,00E+00‐ MAP2663c 658 966 91 1533 157 64 4,79E‐01 1,00E+00ppdK MAP2664 245 203 7 549 78 7 9,45E‐01 1,00E+00‐ MAP2665 356 303 31 305 101 15 1,28E‐01 1,00E+00‐ MAP2666c 0 40 0 12 0 0 1,92E‐04 1,00E+00ephC MAP2667c 370 333 24 923 142 25 8,09E‐01 1,00E+00‐ MAP2668c 0 0 0 0 0 0 1,00E+00 1,00E+00bpoB MAP2669 853 600 46 1254 708 54 5,42E‐01 1,00E+00gnd2 MAP2670c 2286 2305 130 4219 1533 133 9,36E‐01 1,00E+00zwf MAP2671c 2536 2421 102 4238 1130 84 6,19E‐01 1,00E+00‐ MAP2672 151 151 13 203 0 5 1,33E‐01 1,00E+00‐ MAP2673 456 404 27 1060 403 37 2,88E‐01 1,00E+00‐ MAP2674c 101 51 18 153 44 18 5,02E‐01 1,00E+00‐ MAP2675c 51 26 4 203 102 15 7,45E‐02 1,00E+00‐ MAP2676c 383 539 74 1173 629 130 8,00E‐02 1,00E+00‐ MAP2677c 0 215 14 393 101 27 1,93E‐01 1,00E+00‐ MAP2678c 102 50 16 202 0 12 5,30E‐01 1,00E+00‐ MAP2679c 2174 1757 261 3153 1102 226 7,48E‐01 1,00E+00‐ MAP2680c 2494 2694 404 3521 2518 444 7,04E‐01 1,00E+00‐ predicted RNA 12094 6266 6307 17043 5684 6084 7,74E‐01 1,00E+00‐ MAP2681c 525 891 42 1190 704 52 4,83E‐01 1,00E+00‐ MAP2682c 1863 2649 120 3241 1649 115 9,42E‐01 1,00E+00‐ MAP2683 1711 4240 138 3961 2066 127 8,11E‐01 1,00E+00ispH MAP2684c 2930 2210 151 4765 1676 151 9,70E‐01 1,00E+00‐ MAP2685 5288 6763 581 8182 4055 518 8,18E‐01 1,00E+00

245









xseA MAP2686 663 763 33 1296 488 34 8,03E‐01 1,00E+00xseB MAP2687 6587 7860 1676 9940 3861 1331 4,12E‐01 1,00E+00‐ MAP2688 984 999 52 1113 473 35 3,66E‐01 1,00E+00‐ MAP2689c 524 531 19 736 377 18 9,53E‐01 1,00E+00‐ MAP2690c 972 1183 77 1465 867 76 8,93E‐01 1,00E+00‐ MAP2691c 508 819 50 914 254 35 4,67E‐01 1,00E+00glpX MAP2692 1519 2465 105 2616 723 69 2,30E‐01 1,00E+00fumC MAP2693 1617 2359 80 3245 1069 70 7,85E‐01 1,00E+00‐ MAP2694 660 1238 50 1728 810 60 5,18E‐01 1,00E+00‐ MAP2695c 299 393 13 760 302 17 4,29E‐01 1,00E+00‐ MAP2696c 604 789 45 1083 759 57 4,59E‐01 1,00E+00phoH2 MAP2697c 3157 3819 154 5796 1301 118 3,46E‐01 1,00E+00desA2 MAP2698c 6526 9656 559 13694 4841 527 9,55E‐01 1,00E+00glyA MAP2699c 2217 2301 102 4416 1700 114 7,27E‐01 1,00E+00coaA MAP2700 3481 4245 237 6637 2459 230 9,63E‐01 1,00E+00‐ MAP2701c 222 150 25 712 226 50 8,64E‐02 1,00E+00‐ MAP2702c 362 692 21 808 401 22 7,52E‐01 1,00E+00‐ MAP2703c 612 552 42 843 153 26 2,65E‐01 1,00E+00‐ MAP2704 809 1013 67 1383 285 46 3,93E‐01 1,00E+00‐ MAP2705c 356 99 36 238 50 16 1,11E‐01 1,00E+00‐ MAP2706c 310 658 13 797 509 17 3,84E‐01 1,00E+00‐ MAP2708c 695 796 82 765 226 43 1,11E‐01 1,00E+00tesB2 MAP2709c 3612 5434 309 8698 3560 355 5,98E‐01 1,00E+00‐ MAP2710c 7810 8580 521 11882 5767 487 9,48E‐01 1,00E+00‐ MAP2711c 784 994 49 1224 697 48 9,42E‐01 1,00E+00‐ MAP2712c 815 1225 51 2426 346 49 9,69E‐01 1,00E+00‐ MAP2713c 153 478 18 407 153 13 6,18E‐01 1,00E+00pgsA MAP2714c 666 686 61 712 394 44 5,52E‐01 1,00E+00‐ MAP2715c 1440 1670 153 2384 891 133 7,85E‐01 1,00E+00thrS MAP2716c 1898 3196 70 4570 1701 72 9,07E‐01 1,00E+00

246









‐ MAP2717 484 1092 25 1066 432 20 7,41E‐01 1,00E+00‐ MAP2718c 285 180 10 781 203 17 2,16E‐01 1,00E+00‐ MAP2719c 358 318 31 576 257 32 8,53E‐01 1,00E+00‐ MAP2720c 2508 4452 213 5882 2503 221 7,83E‐01 1,00E+00‐ MAP2721 51 270 17 594 68 25 2,57E‐01 1,00E+00‐ MAP2722c 203 163 11 374 70 9 8,92E‐01 1,00E+00‐ MAP2723c 0 129 9 296 75 23 1,56E‐01 1,00E+00‐ MAP2724c 0 100 6 184 73 14 4,38E‐01 1,00E+00‐ MAP2725c 88 51 5 330 101 14 1,39E‐01 1,00E+00fdxA MAP2726c 101 92 15 153 51 13 5,23E‐01 1,00E+00‐ MAP2727 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP2728 182 484 70 598 476 114 1,56E‐01 1,00E+00pcaB MAP2729c 35 199 5 223 51 4 5,18E‐01 1,00E+00pcaH MAP2731c 51 102 5 202 153 12 1,61E‐01 1,00E+00‐ MAP2732c 528 336 52 1385 354 79 1,96E‐01 1,00E+00‐ MAP2733c 675 474 34 1811 174 39 6,07E‐01 1,00E+00‐ MAP2734 356 400 16 1070 508 29 8,02E‐02 1,00E+00‐ MAP2735 50 28 4 74 28 4 5,03E‐01 1,00E+00fabG5_1 MAP2736 0 0 0 90 51 4 0,00E+00 1,00E+00fliH MAP2737 150 147 11 380 19 10 7,27E‐01 1,00E+00‐ MAP2738c 304 459 26 407 153 16 3,03E‐01 1,00E+00‐ MAP2739 110 50 5 197 0 3 5,40E‐01 1,00E+00‐ MAP2740 244 152 17 609 197 28 2,25E‐01 1,00E+00‐ MAP2741c 1655 1951 168 3665 968 167 9,11E‐01 1,00E+00‐ MAP2742 3844 4808 569 6575 3376 578 8,37E‐01 1,00E+00‐ MAP2743c 51 101 5 255 0 5 5,02E‐01 1,00E+00‐ MAP2744c 206 199 12 644 157 18 2,82E‐01 1,00E+00‐ MAP2745c 231 102 12 164 163 11 9,07E‐01 1,00E+00‐ MAP2746 310 584 48 510 153 29 2,79E‐01 1,00E+00‐ MAP2747 167 690 15 513 78 7 1,40E‐01 1,00E+00

247









‐ MAP2748c 51 68 3 144 50 5 5,26E‐01 1,00E+00‐ MAP2749c 29 54 8 110 27 10 5,37E‐01 1,00E+00‐ MAP2750c 563 1120 108 1276 1443 187 6,67E‐02 1,00E+00‐ MAP2751 168 380 26 424 214 27 8,15E‐01 1,00E+00‐ MAP2752 223 270 12 141 15 2 3,02E‐03 1,00E+00‐ MAP2753 404 550 36 531 400 33 9,26E‐01 1,00E+00‐ MAP2754 180 129 35 92 89 20 2,72E‐01 1,00E+00‐ MAP2755 80 234 28 319 51 25 8,32E‐01 1,00E+00‐ MAP2756c 405 553 5 1204 301 6 4,69E‐01 1,00E+00‐ MAP2757 153 248 40 204 51 19 1,71E‐01 1,00E+00‐ MAP2758 4194 6635 1227 9094 7178 1806 7,93E‐02 1,00E+00‐ MAP2759 714 734 81 1844 571 106 3,59E‐01 1,00E+00‐ MAP2760c 0 0 0 49 0 1 1,81E‐119 1,00E+00‐ MAP2761c 51 218 10 210 51 7 4,82E‐01 1,00E+00‐ MAP2763c 0 151 13 101 0 5 6,36E‐01 1,00E+00‐ MAP2765c 50 102 3 102 0 1 7,04E‐01 1,00E+00‐ MAP2766c 0 161 8 51 101 10 5,16E‐01 1,00E+00‐ MAP2767c 1503 3992 278 2576 1849 219 5,08E‐01 1,00E+00‐ MAP2768c 14375 19219 930 24747 10997 850 4,08E‐01 1,00E+00‐ predicted RNA 6263 8574 7749 9967 3277 5593 2,47E‐01 1,00E+00‐ predicted RNA 2289 4537 4292 3718 2009 3278 3,57E‐01 1,00E+00‐ MAP2769c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP2770 1167 1258 126 860 829 88 3,80E‐01 1,00E+00‐ MAP2771c 739 1273 44 1709 480 38 7,81E‐01 1,00E+00‐ MAP2772c 372 657 24 886 310 23 8,68E‐01 1,00E+00‐ MAP2773c 592 561 41 420 393 29 4,78E‐01 1,00E+00‐ MAP2774c 462 635 32 1079 404 36 6,02E‐01 1,00E+00‐ MAP2775 97 202 9 152 47 5 2,56E‐01 1,00E+00‐ MAP2776c 2182 1807 93 3370 1353 91 1,00E+00 1,00E+00‐ MAP2777c 19 102 4 0 49 2 5,89E‐01 1,00E+00

248









‐ MAP2779 125 94 7 416 105 13 1,99E‐01 1,00E+00‐ MAP2780 0 39 1 41 48 3 7,26E‐01 1,00E+00‐ MAP2781 101 51 5 51 48 3 5,62E‐01 1,00E+00‐ MAP2782 102 43 2 51 51 2 5,50E‐01 1,00E+00‐ MAP2783 1261 1838 314 3312 1489 421 2,87E‐01 1,00E+00‐ MAP2784 52349 51410 2416 94181 35653 2479 2,18E‐01 1,00E+00‐ MAP2785c 799 399 73 1008 406 70 9,37E‐01 1,00E+00‐ MAP2786c 2564 2673 441 6218 1745 520 4,78E‐01 1,00E+00clpX' MAP2787 142 0 5 101 0 2 7,86E‐01 1,00E+00‐ MAP2788 1223 2031 175 2652 1348 192 6,44E‐01 1,00E+00‐ MAP2789 570 666 68 783 448 61 9,49E‐01 1,00E+00‐ MAP2790c 248 254 13 254 102 7 2,78E‐01 1,00E+00ribD MAP2791 51 0 2 51 101 6 1,53E‐01 1,00E+00‐ MAP2792 450 583 18 1375 405 25 2,96E‐01 1,00E+00‐ MAP2793 453 962 31 1012 673 35 6,25E‐01 1,00E+00‐ MAP2794 961 1861 197 2908 894 215 6,48E‐01 1,00E+00‐ MAP2796c 509 809 49 1168 349 45 9,79E‐01 1,00E+00‐ MAP2797c 1480 2010 144 1601 1017 100 3,45E‐01 1,00E+00hemY' MAP2798c 180 255 9 111 87 4 1,25E‐01 1,00E+00hemE MAP2799c 643 599 33 990 432 32 9,19E‐01 1,00E+00echA15 MAP2800 1315 1162 88 1709 360 53 2,11E‐01 1,00E+00‐ MAP2801 1793 4310 269 4162 2326 264 9,85E‐01 1,00E+00‐ MAP2802 636 919 34 1452 497 35 8,26E‐01 1,00E+00dxs MAP2803c 1805 2201 60 4340 960 59 9,64E‐01 1,00E+00‐ MAP2804 249 155 24 308 174 25 7,88E‐01 1,00E+00arsA MAP2805 442 471 20 440 115 9 9,14E‐02 1,00E+00‐ MAP2806c 75 232 7 306 67 7 9,07E‐01 1,00E+00‐ MAP2807c 1185 1840 43 1899 403 24 1,20E‐01 1,00E+00trkA MAP2808 1992 2190 182 3075 1178 152 6,74E‐01 1,00E+00trkB MAP2809 1709 1598 146 2297 984 122 6,78E‐01 1,00E+00

249









‐ MAP2810c 803 959 79 1806 677 92 5,50E‐01 1,00E+00‐ MAP2811c 5791 4717 681 10598 2985 676 8,67E‐01 1,00E+00‐ MAP2812 129 179 12 200 0 4 1,27E‐01 1,00E+00‐ MAP2813c 1226 1235 92 2208 798 91 8,71E‐01 1,00E+00dut MAP2814c 1449 793 143 1847 1285 183 3,71E‐01 1,00E+00‐ MAP2815 329 244 34 507 101 26 6,30E‐01 1,00E+00‐ MAP2816c 1992 2105 392 4690 889 387 9,81E‐01 1,00E+00‐ MAP2817 353 374 31 699 48 20 4,02E‐01 1,00E+00suhB MAP2818c 137 100 7 180 105 8 4,49E‐01 1,00E+00ppgK MAP2819 1224 534 65 962 250 33 9,98E‐02 1,00E+00sigA MAP2820 5396 5619 209 9982 3524 207 8,60E‐01 1,00E+00‐ MAP2821 683 1432 146 1717 306 103 4,31E‐01 1,00E+00‐ MAP2822 1122 1597 222 1623 285 113 7,03E‐02 1,00E+00‐ MAP2823 361 300 19 558 306 22 6,53E‐01 1,00E+00‐ MAP2824c 7670 6132 1689 7654 3568 1166 2,14E‐01 1,00E+00‐ MAP2825 881 1837 166 2887 1392 232 2,08E‐01 1,00E+00sigB MAP2826 43298 41398 2472 96429 32082 2994 1,61E‐01 1,00E+00ideR MAP2827c 0 0 0 106 0 3 0,00E+00 1,00E+00‐ MAP2828c 0 0 0 0 32 1 1,33E‐263 1,00E+00‐ MAP2829 1938 2237 85 2731 1155 67 5,36E‐01 1,00E+00‐ MAP2830c 763 946 58 1387 287 42 5,09E‐01 1,00E+00‐ MAP2831 2514 2553 151 4696 1623 152 9,64E‐01 1,00E+00‐ MAP2832 888 1269 59 2004 462 51 7,95E‐01 1,00E+00‐ MAP2833c 302 449 44 759 283 51 6,09E‐01 1,00E+00nrdR MAP2834c 930 853 112 1670 664 121 7,09E‐01 1,00E+00‐ MAP2835c 292 501 43 1089 145 48 6,99E‐01 1,00E+00‐ predicted RNA 7132 5335 7202 13855 4060 7979 5,59E‐01 1,00E+00lexA MAP2836 471 796 55 982 161 36 3,57E‐01 1,00E+00‐ MAP2837c 13632 16999 374 23209 10463 353 3,58E‐01 1,00E+00fadE20_2 MAP2838c 3190 3097 152 4908 1651 127 5,56E‐01 1,00E+00

250









hflX MAP2839c 1723 2135 76 3588 1068 73 9,75E‐01 1,00E+00dapF MAP2840c 275 505 25 770 85 18 5,94E‐01 1,00E+00miaA MAP2841c 152 344 14 143 151 9 3,48E‐01 1,00E+00‐ MAP2842c 150 358 20 224 96 11 2,05E‐01 1,00E+00‐ MAP2843c 1832 2065 114 4158 1503 135 5,84E‐01 1,00E+00‐ predicted RNA 1412 2894 4056 1389 1574 2982 4,03E‐01 1,00E+00‐ MAP2844 2125 2478 94 4151 1583 97 9,13E‐01 1,00E+00‐ MAP2845c 299 343 30 853 351 48 1,76E‐01 1,00E+00‐ MAP2846c 821 1044 34 1021 326 20 2,01E‐01 1,00E+00recX MAP2847c 401 463 47 734 249 44 9,68E‐01 1,00E+00recA MAP2848c 5671 7240 302 13505 4446 339 5,36E‐01 1,00E+00‐ MAP2849 50 49 4 50 0 1 9,83E‐02 1,00E+00‐ MAP2850c 1269 987 320 1874 825 321 8,50E‐01 1,00E+00‐ MAP2851c 0 199 4 305 51 6 8,06E‐01 1,00E+00‐ MAP2852 2427 2884 355 3958 1845 335 8,74E‐01 1,00E+00‐ MAP2853c 1619 3232 322 2703 1453 251 5,19E‐01 1,00E+00‐ MAP2854c 1657 1582 116 2864 1426 134 5,55E‐01 1,00E+0035kd_ag MAP2855c 3679 5194 307 6999 2462 268 8,33E‐01 1,00E+00‐ MAP2856c 2298 2755 446 5146 2375 572 3,04E‐01 1,00E+00pgsA3 MAP2857c 1153 1047 107 1351 421 67 2,67E‐01 1,00E+00‐ MAP2858 659 932 86 1078 203 51 2,40E‐01 1,00E+00ftsK MAP2859c 2409 3089 58 3770 1591 48 5,80E‐01 1,00E+00‐ MAP2860 618 626 114 1379 161 96 8,20E‐01 1,00E+00‐ MAP2861 314 790 37 1087 537 49 3,35E‐01 1,00E+00‐ MAP2862 318 470 25 752 283 28 7,00E‐01 1,00E+00‐ MAP2863c 2519 3243 98 4843 2073 101 8,73E‐01 1,00E+00dapA MAP2864c 1431 2029 109 2280 1145 96 8,00E‐01 1,00E+00thyX MAP2865c 440 580 38 406 438 33 8,93E‐01 1,00E+00‐ MAP2866c 0 0 0 0 50 1 0,00E+00 1,00E+00‐ MAP2867c 1381 2363 143 3617 1268 155 7,41E‐01 1,00E+00

251









‐ predicted RNA 1473 2370 4386 3369 1288 4459 8,79E‐01 1,00E+00dfrA MAP2868c 199 336 27 358 154 23 7,67E‐01 1,00E+00thyA MAP2869c 1195 1315 90 2356 1014 103 5,81E‐01 1,00E+00‐ MAP2870 442 272 28 808 405 41 2,55E‐01 1,00E+00‐ MAP2871c 0 81 1 51 0 0 8,00E‐01 1,00E+00fabG MAP2872c 314 507 30 292 124 13 6,93E‐02 1,00E+00‐ MAP2873c 406 400 7 763 344 8 5,55E‐01 1,00E+00fadD13 MAP2874c 207 624 15 457 310 13 8,78E‐01 1,00E+00‐ MAP2875 0 144 4 225 102 9 2,09E‐01 1,00E+00‐ MAP2876c 251 476 44 484 188 34 6,54E‐01 1,00E+00‐ MAP2877c 162 268 26 703 38 29 5,81E‐01 1,00E+00dapB MAP2878c 1126 754 75 1500 692 73 9,28E‐01 1,00E+00‐ MAP2879c 533 381 48 1601 306 71 1,96E‐01 1,00E+00‐ MAP2880 51 0 1 102 51 2 4,46E‐01 1,00E+00‐ MAP2881c 368 663 27 539 458 26 8,55E‐01 1,00E+00‐ MAP2882c 235 479 19 415 51 8 9,57E‐02 1,00E+00‐ MAP2883 100 31 6 199 98 11 3,49E‐01 1,00E+00‐ MAP2884c 351 443 20 510 272 18 8,32E‐01 1,00E+00‐ MAP2885c 557 854 22 1403 440 23 7,67E‐01 1,00E+00‐ MAP2886c 432 473 28 707 152 20 4,85E‐01 1,00E+00‐ MAP2887c 51 198 14 304 40 14 4,81E‐01 1,00E+00ald MAP2888 240 250 12 394 102 9 6,72E‐01 1,00E+00‐ MAP2889c 1309 1971 91 3210 1027 95 7,59E‐01 1,00E+00pepR MAP2890c 1860 3506 115 3892 1149 86 4,38E‐01 1,00E+00gpsI MAP2891c 16000 20595 463 29397 9415 394 5,36E‐01 1,00E+00‐ predicted RNA 10229 13724 13243 15807 7078 10890 9,92E‐01 1,00E+00rpsO MAP2892c 949 1394 248 2391 865 285 5,79E‐01 1,00E+00ribF MAP2893c 3107 3316 189 4903 1631 154 5,00E‐01 1,00E+00‐ MAP2894 688 1603 255 2179 396 213 7,15E‐01 1,00E+00‐ MAP2895 51 178 14 231 51 13 4,85E‐01 1,00E+00

252









fadE21 MAP2896c 1667 2104 86 2486 1127 71 6,49E‐01 1,00E+00truB MAP2898c 89 203 9 50 50 3 1,23E‐01 1,00E+00‐ MAP2899c 250 352 25 367 162 19 6,09E‐01 1,00E+00‐ MAP2900c 984 1261 65 1737 829 65 8,68E‐01 1,00E+00‐ MAP2901 204 226 19 357 152 19 8,70E‐01 1,00E+00‐ MAP2902 255 120 6 340 302 10 1,97E‐01 1,00E+00‐ MAP2903c 477 239 38 869 454 60 1,72E‐01 1,00E+00‐ MAP2905c 1527 2285 109 3728 1545 128 5,83E‐01 1,00E+00rbfA MAP2906c 2481 1405 236 3520 845 195 6,41E‐01 1,00E+00infB MAP2907c 16540 20939 388 34338 12629 401 1,78E‐01 1,00E+00‐ MAP2908c 57715 62564 11292 92314 40307 10564 2,42E‐01 1,00E+00nusA MAP2909c 1254 1116 65 1896 362 45 3,53E‐01 1,00E+00‐ MAP2910c 3125 3981 381 7390 2979 467 4,47E‐01 1,00E+00‐ predicted RNA 18101 18071 14424 29953 10572 13077 4,45E‐01 1,00E+00‐ MAP2911 80 108 10 98 51 7 6,12E‐01 1,00E+00‐ MAP2912 274 389 42 558 129 33 6,68E‐01 1,00E+00proS MAP2913c 279 522 12 963 253 15 5,30E‐01 1,00E+00‐ MAP2914c 401 283 16 1295 264 26 1,42E‐01 1,00E+00efpA_2 MAP2915c 7493 8097 279 14037 4313 260 9,76E‐01 1,00E+00cysG2 MAP2916c 556 725 30 1143 204 23 6,39E‐01 1,00E+00cobB MAP2917c 30 51 1 302 0 3 8,13E‐01 1,00E+00cobA MAP2918c 710 1251 90 1263 644 78 8,05E‐01 1,00E+00‐ MAP2919c 72 131 3 441 115 6 1,34E‐01 1,00E+00‐ MAP2920c 228 523 44 355 187 29 3,91E‐01 1,00E+00‐ MAP2921c 1001 1834 53 2501 1078 58 6,44E‐01 1,00E+00‐ MAP2922 1010 559 45 1302 507 42 9,79E‐01 1,00E+00gorA MAP2923 594 499 23 658 351 18 7,68E‐01 1,00E+00nicT MAP2924 320 354 15 707 51 11 5,46E‐01 1,00E+00‐ MAP2925 0 44 1 0 51 1 5,74E‐01 1,00E+00‐ MAP2926 543 818 87 1056 716 107 4,87E‐01 1,00E+00

253









‐ MAP2927 102 187 8 151 31 4 2,09E‐01 1,00E+00‐ MAP2928c 408 407 30 565 204 23 6,08E‐01 1,00E+00aldC MAP2929c 700 735 30 1479 561 35 5,76E‐01 1,00E+00‐ MAP2930c 1276 1522 105 3478 764 119 5,61E‐01 1,00E+00glnA4 MAP2931c 1953 2555 93 3193 1546 86 8,48E‐01 1,00E+00‐ MAP2932c 813 1248 106 2543 396 108 8,15E‐01 1,00E+00cobQ MAP2933c 535 1043 29 771 482 22 5,76E‐01 1,00E+00map MAP2934c 1858 2231 137 4431 2717 220 7,91E‐02 1,00E+00‐ MAP2935c 254 323 28 675 272 38 3,66E‐01 1,00E+00‐ MAP2936c 1802 1709 54 2676 1475 57 7,78E‐01 1,00E+00‐ MAP2937c 1904 2203 138 4225 1153 140 9,24E‐01 1,00E+00ispG MAP2938c 11250 13447 611 18233 6882 513 8,76E‐01 1,00E+00‐ MAP2939c 2079 3423 128 4947 1787 130 9,24E‐01 1,00E+00‐ MAP2940c 896 1324 50 1980 799 53 7,34E‐01 1,00E+00‐ MAP2941c 0 102 2 52 102 4 8,85E‐01 1,00E+00mpt53 MAP2942c 51 12 3 101 102 11 1,29E‐01 1,00E+00‐ MAP2943c 436 762 31 1289 603 43 2,95E‐01 1,00E+00cdsA MAP2944c 384 851 37 1010 258 30 7,55E‐01 1,00E+00frr MAP2945c 6591 7503 731 9976 2852 519 2,42E‐01 1,00E+00pyrH MAP2946c 10801 9502 744 14576 5796 616 9,00E‐01 1,00E+00‐ MAP2947 11263 6115 1129 17777 3454 978 9,48E‐01 1,00E+00‐ MAP2948 3181 1696 191 4607 1326 176 8,31E‐01 1,00E+00‐ MAP2949c 3509 1751 167 8156 1442 213 3,09E‐01 1,00E+00‐ MAP2950c 2042 825 150 3971 563 159 7,12E‐01 1,00E+00‐ MAP2951 51 152 6 203 0 4 8,77E‐01 1,00E+00‐ MAP2952c 1055 490 111 1690 250 95 8,08E‐01 1,00E+00‐ MAP2953 31 255 18 102 51 9 2,38E‐01 1,00E+00amiC MAP2954c 424 1120 30 1594 306 28 9,88E‐01 1,00E+00tsf MAP2955c 1415 1331 96 1676 604 65 3,16E‐01 1,00E+00rpsB MAP2956c 5002 6054 384 9490 2055 299 6,36E‐01 1,00E+00

254









‐ MAP2957 0 51 2 0 0 0 1,00E+00 1,00E+00xerC MAP2958c 51 358 12 366 187 15 4,83E‐01 1,00E+00‐ MAP2959c 819 1288 51 1681 592 46 8,51E‐01 1,00E+00viuB MAP2960c 1078 1056 89 1754 496 72 6,62E‐01 1,00E+00‐ MAP2961c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP2962c 50 0 1 103 0 1 5,14E‐01 1,00E+00‐ MAP2963c 351 579 10 512 306 8 7,35E‐01 1,00E+00‐ MAP2964c 255 353 15 1011 102 19 5,43E‐01 1,00E+00‐ MAP2965c 0 132 11 68 51 11 5,15E‐01 1,00E+00fdhD MAP2966c 153 284 15 361 252 20 4,03E‐01 1,00E+00‐ MAP2967c 303 236 16 289 186 12 7,16E‐01 1,00E+00‐ MAP2968 1314 2317 133 2206 878 96 3,84E‐01 1,00E+00‐ MAP2969c 4030 5520 896 9618 2940 939 7,74E‐01 1,00E+00rnhB MAP2970c 3604 3657 293 6471 1758 255 7,44E‐01 1,00E+00lepB MAP2971c 1489 1889 108 2380 1020 92 7,44E‐01 1,00E+00rplS MAP2972c 2506 5296 450 5019 2497 388 7,36E‐01 1,00E+00trmD MAP2974c 201 344 21 701 203 28 4,53E‐01 1,00E+00rimM MAP2975c 250 168 23 587 102 27 6,25E‐01 1,00E+00‐ MAP2976c 376 717 127 602 252 85 4,06E‐01 1,00E+00rpsP MAP2977c 3472 4424 440 5597 1492 306 2,06E‐01 1,00E+00‐ MAP2978c 811 233 75 657 117 38 1,21E‐01 1,00E+00dacB MAP2979 500 242 25 639 224 23 9,05E‐01 1,00E+00‐ MAP2980c 356 278 31 474 152 24 6,47E‐01 1,00E+00‐ MAP2981c 2591 1376 63 2273 660 35 8,70E‐02 1,00E+00‐ MAP2982c 266 89 9 334 123 9 5,37E‐01 1,00E+00ffh MAP2983c 2486 2939 100 4351 1313 83 5,80E‐01 1,00E+00‐ MAP2984 406 455 31 609 356 31 8,13E‐01 1,00E+00‐ MAP2985 447 539 16 717 173 11 4,41E‐01 1,00E+00glnD MAP2986c 1173 951 25 1148 448 15 2,39E‐01 1,00E+00glnB MAP2987c 2551 2605 442 4237 1503 399 7,78E‐01 1,00E+00

255









amt_2 MAP2988c 5770 6827 252 11640 4821 278 5,72E‐01 1,00E+00ftsY MAP2989c 300 482 16 193 185 8 1,25E‐01 1,00E+00smc MAP2990c 2299 3314 43 3810 1417 33 4,55E‐01 1,00E+00‐ MAP2991c 51 291 31 304 179 43 3,52E‐01 1,00E+00‐ MAP2992c 202 305 34 709 152 43 5,05E‐01 1,00E+00‐ MAP2993 0 51 1 102 0 2 5,36E‐01 1,00E+00fpg MAP2994c 370 254 21 624 191 21 9,06E‐01 1,00E+00rnc MAP2995c 1146 1573 109 1935 904 99 9,30E‐01 1,00E+00‐ MAP2996c 420 776 53 1167 589 70 3,66E‐01 1,00E+00‐ MAP2997c 3872 3362 287 6682 2387 290 8,64E‐01 1,00E+00‐ MAP2998c 101 419 17 551 102 16 9,77E‐01 1,00E+00‐ MAP3000c 767 401 20 854 390 18 9,30E‐01 1,00E+00‐ MAP3001 2100 2098 98 5370 1726 131 3,30E‐01 1,00E+00coaD MAP3002c 904 1774 156 1317 894 123 6,27E‐01 1,00E+00‐ MAP3003c 57 50 5 0 0 0 1,00E+00 1,00E+00‐ MAP3004c 441 480 42 977 680 70 9,93E‐02 1,00E+00‐ MAP3005c 1532 2368 145 2361 1049 109 4,51E‐01 1,00E+00lipN MAP3006c 540 746 32 1510 508 41 4,26E‐01 1,00E+00‐ MAP3007 2255 2549 164 2900 1544 134 6,11E‐01 1,00E+00‐ MAP3008c 484 164 27 693 430 41 2,10E‐01 1,00E+00recG MAP3009c 1490 2448 50 2501 1336 44 7,85E‐01 1,00E+00‐ MAP3010c 723 754 24 1430 704 31 4,39E‐01 1,00E+00‐ MAP3011c 0 0 0 104 0 2 0,00E+00 1,00E+00‐ MAP3012c 0 233 7 33 153 8 8,20E‐01 1,00E+00‐ MAP3013c 51 0 1 51 1 1 5,82E‐01 1,00E+00‐ MAP3014 51 137 3 0 0 0 1,00E+00 1,00E+00‐ MAP3015 0 44 1 51 0 1 5,48E‐01 1,00E+00ung MAP3016c 72 301 15 225 30 7 1,93E‐01 1,00E+00thiL MAP3017c 35 152 5 456 55 9 2,06E‐01 1,00E+00‐ MAP3018 51 55 5 108 51 7 5,29E‐01 1,00E+00

256









ddl MAP3019c 751 888 42 1304 641 44 8,14E‐01 1,00E+00‐ MAP3021 0 132 5 202 102 11 1,98E‐01 1,00E+00ppk MAP3022 2952 3950 90 5821 2343 90 8,89E‐01 1,00E+00mutT1 MAP3023 568 1616 64 1484 907 66 7,76E‐01 1,00E+00hupB MAP3024c 23867 23062 2140 37571 11522 1760 6,12E‐01 1,00E+00leuD MAP3025c 1012 851 90 1359 255 56 2,72E‐01 1,00E+00leuC MAP3026c 1366 1002 48 2188 506 40 7,47E‐01 1,00E+00‐ MAP3027 115 182 12 203 101 10 9,78E‐01 1,00E+00‐ MAP3028 454 530 55 457 254 35 3,67E‐01 1,00E+00gltX MAP3029c 953 1847 53 1891 691 41 5,84E‐01 1,00E+00‐ MAP3030c 313 661 37 768 325 36 8,55E‐01 1,00E+00‐ MAP3031 436 588 22 812 406 23 7,06E‐01 1,00E+00leuB MAP3032c 746 1111 52 1884 714 61 5,35E‐01 1,00E+00serA MAP3033c 1851 2384 76 3338 538 50 2,09E‐01 1,00E+00‐ MAP3034 151 146 6 203 0 2 1,41E‐01 1,00E+00‐ MAP3035 367 548 43 653 303 39 9,75E‐01 1,00E+00ilvC MAP3036c 2757 3080 163 4376 1435 130 4,82E‐01 1,00E+00ilvH MAP3037c 1284 1620 165 2686 1352 202 4,11E‐01 1,00E+00ilvB_1 MAP3038c 1487 2110 55 3987 1303 65 5,34E‐01 1,00E+00‐ MAP3040c 2807 3911 223 4459 2683 218 9,35E‐01 1,00E+00lppZ MAP3041 796 599 34 1217 255 26 6,33E‐01 1,00E+00gatB MAP3042c 5890 6280 233 10739 4107 235 8,35E‐01 1,00E+00‐ MAP3043c 2132 991 80 5155 984 110 2,60E‐01 1,00E+00pfkA MAP3044c 1680 2058 104 3662 1593 125 5,43E‐01 1,00E+00gatA MAP3045c 829 951 34 1071 851 36 7,89E‐01 1,00E+00gatC MAP3046c 49 136 17 146 51 15 5,13E‐01 1,00E+00‐ MAP3048c 0 117 7 241 125 21 7,25E‐02 1,00E+00mmpL2 MAP3049c 1002 1120 21 1069 658 15 5,02E‐01 1,00E+00‐ MAP3050c 51 51 8 43 0 2 3,09E‐02 1,00E+00‐ MAP3051 0 68 3 51 0 1 5,97E‐01 1,00E+00

257









‐ MAP3052c 1089 1322 115 1338 815 94 6,83E‐01 1,00E+00‐ MAP3053c 84 96 4 208 151 8 2,23E‐01 1,00E+00ligA MAP3054c 779 550 19 995 437 17 9,30E‐01 1,00E+00‐ MAP3055c 51 51 2 0 51 2 5,65E‐01 1,00E+00mnmA MAP3057c 921 1508 64 1373 814 53 7,17E‐01 1,00E+00‐ MAP3058c 1383 1685 75 2799 858 71 9,98E‐01 1,00E+00‐ MAP3059c 0 0 0 44 0 0 0,00E+00 1,00E+00fixB MAP3060c 1202 1890 92 1804 733 64 3,77E‐01 1,00E+00fixA MAP3061c 6842 6502 491 10011 3354 393 4,44E‐01 1,00E+00‐ MAP3062 280 436 24 289 202 16 3,86E‐01 1,00E+00‐ MAP3063 1040 1417 43 2087 1061 49 5,97E‐01 1,00E+00‐ MAP3064 564 506 24 1296 669 39 1,34E‐01 1,00E+00‐ MAP3065 184 183 8 549 102 10 4,60E‐01 1,00E+00‐ MAP3066c 72 0 2 51 0 1 9,63E‐01 1,00E+00‐ MAP3067c 264 174 17 725 0 16 9,50E‐01 1,00E+00‐ MAP3068 0 78 4 30 108 10 6,89E‐01 1,00E+00idsA2_2 MAP3069 141 12 4 290 51 6 8,78E‐01 1,00E+00‐ MAP3070 51 0 1 80 51 2 6,20E‐01 1,00E+00‐ MAP3071 0 51 1 18 0 0 1,14E‐02 1,00E+00‐ MAP3072 51 197 21 183 0 9 2,69E‐01 1,00E+00‐ MAP3073 0 11 0 11 0 0 8,26E‐01 1,00E+00crtT MAP3074 5 0 0 0 0 0 4,49E‐46 1,00E+00‐ MAP3075 101 0 2 153 101 4 2,47E‐01 1,00E+00‐ MAP3076 35 50 2 110 51 3 5,70E‐01 1,00E+00‐ MAP3077 151 79 12 311 51 13 4,45E‐01 1,00E+00‐ MAP3078c 305 307 17 255 203 12 5,36E‐01 1,00E+00‐ MAP3079c 1619 1441 86 2201 1070 79 9,30E‐01 1,00E+00‐ MAP3080 102 241 4 201 250 6 2,98E‐01 1,00E+00phr MAP3081 51 138 3 204 0 2 6,36E‐01 1,00E+00‐ MAP3082c 1807 1280 119 1768 560 70 1,41E‐01 1,00E+00

258









‐ MAP3083 200 477 17 497 51 9 2,24E‐01 1,00E+00‐ MAP3084c 946 1987 121 1592 811 89 4,89E‐01 1,00E+00‐ MAP3085c 608 267 23 653 201 17 5,68E‐01 1,00E+00‐ MAP3086c 1228 2092 97 2813 1045 94 9,28E‐01 1,00E+00echA17 MAP3087c 204 189 14 753 101 22 2,78E‐01 1,00E+00‐ MAP3088c 248 174 15 542 303 26 1,33E‐01 1,00E+00‐ MAP3089c 687 724 48 1503 250 42 8,93E‐01 1,00E+00serB2 MAP3090c 1626 2934 104 4226 2024 126 5,35E‐01 1,00E+00ctaD MAP3091c 6541 6746 221 11745 3956 209 9,32E‐01 1,00E+00fecB MAP3092 268 223 13 225 197 11 8,03E‐01 1,00E+00adhC MAP3093 557 1174 46 2155 653 61 3,35E‐01 1,00E+00‐ MAP3094c 575 746 91 870 499 86 9,81E‐01 1,00E+00nrdF MAP3095c 10548 9618 604 25886 11275 937 7,83E‐02 1,00E+00‐ MAP3096 0 0 0 102 0 3 0,00E+00 1,00E+00‐ MAP3097 0 0 0 50 0 1 0,00E+00 1,00E+00‐ MAP3098c 8512 9372 336 15482 5470 320 8,31E‐01 1,00E+00‐ MAP3099c 8831 13791 872 16655 9164 901 3,90E‐01 1,00E+00nrdH MAP3102c 3863 3566 904 10710 3623 1394 1,48E‐01 1,00E+00‐ MAP3104c 701 1064 84 1470 559 81 9,75E‐01 1,00E+00‐ MAP3105 50 342 17 456 177 24 3,23E‐01 1,00E+00dinP MAP3106 305 637 25 403 431 23 9,53E‐01 1,00E+00‐ MAP3107c 356 576 28 753 303 27 8,93E‐01 1,00E+00‐ MAP3109 2098 1536 72 3039 1114 66 9,07E‐01 1,00E+00‐ MAP3110c 45 101 7 253 98 16 2,21E‐01 1,00E+00‐ predicted RNA 8243 2248 5519 13652 1008 4762 8,39E‐01 1,00E+00‐ MAP3111c 1115 1131 67 3264 889 96 2,04E‐01 1,00E+00‐ MAP3112c 51 131 3 16 51 1 8,49E‐01 1,00E+00‐ MAP3113c 101 65 4 254 51 5 7,56E‐01 1,00E+00‐ MAP3114 151 0 13 102 51 10 5,22E‐01 1,00E+00fadE22 MAP3115c 251 420 8 962 304 13 2,04E‐01 1,00E+00

259









‐ MAP3116c 368 433 30 745 258 31 8,51E‐01 1,00E+00ligB MAP3117 51 101 2 152 0 1 5,74E‐01 1,00E+00cstA MAP3118 527 204 9 254 151 4 1,13E‐01 1,00E+00‐ MAP3119 603 446 20 1008 150 15 6,36E‐01 1,00E+00‐ MAP3120c 0 88 2 153 102 7 1,31E‐01 1,00E+00‐ MAP3121 102 221 10 102 2 2 1,31E‐02 1,00E+00fadE1_2 MAP3122 253 402 14 404 76 7 1,94E‐01 1,00E+00‐ MAP3123c 143 173 13 152 152 13 8,39E‐01 1,00E+00‐ MAP3124c 51 51 3 0 0 0 1,00E+00 1,00E+00‐ MAP3125c 35 146 6 0 0 0 1,00E+00 1,00E+00‐ MAP3126c 102 0 3 51 0 1 9,06E‐02 1,00E+00emrE MAP3127 253 234 35 415 53 23 2,18E‐01 1,00E+00‐ MAP3128 906 1318 44 1468 610 35 6,05E‐01 1,00E+00‐ MAP3131 806 1215 20 1877 448 17 8,25E‐01 1,00E+00‐ MAP3132 102 381 4 329 148 4 9,05E‐01 1,00E+00‐ MAP3133c 0 0 0 24 0 0 1,34E‐33 1,00E+00‐ MAP3134c 0 0 0 51 0 1 0,00E+00 1,00E+00‐ MAP3135c 0 51 1 134 6 3 5,94E‐01 1,00E+00‐ MAP3136c 232 279 11 375 51 6 2,59E‐01 1,00E+00‐ MAP3137c 157 224 14 403 102 15 8,09E‐01 1,00E+00‐ MAP3138c 229 51 10 105 102 7 3,50E‐01 1,00E+00‐ MAP3139c 38 449 29 439 110 26 9,77E‐01 1,00E+00‐ MAP3140c 40 227 5 191 97 5 4,78E‐01 1,00E+00‐ MAP3141c 750 386 26 614 238 16 2,44E‐01 1,00E+00‐ MAP3142 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP3143 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP3144c 1085 2071 232 2444 1694 293 3,79E‐01 1,00E+00‐ MAP3145c 446 487 21 689 307 19 9,93E‐01 1,00E+00pgmA MAP3146c 698 805 26 1819 760 38 2,12E‐01 1,00E+00ccrB MAP3147 22 0 1 51 0 2 5,15E‐01 1,00E+00

260









ccrB MAP3148 0 0 0 112 0 5 0,00E+00 1,00E+00‐ MAP3149c 102 169 12 513 203 27 7,17E‐02 1,00E+00‐ MAP3150c 1153 936 171 1939 863 193 6,01E‐01 1,00E+00‐ MAP3151 68 0 1 104 102 4 1,63E‐01 1,00E+00‐ MAP3152c 941 1068 63 2203 749 74 5,03E‐01 1,00E+00‐ MAP3153 499 268 40 1810 51 58 2,54E‐01 1,00E+00‐ MAP3154 407 495 17 1239 468 27 1,56E‐01 1,00E+00‐ MAP3155c 315 276 63 517 216 65 8,60E‐01 1,00E+00‐ MAP3156c 304 350 31 228 137 16 1,51E‐01 1,00E+00‐ MAP3157 50 173 6 229 121 8 3,23E‐01 1,00E+00‐ MAP3158c 511 409 68 431 209 40 2,80E‐01 1,00E+00‐ MAP3159 610 772 27 1031 250 19 4,97E‐01 1,00E+00‐ MAP3160 791 1139 66 1845 845 80 4,69E‐01 1,00E+00‐ MAP3161c 141 31 6 51 153 9 8,52E‐01 1,00E+00‐ MAP3162c 102 285 18 302 204 23 4,77E‐01 1,00E+00‐ MAP3163 33 125 6 70 0 1 1,10E‐01 1,00E+00‐ MAP3164 836 1169 114 1075 615 87 5,69E‐01 1,00E+00‐ MAP3165 777 971 43 1123 581 37 8,18E‐01 1,00E+00‐ MAP3166c 358 248 24 492 215 23 9,67E‐01 1,00E+00‐ MAP3167c 2590 4590 427 5967 2414 425 9,00E‐01 1,00E+00‐ predicted RNA 1479085 1373656 252422 2912978 964113 273243 4,46E‐01 1,00E+00‐ MAP3168c 102 299 13 180 55 6 1,68E‐01 1,00E+00‐ MAP3169c 1326 1792 114 2350 830 95 7,09E‐01 1,00E+00smpB MAP3170c 5818 8548 806 10057 4379 696 6,39E‐01 1,00E+00ftsX MAP3171c 2144 3084 167 3192 1329 123 4,04E‐01 1,00E+00ftsE MAP3172c 1068 2179 133 2443 1017 122 9,27E‐01 1,00E+00‐ MAP3173c 738 500 73 643 491 62 8,61E‐01 1,00E+00‐ MAP3174c 2025 2171 122 3493 1640 128 8,54E‐01 1,00E+00prfB MAP3175c 10827 15501 672 20146 8377 619 5,00E‐01 1,00E+00fprA MAP3176 985 1713 56 1969 376 36 2,57E‐01 1,00E+00

261









‐ MAP3177 329 685 62 864 172 48 6,42E‐01 1,00E+00‐ MAP3178c 51 0 3 0 0 0 1,00E+00 1,00E+00‐ MAP3179c 200 0 8 252 0 5 9,56E‐01 1,00E+00‐ MAP3181 98 43 2 102 50 2 5,11E‐01 1,00E+00‐ MAP3182 0 51 2 0 0 0 1,00E+00 1,00E+00‐ MAP3183 0 152 5 0 0 0 1,00E+00 1,00E+00‐ MAP3184 445 540 24 622 299 19 7,63E‐01 1,00E+00‐ MAP3185 228 465 17 157 143 7 8,59E‐02 1,00E+00‐ MAP3186c 406 649 87 761 202 62 5,06E‐01 1,00E+00‐ MAP3187 51 101 5 135 55 5 5,07E‐01 1,00E+00fadE24 MAP3188 1430 2167 73 3115 957 67 8,86E‐01 1,00E+00fadE23 MAP3189 2154 2732 116 3591 1145 90 5,09E‐01 1,00E+00‐ MAP3191 179 74 6 117 102 5 4,21E‐01 1,00E+00‐ MAP3192 846 1090 47 1511 187 28 2,38E‐01 1,00E+00‐ MAP3193 303 436 17 602 397 22 4,27E‐01 1,00E+00‐ MAP3194 178 94 8 82 88 5 3,21E‐01 1,00E+00‐ MAP3195 529 465 46 559 273 33 5,24E‐01 1,00E+00fadE12_3 MAP3196 894 922 42 1320 386 31 5,17E‐01 1,00E+00‐ MAP3197 165 328 17 341 153 15 8,83E‐01 1,00E+00‐ MAP3198 406 464 65 1040 292 77 5,03E‐01 1,00E+00‐ MAP3199 287 362 34 285 163 21 3,41E‐01 1,00E+00‐ MAP3200 590 786 95 851 200 55 2,01E‐01 1,00E+00nuoA MAP3201 4252 4725 688 6177 1941 494 3,86E‐01 1,00E+00nuoB MAP3202 2721 2738 286 4361 1693 261 7,93E‐01 1,00E+00nuoC MAP3203 2031 4823 272 4534 1560 201 3,08E‐01 1,00E+00nuoD MAP3204 10742 15937 576 13838 5446 350 4,04E‐01 1,00E+00nuoE MAP3205 1563 2653 158 2954 803 110 3,13E‐01 1,00E+00nuoF MAP3206 5609 9452 314 8150 3382 206 1,51E‐01 1,00E+00nuoG MAP3207 4527 5563 124 8621 2559 108 8,67E‐01 1,00E+00nuoH MAP3208 1928 3331 121 2560 1163 75 1,65E‐01 1,00E+00

262









nuoI_2 MAP3209 1961 2781 249 2929 559 134 5,91E‐02 1,00E+00nuoJ MAP3210 1024 1328 82 1962 305 56 3,53E‐01 1,00E+00nuoL MAP3212 3892 5697 145 6504 1715 97 2,65E‐01 1,00E+00nuoM MAP3213 3562 2867 120 5056 1087 84 2,40E‐01 1,00E+00nuoN MAP3214 1660 1870 64 2311 436 36 1,02E‐01 1,00E+00‐ MAP3215c 0 151 5 51 0 1 2,41E‐02 1,00E+00omt MAP3216 194 236 14 390 227 19 4,48E‐01 1,00E+00‐ MAP3217c 243 151 10 204 102 6 3,92E‐01 1,00E+00moxR3 MAP3218c 246 436 19 706 204 21 8,15E‐01 1,00E+00‐ MAP3219c 452 462 55 744 201 43 6,92E‐01 1,00E+00‐ MAP3220c 184 140 9 122 102 6 3,08E‐01 1,00E+00‐ MAP3221 0 51 0 0 0 0 1,00E+00 1,00E+00‐ MAP3222c 0 51 1 130 0 2 5,75E‐01 1,00E+00‐ MAP3223c 201 303 22 447 251 28 5,24E‐01 1,00E+00‐ MAP3224 969 1136 53 1121 402 31 2,02E‐01 1,00E+00‐ MAP3225 251 190 11 761 102 15 4,25E‐01 1,00E+00‐ MAP3226c 198 345 11 1027 100 15 3,48E‐01 1,00E+00‐ MAP3228 626 493 24 507 357 17 5,19E‐01 1,00E+00‐ MAP3230c 646 667 35 1159 356 32 9,56E‐01 1,00E+00‐ MAP3231c 233 144 9 424 232 14 2,62E‐01 1,00E+00‐ MAP3232 153 168 10 152 51 5 2,19E‐01 1,00E+00‐ MAP3233c 6127 8208 222 12731 4152 211 9,53E‐01 1,00E+00‐ MAP3234c 408 396 30 857 291 35 5,94E‐01 1,00E+00‐ MAP3235c 1185 745 56 1438 667 51 9,16E‐01 1,00E+00catB MAP3236 2419 789 45 4226 487 43 9,82E‐01 1,00E+00‐ MAP3237c 115 147 13 398 0 11 8,80E‐01 1,00E+00‐ MAP3238 282 243 16 1149 240 30 6,43E‐02 1,00E+00‐ MAP3239 593 633 46 2142 299 64 3,05E‐01 1,00E+00‐ MAP3240 135 0 5 61 51 4 5,40E‐01 1,00E+00‐ MAP3241 0 42 3 0 0 0 1,00E+00 1,00E+00

263









‐ MAP3242 101 151 6 201 51 5 6,63E‐01 1,00E+00‐ MAP3243 605 873 106 1489 233 88 7,77E‐01 1,00E+00‐ MAP3244 442 448 21 964 100 17 6,93E‐01 1,00E+00‐ MAP3245 52 0 1 140 0 2 5,60E‐01 1,00E+00‐ MAP3246 55 0 1 0 0 0 1,00E+00 1,00E+00‐ MAP3247c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP3248 51 0 1 51 0 0 5,85E‐01 1,00E+00‐ MAP3249 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP3250 0 23 0 51 0 0 5,27E‐01 1,00E+00‐ MAP3251 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP3252 51 18 0 102 0 0 5,41E‐01 1,00E+00‐ MAP3253 39 0 1 51 51 4 9,35E‐01 1,00E+00‐ MAP3254 0 50 0 18 0 0 1,36E‐02 1,00E+00‐ MAP3255 1798 1105 48 5747 628 69 1,88E‐01 1,00E+00‐ MAP3256c 456 353 35 457 153 21 2,75E‐01 1,00E+00‐ MAP3257c 5272 2582 371 9733 1317 350 9,80E‐01 1,00E+00‐ MAP3258 102 201 7 607 92 12 1,87E‐01 1,00E+00pknJ MAP3259 94 122 6 204 0 3 7,48E‐01 1,00E+00‐ MAP3260 1930 2111 120 5225 1628 161 3,43E‐01 1,00E+00glgX_2 MAP3262c 11261 6054 240 22013 5619 284 3,03E‐01 1,00E+00‐ MAP3263c 639 302 23 763 204 18 6,33E‐01 1,00E+00‐ MAP3264c 3108 3781 269 7750 2893 343 3,67E‐01 1,00E+00‐ predicted RNA 1752 2602 4021 4122 2101 5107 4,42E‐01 1,00E+00‐ MAP3265 1599 2190 83 3662 1427 93 6,70E‐01 1,00E+00‐ MAP3266c 98 201 14 345 51 13 8,65E‐01 1,00E+00‐ MAP3267c 51 102 11 102 50 10 5,11E‐01 1,00E+00hsp18_3 MAP3268 133 81 14 323 0 12 5,23E‐01 1,00E+00‐ MAP3270c 328 597 15 930 528 22 2,32E‐01 1,00E+00‐ MAP3271c 694 1168 79 1523 918 96 4,62E‐01 1,00E+00‐ MAP3272 0 0 0 0 0 0 1,00E+00 1,00E+00

264









‐ MAP3273c 100 0 3 0 51 2 5,74E‐01 1,00E+00‐ MAP3274 763 408 30 1024 395 29 8,93E‐01 1,00E+00narL_2 MAP3275 305 324 27 689 313 37 3,58E‐01 1,00E+00‐ MAP3276c 51 51 2 44 0 0 3,71E‐02 1,00E+00‐ MAP3277c 0 148 12 50 0 2 1,34E‐02 1,00E+00‐ MAP3278c 49 98 3 254 50 5 9,87E‐01 1,00E+00‐ MAP3279 685 459 32 847 357 27 9,04E‐01 1,00E+00‐ MAP3280c 56 7 1 412 102 9 8,54E‐04 1,00E+00‐ MAP3281c 942 1479 63 1834 238 38 1,96E‐01 1,00E+00‐ MAP3282c 3853 3670 235 5690 1220 159 1,65E‐01 1,00E+00‐ MAP3283c 1232 991 71 2540 841 86 4,89E‐01 1,00E+00fadD29 MAP3284c 23231 21869 393 35649 9916 306 8,65E‐01 1,00E+00‐ MAP3285c 465 925 36 990 362 30 7,47E‐01 1,00E+00‐ predicted RNA 5827 4922 7002 8278 5673 8412 3,36E‐01 1,00E+00IS1547_2 MAP3286 1034 1326 61 1406 535 42 3,48E‐01 1,00E+00‐ MAP3287 389 727 35 755 104 19 1,72E‐01 1,00E+00‐ MAP3288 2118 1993 130 2859 1290 112 7,18E‐01 1,00E+00mce1_1 MAP3289c 7424 8477 347 12854 6332 365 6,92E‐01 1,00E+00mpt64 MAP3290c 641 414 52 1051 206 44 8,77E‐01 1,00E+00‐ MAP3291c 5314 7173 120 7160 4482 103 6,94E‐01 1,00E+00‐ MAP3292c 1013 454 43 1297 657 48 6,44E‐01 1,00E+00‐ MAP3293 4115 5166 193 6623 2641 162 7,43E‐01 1,00E+00‐ MAP3294 50 477 16 1 0 0 1,00E+00 1,00E+00‐ MAP3295 2779 3407 132 6181 1831 135 8,17E‐01 1,00E+00‐ MAP3296c 36 203 23 115 65 17 9,57E‐01 1,00E+00uvrD2 MAP3297c 1721 1300 42 2040 816 32 5,71E‐01 1,00E+00‐ MAP3298 373 86 55 551 204 70 4,98E‐01 1,00E+00‐ MAP3299c 1484 2397 55 2453 755 36 2,47E‐01 1,00E+00‐ MAP3300c 102 200 2 196 0 1 1,38E‐01 1,00E+00‐ MAP3301c 185 78 2 226 31 1 3,43E‐01 1,00E+00

265









‐ MAP3302 723 554 158 970 406 141 9,24E‐01 1,00E+00lipV MAP3303 560 489 39 1061 399 44 5,77E‐01 1,00E+00‐ MAP3304 0 51 4 51 51 9 6,13E‐01 1,00E+00‐ MAP3305c 688 704 47 1200 156 31 4,10E‐01 1,00E+00moeZ MAP3306c 707 1321 48 1218 583 37 6,11E‐01 1,00E+00‐ MAP3307c 1139 1642 72 2339 1027 75 7,65E‐01 1,00E+00‐ MAP3308 800 985 74 626 588 51 4,11E‐01 1,00E+00‐ MAP3309c 589 417 112 765 395 112 8,01E‐01 1,00E+00‐ MAP3310 1398 1854 162 3270 754 151 9,76E‐01 1,00E+00‐ MAP3311c 2026 4064 239 4843 1386 195 5,20E‐01 1,00E+00‐ predicted RNA 9637 14471 12543 16902 7736 11136 7,57E‐01 1,00E+00rhlE MAP3312 6436 9412 299 12909 4971 282 9,74E‐01 1,00E+00‐ MAP3313 801 736 36 1110 255 24 3,90E‐01 1,00E+00‐ MAP3314c 491 856 47 1093 248 36 6,26E‐01 1,00E+00entC MAP3316 405 516 24 357 276 16 4,10E‐01 1,00E+00‐ MAP3317 276 39 20 511 214 36 1,35E‐01 1,00E+00‐ MAP3318c 153 51 12 53 0 1 2,75E‐04 1,00E+00‐ MAP3319 253 258 15 919 104 20 4,21E‐01 1,00E+00whiB1 MAP3320 8566 9101 2011 15264 5547 1933 8,15E‐01 1,00E+00‐ MAP3321c 736 1360 39 2371 753 48 4,69E‐01 1,00E+00‐ MAP3322c 6266 7773 1824 12143 4827 1844 8,59E‐01 1,00E+00‐ MAP3323c 412 556 88 813 235 75 8,60E‐01 1,00E+00sigH MAP3324c 3594 5102 309 9013 3454 370 5,26E‐01 1,00E+00‐ MAP3325 1690 2051 127 2689 1180 112 8,09E‐01 1,00E+00‐ MAP3326c 51 204 7 151 102 7 5,64E‐01 1,00E+00‐ MAP3327c 0 226 5 0 174 6 4,02E‐01 1,00E+00‐ MAP3328c 104 114 8 51 105 7 5,39E‐01 1,00E+00‐ MAP3329c 51 102 3 150 51 3 5,09E‐01 1,00E+00‐ MAP3330 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP3331 0 36 1 49 0 1 5,16E‐01 1,00E+00

266









‐ MAP3332 406 740 23 644 605 26 6,20E‐01 1,00E+00‐ MAP3333c 286 482 28 868 298 35 4,57E‐01 1,00E+00aroA MAP3334 311 608 19 1092 263 22 5,65E‐01 1,00E+00‐ MAP3335 292 153 13 227 147 10 6,36E‐01 1,00E+00‐ MAP3336c 436 478 56 1021 321 65 5,26E‐01 1,00E+00fadA6_4 MAP3337 99 0 2 0 51 1 5,73E‐01 1,00E+00‐ MAP3338 0 0 0 102 0 3 0,00E+00 1,00E+00‐ MAP3339c 51 102 3 0 0 0 1,00E+00 1,00E+00‐ MAP3340 102 0 4 152 46 6 5,34E‐01 1,00E+00‐ MAP3341 210723 198628 20212 392165 139505 21225 5,66E‐01 1,00E+00‐ MAP3342 158524 196771 12422 278402 107640 11229 3,36E‐01 1,00E+00desA3_1 MAP3343c 99684 105378 4637 190546 60767 4519 2,47E‐01 1,00E+00‐ MAP3344c 7262 12978 497 17096 6220 478 7,50E‐01 1,00E+00‐ predicted RNA 675 991 3408 1010 868 3822 6,46E‐01 1,00E+00‐ MAP3345c 190 547 40 570 95 26 4,13E‐01 1,00E+00pvdS MAP3346c 1253 1162 80 2626 706 84 7,46E‐01 1,00E+00‐ MAP3347c 350 545 17 575 199 12 4,98E‐01 1,00E+00‐ MAP3348 0 24 1 41 0 1 5,09E‐01 1,00E+00kefB MAP3349c 50 51 2 100 51 3 5,33E‐01 1,00E+00‐ MAP3350c 453 465 55 560 151 32 2,81E‐01 1,00E+00‐ MAP3351c 254 251 19 392 152 17 8,97E‐01 1,00E+00‐ MAP3352c 173 242 7 150 153 5 6,31E‐01 1,00E+00‐ MAP3353c 0 0 0 0 0 0 1,00E+00 1,00E+00secA MAP3354c 10712 15102 262 18135 6817 210 9,56E‐01 1,00E+00‐ MAP3355c 12945 12181 1053 24651 7202 1039 3,65E‐01 1,00E+00‐ predicted RNA 8475 10706 10631 13409 5376 8734 8,58E‐01 1,00E+00‐ MAP3356c 0 0 0 0 51 3 0,00E+00 1,00E+00‐ MAP3357c 2043 1598 63 3295 834 54 7,31E‐01 1,00E+00lpqB MAP3358c 2912 3643 107 5904 1844 101 9,45E‐01 1,00E+00mtrB MAP3359c 7808 10082 303 13929 6343 297 7,78E‐01 1,00E+00

267









mtrA MAP3360c 11965 13505 1073 23329 7052 1010 4,70E‐01 1,00E+00sahH MAP3362c 9863 9069 370 18734 4099 330 9,57E‐01 1,00E+00‐ MAP3363c 3135 1217 149 5988 668 149 9,91E‐01 1,00E+00‐ MAP3364c 8499 4434 287 14657 2499 264 8,29E‐01 1,00E+00‐ MAP3365c 1975 2581 86 3085 1430 74 7,09E‐01 1,00E+00‐ MAP3366 153 202 7 502 0 6 8,24E‐01 1,00E+00manA MAP3367c 980 1390 55 1614 850 51 9,79E‐01 1,00E+00‐ MAP3368c 594 691 33 1421 494 40 5,09E‐01 1,00E+00manB MAP3369c 921 820 35 1206 505 29 7,20E‐01 1,00E+00‐ MAP3370c 205 562 43 614 223 39 9,24E‐01 1,00E+00‐ MAP3371 152 228 25 363 100 24 9,26E‐01 1,00E+00whiB2 MAP3372c 5325 4322 773 10437 4016 946 4,06E‐01 1,00E+00‐ MAP3373 105 110 23 120 37 13 7,57E‐01 1,00E+00‐ MAP3374 354 394 21 764 255 23 7,17E‐01 1,00E+00‐ MAP3375 203 428 13 385 149 9 5,33E‐01 1,00E+00‐ MAP3376 250 328 10 456 234 11 8,16E‐01 1,00E+00‐ MAP3377 51 286 17 0 0 0 1,00E+00 1,00E+00rmlA2 MAP3378c 542 805 35 1345 174 28 6,86E‐01 1,00E+00wbbL MAP3379c 1406 1079 84 1748 775 71 7,92E‐01 1,00E+00rmlD MAP3380c 55 104 4 289 56 7 7,23E‐01 1,00E+00‐ MAP3381 2077 1777 76 3802 1624 90 6,01E‐01 1,00E+00‐ MAP3382 380 578 40 508 194 25 3,11E‐01 1,00E+00ctpC MAP3384 1149 506 22 1042 152 11 7,01E‐02 1,00E+00‐ MAP3385 203 181 12 143 14 3 2,59E‐02 1,00E+00‐ MAP3386 548 764 30 830 324 22 5,75E‐01 1,00E+00pknD MAP3387c 1906 3555 78 3503 2132 75 9,23E‐01 1,00E+00pstS MAP3388c 1681 2352 101 3177 1363 97 9,75E‐01 1,00E+00‐ MAP3389c 1558 1820 221 2077 559 133 1,65E‐01 1,00E+00‐ MAP3390c 3100 4204 131 4468 1773 94 2,40E‐01 1,00E+00‐ MAP3391c 564 804 33 1427 363 33 8,43E‐01 1,00E+00

268









fadE25_4 MAP3392c 3829 5271 223 7239 2406 191 7,98E‐01 1,00E+00purE MAP3393c 566 449 57 1190 413 72 4,01E‐01 1,00E+00purK MAP3394c 148 676 17 680 401 22 4,47E‐01 1,00E+00‐ MAP3395 2667 3587 269 4450 1960 237 6,85E‐01 1,00E+00‐ MAP3396c 673 721 77 1090 459 72 9,95E‐01 1,00E+00birA MAP3397c 126 275 13 535 51 13 8,52E‐01 1,00E+00‐ MAP3398c 0 31 0 121 0 1 7,62E‐01 1,00E+00accD5 MAP3399 10160 12806 403 16222 5611 312 8,04E‐01 1,00E+00‐ MAP3400 2398 2534 548 3525 1503 471 6,93E‐01 1,00E+00maf MAP3401 530 828 61 1484 446 69 6,24E‐01 1,00E+00sseA MAP3402 6403 7175 438 8848 4048 357 4,71E‐01 1,00E+00‐ MAP3403 101 591 44 183 118 19 7,76E‐02 1,00E+00accA3 MAP3404 5292 5426 170 9435 2056 135 6,79E‐01 1,00E+00Rv0516c MAP3405 763 805 104 1198 419 87 7,77E‐01 1,00E+00sigF_2 MAP3406c 6438 4644 414 11167 2581 379 9,46E‐01 1,00E+00rsbW MAP3407c 2363 1528 222 4339 1023 225 9,11E‐01 1,00E+00‐ MAP3408c 1577 2480 371 3644 2222 497 3,52E‐01 1,00E+00‐ MAP3409c 5093 4666 742 11643 3197 867 5,20E‐01 1,00E+00lat MAP3410c 6516 14147 434 15555 7140 420 7,12E‐01 1,00E+00‐ MAP3411c 152 176 20 407 51 20 3,61E‐01 1,00E+00‐ MAP3412 1051 2269 74 2415 1445 80 6,69E‐01 1,00E+00aldB MAP3413 5296 7361 237 8664 4608 222 9,10E‐01 1,00E+00‐ MAP3414 5673 9883 670 11413 4972 610 8,86E‐01 1,00E+00lhr MAP3415 755 446 7 1220 498 8 5,60E‐01 1,00E+00nei MAP3416 196 102 11 196 51 7 2,98E‐01 1,00E+00lpqC MAP3417c 83 265 10 158 51 5 2,06E‐01 1,00E+00‐ MAP3418 1269 1515 178 1479 912 140 6,26E‐01 1,00E+00‐ MAP3419c 383 1226 39 1869 916 61 1,30E‐01 1,00E+00‐ MAP3422c 293 383 22 769 53 17 6,76E‐01 1,00E+00glpD2 MAP3423c 1182 592 30 1907 250 24 6,94E‐01 1,00E+00

269









lpdA MAP3424c 476 384 17 762 559 24 2,45E‐01 1,00E+00‐ MAP3425 453 516 59 1000 420 74 4,31E‐01 1,00E+00amiA MAP3426c 1064 1542 63 2226 748 58 9,85E‐01 1,00E+00amiB MAP3427c 655 526 28 732 202 17 2,47E‐01 1,00E+00‐ MAP3428c 254 395 26 682 272 32 5,15E‐01 1,00E+00deoD MAP3429 51 202 8 203 50 6 8,46E‐01 1,00E+00pmmB MAP3430 102 176 5 357 204 9 1,42E‐01 1,00E+00‐ MAP3432 153 357 15 153 254 14 9,53E‐01 1,00E+00‐ MAP3433 1858 1836 81 3591 1118 82 8,90E‐01 1,00E+00‐ MAP3434 912 1585 71 1775 810 64 9,24E‐01 1,00E+00‐ MAP3435c 987 1134 60 1416 403 40 3,47E‐01 1,00E+00‐ MAP3436c 177 51 9 153 254 18 1,52E‐01 1,00E+00‐ MAP3437c 138 147 9 51 51 3 1,24E‐01 1,00E+00add MAP3438c 1900 1784 97 3639 1615 117 5,28E‐01 1,00E+00deoA MAP3439c 637 1085 38 1849 941 55 2,08E‐01 1,00E+00cdd MAP3440c 159 106 19 144 51 11 3,01E‐01 1,00E+00sdhC MAP3441 661 378 67 964 182 52 6,86E‐01 1,00E+00sdhD MAP3442 347 538 53 642 59 28 1,62E‐01 1,00E+00sdhA MAP3443 3315 5694 146 5529 2601 115 6,01E‐01 1,00E+00sdhB MAP3444 757 1307 73 1792 1039 92 4,02E‐01 1,00E+00‐ MAP3445 13 106 4 209 25 6 5,41E‐01 1,00E+00sigJ MAP3446c 0 0 0 0 100 4 0,00E+00 1,00E+00‐ MAP3447 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP3448 669 629 31 660 203 16 1,08E‐01 1,00E+00sugI MAP3449 171 286 9 275 102 6 4,87E‐01 1,00E+00nagA MAP3450 0 0 0 51 101 4 0,00E+00 1,00E+00sugE MAP3451 102 119 16 255 50 16 9,67E‐01 1,00E+00‐ MAP3452c 297 461 21 709 408 28 3,44E‐01 1,00E+00trpS MAP3453c 710 700 39 1016 356 31 6,76E‐01 1,00E+00‐ MAP3454 1313 1924 108 2559 488 75 3,61E‐01 1,00E+00

270









icd1 MAP3455c 3100 5533 197 6285 3118 191 9,41E‐01 1,00E+00icd2 MAP3456c 7327 9812 220 13900 5968 217 7,81E‐01 1,00E+00metC MAP3457 2497 2461 105 3441 1670 93 7,61E‐01 1,00E+00metX MAP3458 1744 2610 105 3353 1650 107 9,39E‐01 1,00E+00‐ MAP3459 680 1076 68 882 263 35 1,16E‐01 1,00E+00‐ MAP3461 1274 1569 134 2508 584 110 7,08E‐01 1,00E+00‐ MAP3462c 90 263 34 335 102 35 7,97E‐01 1,00E+00folD MAP3463c 698 682 47 809 404 36 6,30E‐01 1,00E+00‐ MAP3464 1206 942 51 2490 407 49 9,92E‐01 1,00E+00‐ MAP3465 3418 4852 90 5967 2845 84 9,54E‐01 1,00E+00‐ MAP3466 1234 2275 40 2746 1199 39 9,34E‐01 1,00E+00‐ MAP3467c 1654 1511 55 3409 922 57 7,44E‐01 1,00E+00‐ MAP3468c 286 254 38 286 97 21 2,39E‐01 1,00E+00‐ MAP3469c 184 371 26 797 155 34 4,88E‐01 1,00E+00‐ MAP3470c 712 703 109 1536 288 102 9,96E‐01 1,00E+00‐ MAP3471c 739 828 107 1527 302 91 8,22E‐01 1,00E+00‐ MAP3472c 5513 4878 107 8801 2929 96 9,28E‐01 1,00E+00‐ MAP3473c 51 92 6 202 0 5 5,21E‐01 1,00E+00spoU MAP3474 102 102 12 151 102 14 9,56E‐01 1,00E+00‐ MAP3475c 3584 4199 347 4844 2226 271 4,64E‐01 1,00E+00dnaE2 MAP3476c 153 102 2 293 0 1 4,88E‐01 1,00E+00‐ MAP3477 1614 700 54 3175 669 64 5,08E‐01 1,00E+00otsB2 MAP3478 4239 2735 175 7459 2374 192 6,66E‐01 1,00E+00‐ MAP3480 558 476 24 774 549 29 4,89E‐01 1,00E+00lpqD MAP3481 3551 4856 338 5861 3035 318 9,83E‐01 1,00E+00acrA1 MAP3482 2338 3310 79 5172 2465 94 4,49E‐01 1,00E+00‐ MAP3483 50 262 18 239 153 22 4,03E‐01 1,00E+00iunH MAP3484 383 578 26 813 40 15 2,30E‐01 1,00E+00kasB_2 MAP3485 3841 3785 176 7410 2410 180 8,32E‐01 1,00E+00‐ MAP3486 667 365 26 1380 407 34 3,39E‐01 1,00E+00

271









‐ MAP3487c 1365 1092 45 3675 1160 70 1,17E‐01 1,00E+00‐ MAP3488c 102 268 11 537 202 19 1,68E‐01 1,00E+00‐ MAP3490 0 0 0 30411 13036 667 1,00E+00 1,00E+00‐ MAP3493 0 0 0 153 50 4 0,00E+00 1,00E+00‐ MAP3494 0 102 1 99 51 2 5,48E‐01 1,00E+00‐ MAP3495c 7707 3411 435 16132 1899 463 6,33E‐01 1,00E+00‐ MAP3496 51 51 3 229 51 6 5,84E‐01 1,00E+00fadD12_2 MAP3497 189 326 9 455 102 7 7,71E‐01 1,00E+00ctpI MAP3498c 2289 1945 25 4306 1617 29 6,91E‐01 1,00E+00‐ MAP3499c 5654 6366 1758 12487 4320 1991 4,64E‐01 1,00E+00‐ MAP3500c 319 249 35 611 286 46 4,11E‐01 1,00E+00‐ MAP3501 101 98 11 260 226 28 8,71E‐02 1,00E+00‐ MAP3503c 408 297 26 488 152 18 4,95E‐01 1,00E+00‐ MAP3504c 151 204 6 306 101 6 9,78E‐01 1,00E+00‐ MAP3505c 50 0 2 130 51 5 6,97E‐01 1,00E+00‐ MAP3506c 295 101 7 349 50 4 4,32E‐01 1,00E+00‐ MAP3507 0 7 0 0 0 0 5,99E‐61 1,00E+00‐ MAP3508 153 51 4 50 0 0 1,56E‐05 1,00E+00‐ MAP3509 51 0 0 51 0 0 5,85E‐01 1,00E+00‐ MAP3510 0 51 1 0 0 0 1,00E+00 1,00E+00‐ MAP3511 0 0 0 49 0 0 1,81E‐119 1,00E+00‐ MAP3512 0 0 0 51 79 2 0,00E+00 1,00E+00‐ MAP3513 51 0 1 291 0 3 2,08E‐01 1,00E+00‐ MAP3514 1366 2372 51 1742 810 30 1,49E‐01 1,00E+00‐ predicted RNA 940 1085 3661 2355 974 5063 2,62E‐01 1,00E+00‐ MAP3516 0 0 0 100 0 7 0,00E+00 1,00E+00‐ MAP3517 51 40 1 153 139 4 8,46E‐02 1,00E+00‐ MAP3518c 305 274 16 657 188 18 7,13E‐01 1,00E+00‐ MAP3519 153 50 9 416 0 11 7,49E‐01 1,00E+00‐ MAP3520c 355 1248 58 1246 724 67 5,85E‐01 1,00E+00

272









‐ MAP3521 153 99 9 138 0 3 1,11E‐01 1,00E+00oxyS_1 MAP3522 51 51 3 102 101 6 6,39E‐01 1,00E+00oxcA MAP3523c 238 0 4 146 0 1 1,23E‐01 1,00E+00fadD7 MAP3524 50 64 2 0 0 0 1,00E+00 1,00E+00fusA2 MAP3525c 2555 3361 78 6835 2206 96 3,73E‐01 1,00E+00‐ MAP3526c 157 125 18 229 32 12 3,24E‐01 1,00E+00pepA MAP3527 3022 1938 135 4802 1688 140 8,78E‐01 1,00E+00‐ MAP3528 6078 8941 242 15962 3922 246 8,16E‐01 1,00E+00‐ MAP3529 1801 1471 70 4742 923 88 4,20E‐01 1,00E+00‐ MAP3530 1140 1037 92 2806 782 117 3,93E‐01 1,00E+00fbpC2 MAP3531c 8161 8493 457 13570 4889 412 9,78E‐01 1,00E+00‐ MAP3532c 0 102 2 0 152 6 3,52E‐01 1,00E+00‐ MAP3533c 303 293 14 406 253 15 9,01E‐01 1,00E+00‐ MAP3534c 0 0 0 50 0 1 0,00E+00 1,00E+00‐ MAP3535 233 208 42 632 224 66 2,40E‐01 1,00E+00‐ MAP3536 154 102 18 283 54 17 8,95E‐01 1,00E+00bpoC_1 MAP3537c 0 0 0 277 18 6 0,00E+00 1,00E+00‐ MAP3538 327 434 48 626 324 53 6,88E‐01 1,00E+00fadE1_3 MAP3539c 2556 1924 97 3477 1369 86 7,67E‐01 1,00E+00‐ MAP3540c 403 832 49 1143 456 55 6,50E‐01 1,00E+00‐ MAP3541c 255 296 14 608 102 12 9,53E‐01 1,00E+00‐ MAP3542 178 211 18 607 264 35 9,91E‐02 1,00E+00‐ MAP3543 1151 300 125 2389 459 169 2,96E‐01 1,00E+00‐ MAP3544c 8635 15687 917 16385 8061 819 7,36E‐01 1,00E+00‐ MAP3545 3488 3223 178 5966 1720 158 7,56E‐01 1,00E+00desA3_2 MAP3546 3646 5118 228 8375 2005 206 9,05E‐01 1,00E+00‐ MAP3547c 51 96 3 118 101 5 8,82E‐01 1,00E+00‐ MAP3548c 51 0 2 86 101 8 9,84E‐02 1,00E+00‐ MAP3549 41 412 10 102 51 3 3,98E‐02 1,00E+00ephF MAP3550 1141 1350 80 4156 809 117 1,67E‐01 1,00E+00

273









‐ MAP3551c 153 343 65 211 49 26 8,65E‐02 1,00E+00‐ MAP3552c 344 119 23 377 126 19 8,02E‐01 1,00E+00‐ MAP3553 529 241 17 798 260 18 7,57E‐01 1,00E+00‐ MAP3554c 3153 2420 317 4624 1283 257 5,23E‐01 1,00E+00‐ MAP3555 152 201 20 51 102 10 2,02E‐01 1,00E+00‐ MAP3556 0 102 2 101 0 1 5,88E‐01 1,00E+00‐ MAP3558c 531 295 61 460 407 62 8,31E‐01 1,00E+00‐ MAP3559 0 83 2 153 101 7 1,13E‐01 1,00E+00‐ predicted RNA 4814 1037 5793 6659 1048 5094 6,85E‐01 1,00E+00‐ MAP3560 15334 4425 1096 25314 3090 1025 7,80E‐01 1,00E+00‐ MAP3561 0 134 3 436 0 7 2,22E‐01 1,00E+00‐ MAP3562 925 1475 106 1881 710 96 9,16E‐01 1,00E+00‐ MAP3563 335 459 24 610 303 24 8,65E‐01 1,00E+00‐ MAP3564 0 139 3 428 72 10 7,85E‐02 1,00E+00‐ MAP3565 157 404 10 208 104 5 4,71E‐02 1,00E+00‐ MAP3566 2592 4849 143 7117 2745 161 6,28E‐01 1,00E+00‐ MAP3567 6409 6423 432 8595 3201 325 3,96E‐01 1,00E+00‐ MAP3569c 102 236 23 271 0 11 1,98E‐01 1,00E+00‐ MAP3571 0 94 6 192 51 13 8,35E‐01 1,00E+00pntAA MAP3572 1525 1306 75 2154 733 61 6,86E‐01 1,00E+00pntAB MAP3573 391 252 59 692 58 44 5,82E‐01 1,00E+00pntB MAP3574 2280 3391 113 3958 2272 114 9,55E‐01 1,00E+00‐ MAP3575 752 1047 81 1663 870 101 4,05E‐01 1,00E+00‐ MAP3576 1747 1961 97 3071 1178 92 9,77E‐01 1,00E+00fabG3_2 MAP3577 874 950 71 1651 286 54 5,77E‐01 1,00E+00‐ MAP3578 366 305 14 852 101 14 9,88E‐01 1,00E+00‐ MAP3579c 427 355 41 679 62 25 3,17E‐01 1,00E+00‐ MAP3580c 152 245 13 189 51 6 1,61E‐01 1,00E+00‐ MAP3581c 386 94 16 306 153 13 7,08E‐01 1,00E+00‐ MAP3582c 29 90 6 193 50 11 8,79E‐01 1,00E+00

274









‐ MAP3583 102 81 5 51 51 3 8,05E‐01 1,00E+00‐ MAP3584 203 196 12 651 153 19 2,69E‐01 1,00E+00‐ MAP3585 301 439 18 356 98 8 1,14E‐01 1,00E+00‐ MAP3586c 289 289 23 848 242 34 2,72E‐01 1,00E+00‐ MAP3587 178 300 11 241 152 8 6,68E‐01 1,00E+00‐ MAP3588 51 0 3 0 0 0 1,00E+00 1,00E+00‐ MAP3589 102 151 10 204 51 7 6,36E‐01 1,00E+00‐ MAP3590 51 150 4 253 0 3 5,33E‐01 1,00E+00‐ MAP3591 50 254 8 101 0 1 2,23E‐02 1,00E+00‐ MAP3592 51 51 5 0 0 0 1,00E+00 1,00E+00‐ MAP3593 0 51 1 0 0 0 1,00E+00 1,00E+00‐ MAP3594 0 279 4 51 0 0 1,34E‐06 1,00E+00‐ MAP3595 0 0 0 51 0 0 0,00E+00 1,00E+00adhE MAP3596c 69 127 5 153 101 6 9,45E‐01 1,00E+00‐ MAP3597 378 305 41 401 99 22 2,03E‐01 1,00E+00‐ MAP3598 3092 2842 375 5401 1465 332 7,07E‐01 1,00E+00‐ MAP3599c 4982 7337 432 7259 2565 283 2,68E‐01 1,00E+00‐ MAP3600 59640 47497 13993 113186 29138 14029 2,22E‐01 1,00E+00fadD5 MAP3601 58445 79153 2897 101110 50916 2826 2,29E‐01 1,00E+00‐ MAP3602 8008 9719 627 14555 4163 518 8,07E‐01 1,00E+00‐ MAP3603 5908 7903 525 10372 4912 506 9,87E‐01 1,00E+00mce1_2 MAP3604 19673 25758 1001 29342 15900 893 3,70E‐01 1,00E+00‐ MAP3605 16902 23982 1126 25787 11038 867 7,93E‐01 1,00E+00‐ MAP3606 18291 21390 736 33548 13985 744 1,87E‐01 1,00E+00‐ MAP3607 23243 28892 931 42289 17491 901 2,35E‐01 1,00E+00lprK MAP3608 9909 15183 617 13760 6876 450 7,23E‐01 1,00E+00‐ MAP3609 38948 51234 1673 62911 27104 1424 3,24E‐01 1,00E+00‐ MAP3610 2199 3830 267 4278 2389 269 8,89E‐01 1,00E+00‐ MAP3611 2623 5130 225 5414 2125 186 6,08E‐01 1,00E+00‐ MAP3612 11936 12945 1300 17831 4819 913 6,45E‐01 1,00E+00

275









‐ MAP3613 7256 8245 591 10695 3605 439 3,18E‐01 1,00E+00‐ MAP3614 635 464 49 570 257 31 3,10E‐01 1,00E+00lprO MAP3615c 1703 3884 142 3900 2570 158 6,44E‐01 1,00E+00‐ MAP3616c 501 393 18 841 376 21 5,57E‐01 1,00E+00‐ MAP3617c 207 750 36 893 402 44 4,69E‐01 1,00E+00‐ MAP3618c 51 0 1 90 0 1 4,87E‐01 1,00E+00‐ MAP3619 0 0 0 100 50 3 0,00E+00 1,00E+00‐ MAP3620c 478 902 27 445 557 21 6,89E‐01 1,00E+00sigG MAP3621c 221 395 15 417 203 14 8,90E‐01 1,00E+00‐ MAP3622 540 830 46 843 249 29 3,21E‐01 1,00E+00‐ MAP3623 186 233 16 517 134 19 5,70E‐01 1,00E+00‐ MAP3624 386 513 50 1073 306 60 4,79E‐01 1,00E+00bglS MAP3625 231 383 8 1090 295 14 9,74E‐02 1,00E+00‐ MAP3628c 101 0 4 44 0 1 2,27E‐02 1,00E+00‐ MAP3629c 0 0 0 13 0 0 4,36E‐10 1,00E+00‐ MAP3630 774 969 115 1366 190 72 2,93E‐01 1,00E+00‐ MAP3633 965 1620 59 3335 1517 96 7,89E‐02 1,00E+00‐ MAP3634 2038 1578 102 5340 1429 145 2,47E‐01 1,00E+00‐ MAP3635 136 47 9 255 85 13 5,53E‐01 1,00E+00‐ MAP3636 458 515 10 563 232 7 4,44E‐01 1,00E+00mmpL11 MAP3637c 6645 10432 161 16240 4574 155 8,50E‐01 1,00E+00‐ MAP3638 0 49 2 0 51 3 5,67E‐01 1,00E+00‐ MAP3639c 2506 2030 112 3377 1368 97 7,17E‐01 1,00E+00‐ MAP3640 611 542 29 2074 357 43 2,04E‐01 1,00E+00mmpL3 MAP3641c 8793 9271 182 18162 6688 205 4,06E‐01 1,00E+00‐ MAP3642c 4436 5357 396 8982 3336 410 7,92E‐01 1,00E+00trmB MAP3643c 6101 8095 523 9886 3652 412 3,90E‐01 1,00E+00‐ MAP3644 388 164 15 837 384 27 8,41E‐02 1,00E+00‐ MAP3645 1415 2713 76 3646 799 62 6,23E‐01 1,00E+00pckA MAP3646 42706 42968 1362 79093 21853 1239 2,97E‐01 1,00E+00

276









‐ MAP3647c 43 312 17 69 86 8 2,02E‐01 1,00E+00‐ MAP3648c 1187 1714 159 1828 826 126 6,28E‐01 1,00E+00fadD4 MAP3649 1164 1175 44 2758 881 55 4,27E‐01 1,00E+00‐ MAP3650 648 234 27 794 70 17 3,24E‐01 1,00E+00‐ predicted RNA 3016 1962 6145 4276 1084 4939 5,58E‐01 1,00E+00‐ predicted RNA 5280 6056 6834 9016 2946 5781 7,87E‐01 1,00E+00‐ predicted RNA 41233 38551 26770 80257 20627 25710 2,73E‐01 1,00E+00fadE3_2 MAP3651c 40861 43866 2018 81039 33186 2277 1,95E‐01 1,00E+00‐ MAP3652 50 0 1 102 0 1 5,12E‐01 1,00E+00‐ MAP3653 49 51 2 99 50 3 5,35E‐01 1,00E+00‐ MAP3654 200 299 11 150 134 6 6,06E‐02 1,00E+00lipW MAP3655c 740 850 51 854 416 35 4,58E‐01 1,00E+00lipC MAP3656 2059 3407 124 4009 1683 111 7,39E‐01 1,00E+00‐ MAP3657 4673 5760 213 7688 4298 220 7,84E‐01 1,00E+00echA1_2 MAP3658 448 460 33 747 162 24 5,62E‐01 1,00E+00‐ MAP3659 12768 15409 531 22423 10232 530 2,98E‐01 1,00E+00‐ MAP3660 7111 8234 1681 14239 4352 1612 9,55E‐01 1,00E+00‐ MAP3661c 13823 17426 1146 23867 9233 1010 4,66E‐01 1,00E+00‐ MAP3662c 706 791 29 1411 802 38 3,34E‐01 1,00E+00‐ MAP3663c 0 51 1 33 74 4 8,74E‐01 1,00E+00‐ MAP3664 625 794 35 998 308 25 5,58E‐01 1,00E+00‐ MAP3665c 494 546 17 691 102 9 1,66E‐01 1,00E+00‐ MAP3666c 3191 4616 180 6320 2741 179 9,00E‐01 1,00E+00‐ MAP3667 254 286 12 606 306 18 2,74E‐01 1,00E+00‐ MAP3668c 4641 5208 290 5411 2769 212 4,70E‐01 1,00E+00fadE4 MAP3669 534 1184 28 1712 639 32 5,76E‐01 1,00E+00‐ MAP3670 249 450 20 303 102 9 1,13E‐01 1,00E+00‐ MAP3671 6832 1634 378 13395 1265 413 6,98E‐01 1,00E+00nrdB MAP3672 10981 3532 470 27373 2716 622 2,37E‐01 1,00E+00gabD1 MAP3673c 2413 2345 97 2502 913 57 1,03E‐01 1,00E+00

277









‐ MAP3674 68 211 48 152 102 43 7,91E‐01 1,00E+00ilvB_2 MAP3675 139 307 8 613 102 9 6,03E‐01 1,00E+00oxyS_2 MAP3676 0 97 2 151 51 5 6,42E‐01 1,00E+00‐ MAP3677 202 147 7 354 0 4 2,51E‐01 1,00E+00‐ MAP3678 306 547 64 1189 191 75 5,44E‐01 1,00E+00‐ MAP3679 114 0 3 148 133 7 1,83E‐01 1,00E+00‐ MAP3680c 568 588 28 1337 545 39 3,18E‐01 1,00E+00‐ MAP3681 1398 2113 229 4642 1741 347 1,60E‐01 1,00E+00‐ MAP3682 2852 3684 129 6389 2922 158 3,94E‐01 1,00E+00‐ MAP3683 453 975 27 1458 760 38 2,67E‐01 1,00E+00‐ MAP3684 5233 5870 173 14040 3982 219 2,22E‐01 1,00E+00‐ MAP3685c 1240 685 39 1950 492 37 9,76E‐01 1,00E+00‐ MAP3686c 517 374 6 1065 453 8 2,58E‐01 1,00E+00‐ predicted RNA 2605 3724 5337 4019 1896 4353 5,03E‐01 1,00E+00‐ MAP3687c 56 222 28 89 57 14 2,49E‐01 1,00E+00lpqI MAP3688 389 309 17 508 255 16 9,60E‐01 1,00E+00‐ MAP3689 692 1126 80 2103 328 76 9,82E‐01 1,00E+00‐ MAP3690 50 51 2 591 51 9 8,50E‐03 1,00E+00‐ MAP3691c 1326 1691 103 2551 996 101 9,06E‐01 1,00E+00fabG MAP3692c 1091 854 41 2638 502 48 5,50E‐01 1,00E+00fadA2 MAP3693 1899 1981 83 2924 584 55 2,35E‐01 1,00E+00fadE5 MAP3694c 3156 1633 77 5134 685 63 5,90E‐01 1,00E+00‐ MAP3695 473 141 17 399 37 7 9,48E‐02 1,00E+00‐ MAP3697c 12141 15174 1054 16477 4387 623 3,72E‐01 1,00E+00sdhA MAP3698c 21759 28048 737 33871 8116 472 7,01E‐01 1,00E+00‐ MAP3699c 18847 18819 1324 22957 5678 761 5,24E‐01 1,00E+00‐ MAP3700c 1193 1544 250 2194 923 241 9,43E‐01 1,00E+00hsp MAP3701c 1624 949 173 2829 962 201 5,20E‐01 1,00E+00nirB MAP3702 1489 1982 38 2240 1067 32 6,68E‐01 1,00E+00nirD MAP3703 62 173 21 88 92 17 7,21E‐01 1,00E+00

278









‐ MAP3704c 61 100 10 300 51 16 5,60E‐01 1,00E+00‐ MAP3705c 48 41 3 154 44 5 5,74E‐01 1,00E+00‐ MAP3706c 237 178 10 376 248 14 3,76E‐01 1,00E+00narK3_2 MAP3707c 254 287 11 204 0 2 2,53E‐03 1,00E+00‐ MAP3708c 1631 2581 131 2801 1036 100 4,64E‐01 1,00E+00‐ MAP3709c 3169 2837 260 5958 1598 250 9,58E‐01 1,00E+00fecB2 MAP3710c 605 391 29 863 252 25 8,89E‐01 1,00E+00‐ MAP3711c 692 936 77 888 315 47 2,71E‐01 1,00E+00narU MAP3712 0 142 2 153 84 4 9,22E‐01 1,00E+00‐ MAP3713c 651 504 26 1023 251 21 8,02E‐01 1,00E+00fadD2 MAP3714 23532 22626 798 40992 13360 747 2,42E‐01 1,00E+00‐ MAP3715 850 344 93 1038 196 67 5,38E‐01 1,00E+00‐ predicted RNA 7384 6801 8124 11337 4342 7363 8,04E‐01 1,00E+00fadE6 MAP3716c 3561 4080 100 5389 2104 81 5,70E‐01 1,00E+00‐ MAP3717c 1541 2103 92 3159 1783 113 4,85E‐01 1,00E+00‐ MAP3718c 1342 1417 119 1537 1231 115 9,37E‐01 1,00E+00‐ MAP3719 2572 3073 261 4609 1924 255 9,68E‐01 1,00E+00‐ MAP3720 0 138 6 0 100 7 5,10E‐01 1,00E+00‐ MAP3721 1590 2301 75 1753 904 45 1,54E‐01 1,00E+00‐ MAP3722 0 101 2 247 102 7 8,08E‐02 1,00E+00fadD27 MAP3723c 45 50 4 51 51 4 5,10E‐01 1,00E+00‐ MAP3724 203 74 9 254 95 9 7,46E‐01 1,00E+00‐ MAP3725 37 189 3 301 302 11 2,87E‐02 1,00E+00‐ MAP3726 1953 2678 129 3355 1370 111 7,15E‐01 1,00E+00‐ MAP3727 50 51 3 233 24 6 7,55E‐01 1,00E+00‐ MAP3728 263 544 21 305 223 13 3,49E‐01 1,00E+00‐ MAP3729 100 444 19 189 149 12 3,62E‐01 1,00E+00‐ MAP3742 451 267 4 866 664 9 4,31E‐02 1,00E+00‐ MAP3744 203 485 18 1271 203 29 1,81E‐01 1,00E+00‐ MAP3745 334 675 37 558 356 32 8,75E‐01 1,00E+00

279









‐ MAP3746 484 987 132 1559 586 162 4,84E‐01 1,00E+00‐ predicted RNA 0 0 0 11264 9686 6155 1,00E+00 1,00E+00‐ MAP3755 1002 1485 158 1340 775 122 5,72E‐01 1,00E+00‐ MAP3756c 858 1308 71 1207 591 52 4,73E‐01 1,00E+00‐ MAP3757c 779 1749 64 1415 825 53 7,09E‐01 1,00E+00‐ MAP3758c 1148 2057 119 2506 1416 134 5,95E‐01 1,00E+00‐ MAP3759c 632 685 30 866 274 21 4,53E‐01 1,00E+00rpsR MAP3767c 0 0 0 11121 10811 2402 1,00E+00 1,00E+00‐ MAP3777 971 1432 111 3770 1256 189 6,01E‐02 1,00E+00‐ MAP3789c 198 333 12 357 70 7 2,95E‐01 1,00E+00atsG MAP3791c 1008 1147 43 2098 747 46 6,98E‐01 1,00E+00‐ MAP3792c 188 89 12 301 151 17 2,88E‐01 1,00E+00‐ MAP3793 145 204 35 313 49 26 4,90E‐01 1,00E+00‐ MAP3794c 812 993 107 914 357 63 2,20E‐01 1,00E+00‐ MAP3795 0 100 3 51 0 1 4,59E‐01 1,00E+00‐ MAP3796 13511 23518 1595 26265 12799 1491 4,01E‐01 1,00E+00‐ MAP3797c 1059 1059 123 1472 763 114 9,52E‐01 1,00E+00‐ MAP3798c 0 0 0 51 0 1 0,00E+00 1,00E+00‐ MAP3800 2471 4560 101 6651 2862 118 5,18E‐01 1,00E+00‐ MAP3801 2765 3676 126 5261 2771 140 5,95E‐01 1,00E+00‐ MAP3802c 204 161 16 391 254 26 2,06E‐01 1,00E+00‐ MAP3803 186 459 17 826 381 29 1,36E‐01 1,00E+00‐ MAP3804 2087 1924 142 3175 1228 128 8,33E‐01 1,00E+00‐ MAP3805c 215 316 9 534 254 12 4,82E‐01 1,00E+00‐ MAP3806 100 50 6 251 0 6 5,03E‐01 1,00E+00‐ MAP3807 63 102 6 143 0 3 6,14E‐01 1,00E+00‐ MAP3808c 274 181 17 759 51 19 6,86E‐01 1,00E+00‐ MAP3809c 1037 1642 54 1247 601 33 1,94E‐01 1,00E+00‐ MAP3810c 330 694 66 847 167 49 5,80E‐01 1,00E+00‐ MAP3811 1086 850 103 1554 720 102 8,86E‐01 1,00E+00

280









‐ MAP3813 1534 2956 415 3960 1866 476 6,74E‐01 1,00E+00‐ MAP3814c 0 102 1 153 0 1 4,89E‐01 1,00E+00‐ MAP3815 1669 2253 131 3256 1330 130 9,56E‐01 1,00E+00‐ MAP3816 50 73 14 26 35 7 6,09E‐01 1,00E+00‐ MAP3817c 962 1376 71 1349 563 49 3,76E‐01 1,00E+00‐ MAP3818 1829 2575 97 3101 1317 83 7,08E‐01 1,00E+00‐ MAP3819 153 537 30 1015 252 43 2,52E‐01 1,00E+00dcd MAP3820 802 1019 91 1225 771 92 8,60E‐01 1,00E+00‐ MAP3821 1060 1748 38 3492 1320 55 1,85E‐01 1,00E+00‐ MAP3822 180 622 14 615 461 19 3,52E‐01 1,00E+00‐ MAP3823 884 1102 46 1950 1253 69 1,63E‐01 1,00E+00‐ MAP3824 2465 2048 98 6472 1139 117 5,52E‐01 1,00E+00udgA MAP3825 0 23 0 128 51 3 7,13E‐06 1,00E+00‐ MAP3826 279 629 30 593 131 18 3,07E‐01 1,00E+00‐ MAP3827 1232 1191 201 1514 903 181 9,14E‐01 1,00E+00rmlA MAP3828 1192 1736 95 2143 1045 91 9,72E‐01 1,00E+00‐ MAP3829c 41 101 3 406 110 9 6,17E‐02 1,00E+00aspC MAP3830c 4284 6807 244 8140 3814 230 9,77E‐01 1,00E+00‐ MAP3831c 7168 10309 173 11269 4083 126 4,03E‐01 1,00E+00‐ MAP3832c 784 1326 35 1472 588 29 6,96E‐01 1,00E+00‐ MAP3833c 1988 2511 165 3020 808 109 2,30E‐01 1,00E+00‐ MAP3834 153 298 8 587 51 8 9,52E‐01 1,00E+00‐ MAP3835c 1015 2528 120 1612 707 69 1,15E‐01 1,00E+00‐ MAP3836c 4863 9957 179 8311 4799 146 4,92E‐01 1,00E+00‐ predicted RNA 4331 6216 7753 6455 3602 6690 8,45E‐01 1,00E+00lpqJ MAP3837c 3540 6914 490 4483 2774 319 2,71E‐01 1,00E+00‐ MAP3838c 48 199 10 202 0 5 3,72E‐01 1,00E+00‐ MAP3839c 51 268 14 153 102 11 2,43E‐01 1,00E+00dnaK MAP3840 27882 29562 891 49317 17680 845 2,37E‐01 1,00E+00grpE MAP3841 3050 3321 270 6354 1966 279 7,73E‐01 1,00E+00

281









‐ predicted RNA 3551 4236 6617 3963 2036 4496 1,73E‐01 1,00E+00dnaJ MAP3842 6474 6833 327 10668 3293 271 5,19E‐01 1,00E+00hspR MAP3843 1671 3093 341 3144 1517 295 7,23E‐01 1,00E+00‐ MAP3844 1301 1280 17 1421 325 8 6,85E‐02 1,00E+00‐ MAP3845 304 338 23 646 306 29 4,58E‐01 1,00E+00idsA MAP3846 153 400 13 634 153 14 7,18E‐01 1,00E+00‐ MAP3847 24 98 12 51 0 3 7,23E‐02 1,00E+00‐ MAP3848 469 656 31 929 152 21 4,47E‐01 1,00E+00‐ MAP3849 801 1123 17 761 506 11 2,65E‐01 1,00E+00‐ MAP3850c 254 100 11 351 251 18 2,40E‐01 1,00E+00‐ MAP3851c 242 295 13 354 50 6 1,78E‐01 1,00E+00‐ MAP3852c 253 283 26 563 139 26 9,08E‐01 1,00E+00clpB MAP3853 5468 7271 143 12142 4726 159 5,62E‐01 1,00E+00‐ MAP3854 1509 1694 72 1960 1269 67 9,68E‐01 1,00E+00‐ MAP3855 2527 3745 205 5516 1570 183 7,24E‐01 1,00E+00‐ MAP3856 1016 455 57 1398 525 59 7,99E‐01 1,00E+00pyrE MAP3857 362 277 34 479 299 38 7,53E‐01 1,00E+00‐ MAP3858 604 356 31 399 145 14 7,35E‐02 1,00E+00‐ MAP3859 101 308 17 317 215 21 4,83E‐01 1,00E+00‐ MAP3860 530 564 26 751 181 17 3,37E‐01 1,00E+00scoB MAP3861 3079 4049 151 5414 2468 145 9,93E‐01 1,00E+00‐ MAP3862c 968 1683 108 2373 853 110 8,39E‐01 1,00E+00‐ MAP3863c 2596 2610 171 6067 1838 204 4,50E‐01 1,00E+00‐ MAP3864 408 601 62 1415 403 88 2,43E‐01 1,00E+00‐ MAP3865c 51 0 1 51 142 7 3,82E‐02 1,00E+00‐ MAP3866c 25 51 2 46 51 3 5,45E‐01 1,00E+00‐ MAP3867c 68 0 3 102 102 8 1,66E‐01 1,00E+00‐ MAP3868 225 689 27 518 116 14 1,81E‐01 1,00E+00purA MAP3869 1346 1910 71 2942 1230 78 6,60E‐01 1,00E+00purT MAP3871 240 89 7 301 253 12 2,17E‐01 1,00E+00

282









‐ MAP3872 160 264 27 503 42 23 8,74E‐01 1,00E+00metZ MAP3873 559 582 27 973 733 38 2,58E‐01 1,00E+00‐ MAP3874c 1489 1310 56 2008 615 41 4,78E‐01 1,00E+00‐ MAP3875c 334 819 52 917 309 46 9,50E‐01 1,00E+00‐ MAP3876c 1136 1041 95 854 472 51 1,19E‐01 1,00E+00fadE20_3 MAP3877c 2854 3639 162 5191 1852 144 7,32E‐01 1,00E+00fadE7 MAP3878c 4935 5957 262 7875 3342 229 8,66E‐01 1,00E+00‐ MAP3879c 2328 3048 201 4219 1793 191 8,93E‐01 1,00E+00‐ MAP3880 336 146 38 455 151 37 9,43E‐01 1,00E+00‐ MAP3881 97 51 4 103 0 1 7,73E‐01 1,00E+00‐ MAP3882 239 51 17 500 102 24 2,78E‐01 1,00E+00‐ MAP3883c 330 290 24 357 355 28 6,67E‐01 1,00E+00‐ MAP3884 2787 3402 176 3893 1782 139 4,42E‐01 1,00E+00pta MAP3885 707 1199 25 1060 302 14 1,81E‐01 1,00E+00ackA MAP3886 839 740 39 1481 331 33 8,05E‐01 1,00E+00‐ MAP3887c 260 490 19 532 253 18 9,25E‐01 1,00E+00‐ MAP3888c 100 152 5 204 0 2 2,41E‐01 1,00E+00‐ MAP3889 0 0 0 0 0 0 1,00E+00 1,00E+00mmpL4_6 MAP3890 187 295 4 222 101 2 2,57E‐01 1,00E+00‐ MAP3892 51 51 3 62 0 1 8,82E‐01 1,00E+00pknG MAP3893c 3767 4799 107 5964 2797 95 8,53E‐01 1,00E+00glnH MAP3894c 2612 2592 162 4323 1761 158 9,55E‐01 1,00E+00‐ MAP3895c 4289 4147 186 7776 2448 178 9,68E‐01 1,00E+00mutT3 MAP3896 1142 1044 99 1441 806 90 9,26E‐01 1,00E+00thiE MAP3897c 51 0 2 122 0 3 5,40E‐01 1,00E+00‐ MAP3898 1517 1185 73 2864 951 82 5,92E‐01 1,00E+00‐ MAP3899 287 361 94 717 100 83 8,62E‐01 1,00E+00thiG MAP3900 285 684 35 817 0 18 1,48E‐01 1,00E+00‐ MAP3901 51 136 7 285 151 15 1,58E‐01 1,00E+00‐ MAP3903c 777 876 89 1446 184 60 4,13E‐01 1,00E+00

283









‐ MAP3904 2509 3055 482 4475 1416 407 6,15E‐01 1,00E+00‐ MAP3905 1399 1121 173 1607 723 135 5,92E‐01 1,00E+00lpqL_1 MAP3906 2751 2702 106 3357 1450 78 3,97E‐01 1,00E+00lpqL_2 MAP3907 175 850 19 556 417 18 8,85E‐01 1,00E+00lpqM MAP3908 961 1498 48 1747 510 35 4,45E‐01 1,00E+00‐ MAP3909c 272 142 14 354 253 18 4,05E‐01 1,00E+00‐ MAP3910c 83 50 11 0 0 0 1,00E+00 1,00E+00‐ MAP3911c 102 153 11 102 0 2 5,25E‐02 1,00E+00thiD MAP3912c 179 525 23 376 51 10 8,16E‐02 1,00E+00thiC MAP3913c 4850 6804 206 9087 3970 198 9,55E‐01 1,00E+00‐ MAP3914c 1651 1805 359 3339 1307 400 6,41E‐01 1,00E+00‐ MAP3915c 607 707 84 1395 419 92 6,95E‐01 1,00E+00‐ predicted RNA 975 1502 4425 857 800 3003 3,34E‐01 1,00E+00xthA MAP3916c 255 47 11 318 153 14 4,18E‐01 1,00E+00‐ MAP3917c 0 89 2 78 49 4 5,53E‐01 1,00E+00def MAP3918c 373 349 35 354 254 28 6,67E‐01 1,00E+00‐ MAP3919 1813 1563 320 3330 1456 381 5,12E‐01 1,00E+00‐ MAP3920 1158 1719 172 2779 1017 188 6,38E‐01 1,00E+00sodC MAP3921 3007 2676 243 4951 1347 206 6,08E‐01 1,00E+00‐ MAP3922 443 1211 39 1550 693 47 5,10E‐01 1,00E+00‐ MAP3923 304 338 28 557 51 18 3,47E‐01 1,00E+00‐ MAP3924 289 406 19 794 408 29 1,98E‐01 1,00E+00echA8_2 MAP3925 177 379 19 357 153 15 7,07E‐01 1,00E+00‐ MAP3926c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP3927 50 0 2 0 0 0 1,00E+00 1,00E+00‐ MAP3928c 388 646 13 965 149 10 6,61E‐01 1,00E+00pssA MAP3929c 549 352 30 538 305 25 7,61E‐01 1,00E+00psd MAP3930c 149 251 15 474 0 11 5,18E‐01 1,00E+00‐ MAP3931 72 77 3 284 128 8 1,42E‐01 1,00E+00moaA3 MAP3932c 193 511 16 560 254 16 8,87E‐01 1,00E+00

284









‐ MAP3933c 357 392 23 457 254 19 7,76E‐01 1,00E+00‐ MAP3935 387 138 21 605 360 34 1,80E‐01 1,00E+00groEL MAP3936 12529 6202 344 26791 5707 428 1,75E‐01 1,00E+00‐ MAP3937 212 100 11 201 152 12 7,22E‐01 1,00E+00‐ MAP3938c 860 351 92 863 272 66 5,24E‐01 1,00E+00‐ MAP3939c 641 926 69 769 370 44 3,39E‐01 1,00E+00‐ MAP3940c 2676 3073 96 5063 1560 87 7,83E‐01 1,00E+00gloA MAP3941 93 51 11 65 0 3 8,34E‐02 1,00E+00‐ MAP3942 550 944 82 1522 373 80 9,04E‐01 1,00E+00‐ MAP3943 101 30 5 101 12 2 5,94E‐01 1,00E+00‐ MAP3944c 0 153 2 213 153 5 1,26E‐01 1,00E+00‐ MAP3945 196 424 25 482 92 17 4,80E‐01 1,00E+00‐ MAP3946 304 538 46 561 171 32 4,75E‐01 1,00E+00mmpL4_7 MAP3947 2709 3142 57 4126 2011 52 7,85E‐01 1,00E+00‐ MAP3948c 12644 11233 1940 20155 8627 1959 3,57E‐01 1,00E+00echA2 MAP3949c 562 1516 63 1457 894 68 7,07E‐01 1,00E+00‐ MAP3952 14172 13617 531 24257 8408 503 3,78E‐01 1,00E+00‐ MAP3953 195 274 27 467 122 27 9,35E‐01 1,00E+00‐ MAP3954 49 129 17 101 0 6 8,04E‐01 1,00E+00‐ MAP3955 194 482 33 995 420 60 8,14E‐02 1,00E+00‐ MAP3956 3932 4394 186 7301 2269 169 9,07E‐01 1,00E+00‐ MAP3957 29 15 4 71 0 4 5,19E‐01 1,00E+00‐ MAP3958c 579 782 70 885 624 73 7,62E‐01 1,00E+00‐ MAP3959c 1109 935 39 1551 633 34 8,38E‐01 1,00E+00‐ MAP3960 1137 1074 81 1924 876 87 6,98E‐01 1,00E+00aceA MAP3961 153 260 9 257 204 9 7,05E‐01 1,00E+00fadB2 MAP3962 1172 1033 74 2235 356 61 6,82E‐01 1,00E+00umaA1 MAP3963 2188 1871 138 3036 1037 110 5,75E‐01 1,00E+00umaA2 MAP3964c 7493 5660 446 12232 4298 448 8,78E‐01 1,00E+00‐ MAP3965c 1532 1836 137 2943 1761 175 3,91E‐01 1,00E+00

285









‐ MAP3966 1942 2219 87 3768 1067 79 8,36E‐01 1,00E+00‐ MAP3967 1552 1854 235 3902 1478 308 3,57E‐01 1,00E+00‐ MAP3968 2295 2318 228 4225 1101 201 7,58E‐01 1,00E+00‐ MAP3969 439 406 93 877 564 146 1,68E‐01 1,00E+00‐ MAP3970 244 153 27 255 202 30 7,23E‐01 1,00E+00deoC MAP3971 74 289 14 420 51 13 9,72E‐01 1,00E+00‐ MAP3972c 4986 8122 353 9071 3544 286 5,15E‐01 1,00E+00‐ MAP3973c 985 475 53 1187 355 42 7,10E‐01 1,00E+00‐ MAP3974c 132 204 18 397 102 21 5,71E‐01 1,00E+00murB MAP3975 0 51 1 49 0 0 5,52E‐01 1,00E+00‐ MAP3976 839 1494 49 2261 858 55 6,20E‐01 1,00E+00‐ MAP3977c 693 565 49 762 218 29 2,37E‐01 1,00E+00‐ MAP3979 810 459 28 1554 558 37 3,75E‐01 1,00E+00‐ MAP3980 2033 3382 302 4991 1544 294 9,51E‐01 1,00E+00gpmA MAP3981 1249 2726 149 2839 810 109 3,97E‐01 1,00E+00senX3 MAP3982 2959 3339 148 4629 1361 110 3,41E‐01 1,00E+00regX3 MAP3983 1723 2242 166 2986 1298 154 8,92E‐01 1,00E+00‐ MAP3984c 152 189 19 355 102 20 7,33E‐01 1,00E+00‐ MAP3985c 102 145 7 152 50 4 6,86E‐01 1,00E+00‐ MAP3986c 1524 2336 137 3401 1420 146 7,87E‐01 1,00E+00‐ MAP3987 5919 6417 351 13575 4344 407 4,30E‐01 1,00E+00‐ MAP3988 2175 3640 170 5163 2074 180 7,57E‐01 1,00E+00‐ MAP3989 461 921 46 1067 407 41 9,36E‐01 1,00E+00‐ MAP3990 282 1003 42 1042 344 38 9,62E‐01 1,00E+00proC MAP3991 156 479 19 674 310 27 3,41E‐01 1,00E+00‐ MAP3992 5841 5832 1317 11188 4320 1442 5,48E‐01 1,00E+00‐ predicted RNA 20348 22535 17755 33434 13353 16147 3,64E‐01 1,00E+00galE1 MAP3993 6636 8639 389 16177 6794 497 3,10E‐01 1,00E+00‐ MAP3994 4733 5309 273 9071 4334 315 5,25E‐01 1,00E+00cmaA2 MAP3995c 27880 23849 1684 47617 13350 1526 2,62E‐01 1,00E+00

286









‐ MAP3996c 17325 12899 1696 35486 7969 1792 2,33E‐01 1,00E+00serB MAP3997c 1101 1516 82 2701 681 81 8,74E‐01 1,00E+00‐ MAP3998c 16211 21403 405 28175 12039 369 4,50E‐01 1,00E+00‐ MAP3999c 584 330 99 792 372 106 6,71E‐01 1,00E+00‐ MAP4000c 149 327 39 239 51 18 1,28E‐01 1,00E+00‐ MAP4001 262 214 51 466 51 37 5,67E‐01 1,00E+00hemA MAP4002 2280 3196 113 4498 1723 107 8,85E‐01 1,00E+00hemC MAP4003 3088 3900 212 5978 2191 204 9,81E‐01 1,00E+00cysG MAP4004 5189 7365 217 12411 4161 232 6,37E‐01 1,00E+00hemB MAP4005 1561 1854 100 2481 1302 98 9,16E‐01 1,00E+00‐ MAP4006 1229 1777 144 2270 1060 139 9,50E‐01 1,00E+00‐ MAP4007c 4723 6298 718 7648 3667 644 9,19E‐01 1,00E+00‐ MAP4008 2881 3428 138 4621 2110 127 8,22E‐01 1,00E+00‐ MAP4009 1135 1721 110 2821 829 112 8,24E‐01 1,00E+00‐ MAP4010c 974 1633 34 1280 923 27 6,91E‐01 1,00E+00‐ MAP4011c 2471 3014 165 4347 1954 163 9,90E‐01 1,00E+00‐ MAP4012c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP4013 4364 3286 116 11569 1744 140 5,14E‐01 1,00E+00‐ MAP4014 149 285 12 152 101 7 2,03E‐01 1,00E+00‐ MAP4015 0 0 0 49 51 9 0,00E+00 1,00E+00‐ MAP4016c 203 426 19 548 81 13 5,33E‐01 1,00E+00‐ MAP4017c 394 268 16 359 273 14 8,81E‐01 1,00E+00‐ MAP4018c 1192 1387 173 2399 407 135 5,93E‐01 1,00E+00‐ MAP4019 713 888 132 1780 604 160 4,97E‐01 1,00E+00hemL MAP4020 239 540 16 859 321 21 4,14E‐01 1,00E+00‐ MAP4022 348 228 28 239 133 16 2,37E‐01 1,00E+00ccsA MAP4023 159 140 11 585 71 16 2,52E‐01 1,00E+00‐ MAP4024 356 253 10 699 301 14 3,59E‐01 1,00E+00ccsB MAP4025 3205 3837 208 4966 2084 175 6,17E‐01 1,00E+00‐ predicted RNA 2601 3419 5587 4898 2138 5586 9,13E‐01 1,00E+00

287









‐ MAP4026 2645 2676 118 4819 1843 122 8,87E‐01 1,00E+00‐ MAP4027 27 0 2 153 0 7 1,36E‐01 1,00E+00fabH MAP4028c 2109 2559 133 3674 1042 105 5,46E‐01 1,00E+00menA MAP4029c 590 514 37 1286 584 53 2,44E‐01 1,00E+00pnp MAP4030 255 450 25 490 102 16 3,45E‐01 1,00E+00‐ MAP4031 35 237 15 315 51 15 4,67E‐01 1,00E+00‐ MAP4032 0 0 0 51 0 1 0,00E+00 1,00E+00‐ MAP4033c 271 531 13 1042 66 11 8,99E‐01 1,00E+00‐ MAP4034 1077 887 34 1422 492 26 5,96E‐01 1,00E+00‐ MAP4035 15 15 1 24 55 4 1,34E‐01 1,00E+00‐ MAP4036 0 48 1 0 50 3 5,66E‐01 1,00E+00‐ MAP4037c 325 273 12 212 98 5 9,29E‐02 1,00E+00menE MAP4038c 383 293 18 618 305 21 6,09E‐01 1,00E+00‐ MAP4039c 826 1047 178 1768 462 163 9,21E‐01 1,00E+00‐ MAP4040c 288 559 77 526 315 71 9,54E‐01 1,00E+00pitA MAP4041c 2924 3282 141 5618 1699 131 8,60E‐01 1,00E+00‐ MAP4042c 1713 1901 256 2806 1091 229 8,48E‐01 1,00E+00‐ MAP4043c 823 1434 71 2373 406 64 8,85E‐01 1,00E+00menB MAP4044c 1061 1569 83 3046 760 92 6,13E‐01 1,00E+00‐ MAP4045c 78 135 35 243 78 43 6,67E‐01 1,00E+00‐ MAP4046c 68 3 2 126 28 3 5,59E‐01 1,00E+00‐ MAP4047 50 94 6 150 102 10 7,35E‐01 1,00E+00fadD8 MAP4048c 106 101 3 506 0 5 3,35E‐01 1,00E+00‐ MAP4049 102 51 2 100 202 5 1,66E‐01 1,00E+00menC MAP4050 0 0 0 6 2 0 1,14E‐06 1,00E+00bpoC_2 MAP4051 191 244 15 152 151 11 5,36E‐01 1,00E+00menD MAP4052 772 685 26 559 359 14 2,04E‐01 1,00E+00‐ MAP4053 153 294 24 457 285 37 2,46E‐01 1,00E+00‐ MAP4054 90 51 3 101 0 1 6,50E‐01 1,00E+00ubiE MAP4055 203 492 28 731 102 24 8,14E‐01 1,00E+00

288









‐ MAP4056c 3414 5246 629 6697 2376 544 7,90E‐01 1,00E+00‐ MAP4057c 151 250 9 647 99 12 4,09E‐01 1,00E+00grcC1 MAP4058 556 406 28 866 333 28 7,67E‐01 1,00E+00htpX MAP4059 512 675 39 635 536 38 8,86E‐01 1,00E+00‐ MAP4060c 22228 22809 852 42176 15786 899 1,90E‐01 1,00E+00gpsA MAP4061c 2299 2413 137 3699 1288 117 6,95E‐01 1,00E+00‐ MAP4062c 3297 3703 133 5191 1906 110 5,57E‐01 1,00E+00‐ MAP4063c 2486 1917 263 4073 1068 232 7,67E‐01 1,00E+00‐ MAP4064c 192 192 11 273 120 10 8,91E‐01 1,00E+00‐ MAP4066 999 532 37 1205 480 33 9,00E‐01 1,00E+00‐ MAP4067c 229 247 10 480 177 11 6,79E‐01 1,00E+00‐ MAP4068c 0 59 1 0 137 4 8,81E‐02 1,00E+00‐ MAP4070c 130 0 1 269 1 2 5,11E‐01 1,00E+00galT MAP4071 439 344 20 431 51 8 5,66E‐02 1,00E+00galK MAP4072 11 12 0 178 51 4 5,03E‐07 1,00E+00‐ MAP4073 101 51 7 102 0 2 8,78E‐01 1,00E+00‐ MAP4074 555 640 55 858 382 49 9,35E‐01 1,00E+00lpqN MAP4075c 203 202 17 356 102 15 9,16E‐01 1,00E+00‐ MAP4076 97 71 1 254 245 5 4,35E‐02 1,00E+00‐ MAP4077c 204 256 5 346 255 6 5,18E‐01 1,00E+00‐ MAP4078 744 961 50 1423 576 50 9,19E‐01 1,00E+00‐ MAP4079 160 46 4 100 204 7 2,55E‐01 1,00E+00‐ MAP4080c 101 153 27 217 84 27 4,99E‐01 1,00E+00‐ MAP4081 264 199 19 342 152 17 9,22E‐01 1,00E+00‐ MAP4082 299 101 15 139 139 10 4,40E‐01 1,00E+00‐ MAP4083 276 115 13 420 2 8 2,85E‐01 1,00E+00mce2 MAP4084 195 396 14 563 77 11 6,43E‐01 1,00E+00‐ MAP4085 407 165 16 408 50 8 1,77E‐01 1,00E+00‐ MAP4086 153 460 11 355 203 10 8,10E‐01 1,00E+00‐ MAP4087 93 204 5 202 204 7 2,68E‐01 1,00E+00

289









lprL MAP4088 144 367 12 343 101 8 5,22E‐01 1,00E+00‐ MAP4089 51 359 7 218 51 3 1,96E‐01 1,00E+00‐ MAP4090c 0 0 0 0 0 0 1,00E+00 1,00E+00recD MAP4091c 0 51 0 51 0 0 5,64E‐01 1,00E+00‐ MAP4092c 0 0 0 10 51 1 0,00E+00 1,00E+00‐ MAP4093c 51 200 6 304 102 8 3,26E‐01 1,00E+00recC MAP4094c 736 945 14 1361 420 12 7,85E‐01 1,00E+00mmaA2 MAP4095c 1074 1407 82 3154 850 103 3,81E‐01 1,00E+00‐ MAP4096 377 202 33 483 356 44 4,04E‐01 1,00E+00‐ MAP4097 350 478 30 664 254 28 9,52E‐01 1,00E+00‐ MAP4098 263 188 29 777 71 35 4,85E‐01 1,00E+00‐ MAP4099 700 625 37 1533 456 44 5,73E‐01 1,00E+00‐ MAP4100c 108 0 7 226 0 8 5,10E‐01 1,00E+00‐ MAP4101c 334 102 7 822 102 10 3,83E‐01 1,00E+00echA3 MAP4102c 1489 3374 105 2839 1843 97 8,34E‐01 1,00E+00‐ MAP4103c 3786 4878 295 5978 1784 209 3,17E‐01 1,00E+00‐ MAP4104c 2015 2810 193 3280 1335 156 5,85E‐01 1,00E+00‐ MAP4105 443 527 121 1140 585 190 1,48E‐01 1,00E+00rpmG MAP4106 5610 7063 2174 10272 3765 1983 8,17E‐01 1,00E+00‐ MAP4107 7628 13161 1232 16288 5646 1072 9,89E‐01 1,00E+00‐ MAP4108 6015 5707 797 10936 4263 851 6,25E‐01 1,00E+00‐ MAP4109 1304 2378 207 2722 1292 199 9,80E‐01 1,00E+00secE MAP4110 9046 10003 1243 13883 5229 1027 8,71E‐01 1,00E+00nusG MAP4111 6340 8310 546 11163 3543 439 4,51E‐01 1,00E+00rplK MAP4112 10463 10933 1449 17173 6106 1280 9,11E‐01 1,00E+00rplA MAP4113 3043 3397 263 7098 1567 264 8,59E‐01 1,00E+00‐ MAP4114c 51 208 5 225 51 4 4,44E‐01 1,00E+00‐ MAP4115c 690 621 56 750 177 29 1,14E‐01 1,00E+00mmaA4 MAP4116c 6156 8489 468 10705 5990 483 7,91E‐01 1,00E+00mmaA1 MAP4117c 2572 3755 210 6023 2076 220 7,38E‐01 1,00E+00

290









‐ MAP4119c 2302 4944 150 4757 1514 106 2,24E‐01 1,00E+00‐ MAP4120c 765 958 81 1268 407 63 6,33E‐01 1,00E+00‐ MAP4121 401 392 5 652 150 4 5,86E‐01 1,00E+00fabD2 MAP4122 34 0 1 147 51 7 2,47E‐02 1,00E+00‐ MAP4123 259 148 13 564 101 15 6,41E‐01 1,00E+00‐ MAP4124 381 96 32 351 205 32 8,97E‐01 1,00E+00rplJ MAP4125 16298 21047 1819 32425 15748 2052 1,21E‐01 1,00E+00rplL MAP4126 271 263 39 599 118 38 9,42E‐01 1,00E+00‐ MAP4127c 0 95 3 148 0 3 4,96E‐01 1,00E+00‐ MAP4128 200 50 5 163 0 1 1,44E‐01 1,00E+00‐ MAP4129 25836 33044 1677 47822 17822 1546 2,50E‐01 1,00E+00rpoB MAP4130 37834 44512 661 72615 23256 615 2,88E‐01 1,00E+00rpoC MAP4131 36442 38363 549 72611 18746 513 2,83E‐01 1,00E+00end MAP4132 2444 2379 185 3821 1895 191 9,15E‐01 1,00E+00fadE8 MAP4133 2191 3145 95 3746 1880 89 8,45E‐01 1,00E+00echA4 MAP4134 244 364 18 593 135 16 9,20E‐01 1,00E+00‐ MAP4135 87 299 14 250 178 16 6,94E‐01 1,00E+00echA5 MAP4136 147 343 17 253 99 11 3,20E‐01 1,00E+00‐ MAP4137c 2747 3423 366 5291 1681 330 7,62E‐01 1,00E+00‐ MAP4139 304 511 36 812 272 39 6,99E‐01 1,00E+00rpsL MAP4140 17610 29465 3576 31806 15192 3144 3,86E‐01 1,00E+00rpsG MAP4141 18568 27184 2782 34827 14587 2559 2,74E‐01 1,00E+00fusA MAP4142 56192 85917 1929 109480 43947 1761 2,83E‐01 1,00E+00tuf MAP4143 29431 31625 1487 51858 14498 1254 2,93E‐01 1,00E+00‐ MAP4144 711 1040 81 1635 489 78 9,65E‐01 1,00E+00‐ MAP4145 20760 22906 1490 33945 13724 1359 3,35E‐01 1,00E+00fabG MAP4146 2266 2328 161 4420 1443 164 9,40E‐01 1,00E+00‐ MAP4147 587 1239 43 1733 506 42 9,23E‐01 1,00E+00‐ MAP4148c 637 788 49 1135 507 49 8,88E‐01 1,00E+00‐ MAP4149 0 253 7 259 97 9 3,76E‐01 1,00E+00

291









‐ MAP4150c 28 198 5 257 0 4 7,98E‐01 1,00E+00‐ predicted RNA 3963 1909 4630 7566 1589 5158 5,82E‐01 1,00E+00‐ MAP4152 1071 580 149 2242 997 242 1,04E‐01 1,00E+00pqqE MAP4153 2494 1687 101 5309 1196 115 6,90E‐01 1,00E+00lldD1 MAP4154 4226 3460 190 10719 2199 232 4,89E‐01 1,00E+00‐ MAP4155 1239 481 70 1591 195 48 4,05E‐01 1,00E+00‐ MAP4156 298 773 45 755 267 36 7,44E‐01 1,00E+00‐ MAP4157 1727 1961 141 3003 1267 138 9,51E‐01 1,00E+00‐ MAP4159 393 629 53 658 305 43 7,93E‐01 1,00E+00rpsJ MAP4160 6311 9900 1513 11159 5096 1319 8,15E‐01 1,00E+00rplC MAP4161 7456 9086 730 10355 4549 561 4,88E‐01 1,00E+00rplD MAP4162 1862 2457 190 3693 1176 171 8,24E‐01 1,00E+00rplW MAP4163 7277 8182 1477 10429 4674 1233 6,31E‐01 1,00E+00rplB MAP4164 4704 5957 364 6935 3504 314 8,46E‐01 1,00E+00rpsS MAP4165 7871 7051 1547 10052 3739 1164 3,19E‐01 1,00E+00rplV MAP4166 6105 6149 656 11007 3501 616 9,26E‐01 1,00E+00rpsC MAP4167 5721 6445 417 12311 2888 393 9,43E‐01 1,00E+00rplP MAP4168 7034 6584 953 11937 3975 888 8,75E‐01 1,00E+00rpmC MAP4169 12917 13831 3317 22320 8795 3203 3,66E‐01 1,00E+00rpsQ MAP4170 8722 9354 1481 14516 5406 1340 9,38E‐01 1,00E+00atsA MAP4171 2335 2542 59 3413 1391 49 6,14E‐01 1,00E+00phoS2_3 MAP4172c 0 0 0 49 0 0 1,81E‐119 1,00E+00‐ MAP4173 1363 1283 81 1845 399 51 2,22E‐01 1,00E+00‐ MAP4175 51 102 4 102 0 1 1,91E‐01 1,00E+00‐ MAP4176 152 148 5 457 249 12 8,65E‐02 1,00E+00rplN MAP4177 3047 2897 469 4611 2155 457 9,96E‐01 1,00E+00rplX MAP4178 8482 7627 1481 11681 4554 1227 6,87E‐01 1,00E+00rplE MAP4179 9023 13196 1128 16531 6744 1001 8,68E‐01 1,00E+00rpsN MAP4180 10767 12567 3628 17443 7305 3246 7,65E‐01 1,00E+00rpsH MAP4181 4393 3316 569 6097 2628 536 9,70E‐01 1,00E+00

292









rplF MAP4182 8315 8071 884 12072 3739 672 4,54E‐01 1,00E+00rplR MAP4183 5768 6289 857 10018 3010 728 7,10E‐01 1,00E+00rpsE MAP4184 3191 3161 274 6405 1846 276 8,38E‐01 1,00E+00rpmD MAP4185 750 748 201 1079 549 191 9,67E‐01 1,00E+00rplO MAP4186 3524 4490 523 8435 2190 535 8,37E‐01 1,00E+00‐ MAP4187c 631 852 45 942 337 32 5,01E‐01 1,00E+00sppA MAP4188 671 388 17 1133 630 25 2,29E‐01 1,00E+00‐ MAP4189c 204 147 11 220 51 6 2,39E‐01 1,00E+00‐ MAP4190c 257 306 17 350 123 12 4,72E‐01 1,00E+00‐ MAP4191c 284 610 23 907 397 29 4,04E‐01 1,00E+00adh MAP4192 157 318 10 225 110 6 3,48E‐01 1,00E+00fucA MAP4193c 102 209 13 204 151 14 5,66E‐01 1,00E+00‐ MAP4194c 102 180 8 405 102 11 2,79E‐01 1,00E+00xylB MAP4195 179 359 11 152 212 8 6,21E‐01 1,00E+00‐ MAP4196 3792 6023 420 8453 2409 368 8,61E‐01 1,00E+00‐ MAP4197c 0 51 1 408 0 7 9,37E‐03 1,00E+00‐ predicted RNA 921 1205 4706 1808 778 4881 7,77E‐01 1,00E+00secY MAP4198 5983 8470 312 8840 5498 287 8,49E‐01 1,00E+00adk MAP4199 1533 2607 215 3097 917 167 5,07E‐01 1,00E+00map' MAP4200 1538 1856 122 1940 969 91 4,72E‐01 1,00E+00sigL MAP4201 603 1310 98 2153 1000 144 2,02E‐01 1,00E+00‐ MAP4202 735 846 64 1960 721 89 2,55E‐01 1,00E+00‐ MAP4204 51 39 4 154 51 8 1,65E‐01 1,00E+00‐ MAP4205 0 0 0 204 100 12 0,00E+00 1,00E+00‐ MAP4206c 228 205 5 509 152 6 5,83E‐01 1,00E+00‐ MAP4207c 102 204 12 453 202 23 1,30E‐01 1,00E+00‐ MAP4208 148 451 9 355 256 9 9,01E‐01 1,00E+00‐ MAP4210 153 204 10 51 200 8 9,56E‐01 1,00E+00‐ MAP4211 51 96 3 50 101 4 5,18E‐01 1,00E+00‐ MAP4212 241 102 20 302 253 31 2,49E‐01 1,00E+00

293









mmsB MAP4213c 102 277 11 304 275 18 2,24E‐01 1,00E+00fadE9 MAP4214c 509 443 24 920 617 35 1,94E‐01 1,00E+00mmsA MAP4215c 481 259 14 650 204 12 8,55E‐01 1,00E+00‐ MAP4216 325 687 20 747 288 17 9,10E‐01 1,00E+00‐ MAP4217 255 246 27 710 153 34 5,11E‐01 1,00E+00‐ MAP4218 102 40 6 153 0 3 5,72E‐01 1,00E+00‐ MAP4219 0 51 3 0 25 2 5,43E‐01 1,00E+00‐ MAP4220 49 202 7 355 79 10 3,31E‐01 1,00E+00‐ MAP4221c 782 831 35 1043 238 20 2,46E‐01 1,00E+00atfA_1 MAP4222c 3439 5026 211 6989 2929 211 8,80E‐01 1,00E+00atfA_2 MAP4223c 7559 8774 419 13704 5799 423 7,66E‐01 1,00E+00rmlC MAP4224c 724 1278 93 1571 842 102 6,71E‐01 1,00E+00rmlB MAP4225c 3690 5658 268 4815 2721 196 4,47E‐01 1,00E+00‐ MAP4226c 633 353 33 827 335 32 8,75E‐01 1,00E+00‐ MAP4227c 262 528 26 530 286 24 9,67E‐01 1,00E+00infA MAP4228 12070 16497 3696 22315 9754 3556 3,46E‐01 1,00E+00rpmJ MAP4229 11922 15860 7009 25804 8979 7167 2,71E‐01 1,00E+00rpsM MAP4230 11919 12537 1894 17810 5657 1443 8,27E‐01 1,00E+00rpsK MAP4231 5393 7900 913 10617 4095 846 8,54E‐01 1,00E+00rpsD MAP4232 5163 7668 606 10636 3575 547 7,81E‐01 1,00E+00rpoA MAP4233 9190 10697 550 15191 5648 475 9,81E‐01 1,00E+00rplQ MAP4234 3499 4664 418 6568 1978 347 6,67E‐01 1,00E+00truA MAP4235 256 400 24 770 203 28 6,53E‐01 1,00E+00‐ MAP4236c 1706 2214 177 2628 1290 155 7,78E‐01 1,00E+00‐ MAP4237c 5567 4630 343 10136 2592 324 9,75E‐01 1,00E+00‐ MAP4238 0 50 0 100 0 1 5,31E‐01 1,00E+00‐ MAP4239c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP4240c 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP4241 0 0 0 51 0 0 0,00E+00 1,00E+00‐ MAP4242 49 0 1 0 0 0 1,00E+00 1,00E+00

294









‐ MAP4243 444 746 106 700 365 85 7,50E‐01 1,00E+00‐ MAP4244 151 666 75 486 235 61 6,88E‐01 1,00E+00rplM MAP4245 3709 5136 571 7380 2592 528 9,60E‐01 1,00E+00rpsI MAP4246 734 1431 122 2251 528 121 8,85E‐01 1,00E+00glmM MAP4247 597 1081 35 1380 459 32 9,08E‐01 1,00E+00‐ MAP4248 0 0 0 74 55 10 0,00E+00 1,00E+00‐ MAP4249 0 86 1 252 0 3 6,26E‐01 1,00E+00‐ MAP4250c 1007 1730 74 1613 956 64 8,34E‐01 1,00E+00‐ MAP4251c 713 830 53 928 315 34 3,70E‐01 1,00E+00‐ MAP4252c 0 0 0 0 0 0 1,00E+00 1,00E+00glmS MAP4253 2533 4290 103 4923 2128 92 7,65E‐01 1,00E+00‐ MAP4254 948 905 60 1768 469 55 9,31E‐01 1,00E+00‐ MAP4255 457 590 41 440 203 21 1,61E‐01 1,00E+00‐ MAP4256 194 291 9 393 249 12 5,44E‐01 1,00E+00gadB MAP4257 1265 1372 54 2807 1135 68 3,75E‐01 1,00E+00alr MAP4258 1029 1146 53 2162 508 49 9,54E‐01 1,00E+00‐ MAP4259 756 661 41 866 458 33 7,48E‐01 1,00E+00‐ MAP4260 248 0 16 356 0 12 4,00E‐01 1,00E+00‐ MAP4261 30 77 4 112 51 6 5,35E‐01 1,00E+00rimI MAP4262 232 595 49 451 102 25 1,51E‐01 1,00E+00gcp MAP4263 151 229 10 600 153 16 2,48E‐01 1,00E+00groES MAP4264 6044 2407 841 8805 2417 831 8,94E‐01 1,00E+00groEL MAP4265 1848 638 46 4395 1028 73 1,05E‐01 1,00E+00‐ MAP4266 1813 3276 94 4090 1867 96 9,22E‐01 1,00E+00‐ MAP4267 1226 770 163 1619 521 136 7,16E‐01 1,00E+00‐ MAP4268c 10097 8104 1730 16205 5793 1681 7,71E‐01 1,00E+00‐ MAP4269c 7744 9221 1210 12187 5712 1104 9,76E‐01 1,00E+00‐ MAP4270 22460 24858 1979 35380 11097 1543 8,21E‐01 1,00E+00‐ MAP4271 2649 3176 140 3258 2266 125 7,27E‐01 1,00E+00‐ MAP4272c 1024 935 74 2663 498 86 5,44E‐01 1,00E+00

295









whiB3 MAP4273c 2963 3259 583 7725 1764 666 5,29E‐01 1,00E+00‐ MAP4274 0 0 0 0 0 0 1,00E+00 1,00E+00sigD MAP4275 3685 4656 402 6394 3056 397 9,09E‐01 1,00E+00‐ MAP4276 1675 1244 107 2633 709 93 8,02E‐01 1,00E+00‐ MAP4277c 5260 6953 848 11214 5378 1006 3,59E‐01 1,00E+00guaB2 MAP4278 4302 5060 169 9355 2996 178 7,63E‐01 1,00E+00guaB3 MAP4279 640 1126 44 1371 677 45 8,26E‐01 1,00E+00choD MAP4280 4065 3363 712 6504 1757 604 6,78E‐01 1,00E+00‐ MAP4281 670 636 31 666 345 21 4,26E‐01 1,00E+00‐ MAP4282 112 389 16 931 165 27 1,76E‐01 1,00E+00‐ MAP4283 198 357 74 630 18 54 5,77E‐01 1,00E+00ctpA MAP4284 701 657 17 1459 452 19 6,71E‐01 1,00E+00‐ MAP4285 305 495 15 996 151 15 8,40E‐01 1,00E+00‐ MAP4286 458 892 44 1412 458 50 6,25E‐01 1,00E+00‐ MAP4287c 0 203 11 31 31 4 4,85E‐01 1,00E+00lpqP MAP4288 0 0 0 204 0 3 0,00E+00 1,00E+00‐ MAP4289 51 220 5 129 102 4 5,31E‐01 1,00E+00‐ MAP4290 51 51 5 0 0 0 1,00E+00 1,00E+00‐ MAP4291c 51 106 7 204 201 19 8,42E‐02 1,00E+00‐ MAP4292 0 51 1 0 56 2 5,83E‐01 1,00E+00‐ MAP4293 529 717 46 723 200 27 1,97E‐01 1,00E+00fadD1_2 MAP4294 168 871 17 552 245 11 4,51E‐01 1,00E+00‐ MAP4295c 101 81 8 199 85 10 9,95E‐01 1,00E+00‐ MAP4296c 101 265 23 357 74 21 9,58E‐01 1,00E+00‐ MAP4297c 25 51 1 47 65 3 5,72E‐01 1,00E+00‐ MAP4298c 146 404 6 303 355 8 4,65E‐01 1,00E+00‐ MAP4299c 459 455 19 602 102 10 1,98E‐01 1,00E+00‐ MAP4300 205 252 13 305 153 11 9,03E‐01 1,00E+00‐ MAP4301c 51 0 3 102 17 5 5,67E‐01 1,00E+00‐ MAP4302c 248 294 12 146 101 5 8,77E‐02 1,00E+00

296









‐ MAP4303c 212 153 5 255 0 2 1,15E‐01 1,00E+00‐ MAP4304 0 0 0 0 0 0 1,00E+00 1,00E+00‐ MAP4305 733 1389 65 1316 255 36 1,43E‐01 1,00E+00‐ MAP4306 549 1597 51 889 633 35 4,06E‐01 1,00E+00‐ MAP4307 302 485 21 624 234 19 9,02E‐01 1,00E+00‐ MAP4308c 4011 4163 255 6116 1421 176 2,16E‐01 1,00E+00‐ predicted RNA 1936 2799 5026 1818 1452 3397 2,76E‐01 1,00E+00‐ MAP4309 822 822 143 918 423 100 4,54E‐01 1,00E+00‐ MAP4310c 51 50 2 102 0 1 5,98E‐01 1,00E+00‐ MAP4311c 0 0 0 101 0 1 0,00E+00 1,00E+00‐ MAP4312 102 102 9 129 0 3 4,30E‐01 1,00E+00‐ MAP4313 135 36 4 51 0 0 1,78E‐03 1,00E+00‐ MAP4314 152 147 4 204 113 4 9,13E‐01 1,00E+00‐ MAP4315 101 153 5 204 26 3 5,35E‐01 1,00E+00‐ MAP4316 787 859 125 1357 503 116 9,68E‐01 1,00E+00‐ MAP4317c 454 1400 78 1415 763 85 7,01E‐01 1,00E+00‐ MAP4318c 630 1367 46 1676 524 41 8,70E‐01 1,00E+00‐ MAP4319 2114 3403 413 4090 1005 294 3,38E‐01 1,00E+00‐ MAP4320 3287 4445 77 7891 2728 87 6,41E‐01 1,00E+00‐ MAP4321c 1385 1605 20 1754 741 14 4,00E‐01 1,00E+00‐ MAP4322c 51 140 14 102 89 15 4,97E‐01 1,00E+00‐ MAP4323c 1905 2006 101 2793 735 70 2,90E‐01 1,00E+00‐ MAP4324c 720 1356 67 1042 430 41 2,36E‐01 1,00E+00‐ MAP4325c 581 422 32 1072 275 32 7,77E‐01 1,00E+00‐ MAP4326c 3491 4519 106 5472 2579 93 7,81E‐01 1,00E+00‐ MAP4327c 892 1103 105 2015 971 137 3,50E‐01 1,00E+00‐ MAP4328c 3848 4599 430 7864 3114 466 7,09E‐01 1,00E+00‐ MAP4329c 1993 1748 331 3831 1156 345 8,30E‐01 1,00E+00‐ MAP4330c 0 248 3 104 49 1 6,13E‐01 1,00E+00‐ MAP4331c 0 204 10 63 188 17 2,92E‐01 1,00E+00

297









pcnA MAP4332c 694 1136 36 1058 639 31 7,99E‐01 1,00E+00‐ MAP4333 1965 2817 84 2336 1461 61 4,17E‐01 1,00E+00‐ MAP4334 528 623 44 1213 559 58 3,48E‐01 1,00E+00‐ MAP4335 1206 1545 32 1459 852 25 5,62E‐01 1,00E+00‐ MAP4336 2955 4006 56 5107 1753 45 4,56E‐01 1,00E+00sigM MAP4337 0 101 4 204 0 5 5,39E‐01 1,00E+00‐ MAP4338 99 91 7 149 102 9 9,32E‐01 1,00E+00trxB2 MAP4339 4254 3303 219 7448 3864 285 3,87E‐01 1,00E+00trxC MAP4340 2195 1420 302 3136 1665 348 6,16E‐01 1,00E+00cwlM MAP4341 1400 2271 85 3942 1347 101 5,52E‐01 1,00E+00‐ MAP4342c 378 413 30 991 310 39 3,84E‐01 1,00E+00parA MAP4343c 1040 853 56 1816 406 48 7,95E‐01 1,00E+00parB MAP4344c 719 755 38 1086 524 36 9,74E‐01 1,00E+00gidB MAP4345c 1193 928 83 1671 433 62 5,06E‐01 1,00E+00‐ MAP4346c 1356 2102 168 2292 1162 149 8,37E‐01 1,00E+00‐ MAP4347c 4177 5889 271 8249 2962 249 9,65E‐01 1,00E+00‐ MAP4348c 875 2064 237 2603 1088 258 6,47E‐01 1,00E+00rnpA MAP4349c 254 369 49 628 137 45 9,47E‐01 1,00E+00rpmH MAP4350c 89 494 110 368 561 206 7,76E‐02 1,00E+00‐ predicted RNA 1537 2361 4845 4077 1535 5823 5,54E‐01 1,00E+00

298

Table 11: Raw data of survival of MAPwt, MAP∆fur A and MAP∆fur AC after macrophage infection in colony forming units [Cfu].

2 h 2 d 7d

MAPwt MAP∆fur A MAP∆fur AC MAPwt MAP∆fur A MAP∆fur AC MAPwt MAP∆fur A MAP∆fur AC

42000 2611158 81428 42000 2611158 81428 42000 2611158 8142845000 8520574 93971 425000 4944976 631489 23000 859665 16914882000 5860741 301000 74000 3312593 199363 36000 1431210 121181

299

Table 12: Raw data of survival of MAPwt, MAP∆fur A and MAP∆fur AC after mouse infection.

PBS MAPwt MAP∆fur A MAPwt MAP∆fur A PBS MAPwt MAP∆fur A MAPwt MAP∆fur A1.219 1.291 1.3375 59940 6660 0,082 0,128 0,1592 25 271.117 1.313 1.4557 19980 0 0.066 0.111 0.134 19 151.113 1.175 1.1822 3330 3330 0.069 0.156 0.117 25 151.109 1.581 1.1622 19980 0 0.06 0.264 0.1205 25 160.994 1.088 1.2088 9990 3330 0.101 0.12 0.1163 16 120.997 1.123 1.0143 6660 6660 0.064 0.1 0.0779 13 231.07 1.24 1.202 0 0 0.071 0.12 0.1037 15 14

1.069 1.104 1.2535 0 12460 0.069 0.0759 0.1085 9 221.166 1.315 1.3706 9990 0 0.086 0.137 0.1402 15 211.139 1.016 1.056 0 3330 0.081 0.096 0.0714 2 28

Weight of liver [g] Cfu liver Weight of spleen [g] Ammount of granuloma

300

(A) MAP zinc regulonM. avium ssp. paratuberculosis

M. avium ssp. avium Identity [%]

M. tuberculosis H37Rv Identity [%]

M. smegmatis mc2 155 Identity [%]

M. bovis BCG pasteur Identity [%] M. leprae Identity [%] M. marinum Identity [%] M. vanbaalenii Identity [%]

MAP4069c MAV_4568 99.3 - - MSMEG_4513 72.5 - - - - MMAR_4035 77.2 Mvan_3433 61.6MAP4065 MAV_4571 99.8 Rv0924c 43.62 - - BCG_2397c 55.0 ML2536 71.3 MMAR_0550 70.5 - -MAP3788 MAV_4860 98.3 Rv0292 61.6 - - BCG_2067c 47.0 - - MMAR_0293 54.0 Mvan_5488 55.0MAP3787 MAV_4862 98.9 Rv0291 69.9 - - - - - - MMAR_5073 86.4 - -MAP3786 MAV_4863 99.4 Rv0290 80.1 - - BCG_0134 40.0 - - - - - -MAP3785 MAV_4864 99.7 Rv0289 77.0 - - BCG_2372 74.4 - - MMAR_2341 65.2 - -MAP3784 MAV_4865 100.0 Rv0288 79.0 MSMEG_0622 60.0 - - - - - - Mvan_3849 61.0MAP3783 MAV_4866 100.0 Rv0287 84.5 MSMEG_0230 85.9 - - - - - - - -MAP3782 MAV_4867 98.6 Rv0286 41.85 - - - - ML0337 58.0 MMAR_0289 74.4 Mvan_5492 72.2MAP3781 MAV_4868 99.0 Rv0285 85.1 MSMEG_1608 81.8 BCG_2973 72.0 - - MMAR_3170 64.9 - -MAP3780 MAV_4869 93.47 Rv0284 84.9 MSMEG_1609 75.8 - - ML0392 85.9 MMAR_0290 82.2 Mvan_5491 82.2MAP3779 MAV_4870 87.5 Rv0283 72.6 MSMEG_2363 76.3 BCG_0320 60.5 - - - - - -MAP3778 MAV_4871 95.1 Rv0282 86.5 - - BCG_1406 77.8 - - - - - -MAP3776c MAV_0583 46.3 Rv2059 51.45 MSMEG_4727 63.1 - - - - MMAR_1144 84.6 Mvan_5751 68.6MAP3775c MAV_0582 55.5 Rv2397c 52.38 MSMEG_0617 77.1 - - - - - - Mvan_3845 62.3MAP3774c MAV_0581 51.89 - - - - BCG_1408 81.9 ML1846 49.0 - - Mvan_5318 71.4MAP3773c MAV_2036 58.06 Rv2359 56.8 MSMEG_6067 92.6 BCG_0329 77.0 ML2348 59.0 - - Mvan_5320 58.0MAP3772c - - - - MSMEG_4511 65.2 BCG_0139 66.1 - - - - - -MAP3771 - - - - MSMEG_0019 41.0 - - - - - - Mvan_1945 62.7MAP3770 MAV_4874 73.5 Rv0106 66.1 MSMEG_4515 62.1 - - - - MMAR_4037 77.6 - -MAP3769c MAV_4876 93.5 Rv2057c 85.2 - - BCG_3470 77.3 ML2529 72.9 MMAR_0544 82.4 Mvan_0414 71.0MAP3768c - - Rv2056c 81.2 - - BCG_3035 88.0 ML2531 66.7 MMAR_0546 83.5 Mvan_0417 77.9MAP3767c MAV_0076 84.61 Rv2055c 77.2 MSMEG_0393 70.1 - - - - MMAR_3668 71.0 Mvan_3819 65.1MAP3766 MAV_4878 85.1 - - MSMEG_4486 74.4 BCG_2076c 85.2 - - MMAR_0774 69.0 - -MAP3765 MAV_4879 76.1 Rv3728c 80.43 MSMEG_6554 74.0 - - - - MMAR_0433 91.7 Mvan_0175 83.7MAP3764c MAV_2370 68.0 Rv1180 78.67 - - - - ML0825 70.2 MMAR_0293 68.6 Mvan_5488 60.9MAP3763c MAV_2723 66.35 Rv1182 68.24 - - BCG_2397c 72.0 ML2535 84.3 MMAR_0549 76.2 Mvan_0420 59.0MAP3762c MAV_3994 70.74 Rv1524 67.83 - - BCG_2984 80.7 ML2532 74.7 MMAR_0547 84.4 Mvan_0418 72.6MAP3761c MAV_1758 50.58 Rv1517 50.86 MSMEG_3496 66.3 - - ML2609 83.0 MMAR_2593 84.9 - -MAP3760c MAV_3877 50.58 Rv2952 72.0 - - - - - - - - Mvan_1944 75.9MAP3752 MAV_2374 67.1 Rv3826 61.4 MSMEG_1210 84.3 BCG_3889 61.4 - - MMAR_2353 58.0 - -MAP3751 MAV_3863 65.4 Rv0507 64.9 - - BCG_2396c 71.9 ML2537 84.0 MMAR_0551 57.0 Mvan_0422 47.0MAP3750 MAV_3864 68.37 Rv0451c 69.49 MSMEG_6554 41.0 - - - - - - - -MAP3749 MAV_2946 60.0 Rv2750 49.46 MSMEG_0618 76.3 - - - - - - - -MAP3748c MAV_1059 43.31 Rv2177c 50.0 MSMEG_6060 67.4 - - - - - - - -MAP3747c MAV_4874 58.39 Rv0106 59.53 - - BCG_1407 70.0 ML2683 68.0 MMAR_2590 78.7 Mvan_1014 79.7MAP3741 MAV_2009 66.47 Rv2383c 45.86 MSMEG_6047 57.0 BCG_0324 85.0 ML0138 62.7 MMAR_2340 69.0 - -MAP3740 MAV_2013 47.41 Rv2383c 45.86 MSMEG_0615 75.5 BCG_0320 63.9 - - MMAR_4037 42.0 - -

Table 15: Homologue genes in mycobacteria compared to MAP zinc responsive genes (A) and genes of the Mtb Zur regulon not present or regulated in MAP (B). Genomes of different mycobacteria (see below) were compared by “Genome Genes Best Homologues” of Integrated Microbial Genomes Expert Review (IMG/ER) (https://img.jgi.doe.gov/cgi-bin/er/main.cgi) and NCBI blastx analysis (min. 60% coverage and 40% identity on protein level). Identified genes of each species were sorted by locus tag and clustered genes homologue to genes of the zinc responsive genomic island ZnGI (map 3731c-3788) were marked bold red.

301

M. avium ssp. paratuberculosis

M. avium ssp. avium Identity [%]

M. tuberculosis H37Rv Identity [%]

M. smegmatis mc2 155 Identity [%]

M. bovis BCG pasteur Identity [%] M. leprae Identity [%] M. marinum Identity [%] M. vanbaalenii Identity [%]

MAP3739c - - Rv2333c 44.2 MSMEG_6065 63.9 BCG_0327 84.5 - - - - - -MAP3738c - - - - MSMEG_4303 58.0 BCG_2075c 81.2 - - MMAR_0705 55.0 - -MAP3737 MAV_4872 59.37 Rv0280 63.9 MSMEG_3876 65.0 BCG_2074c 77.2 - - MMAR_3782 46.0 Mvan_0416 84.0MAP3736c MAV_1566 51.37 Rv1348 50.0 MSMEG_0226 56.0 - - - - - - Mvan_1946 69.6MAP3735c MAV_1566 54.16 Rv1348 54.48 MSMEG_4801 51.0 - - - - MMAR_1143 85.4 Mvan_5750 79.4MAP3734c MAV_1566 58.36 Rv1348 59.33 MSMEG_4550 84.8 - - - - MMAR_1700 84.2 Mvan_2113 76.7MAP3733c - - - - MSMEG_2132 65.6 BCG_3888c 68.3 - - MMAR_3658 40.0 - -MAP3732c - - - - MSMEG_2131 61.2 BCG_3882c 55.0 ML2527 62.2 MMAR_0542 71.7 Mvan_0412 64.3MAP3731c - - Rv3663c 44.93 MSMEG_0626 53.0 BCG_1609 66.0 - - - - - -MAP3632 MAV_4988 100.0 Rv0190 89.6 MSMEG_4524 67.9 - - - - MMAR_1754 80.3 - -MAP3626c MAV_4993 100.0 - - MSMEG_2130 76.1 - - - - MMAR_3706 75.8 - -MAP3492 MAV_4352 99.7 Rv3401 86.0 MSMEG_0624 61.9 - - ML0393 73.8 MMAR_0291 90.7 Mvan_5490 92.6MAP3491 MAV_4350 98.9 Rv3400 77.3 MSMEG_0623 62.4 - - ML1704 82.8 - - - -MAP3047 MAV_3861 100.0 Rv3013 88.0 MSMEG_0621 73.7 - - - - - - Mvan_3848 55.0MAP2999 MAV_3787 99.2 Rv2963 80.7 MSMEG_0620 76.8 - - - - MMAR_3694 51.0 Mvan_3847 72.3MAP2414c MAV_1566 97.7 Rv1348 79.6 MSMEG_6069 53.0 BCG_0330 79.9 ML1230 51.0 - - Mvan_5321 73.9MAP2412c MAV_1568 98.6 - - - - BCG_2078 63.1 - - MMAR_0775 77.1 Mvan_1936 67.2MAP2205c MAV_1792 99.6 Rv2386c 74.0 MSMEG_0616 65.1 - - - - - - - -MAP2177c MAV_2009 98.6 Rv2383c 72.1 MSMEG_6046 61.2 BCG_0323 72.6 ML2378 64.9 MMAR_0541 85.0 Mvan_0411 73.5MAP2176c MAV_2010 98.6 Rv2383c 58.02 MSMEG_6045 70.1 BCG_0322 86.5 - - MMAR_1418 74.3 - -MAP2175c MAV_2011 99.1 Rv2382c 71.9 - - BCG_0227 89.6 - - - - - -MAP2174c MAV_2012 98.2 Rv2381c 53.08 MSMEG_6048 72.6 BCG_0325 85.1 ML0130 68.2 MMAR_2355 60.0 - -MAP2173c MAV_2013 96.8 Rv2380c 74.38 MSMEG_6070 79.3 BCG_0332 62.0 - - - - - -MAP2172c MAV_2013 99.3 Rv2380c 51.11 MSMEG_6069 60.0 BCG_0331 69.9 ML1229 63.4 MMAR_0294 78.0 Mvan_5333 83.5MAP2138 MAV_2037 99.3 Rv2358 74.4 MSMEG_6066 75.2 BCG_3042c 80.2 ML2530 74.0 - - - -MAP1977c MAV_2216 98.6 Rv0560c 43.04 - - - - ML0336 76.9 - - Mvan_5330 67.2MAP1555c MAV_2873 100.0 Rv1344 77.8 - - BCG_2400c 74.0 ML2534 74.7 MMAR_0548 72.2 Mvan_0419 56.0MAP1554c MAV_2874 99.2 Rv1345 70.0 - - - - - - MMAR_5072 75.7 - -MAP1553c MAV_2876 99.2 Rv1346 81.9 - - BCG_1410 79.6 ML1911 40.0 - - Mvan_5319 62.3MAP0489c MAV_0583 99.0 Rv2059 63.1 - - BCG_3471 86.0 ML2528 67.6 MMAR_0543 84.0 Mvan_0413 74.7MAP0488c MAV_0582 99.3 - - - - - - ML0335 85.2 - - - -MAP0487c MAV_0581 99.7 Rv2060 84.2 - - - - - - MMAR_5071 63.1 - -

(B) Mbt Zur regulon absent or not regulated in MAPM. tuberculosis H37Rv

M. avium ssp. avium Identity [%] M. avium ssp.

paratuberculosis Identity [%]M. smegmatis mc2 155

Identity [%] M. bovis BCG pasteur Identity [%] M. leprae Identity [%] M. marinum Identity [%] M. vanbaalenii Identity [%]

Rv0105c MAV_4875 79.4 - - MSMEG_6068 77.8 - - ML1674 46.0 MMAR_0292 76.0 Mvan_5489 81.0Rv0232 MAV_4938 86.1 MAP3671 86.1 - - BCG_0269 100.0 - - MMAR_0489 91.5 Mvan_3467 78.2Rv1195 MAV_2923 76.7 MAP1507 74.5 - - BCG_1255 100.0 ML1183 47.0 MMAR_2673 76.5 - -Rv1857 MAV_2863 65.5 MAP1565 65.9 - - BCG_1893 100.0 - - MMAR_2731 69.7 - -Rv1870c MAV_2847 76.0 MAP1581c 72.0 - - BCG_1906c 100.0 - - - - - -Rv2058c MAV_4875 85.9 - - MSMEG_6068 82.1 BCG_2077c 100.0 ML1674 45.0 MMAR_0292 83.3 Mvan_5489 84.6Rv2990c - - - - - - BCG_3011c 100.0 - - - - - -Rv3229 MAV_4192 85.2 MAP3343c 85.2 MSMEG_1886 79.4 BCG_3352c 100.0 - - MMAR_1315 87.9 Mvan_1768 76.0Rv3612c - - - - - - BCG_3676c 100.0 - - - - - -

302

FurA and FurB–the impact of two transcriptional metalloregulators ...

Documents

Transcript of FurA and FurB–the impact of two transcriptional metalloregulators ...