1

Master thesis – GEN 80436

Es, Sam van

Wageningen UR

February – October 2012

Functional studies of NcbZIP19 and -23 in Arabidopsis thaliana

and Noccaea caerulescens

2

3

Functional studies of NcbZIP19 and -23 in Arabidopsis thaliana and Noccaea caerulescens.

Name: Samuel W. van Es

Registration number: 861125-229-120

Study Program: MBI, specialization Plant Adaptation

Course: Master Thesis Genetics - GEN 70424

Duration: February - October 2012

1st supervisor: Mrs. Ya-Fen Lin

Examiner: Dr. Mark G.M. Aarts

Laboratory of Genetics – Department of Plant Genetics

Wageningen University & Research centre

Droevendaalsesteeg 1

6708 PB Wageningen

The Netherlands

4

Abstract

In this Master Thesis I performed experiments to determine the role of the transcription factors

NcbZIP19 and -23 in N. caerulescens. For this I compared their expression and that of their possible

targets to their homologues in A. thaliana. bZIP19 was found to be higher expressed in N.

caerulescens in shoot tissue whereas in root tissue bZIP19 was higher expressed in A. thaliana. I

found its possible target ZNT1 higher expressed in N. caerulescens in comparison to its homologue

ZIP4 in A. thaliana in root and shoot tissue except under zinc deficient conditions.

On top of that I created a NcbZIP19 knock-down mutant of N. caerulescens and analysed its effect on

gene expression, metal content and translocation efficiency of those metals. The knock-down

construct I created prove itself very effective. I also provide evidence for a function of ZNT1 and

NAS4 in the transport of metals in N. caerulescens; as well as a possible lack of NcbZIP23 in N.

caerulescens accession La Calamine.

5

Table of contents

Abstract ..............................................................................................................................................4

Table of contents ................................................................................................................................5

Acknowledgements ............................................................................................................................6

Introduction........................................................................................................................................7

Methodology .................................................................................................................................... 12

Identification of NcbZIP19 and NcbZIP23 and their target genes ................................................................ 12

A. thaliana and N. caerulescens growth conditions and tissue harvesting .......................................................... 13

Constructing expression vector for NcbZIP19 and NcbZIP23 knock-down experiment ........................................... 13

Hairy root transformation of N. caerulescens with A. rhizogenes and growth conditions of the plants. ...................... 17

Metal content measurement................................................................................................................. 18

Quantitative PCR primer design and PCR efficiency test ................................................................................ 19

Quantitative Real-Time PCR expression analysis ......................................................................................... 20

Isolating NcbZIP23 from N. caerulescens spp. Ganges and La Calamine ............................................................. 21

Data analysis and statistics ................................................................................................................... 22

Results .............................................................................................................................................. 23

Identification of NcbZIP19 and NcbZIP23 .................................................................................................. 23

Comparing the expression of bZIP19, bZIP23 and their targets in Arabidopsis and Noccaea. ................................... 23

Construction of the knock-down of NcbZIP19 in N. caerulescens through RNAi ................................................... 26

NcbZIP19 expression in RNAi:NcbZIP19 knock-down plants ........................................................................... 29

Metal response and metal accumulation of RNAi:NcbZIP19 knock-down plants .................................................. 30

Identification of possible targets of NcbZIP19 and NcbZIP23 .......................................................................... 33

NcbZIP19-regulated gene expression in RNAi:NcbZIP19 knock-down plants ....................................................... 35

Comparing sequences of NcbZIP23 in Ganges and La Calamine. ...................................................................... 36

Discussion ......................................................................................................................................... 38

Comparing metal homeostasis genes in A. thaliana and N. caerulescens ........................................................... 38

RNAi::NcbZIP19 knock-down plants, gene expression- and metal content analysis ............................................... 40

Isolating NcbZIP23 from N. caerulescens .................................................................................................. 43

Conclusions....................................................................................................................................... 45

References ........................................................................................................................................ 46

Appendices ....................................................................................................................................... 49

6

Acknowledgements

I would like to thank Ya-Fen Lin for her friendship, time, technical support and guidance during

my thesis and Mark Aarts for providing me with the opportunity to perform my thesis at his group of

Plant Genetics along with his guidance and technical support during my thesis. I fully enjoyed doing

experiments, analysis and writing although it would not have been such a pleasure without all the

people at the Genetics department. I would therefore also like to thank all the people at Plant

Genetics for their friendship during the long weekends of writing. Dr. Henk Schat has also been very

helpful during the metal measurements at the ‘Vrije Univeriteit’ in Amsterdam.

7

Introduction

Pollution of the environment by heavy metals is an increasing risk for plants and humans that

consume them. The increase of heavy metals in the environment is caused by a number of factors:

industrial activities, mining and smelting, waste and sewage waters, and the use of pesticides and

fertilizers containing heavy metals (Nriagu and Pacyna 1988). For instance, pollution of soil by Zn

causes inhibition in root growth and decreased photosynthetic rates in plants. When the

concentration of Zn increases over its critical toxicity level of 300 mg/kg, the plant eventually dies. In

certain areas, soil has been found with a concentration over 1000 mg Zn/kg (in comparison, ‘normal’

Zn concentrations are around 100 mg Zn/kg soil (Marschner 1995)). Also Cd pollution poses a great

threat to the public health as it is widely distributed in the environment and used by the industries

(Nriagu and Pacyna 1988). Sewage sludge is known to contain Cd when it is a result of the industries

mentioned above; when this sludge is used to fertilize the soil contamination is a fact. In the case of

Ni, the increase of its content in the soil is caused, similar to Cd, by emissions and waste from the

industries.

Heavy metals are classified into two categories: essential metals such as zinc (Zn), copper (Cu),

iron (Fe) and nickel (Ni); and non-essential metals such as cadmium (Cd), lead (Pb) and mercury (Hg).

The essential heavy metals play important roles in various physiological processes (Hänsch and

Mendel 2009), the non-essential metals are not needed whatsoever (Chaffai and Koyama 2011) and

generally regarded as toxic (that is, plants can tolerate low concentrations of the metals but are

quickly overcome by their toxicity) (Järup 2003). Of the metals described above, the essential

micronutrients are required for proper metabolic and physiological function of plants but highly toxic

at high levels (Hassan and Aarts 2011). Zinc for example serves as cofactor for over 300 enzymes and

is important for the correct folding of certain protein functional domains (Guerinot and Eide 1999;

Ehrensberger and Bird 2011). However, when present at high concentrations in the soil, zinc

becomes toxic for the plant, inappropriate bindings can occur which will impair the function of a

protein (Epstein and Bloom 2005). This affects agricultural crops and is a growing risk for global

health (McLaughlin, Parker et al. 1999; Clemens 2006). Limitations in zinc supply may also have

negative effects for plants as zinc is an essential metal. An example for the negative effects are large

changes in gene expression that have been observed in many eukaryotic species which were

impaired in their zinc supply (Dainty, Kennedy et al. 2008; Assunção, Herrero et al. 2010;

Ehrensberger and Bird 2011). As for Ni, plants need it as a co-factor for the enzyme urease, however

in very small amounts (Hänsch and Mendel 2009). An excess of Ni causes plants to loose chlorophyll

content and it also causes a reduction in shoot and root tissue growth (Freeman, Persans et al. 2004).

Cadmium is a non-essential metal and highly toxic to plants. Plants that grow on soil with high levels

of Cd have shown inhibition of their DNA repair mechanisms (Banerjee and Flores-Rozas 2005); as

well as a reduction in photosynthesis and water and nutrient uptake (Sanità Di Toppi and Gabbrielli

1999; Hassan and Aarts 2011). As Cd resembles Zn and Fe, it therefore might enter the plant via their

uptake machinery (Guerinot 2000; Clemens 2006; Hassan and Aarts 2011).

Plants are sessile organisms, they cannot outrun their enemies and have therefore evolved all

kind of defence mechanisms to deal with the problems faced when you’re stuck on the spot. One of

these problems is the acquisition of nutrients i.e. metals which are essential for a plants survival. The

8

internal balance of metals is called the metal homeostasis. Because of the vital importance for a

proper balance, plants have evolved a highly regulated cascade of metal sensors, uptake-,

transporter- and storage mechanisms for this purpose (Clemens 2001; Hall 2002). The genetics

behind the metal homeostasis network is highly complicated and researchers are only beginning to

get a proper understanding of the system. Metals that are taken up by a plants root system are first

stored in a symplastic metal pool after which it is loaded into the xylem and transported through the

shoot into the leaves where it can be stored again or used (reviewed by (Clemens, Palmgren et al.

2002; Krämer, Talke et al. 2007)). These mechanisms however are not sufficient in the case of an

excess of heavy metals in the soil because, as explained before, an excess of heavy metals (regardless

of their essential of non-essential nature) has detrimental effects on most plants (Göhre and

Paszkowski 2006).

Figure 1. Simplified overview of the genes found in metal hyperaccumulator species. The genes are involved in uptake,

transport and storage of heavy metals in plants. HMA (Heavy-Metal P-type ATPase)ŧt*

; MTP (Metal Tolerance Protein)t*

;

MHX (Magnesium Proton Exchanger protein)*; ZTP (Zinc Tolerance Protein)ŧ; FRD (Ferric Reductase Defective)t; YSL (Yellow

Stripe Like protein) ŧ; ZIP (ZRT-, IRT-like proteins)ŧt*; IRT (Iron Regulated Transporter protein)ŧt*. Found in: ŧ (Hassan and Aarts

2011); t (Verbruggen, Hermans et al. 2009); * (Van De Mortel, Villanueva et al. 2006).

Several species of plants are able to cope with an excess of heavy metals in the soil. The ability to

cope with an excess of heavy metals exists in a two of forms, plants that exclude heavy metals and

plants that are tolerant to heavy metals (Baker and Walker 1990; Lin and Aarts 2012). Tolerant plants

come also in two types: (1) heavy metal-tolerant non-hyperaccumulator plants and (2) heavy metal-

hypertolerant hyperaccumulator plants (Pollard, Powell et al. 2002).

One of the ways excluder plants are able to block the entrance of heavy metals is by the excretion

of organic acids; they form a complex with the heavy metals in the rhizosphere hence preventing the

uptake of these metals (Murphy and Taiz 1995). Heavy metal-tolerant non-hyperaccumulator plants

store metals in root vacuoles and prevent transport to shoot tissue and heavy metal-hypertolerant

9

hyperaccumulator plants are able to store the excess of metals in their leaf vacuoles (Pollard, Powell

et al. 2002; Lin and Aarts 2012).

The fact that the largest number of hyperaccumulating species accumulate nickel lead to the

assumption that the ability to accumulate metals has evolved on soils with a high nickel

concentration after which it evolved towards the accumulation of other metals such as zinc and

cadmium (Hanikenne and Nouet 2011). Hyperaccumulation occurs in over 34 different families in

which the Brassicaceae is relatively highly represented (Verbruggen, Hermans et al. 2009).

One of the hyperaccumulating species belonging to the Brassicaceae family is Noccaea

caerulescens (formerly known as Thlaspi caerulescens). First described in 1865 on zinc-rich soils (Risse

and Sachs 1865) it is extensively studied on its ability to accumulate heavy metals (reviewed by

(Assunção, Schat et al. 2003; Milner and Kochian 2008). N. caerulescens is able to accumulate Zn

(30.000 µg/g dry weight), Ni (4000 µg/g dry weight) and Cd (2700 µg/g dry weight) in aboveground

tissue (found in (Brown, Chaney et al. 1995; Lombi, Zhao et al. 2000; Schat, Llugany et al. 2000)

respectively).

N. caerulescens is found throughout Europe (Tutin, Burges et al. 1993) and quite a number of

accessions have been found and analysed (Koch, Mummenhoff et al. 1998; Assunção, Bookum et al.

2003). The concept of hypertolerance and hyperaccumulation is specific for certain metals in a

certain species or subspecies (Schat and Vooijs 1997). This consequently results in differences in the

hyperaccumulating abilities of different heavy metals for different accessions of N. caerulescens

(Assunção, Bookum et al. 2003). These differences in metal hyperaccumulation abilities have been

found to originate from independent local adaptation on a micro-evolutionary level (Pollard, Powell

et al. 2002; Jiménez-Ambriz, Petit et al. 2007).

Besides its heavy metal accumulating characteristics it also is highly similar to the main model

species Arabidopsis thaliana; it shares on average 88.5% DNA identity in coding regions (Rigola, Fiers

et al. 2006) and 87% DNA identity in the intergenic transcribed spacer regions (Peer, Mamoudian et

al. 2003) (from (Van De Mortel, Villanueva et al. 2006)). Concluding: the hyperaccumulating abilities

and the high sequence similarity with model species A. thaliana has resulted in the use of N.

caerulescens as a model species in the research on heavy metal accumulation in plants.

Zinc influx facilitator genes play a major role in the zinc uptake in plants (Assunção, Herrero et al.

2010). The uptake of Cd and Ni has been suggested to share some mechanisms of uptake as Zn but

the uptake is additionally governed by metal-specific elements (Verbruggen, Hermans et al. 2009).

Genes of the zinc influx facilitator belong to the ZIP (ZRT1/IRT1-like proteins) gene family (Guerinot

2000). Proteins with bZIP domains are found in all eukaryotes (Riechmann, Heard et al. 2000). Most

ZIP proteins have eight transmembrane domains and a long loop region between transmembrane

domains 3 and 4 containing a histidine-rich sequence (Jakoby, Weisshaar et al. 2002). The potential

metal binding ability of this loop suggests a role in the metal transport (Eide 2006). In Arabidopsis

there are 15 ZIP genes of which AtZIP4 is strongly induced upon zinc shortage (Assunção, Herrero et

al. 2010). The homolog of AtZIP4 in N. caerulescens is NcZNT1. In this hyperaccumulator the gene is

highly expressed in roots under sufficient zinc supply (Van De Mortel, Villanueva et al. 2006). This

shows one of the differences between hyperaccumulators and non-accumulators plants; AtZIP4 is Zn-

regulated in non-accumulators (only expressed under conditions of Zn deficiency) whereas its

homolog NcZNT1 is constitutively expressed in the hyperaccumulator N. caerulescens; independently

of the Zn supply (Pence, Larsen et al. 2000; Assunção, Da CostaMartins et al. 2001).

10

Recent research on the localization of their gene expression has shown that NcZNT1 and AtZIP4

are expressed in the root endodermis and pericycle of A. thaliana and N. caerulescens respectively.

Other research has shown that the site of expression of NcZNT1 in N. caerulescens is specifically

expressed in the stomata guard cells (Chaffai and Koyama 2011), bundle sheath and guard cells in

leafs (Küpper and Kochian 2010) and on the plasma membrane of mesophyll- and bundle sheath cells

in the leaf (Milner and Kochian 2008). More research is needed to get a complete overview of the

localization of expression of NcZNT1 in N. caerulescens and AtZIP4 in A. thaliana.

Growth and development of all organisms depends on regulated gene expression. Needless to

say, this is also the case in the aforementioned metal homeostasis genes in plants. Gene expression

is regulated through transcription factors (TFs); one of the most important means of modulating

gene expression (Corrêa, Riaño-Pachón et al. 2008). Transcription factors (trans-regulatory element)

contain a region that mediates DNA binding on a specific sequence (cis-regulatory element), which

eventually results in the transcription of the target gene (Jakoby, Weisshaar et al. 2002). One of the

major groups of transcription factors is the basic leucine zipper (bZIP) family, known to regulate

many central developmental and physiological processes in plants (Jakoby, Weisshaar et al. 2002;

Corrêa, Riaño-Pachón et al. 2008). These bZIP TFs are characterized by a 40- to 80-amino-acid-long

conserved domain (bZIP domain) composed of two motifs: a basic region responsible for specific

binding of the TF to its cis-regulatory element on the target DNA, and a leucine zipper required for TF

dimerization (Corrêa, Riaño-Pachón et al. 2008). For the aforementioned AtZIP4 gene two

transcription factors were identified: AtbZIP19 and AtbZIP23; a knock-down of both TFs resulted in a

downregulation of AtZIP4 under zinc deficient conditions whereas bot AtZIP4 and its TFs are

expressed under zinc deficient conditions in wild-type plants (Assunção, Herrero et al. 2010). The

characteristic cis-element of bZIP19 and -23 to target AtZIP4 for transcriptional control is the ZDRE

(Zinc Deficiency Response Element) (Assunção, Herrero et al. 2010). The ZDRE is a specific sequence

in the promoter region (located upstream of the transcription start) of its target sequence (AtZIP4)

responsible for specific binding of the TF (bZIP19 and -23). This specific sequence (ZDRE) is a 10-bp

(base pair) palindrome with the sequence with only a difference in the first and last base:

A/G[TGTCGACA]T/C to which the transcription factors bind.

Besides AtZIP4, other ZIP-genes also possess the same ZDRE palindrome in their promoter regions

(Assunção, Herrero et al. 2010). Work done by a student at the Laboratory for Genetics at the

Wageningen UR showed that also AtZIP10, AtNAS2 and AtNAS4 have one or more ZDRE elements

(Herrero Serrano 2007). This finding suggests that those genes (AtZIP1, -3, -5, -9, -10, -12, AtNAS2, -4

and AtIRT3) are also transcriptionally regulated by AtbZIP19 and -23.

Previous research has shown that in A. thaliana, AtbZIP19, AtbZIP23 and AtZIP4 are induced upon

zinc deficiency (Assunção, Herrero et al. 2010) whereas its homolog NcZNT1 is constitutively

expressed in N. caerulescens (Verbruggen, Hermans et al. 2009). The trans-regulatory elements of

NcZNT1 have yet to be identified. Whether the trans-regulatory elements (most likely transcription

factors NcbZIP19 and -23) are likewise constitutively expressed in N. caerulescens is unknown. Also

whether they can account (partly) for the difference in metal homeostasis and related gene

expression between hyperaccumulator species A. thaliana and non-hyperaccumulator species N.

caerulescens is something that will be researched in this thesis.

11

The main focus of my thesis will lay on the transcriptions factors bZIP19 and bZIP23. The objective

of this research project is to understand the role of NcbZIP19 and -23 in Zn homeostasis in the

hyperaccumulator species N. caerulescens. For this, identifying the Noccaea homologues of

transcription factors AtbZIP19 and -23 will be conducted first; when found, a comparison will be

made of the expression of Nc/AtbZIP19 and its target NcZNT1/AtZIP4 in N. caerulescens and A.

thaliana.

In A. thaliana, ZIP4 and bZIP19 and -23 are known to be induced upon zinc deficiency (Assunção,

Herrero et al. 2010) whereas its homolog ZNT1 is constitutively expressed in N. caerulescens (Lin,

Liang et al. 2009; Verbruggen, Hermans et al. 2009). The hypothesis rises that also NcbZIP19 will be

constitutively expressed in N. caerulescens. The sequences of NcbZIP19 and -23 will be used to create

N. caerulescens knock-down mutants through RNA interference (RNAi) and testing their effect on

different metal treatments. This way, we hope to identify their function and find out whether this

transcription factor plays a vital role in the metal transport in plants. I hypothesise that by knocking

down NcbZIP19 and -23, its target genes will also show a reduced level of expression. These possible

targets of NcbZIP19 and -23 will be identified by searching for ZDRE elements in the promoter region

of homologues of Arabidopsis genes that are known to possess a ZDRE element. The ZDRE-element is

thought to be the cis-element to which the transcription factors bZIP19 and -23 bind to their target

genes. The hypothesis is that the genes in which a ZDRE is present in A. thaliana will also contain a

ZDRE in their N. caerulescens homologue. To confirm the specificity of NcbZIP19 and -23 to those

targets their gene expression will be tested in the RNAi:NcbZIP19 knock-down in the N. caerulescens

experiment. Finally an attempt was made to find isolate NcbZIP23 from N. caerulescens’ accessions

La Calamine and Ganges to check for sequential differences.

12

Methodology

Identification of NcbZIP19 and NcbZIP23 and their target genes

In order to identify the two transcription factors NcbZIP19 and NcbZIP23 and their targets (e.g.

NcZNT1), their known homologues in Arabidopsis were used. The Basic Local Alignment Search Tool

(BLAST, found on biotools.wurnet.nl, created and supported by Applied Biosystematics, Plant

Research International, WUR) finds regions of local similarity between sequences (a process called

BLASTing) and compares nucleotide or sequences to a database and calculates the statistical

significance of matches. The databases used in this research were the ‘Noccaea caerulescens ESTs’

and the ‘Noccaea Scaffold database’; both created by M.G.M. Aarts and Ya-Fen Lin (Laboratory of

genetics, WUR) and based on sequences from N. caerulescens accession Ganges (GA). The EST

database consists of expressed sequence tags from root, shoot and flower tissues of N. caerulescens;

the scaffold database is build-up of whole-genome sequences. The Arabidopsis sequences were used

to find homologues regions in the Noccaea genome by BLASTing. Filter parameters were set as

follows: Coverage threshold 0% (default), Identity threshold 0% (default) and Blast expected

threshold 0.001. Homologues regions were downloaded for further analysis using the ‘FASTA-batch

retriever’ (found on biotools.wurnet.nl) which retrieves specific sequences from the aforementioned

databases.

The sequences of AtbZIP19 (AT4G35040.1) and AtbZIP23 (AT2G16770.1) were retrieved from The

Arabidopsis Information Resource (TAIR; www.arabidopsis.org); the NcbZIP19 sequence was received

from my supervisor Ya-Fen Lin (Laboratory of Genetics, WUR). When a region of similarity was found

by BLASTing the bZIP19 and -23 to the Noccaea databases, the specific sequence was retrieved

including an approximately 500 bp flanking region. Using this sequence, the presumed START- and

STOP-codon were determined. After constructing the approximated gene it is blasted against the

Noccaea EST database in order to determine the exon- and intron- regions.

Sequence similarity was determined for [NcbZIP19 vs. NcbZIP23]; [AtbZIP19 vs. NcbZIP19] and

[AtbZIP23 vs. NcbZIP23] using the ‘Multiple sequence alignment tool’ version 5.4.1

(http://multalin.toulouse.inra.fr/multalin/) (Corpet 1988) using the following parameters: Gap

weight = 12; GAP length weight = 2; Consensus levels: High = 90%; Low = 50%.

The Arabidopsis genes AtZIP1, -3, -4, -5, -9, -10, -12, AtNAS2, -4 and AtIRT3 are known contain one

or more ZDREs in their promoter region (Herrero Serrano 2007; Assunção, Herrero et al. 2010). In

order to find out whether Noccaea also has these genes containing ZDRE elements, the sequences of

the Arabidopsis genes were received from TAIR and the BLAST tool was used to find homologues in

the Noccaea Scaffold database. The steps that were taken were the following: (1) download

sequence of gene of interest from TAIR website (www.arabidopsis.org), (2) BLAST the sequence

against Noccaea scaffold on biotools.wurnet.nl. (3) When a region of homology was found an

extensive part of the corresponding scaffold was downloaded in order to acquire the whole gene

region including approximately 2000 bp upstream sequence of the gene. (4) This sequence was

analysed to find possible ZDRE elements in the region upstream of the START-codon (the promoter

region).

13

A. thaliana and N. caerulescens growth conditions and tissue harvesting

For the comparison of gene expression in A. thaliana and N. caerulescens I used material already

available. The following steps were performed by Alfred Joseph, a previous MSc student from Ya-Fen

Lin; my supervisor. A. thaliana and N. caerulescens seeds were sown in ½ Hoagland’s solution with

normal zinc applied; 2 µM Zn for A. thaliana and 10 µM Zn for N. caerulescens are considered to be

the normal conditions. The solution was renewed weekly and after three weeks the plants are

transferred to their different treatments (table 1). They were grown in metal treated solutions

(which are renewed weekly) for three weeks after which they are harvested for the RNA isolation.

Three plants per treatment were harvested as three biological repeats. Shoot and root tissues

were harvested separately from the plants and frozen in liquid nitrogen after which the RNA isolation

was performed using the RNeasy® Mini kit according to the manufacturers instruction (Qiagen®). To

prevent contamination by genomic DNA the samples were treated with On-Column DNase Digestion

with the RNase-Free DNase set (Qiagen®). RNA samples were quantified by NanoDrop® ND-1000

(NanoDrop Technology, Inc.); required levels of purity were met when the OD260/280 ratio is 1.8 to

2 and the 260/230 ratio is 1.8 or greater. For cDNA synthesis, 1000ng of RNA was applied to iScript™

cDNA synthesis kit (Bio-Rad Laboratories) according to the manufacturer’s instructions.

Table 1. Heavy metal concentrations for ½Hoagland’s solution of both Arabidopsis thaliana and Noccaea caerulescens.

*ZnSO4: Zinc sulphate; tCdSO4: Cadmium sulphate; ŧNiSO4: Nickel sulphate

A . thaliana (Columbia Col-0)

Heavy metal High concentration Normal concentration Low concentration

Zinc (Zn) 50 µM ZnSO4* 2 µM ZnSO4 0 µM ZnSO4

Cadmium (Cd) 2 µM CdSO4t - -

Nickel (Ni) 25 µM NiSO4ŧ - -

N. caerulescens (La Calamine)

Heavy metal High concentration Normal concentration Low concentration

Zinc (Zn) 1000 µM ZnSO4* 10 µM ZnSO4 0 µM ZnSO4

Cadmium (Cd) 50 µM CdSO4t - 0.5 µM CdSO4

Nickel (Ni) 100 µM NiSO4ŧ - 10 µM NiSO4

Constructing expression vector for NcbZIP19 and NcbZIP23 knock-down experiment

Primers were designed by using the primer design tool in the CLC main workbench version 6.6.1 and

using the retrieved sequences from the ‘Noccaea EST database’ in the case of NcbZIP19 and the

‘Noccaea Scaffold database’ for NcbZIP23. All primers (table 2) were designed according to the

following specifications: Tm: 50-60°C, GC content: 45-55%, amplicon length: ±200 bp, primer length:

20-25 bp. The forward primer contains the sequence CACC at the 5’ end of the primer in order to

match the GTGG overhang sequence in the pENTR-D-TOPO® vector (Invitrogentm pENTRtm Directional

TOPO® Cloning Kits). For the construction of the double RNAi knock-down (CaMV35Spro::RNAi-

NcbZIP19::RNAi-NcbZIP23) a GC-rich (C5G5C5) overlap sequence is added to join both amplified

fragments (Cha-aim, Fukunaga et al. 2009) (shown in figure 2).

14

Figure 2. Visualization of the purpose of the G5C5G5 overlap for the double knock-down construct.

Amplification of the fragments for single and double knock-down experiments was performed

using the Phusion polymerase (Phusion® High-Fidelity DNA Polymerase, Finnzymes/Thermo

Scientific) according to manufacturer’s instructions with the following adjustments: 10µl 5x Phusion

HF buffer, 2.5µl of 10µM forward and reverse primer, 2µl cDNA. For cDNA synthesis, 1000ng of RNA

of shoot tissue from N. caerulescens grown under zinc deficient conditions was applied to iScript™

cDNA synthesis kit (Bio-Rad) according to the manufacturer’s instructions.

Table 2. Designed primers for gene knock-down experiments, SAM009 to SAM012 are for the single knock-down constructs

and SAM013 to SAM016 for the double knock-down. (F): forward primers; (R): reverse primers

For the NcbZIP19 single knock-down fragment the three-step temperature cycling was set as

follows: 30 sec at 98°C; 35 cycles of 7 sec at 98°C, 25 sec at 61°C and 10 sec at 72°C; and 8 min. at

72°C. Annealing temperatures for all reactions were determined by using the calculator on the

manufacturer’s website (www.finnzymes.com). The NcbZIP19 double knock-down fragment had the

following the three-step temperature cycling: 30 sec at 98°C; 35 cycles of 7 sec at 98°C, 25 sec at

71°C and 10 sec at 72°C; and 8 min. at 72°C.

For the use in further experiments the PCR products were purified by using the PCR Purification

Kit (Qiagen) according to the manufacturer’s instructions. These purified PCR products were then

used in the TOPO® Cloning Reaction (Invitrogen) to insert them into the pENTR-D-TOPO® vector

according to the manufacturer’s instructions (figure 3c). The resulting ligation mixture will be used

for electroporation in E. coli DH5α (see page 16).

Primer name Sequence (5’ → 3’) Gene Specifications Amplicon length

SAM009 (F) CACCGATAGCGATGAGAAGGTTTC NcbZIP19 Length: 24 bp; Tm: 62.3 °C; GC: 50.0 % 217 bp

SAM010 (R) AGACCTCAGCTTCCAAGGTAGC NcbZIP19 Length: 22 bp; Tm: 62.7 °C; GC: 55.0 %

Resulting construct: CaMV35Spro::RNAi-NcbZIP19

SAM011 (F) CACCTCCATATGCACACCAAGAT NcbZIP23 Length: 23 bp; Tm: 62.7 °C; GC: 48.0 % 246 bp

SAM012 (R) TAACCTCAGCTTCCAATGCAGC NcbZIP23 Length: 22 bp; Tm: 62.2 °C; GC: 50.0 %

Resulting construct: CaMV35Spro::RNAi-NcbZIP23

SAM013 (F) (CACC)ATGTCCACACCAAGATTCTGCCGAA NcbZIP19 Length: 25 bp; Tm: 65.4 °C; GC: 48.0 % 270 bp

SAM014 (R) (C5G5C5)GATCAACAAGCAAACACTTGAGCC NcbZIP19 Length: 24 bp; Tm: 62.2 °C; GC: 46.0 %

SAM015 (F) (G5C5G5)ATATGCACACCAAGATCCTACCTGC NcbZIP23 Length: 25 bp; Tm: 62.9 °C; GC: 48.0 % 252 bp

SAM016 (R) TTAGCCTCGTAACCTCAGCTTCCAA NcbZIP23 Length: 25 bp; Tm: 64.2 °C; GC: 48.0 %

Resulting construct: CaMV35Spro::RNAi-NcbZIP29::RNAiNcbZIP23

15

Figure 3. A graphical overview of the pathway of creating the destination vector pK7GWIWG2-

DsRED-RNAi-NcbZIP19. A. fragment of NcbZIP19 including sequence (CACC) necessary for

directional cloning. B. pENTR/D-TOPO® entry vector, attL1/-2: site-specific recombination

sites, kanamycin: kanamycin resistance gene, pUC ori: origin of replication, T1/-2: rrnB

transcription termination sites, TOPO®: cloning sites. C. pENTR/D-TOPO®-NcbZIP19 entry

vector, PvuII, NotI, EcoRV: restriction sites for the respective enzymes. D. pK7GWIWG2-DsRED

destination vector, Sm/Spr: spectinomycin resistance gene, LB: left border, Kan: kanamycin

resistance gene, Tnos: NOS terminator sequence, DsRed: Red fluorescent gene, pAtUbq10:

Arabidopsis ubiqutin-10 gene promoter, T35S: transcription terminator, attR1/-R2: site-specific

recombination sites, CmR: Chloramphenicol resistance gene, ccdB: growth inhibiting gene in E.

coli, p35S: cauliflower mosaic virus promoter, RB: right border. E. Gateway® LR Clonase™

‘moves’ NcbZIP19 from entry vector pENTR/D-TOPO® into destination vector pK7GWIWG2-

DsRED by recombining the attL1 x attR1 and attL2 x attR2 sites. F. Result from E.: destination

vector pK7GWIWG2-DsRED-RNAi-NcbZIP19, AhaIII: restriction site for enzyme AhaIII. Figures C,

D and F are made by using CLC main Workbench version 6.6.1

A.

B.

C.

D.

E.

F.

Gateway® LR Clonase™

Entry vector:

pENTR/D-TOPO®-NcbZIP19

2.797bp

Destination vector:

pK7GWIWG2-DsRED

15.413bp

Destination vector:

pK7GWIWG2-DsRed-NcbZIP19

14.015bp

16

Of the ligation mixture 4µl was mixed with 100µl electrocompetent Escherichia coli strain DH5α

and and kept on ice for 1 min, the mixture was then transferred to an ice-cold electroporation cuvet

(Bio-Rad Laboratories) after which an electric pulse of 2500V was given between 4.6 and 4.9 msec.

Immediately thereafter 500µl of LB was added, the mixture was transferred to an Eppendorf tube

and incubated at 37°C for one hour. The resulting mixture was plated on agar plates with LB medium

containing 50 mg/L kanamycin as selection marker. The resulting colonies were grown overnight in

liquid LB with kanamycin. After this the plasmid was extracted using the Qiaprep Spin Miniprep Kit

(Qiagen) according to the manufacturer’s instructions after which the plasmid was checked on the

presence of the right insert using enzyme digestion.

Two enzymes digestion reactions were performed in order to confirm the presence of the right

insert. The first reaction was done with the enzyme PvuII which cuts at two sites in the entry vector

(5'...C A G^C T G...3') resulting in fragments of 1942bp, 685bp and 170bp. The second reaction with

EcoRV (5'...G A T^A T C...3') and NotI (5'...G C^G G C C G C...3') which both cut at one site, resulting in

fragments of 362bp and 2439bp. The samples that show the expected size of insert were send to be

sequenced by Eurofins MWG Operon. Approximately 750ng of plasmid DNA was send and sequenced

with the M13 forward and reverse primers.

To create the expression clone in order to knock down the target genes the expression vector

pk7GWIWG2-DsRed was used (figure 3d). The NcbZIP19 fragment was ‘inserted’ in the vector

between both the attR1 and attR2 sites by recombining the attL1xattR1 and attL2xattR2 sites. This

reaction is mediated by the Gateway® LR Clonase™ II Enzyme Mix (Invitrogen™); used according to

the manufacturer’s instructions. The resulting expression clone will produce a stem-loop-stem like

structure (figure 4), resulting in the knock-down of target genes through RNA-interference (Limpens,

Ramos et al. 2004).

Figure 4. RNAi construct designed to knock-down NcbZIP19: CaMV35Spro::RNAi-NcbZIP29

The destination vector was transformed into electro-competent E. coli DH5αE by electroporation.

To check for colonies with insert, they were selected on LB agar plates containing 100 mg/L

spectinomycin. Colonies were picked, grown in liquid LB with 100 mg/L spectinomycin and confirmed

by digesting isolated plasmid DNA with restriction enzymes: AhaIII (5'...T T T^A A A...3') with

expected fragment sizes of 6145bp, 3610bp, 2023bp, 1821bp, 339bp, and 77bp. When the right

insert was confirmed, 4µl of isolated plasmid is added to 40µl of electrocompetent Agrobacterium

rhizogenes (strain MSU440) and and kept on ice for 1 min, the mixture was then transferred to an

ice-cold electroporation cuvette (Bio-Rad Laboratories) after which an electric pulse of 2500V was

given between 4.6 and 4.9 msec. Immediately thereafter 960µl of LB was added, the mixture was

transferred to an Eppendorf tube and incubated at 28°C for one hour. The resulting mixture was

plated on agar plates with LB medium containing 50 mg/L kanamycin as selection marker.

17

Hairy root transformation of N. caerulescens with A. rhizogenes and growth conditions of the

plants.

Seeds of Noccaea caerulescens (La Calamine A522, LC 42 1-4 and 1-11) were sterilized by vapour

sterilization for six hours. The seeds were placed in a desiccator jar with two beakers containing 50

mL bleach added with 1.5 mL hydrochloric acid (37%) each; on top of these beakers the seeds in

Eppendorf tubes were placed. After the six-hour period they were left for one hour in a Laminar flow

to remove the remaining chlorine gas. The seeds were then put to germinate on a petri dish with

½MS-medium without sugar (Murashige and Skoog medium, Duchefa Biochemie) containing 8%

Daishin agar. The plates (placed vertically) were put in a climate chamber where they received 250

μmol/m2/s light at plant level during a 16 hour light period, 24°C and 70% relative humidity.

After a week (when the hypocotyledons of the seedlings were fully expanded) the roots were cut

at the hypocotyl-root boundary and the root is removed. A. rhizogenes with the destination vector

was applied at the base of each hypocotyl; for this 200 plants received the control-vector

(pK7GWIWG2-DsRed) and 300 plants received the vector with knock-down construct (pK7GWIWG2-

DsRed::NcbZIP19). The plates were transferred to a hydroponics room where they received a 12 hour

night and day rhythm at 70% relative humidity and temperatures being 15°C and 20°C during night

and day respectively.

After five days of co-culture, seedlings were transferred to new ½MS plates supplemented with

200 mg/L timentin (Duchefa Biochemie) to inhibit the growth of A. rhizogenes. The plants were

checked every week by a Leica stereo-microscope for the expression of DsRED protein in the

transformed roots; transformed roots show fluorescence under a fluorescence filter whereas

untransformed roots show no fluorescence whatsoever. All untransformed roots were removed and

they were all put on new ½MS medium without sugar containing 200 mg/L timentin.

Table 3. Different metal treatments for N. caerulescens on ½Hoagland’s

Heavy metal High concentration Normal concentration Low concentration

Zinc (Zn) 1000 µM ZnSO4* 10 µM ZnSO4 0.05 µM ZnSO4

After three weeks, seedlings were transferred to the hydroponic ½Hoagland solution (Assunção,

Bookum et al. 2003) containing 10μM ZnSO4 were they would stay for a week. Simultaneously

transformed roots were harvested to conduct the expression check of NcbZIP19 to find out whether

the RNAi knock-down strategy was working. Those plants that showed a knock-down of NcbZIP19

expression compared to the control plants (vector-only: pK7GWIWG2-DsRed) were transferred to the

different metal treatments (Table 3) along with the control plants; 10 µM ZnSO4 was considered to

be the normal treatment. The solutions were renewed weekly and the selection for transformed

roots (removing untransformed roots) was also performed every week. After three weeks of this

treatment the plants were harvested for either metal content measurements or gene expression

analysis by the quantitative real-time polymerase chain reaction (qPCR).

18

Metal content measurement

The RNAi:NcbZIP19 knock-down plants that had grown in different metal treatments were

harvested after three weeks. Root and shoot tissue was collected separately and immersed in ice-

cold Pb(NO3)2 for 30 minutes after which they were rinsed with demi-water. Shoot and root tissue

from each plant was placed in separate paper envelopes and put in the oven for two days at 65°C.

The remainder of the preparations and the actual metal measurement was performed at the “Faculty

of Earth and Life Sciences” at the VU Amsterdam under the supervision of Dr. Henk Schat. A

maximum of 100 mg of dry tissue was placed in Teflon bombs and 2 ml of the destruction mixture

(HNO3:HCl (4:1)) was added. Samples that weighed 10 mg or less were only given 1 ml of the

destruction mixture. The Teflon bombs were put at 140°C for seven hours after which they were left

to cool down. Respectively 8 and 4 ml of demi-water was added to the 2 or 1 ml destruction mixture,

the resulting mixture was transferred to 12 ml test tubes and remained in the fume hood in order to

allow the gasses to disperse. These mixtures were used to measure metal content; in some cases the

content was too high for accurate measurements and a dilution series of 10x, 100x and 1000x was

made.

The concentrations of three metals for shoot tissue (Zn, Fe and Mn) and four metals for root

tissue (Zn, Fe, Mn and Cu) were measured using a flame atomic absorption spectrometer

(PerkinElmer AAnalyst 100). The values that were obtained (in ppm or mg/L) were converted to

mg/kg dry weight using the following calculation:

Metal concentration (mg/kg) = [metal concentration, ppm(mg/L)] x dilution factor x 10-2 / Plant dry

weight

The values of Mn gave a read-out in nmol/ml which were converted to mg/kg dry weight using the

following equation:

Metal concentration (mg/kg) = [metal concentration, nmol/ml] x [atomic mass Mn (54,938) / 1000]

x dilution factor x 10-2 / Plant dry weight

In order to conclude something about the transportation capabilities of the plants a ratio will be

calculated. This will tell something about the translocation efficiencies of the vector-only and knock-

down plant on the different treatments (high, normal or low metal concentration). The translocation

efficiency will be calculated as follows:

Translocation efficiency = (Shoot metal concentration / Root metal concentration) x 100%

19

Quantitative PCR primer design and PCR efficiency test

For the quantitative real-time PCR (from here on forward referred to as: qPCR) the primers were

designed to the following specifications using the sequences acquired from the Noccaea sequence in

the CLC Main Workbench version 6.6.1: Tm: 50-60°C, GC content: 45-55%, amplicon length: ±150 bp,

primer length: 20-25 bp. For my thesis I designed primers for the NcbZIP19 and NcbZIP23 genes in

the region with the least similarity between the two genes. All other primers were provided by my

supervisor Ya-Fen Lin for additional gene expression analysis. All primers can be found in table 4.

Before the actual gene expression analysis was performed a primer efficiency test was executed. The

purpose of such a test is to acquire the proper qPCR settings for the gene expression analysis. The

primer efficiency test was performed using cDNA made out of shoot tissue from A. thaliana and N.

caerulescens grown under Zn deficient conditions. cDNA was synthesised from 1000ng RNA using the

iScript™ cDNA Synthesis Kit according to the manufacturer’s instructions.

Table 4. qPCR primers for gene expression analysis of both N. caerulescens and A. thaliana

Primer name Sequence Gene Specifications Amplicon length

SAM005 (F) GCTCGGAGATGGGTGAATTA NcbZIP19 Length: 20 bp; Tm: 56.3 °C; GC: 50.0 % 146 bp

SAM006 (R) GAAGCATGTGTGAGTATGC NcbZIP19 Length: 19 bp; Tm: 55.2 °C; GC: 47.0 %

SAM007 (F) AAGGTGTGTCGATGAATGAGC NcbZIP23 Length: 20 bp; Tm: 59.9 °C; GC: 48.0 % 146 bp

SAM008 (R) ACCGGATCCATCGACACTGAAT NcbZIP23 Length: 22 bp; Tm: 62.1 °C; GC: 50.0 %

ANA13 (F) TTCTCCCGGATGAGAGCGATGA AtbZIP19 Length: 22 bp; Tm 64,1 °C; GC: 54,5% Both from:

ANA28 (R) GCTGATTCACCGCCCTAAGCCT AtbZIP19 Length: 22 bp; Tm 66,0 °C; GC: 59,1% (Assunção, Herrero et

al. 2010)

Judith296 (F) ATGCTCATGGTACATGCGATGGAC NcZNT1 Length: 24 bp; Tm 64,2 °C; GC: 50,0% 181 bp; Both: (Van de

Judith297 (R) CAGGGAGACTGCGATACACCGA NcZNT1 Length: 23 bp; Tm 64,9 °C; GC: 59,1% Mortel et al., 2006)

Ana002 (F) GATCTTCGTCGATGTTCTTTGG AtZIP4 Length: 22 bp; Tm 58,6 °C; GC: 45,5% Both from:

Ana003 (R) TGAGAGGTATGGCTACACCAGCAGC AtZIP4 Length: 25 bp; Tm 66,8 °C; GC: 56,0% (Assunção, Herrero et

al. 2010)

Duy001 (F) GACACTTTGTTCGGGCAACTCG NcNAS1 Length: 22 bp; Tm 63,6 °C; GC: 54,6% 160 bp Both from:

Duy002 (R) CCAAGATTGTGGAGAAGTGTTGC NcNAS1 Length: 23 bp; Tm 61,2 °C; GC: 47,8% (Nguyen 2010)

Duy003 (F) GACAACTCGTGTCCACGTGCTTACC NcNAS2 Length: 25 bp; Tm 66,5 °C; GC: 56,0% 152 bp Both from:

Duy004 (R) GCCTATGATTGTGGAGAAGTGTTCC NcNAS2 Length: 25 bp; Tm 62,3 °C; GC: 48,0% (Nguyen 2010)

Duy005 (F) TCTCGAAGCTCGAGAGTCTGAAACC NcNAS3 Length: 25 bp; Tm 64,7 °C; GC: 52,0% 146 bp Both from:

Duy006 (R) CTTGATGAGTTTTTGTCGAATCTCC NcNAS3 Length: 25 bp; Tm 59,3 °C; GC: 40,0% (Nguyen 2010)

Duy007 (F) GTGAGCACGATCTGCGATCTGTACG NcNAS4 Length: 25 bp; Tm 66,2 °C; GC: 56,0% 147 bp Both from:

Duy008 (R) GCTTTCAGACATCTTTGTGACGTCG NcNAS4 Length: 25 bp; Tm 63,4 °C; GC: 48,0% (Nguyen 2010)

Duy009 (F) CCTACGCACCAGTCATCTCTGC NcTubulin Length: 22 bp; Tm 64,1 °C; GC: 59,1% 151 bp Both from:

Duy010 (R) CCACGGTACATCAGACAGCAAGC NcTubulin Length: 23 bp; Tm 64,8 °C; GC: 56,5% (Nguyen 2010)

ClathrineF (F) AGCATACACTGCGTGCAAAG NcClathrine Length: 20 bp; Tm 60,1 °C; GC: 50,0% Both from:

ClathrineR (R) TCGCCTGTGTCACATATCTC NcClathrine Length: 20 bp; Tm 58,6 °C; GC: 50,0% (Gendre, Czernic et al.

2007)

A two-step protocol of the iCycler® iQTM Real-Time PCR Detection System (Bio-Rad Laboratories)

was used to perform the qPCR with the following reaction mixture: 12.5µl iQ SYBR Green Supermix,

0.5µl of 10µM forward and reverse primers, 6.5µl MilliQ-H2O and 5µl of cDNA. The following reaction

protocol was used: 3 min at 95°C, and 40 amplification cycles of 15 sec at 95°C and 1 min at 62°C for

NcNAS1-4; 60°C for NcbZIP19/-23, AtbZIP19, NcTubulin and NcClathrin; and 58°C for NcZNT1 and

AtZIP4. To confirm the specificity of the amplified fragment in the qPCR, a melting curve analysis was

20

also performed, set for 60 cycles with its starting temperature at 65°C for 5 sec, which was increased

with 0.5°C after each cycle until the final temperature of 95°C was reached.

All samples were performed using two or three technical repeats. A sample with sterilized MilliQ

water (no-template control) was included in each QPCR reaction to check for primer dimerization of

each primer pair and possible contamination.

A dilution series was used to determine the primer efficiency, 20µl of cDNA was added to 80µl of

MilliQ and was considered to be the 1x dilution. From this a 2x, 4x and 8x dilution was made. To

calculate the primer efficiency the logarithmic value of the dilution was plotted against the

respective Ct value after which a regression curve was established. The slope of the regression curve

was used to calculate primer efficiencies: Efficiency = (10(-1/slope)-1)*100. The acceptable primer

efficiencies for qPCR should lay between 80 – 120% and ideally in the range of 90 – 110%. For further

expression analysis the dilution with a Ct-value of 20 – 30 should be used, ideally the Ct value lays

between 25 and 26.

Quantitative Real-Time PCR expression analysis

A volume of 5µl of cDNA (two times diluted, deduced during primer efficiency test) was added to

a reaction mixture containing 12.5µl iQ™ SYBR® Green Supermix, 6.5µl MilliQ-H2O and 0.5µl (10µM)

of forward and reverse primers for the gene of interest. The qPCR protocol for each primer pair was

determined by a primer efficiency test (as shown in the subchapter ‘Quantitative PCR primer design

and PCR efficiency test’). For each primer pair two technical repeats were prepared for the qPCR.

For both the gene expression analysis in the A. thaliana vs. N. caerulescens experiment as well as

the RNAi:NcbZIP19 knock-down experiment two housekeeping genes were tested for their capability

to be the reference gene. Due to time constraints only two housekeeping genes were tested as they

were readily available; these housekeeping genes (NcClathrin and NcTubulin, table 3) were chosen as

they were previously shown to be stable housekeeping genes (Gendre, Czernic et al. 2007; Nguyen

2010) and the only two that showed proper primer efficiencies in both A. thaliana and N.

caerulescens.

The outcome of the qPCR are Ct values, they represent the number of cycles required for the

fluorescent signal to cross the threshold (i.e. exceeds a certain background level) and can be used to

calculate the relative transcript levels (RTL) or relative gene expression. Before gene expression

analysis could commence the most stable housekeeping (reference) gene had to be determined. For

this the geNORM program in the qBASEplus software was used. As threshold a reference target

stability (gNORM M-value) of 0.5 was chosen, although some literature uses an M-value of 1.0

(Hellemans, Mortier et al. 2007) which was used for the N. caerulescens versus A. thaliana

experiments. After the most stable housekeeping gene was determined, its Ct values were used to

normalize the Ct value from the gene of interest to obtain the so-called ΔCt values. The difference in

ΔCt values of the gene of interest in the normal (control) treatment and the other treatments was

calculated to obtain the ΔΔCt values. In short: ΔΔCt = ΔCttreatment – ΔCtcontrol = (Cttarget –

Cthousekeeping)treatment – (Ctcontrol – Cthousekeeping)control. In order to deduce the gene expression the

equation 2-ΔΔCt was executed (Livak and Schmittgen 2001).

21

In the case of the transformed N. caerulescens (RNAi knockdown through the CaMV35Spro::RNAi-

NcbZIP19 construct) NcbZIP19 expression in transgenic roots was checked with primers sam005-006

and an annealing temperature of 60°C. As a relative expression level of 0,25 was set as threshold,

everything below was considered to be sufficiently downregulated to call the plants knocked-down

(a downregulation of 75% or more). Everything above was to be considered as not sufficiently

knocked-down. The control plants (transformed with an empty vector) were used as a reference to

calculate the relative gene expression. A one-way ANOVA test was performed in order to find out

whether there was statistical difference between the gene expression of different treatments (high,

normal or low metal concentration) or different plants (Arabidopsis versus Noccaea or Vector-only

versus Knock-down). A P-value of 0.05 was set to be the threshold of significance.

Isolating NcbZIP23 from N. caerulescens spp. Ganges and La Calamine

The following test was set up in order to find out whether N. caerulescens spp. Ganges (GA) and

La Calamine (LC) both have a copy of the NcbZIP23 gene. In order to do that PCR-primers were

designed from N. caerulescens spp. Ganges (GA) to amplify the whole gene from 5’- to 3’-UTR using

the sequence from N. caerulescens (GA). All primers were designed using the sequences acquired

from the Noccaea sequence in the CLC Main Workbench version 6.6.1 and to the following

specifications: Tm: 50-60°C, GC content: 45-55%, amplicon length: ±1200 bp (length of the gene),

primer length: 20-25 bp (table 5).

Amplification of the fragments for the whole gene amplification was performed using the Pfu

polymerase (Pfu DNA Polymerase, Finnzymes/Thermo Scientific) according to manufacturer’s

instructions. The following parameters were adjusted: 2.5µl of 10µM forward and reverse primer, 2µl

cDNA (150ng/µl). A three-step temperature cycling was set as follows: 5 min at 94°C; 35 cycles of 30

sec at 94°C, 30 sec at 55°C and 72 sec at 72°C; and 10 min. at 72°C. A second PCR-reaction was

performed at the same time with an annealing temperature of 53°C.

Table 5. Specifications of primers for whole gene amplification of NcbZIP23

Primer Name Primer sequence (5' --> 3') Gene Specifications Amplicon length

SAM003 (F) TGTTTCTGGGTTTGCTGT NcbZIP23 Length: 18 bp; Tm: 56.2 °C; GC: 44.0 % 1119 bp

SAM004 (R) AAACTGGTGAATGGTGATG NcbZIP23 Length: 19 bp; Tm: 55.8 °C; GC: 42.0 % 1119 bp

From the resulting gel the bands were extracted using by gel extraction according to the

manufacturer’s instructions (QIAquick Gel Extraction Kit QiaGen®). This was followed by ligation of

the fragments into the pGEM®-T Easy vector (Promega) after which they were transformed in E. coli

DH5α by electroporation. After incubation at 37°C for one hour, the resulting mixture was plated for

blue/white screening on LB/ampicillin/IPTG/X-Gal plates. The plates were made as follows: LB

medium containing 50mg/L ampicillin as selection marker with 50µl (100µM) IPTG and 2µl (50mg/ml)

X-gal added. After overnight growth on these plates single white colonies were transferred to liquid

medium with 50mg/L ampicillin.

After overnight growth in the liquid medium the culture was then mini-prepped according to

manufacturer’s instructions (Qiaprep Spin Miniprep Kit, Qiagen®). Approximately 300-500ng of the

resulting plasmids were digested using EcoRI and NotI to check for the right insert in the plasmid;

expected sizes for NotI are: 1153 bp and 2981 bp; for EcoRI: 120 bp, 1017 bp and 3032 bp. The

plasmids that showed the right digestion pattern on gel were send for sequencing at Eurofins MWG

22

Operon. Approximately 750 ng of plasmid DNA was send and sequenced with the T7 forward and SP6

reverse primers.

Table 6. Specification of primers and primer pairs for the fragment amplification of NcbZIP23 by gradient PCR

A gradient PCR was set up with a number of primer combinations in order to increase the chance

to amplify a fragment of NcbZIP23. Amplification of the fragments for the fragment amplification

was performed using the Pfu polymerase (Pfu DNA Polymerase, Finnzymes/Thermo Scientific)

according to manufacturer’s instructions with the following adjustments: 1.25µl of 10µM forward

and reverse primer (column ‘primer name’ in table 6), 2µl cDNA (150ng/µl). A three-step gradient

cycling was set as follows: 5 min at 94°C; 35 cycles of 30 sec at 94°C, 30 sec at 48-62.3°C (in five

steps) and x sec (column ‘extension time’ in table 6) at 72°C; and 10 min. at 72°C. The gradient-PCR

was performed for cDNA of both Ganges and La Calamine.

The extension time (noted as x in the previous paragraph) was calculated using 1000bp per minute as

the rule of thumb. It therefore follows that the primer combination sam003-008 has an extension

time of 40 seconds: (653bp / 60sec)*1000 ≈ 40 seconds.

Data analysis and statistics

Data analysis and statistics were performed using Microsoft Excel and IBM® SPSS® Statistics

version 19.0. In order to find out whether there was statistical difference between two samples (for

instance the ZNT1 expression of the vector-only and NcbZIP19 knock-down plants) a one-way ANOVA

test was performed. This test was performed with the threshold of significance set to be the P-value

of 0.05; followed by a post hoc LSD test.

To be able to distinguish between the different treatments and different plants (e.g. to compare

the expression of ZNT1 under high, normal or low metal concentrations in A. thaliana and N.

caerulescens), a univariate analysis was performed. For this analysis a level of P=0.05 was also used

as threshold for significance; followed again by a post hoc LSD test.

Relative transcript levels are calculated by first choosing the most stable housekeeping gene

(reference gene) using the geNORM program in the qBASEplus software with a reference target

stability (gNORM M-value) of 0.5 chosen as threshold. For further calculations Excel was used for the

equation 2-ΔΔCt to calculate relative transcript levels (Livak and Schmittgen 2001).

Primer Name Primer sequence (5' --> 3') Gene Specifications Amplicon length Extension time

SAM003 (F) TGTTTCTGGGTTTGCTGT NcbZIP23 Length: 18 bp; Tm: 56.2 °C; GC: 44.0 % 653 bp 40 sec

SAM008 (R) ACCGGATCCATCGACACTGAAT NcbZIP23 Length: 22 bp; Tm: 62.1 °C; GC: 50.0 %

SAM007 (F) AAGGTGTGTCGATGAATGAGC NcbZIP23 Length: 20 bp; Tm: 59.9 °C; GC: 48.0 % 487 bp 30 sec

SAM004 (R) AAACTGGTGAATGGTGATG NcbZIP23 Length: 19 bp; Tm: 55.8 °C; GC: 42.0 %

SAM017 (F) GCGCCTTTCTCGTATATG NcbZIP23 Lenght: 18 bp; Tm: 54.22 °C; GC: 50.0% 184 bp 11 sec

SAM018 (R) TCTCCTTAGTCCTTGCCA NcbZIP23 Lenght: 18 bp; Tm: 53.67 °C; GC: 50.0%

SAM017 (F) GCGCCTTTCTCGTATATG NcbZIP23 Lenght: 18 bp; Tm: 54.22 °C; GC: 50.0% 576 bp 34 sec

SAM004 (R) AAACTGGTGAATGGTGATG NcbZIP23 Length: 19 bp; Tm: 55.8 °C; GC: 42.0 %

SAM003 (F) TGTTTCTGGGTTTGCTGT NcbZIP23 Length: 18 bp; Tm: 56.2 °C; GC: 44.0 % 728 bp 43 sec

SAM018 (R) TCTCCTTAGTCCTTGCCA NcbZIP23 Lenght: 18 bp; Tm: 53.67 °C; GC: 50.0%

SAM017 (F) GCGCCTTTCTCGTATATG NcbZIP23 Lenght: 18 bp; Tm: 54.22 °C; GC: 50.0% 234 bp 14 sec

SAM008 (R) ACCGGATCCATCGACACTGAAT NcbZIP23 Length: 22 bp; Tm: 62.1 °C; GC: 50.0 %

23

Results

Identification of NcbZIP19 and NcbZIP23

First the homologues of AtbZIP19 and -23 were identified in the N. caerulescens genome. For this

the sequences were retrieved from the TAIR website (www.arabidopsis.org). These sequences were

BLASTed against the Noccaea Scaffold sequences to find homologues regions. The results of this

search can be found in table 7. The NcZIP19 and -23 sequences found in the Noccaea Scaffold

database were then blasted against the EST-database in which NcbZIP19 was found in isotig08734

(position 296 to 1169). NcbZIP23 could not be identified in the EST-database.

Table 7. Regions on a certain scaffold in the database ‘Noccaea Scaffold database’ found on the website biotool.wurnet.nl.

The column ‘Species’ shows the name of the gene of interest in Arabidopsis thaliana (and Genebank number from TAIR)

and the name of the homologue in Noccaea caerulescens. The column ‘Scaffold nr.’ shows the scaffold in the Noccaea

database to which the Arabidopsis gene shows resemblance. The column ‘Regions of homology’ show the region in which

(part of) the Arabidopsis gene (retrieved from TAIR) corresponds to the depicted region in the Noccaea database.

Species Scaffold nr.

Regions of homology

Arabidopsis gene Noccaea gene Arabidopsis gene Noccaea gene

AtbZIP19 AT4G35040.1

NcbZIP19

Scaffold 8

8-46 111 - 169 217 - 978 974 - 1108 1226 – 1264

2215245 - 2215209 2215048 - 2214990 2214911 - 2214168 2213991 - 2213857 2213777 - 2213739

AtbZIP23 AT2G16770.1

NcbZIP23

Scaffold 3

1-45 100 - 696 697 – 741

2484149 - 2484105 2484050 - 2483454 2483450 - 2483494

To compare the coding sequences of bZIP19 and -23 from both species the ‘Multiple sequence

alignment tool’ version 5.4.1 (http://multalin.toulouse.inra.fr/multalin) (Corpet 1988) was used.

Comparing bZIP19 and bZIP23 in both A. thaliana and N. caerulescens showed that AtbZIP19 and

AtbZIP23 share 73.8% sequence similarity; NcbZIP19 and NcbZIP23 share 73.2% sequence similarity.

When comparing A. thaliana and N. caerulescens we find that AtbZIP19 and NcbZIP19 share 87.7%

sequence similarity and AtbZIP23 and NcbZIP23 share 84.5% sequence similarity. All sequence

alignment results can be found in appendix 1.

NcbZIP23 proved to be harder to identify than NcbZIP19, we therefore focussed on NcbZIP19 in

further research. In the chapter ‘Isolating NcbZIP23 from N. caerulescens spp. Ganges and La

Calamine’ I’ll come back to this issue of NcbZIP23.

Comparing the expression of bZIP19, bZIP23 and their targets in Arabidopsis and Noccaea.

Three-week-old seedlings from both A. thaliana and N. caerulescens were grown on different

metal treatments for three weeks after which their root and shoot tissue was harvested for further

analysis. The analysis focussed on the expression of bZIP19, -23, the Arabidopsis gene ZIP4 and its

Noccaea homologue ZNT1. The homologues genes ZIP4 (in A. thaliana) and ZNT1 (in N. caerulescens)

will from here onwards be noted as ZNT1/ZIP4.

After analysis in qBASE the housekeeping gene NcClathrin (table 4) was used as a reference gene

for both species to which the other data was normalized. The reference target stability (M-value:

24

Arabidopsis thaliana

Noccaea caerulescens

calculated by geNORM in qBASE) of this housekeeping gene was unfortunately 1.057, just above the

threshold of 1.0. When removing the tissue grown on Ni and Cd the M-value dropped to 0.875. So,

when analysing the relative gene expression one must keep in mind that possible differences in A.

thaliana and N. caerulescens on high nickel and cadmium treatments might be caused by unstable

reference genes. Primers for the housekeeping gene NcClathrin showed an efficiency of 94% in A.

thaliana and 98% in N. caerulescens respectively.

Figure 5. Relative transcript levels (RTL) of bZIP19 and bZIP23 in A. thaliana and N. caerulescens, ZIP4 in A. thaliana and

ZNT1 in N. caerulescens. Standard error is indicated by the error bars. Asterisks indicate a significant difference in relative

expression between A. thaliana and N. caerulescens calculated using a one-way ANOVA. Note the difference in scale of the

vertical axis. The actual metal concentrations of all treatments (Zn, Ni and Cd) can be found in table 1 of ‘ materials and

methods’.

25

What can be deduced from the data is that the standard error is quite high due to a relatively high

variation in the biological repeats, the technical repeats showed less variation.

The transcription factor bZIP23 obtained very high Ct values (and subsequently very low relative

transcript levels) in N. caerulescens; the question rises whether this is in fact due to very low or no

expression or an erroneous design of qPCR-primers for instance. The gene expression analysis

therefore focusses on bZIP19 and ZIP4/ZNT1. The expression of bZIP19 in shoot tissue of N.

caerulescens seems higher in all treatments but is only significantly higher on low zinc and high

cadmium treatments (figure 5). In root tissue on the other hand, bZIP19 seems higher expressed in A.

thaliana than in N. caerulescens, this is significant in the high Zn, -Cd and -Ni treatments.

Under zinc deficient conditions, the gene ZIP4 is significantly higher expressed in shoot and root

tissue of A. thaliana compared to N. caerulescens. In all other treatments, N. caerulescens shows

higher expression of ZNT1, significantly so in high zinc and nickel treatments in both root and shoot

tissue and in shoot tissue in the high cadmium treatment. There seems to be a trend in the

expression of ZNT1, it seems to be higher expressed than the ZIP4 gene of A. thaliana in shoot and

root tissue in all treatments except for the low Zn treatment.

The difference in gene expression in A. thaliana and N. caerulescens might imply a functional

difference in the regulation of metal homeostasis in these species. In order to understand the

function of NcbZIP19 a RNAi knock-down was created in N. caerulescens.

26

Construction of the knock-down of NcbZIP19 in N. caerulescens through RNAi

The construction of the knock-down mutant RNAi::NcbZIP19 started by isolating a fragment of

NcbZIP19 from cDNA of N. caerulescens (LC). For this primers 009 and 010 were used which resulted

in a product with the expected size of 217bp (figure 6). All gels shown in this chapter had either the

‘GeneRuler™ 100bp Plus DNA Ladder’ or the ‘GeneRuler™ 1kb DNA Ladder’ as marker (both Thermo

Scientific). The purified PCR product was first ligated into the pENTR-D-TOPO vector (Invitrogen) and

then recombined with the destination vector pK7GWIWG2-DsRed. Both the entry vector and

destination vector were tested by enzyme digestion to check for the presence of the right insert.

The enzyme digestion check on pENTR/D-TOPO® was performed with NotI and EcoRV (Eco32I)

which had an expected outcome regarding fragment size of: 362bp and 2439bp (Figure 7). Of this gel

was concluded that samples 19-1, -2, -3, -4, -7, -9 and -10 had the right size (indicated with an

asterisk).Because of the strength of the bands only 19-2, -3, -4, -7 and -9 were tested with the

restriction enzyme PvuII. This restriction enzyme should result in fragments of 1942bp, 685bp and

170bp (figure 8). Indicated with an asterisk are the entry vectors that were send for sequencing.

Sequencing showed (appendix 2) that samples 4 and 7 were of the expected sequence from a

fragment of NcbZIP19. These two samples were therefore used for ligation in the destination vector

pK7GWIWG2-DsRed. Also the destination vector was tested by enzyme digestion before proceeding

to the transformation of N. caerulescens. This revealed that only plasmids derived from sample 4 had

the proper insert after ligation in the destination vector (figure 9 and appendix 2). These plasmids

were send for a final round of sequencing to confirm the right plasmid for the transformation

experiments.

Figure 6. Gel with the result of the

NcbZIP19 amplification with primers

sam009-010. Expected fragment is

217bp. The GeneRuler™ 100bp Plus

DNA Ladder was used.

Figure 7. Gel with the result of the enzyme digestion with

NotI and Eco32I of pENTR-D-TOPO® with the expected

insert NcbZIP19. Expected fragment sizes are 2439- and

362bp. The GeneRuler™ 100bp Plus DNA Ladder was

used.

27

The plasmids ‘sample 4-1’ (pK7GWIWG2-DsRed-NcbZIP19) were transferred in A. rhizogenes by

electroporation and used to transform N. caerulescens seed batch La calamine A522 LC42. An empty

vector (pK7GWIWG2-DsRed) was used as control, to account for the possible effects of A. rhizogenes

infection.

The plants were first kept on plates with ½MS medium after which they were transferred to

½Hoagland’s solution with normal Zn concentrations (10µM ZnSO4) where they grew for a week.

After this week they were transferred to the different metal treatments in ½Hoagland’s solution

(table 2). After three weeks of metal treatment the plants were harvested for metal concentration

measurements and gene expression analysis.

Figure 8. Gel with the result of the

enzyme digestion with PvuII of

pENTR-D-TOPO® with the expected

insert NcbZIP19. Expected fragment

sizes are 1942- and 685- and 170bp.

Both the GeneRuler™ 100bp Plus

and 1kb DNA Ladder were used.

Figure 9. Gel with the result of the enzyme digestion to check

for the presence of the right insert (NcbZIP19) in the

destination vector pK7GWIWG2-DsRed. Enzyme digestion

performed with enzyme AhaIII. Indicated with an asterisk are

the ones send for confirmative sequencing. Expected sizes

are 6145bp, 3610bp, 2023bp, 1821bp, 339bp, and 77bp. The

GeneRuler™ 1kb DNA Ladder was used.

28

Of all seeds sown, a great majority germinated; all of the germinated plants were infected with A.

rhizogenes, either with empty vector (pK7GWIWG2-DsRed) or with vector plus insert (pK7GWIWG2-

DsRed-NcbZIP19) and roughly 35% actually acquired transformed roots (table 8 and figure 10).

Table 8. Transformation efficiencies of A. rhizogenes with plasmid on N. caerulescens. Vector-only: pK7GWIWG2-DsRed;

knock-down: pK7GWIWG2-DsRed-NcbZIP19.

Vector name Transformation step Number of plants Transformation efficiency

Sown 200

Vector-only

Germinated 194 32.47% Transformed 63

Knock-down

Sown 300

Germinated 291 36.43%

Transformed 106

The plants were selected for the presence of transformed roots by a Leica stereo-microscope for

the expression of DsRED protein in the transformed roots; transformed roots show fluorescence

under a fluorescence filter whereas untransformed roots show no fluorescence whatsoever (figure

10).

Figure 10. Fully transformed root system of N. caerulescens as seen under a red-fluorescent filter. This

particular photo was taken of roots transformed by A. rhizogenes with vector pK7GWIWG2-DsRed-NcbZIP19.

29

NcbZIP19 expression in RNAi:NcbZIP19 knock-down plants

In order to conduct the gene analysis comparison first the transformed plants have to be checked

for the expression of NcbZIP19 to find out whether the RNAi knock-down construct is working or not.

For this two to three transformed roots were harvested and RNA isolation was done according to

manufacturer’s instruction (RNeasy Mini Kit, Qiagen®). A qPCR analysis was performed using primers

sam005-006 with an annealing temperature of 60°C for 1 minute which was found to result in the

best primer efficiency (see Materials and Methods). Two plates were prepared simultaneously as

technical repeat. The housekeeping gene NcClathrin (primers ClathrinF and -R) was used as a

reference gene and N. caerulescens transformed with vector only was used as reference for the

expression calculation (figure 11). As explained in the materials and methods two seed batches were

used: N. caerulescens La Calamine A522, LC 42 [1-4] and [1-11]. A one-way ANOVA comparing the

means of relative gene expression showed no difference between these two batches, from heron

forward they will be regarded as one seed batch. All knock-down plants had a downregulation of the

expression of NcbZIP19 of ± 80% or more as can be seen in figure 11. As a threshold a maximum

relative expression of 0,25 was used, this led to the exclusion of only two plants, the other 36 were

used for further testing on different metal treatments.

0,0 0,2 0,4 0,6 0,8 1,0 1,2 1,4 1,6 1,8

RTL

Plant number

Relative expression of NcbZIP19

Figure 11. Relative transcript levels (RTL) of NcbZIP19 in transformed plants. C-1 to C-5 are plants with a vector only. KD-1 to

KD-22 are seed batch [1-4] and KD-23 to KD-36 are seed batch [1-11]. KD-1 to KD-36 are plants with the CaMV35Spro::RNAi-

NcbZIP29 construct (knock-down plants). The relative transcript level (RTL) is calculated using the average expression of

NcbZIP19 in Control plants as a reference value.

30

Metal response and metal accumulation of RNAi:NcbZIP19 knock-down plants

The plants that had grown for three weeks on the different metal treatments (0.05µM Zn, 10µM

Zn and 1000µM Zn) were harvested, root and shoot tissue separately. The plants showed no

difference in phenotype between vector-only and knock-down plants (figure 12 and appendix 3).

Except for a slight discolouration of the new protruding leaves in plants that grew on 1000 µM of

ZnSO4 no phenotypic differences were showing. Possible differences in plant size might be explained

by more extensive root cutting as in some individual plants transformed roots took more time to

appear then in others.

Figure 12. Overview of plant phenotypes after three weeks one the different metal solutions. From top to bottom: Low-,

normal- and high zinc treatments. The left column shows the control plants (vector only) and the right column shows knock-

down plants (plasmid with RNAi:NcbZIP19 construct).

Metal measurements were conducted for three metals in shoot tissue: Zn, Mn and Fe. Four

metals were measured in root tissue: Zn, Fe, Mn and Cu. The value obtained for Cu in shoot tissue in

the first samples was too low to distinguish from ‘background noise’ (i.e. Cu readout in demi-water)

and therefore not further measured. The results are put in charts to be able to distinguish between

Vector-only and RNAi:NcbZIP19 knock-down plants. To calculate whether the difference in metal

concentration was significant comparing vector-only and knock-down plants a one-way ANOVA was

performed. This resulted in the notion that only Zn concentrations in shoot tissue on 10µM Zn and Fe

concentrations in shoot tissue on 1000µM Zn were significantly higher in vector-only plants. Iron

concentrations in root tissue on 0.05 µM Zn on the other hand was higher in knock-down plants

compared to vector-only plants. These significances are noted in figure 13 with an asterisk.

To find the possible differences between treatments a univariate analysis was performed. The

outcome of such an analysis is transformed into letters; a is for instance significantly different from b

whereas ab is not significantly different from either a or b (figure 13). Plants grown on 1000µM Zn

had significantly more zinc in their root and shoot tissue compared to plants grown on normal and

low zinc concentrations. The difference in zinc concentration in plants grown on low and normal zinc

31

concentration was not significantly different from one another. There was a significantly higher

concentration of Fe in shoot tissue of the knock-down plants grown on 10µM Zn and 0,05µM Zn

treatment compared to the high zinc (1000µM Zn) treatment. In root tissue, Fe concentration of

knock-down plants on 0,05µM Zn is significantly higher from the other treatments. The Fe

concentration of Vector-only plants on 10µM Zn is significantly higher than the Fe concentration in

other Vector-only plants, as well as Fe concentration in the knock-down plants grown on 1000µM Zn.

The Mn concentration in shoot tissue of knock-down plants was significantly higher on 10µM Zn

compared to the 0,05µM Zn treatment. Root tissue was also analysed for Cu concentration and it

was found that vector-only plants grown on 1000µM Zn contained significantly more Cu in their root

tissue compared to vector only plants grown 10µM Zn.

Figure 13. Metal concentrations for shoot tissue in mg/kg DW. Standard error is indicated by the error bars. Asterisks

indicate a significant difference in metal concentration between Vector-only and Knock-down plants calculated using a one-

way ANOVA. The letters a, b and c are the result of the univariate analysis. Note the difference in scale of the vertical axis.

Vector-only plants

Knock-down plants

32

Next to the actual concentration of metals in a certain tissue also the translocation efficiency

(T.E.) of those metals can be deduced by calculating the ratio of ‘shoot metal concentration’ over the

‘root metal concentration’ (figure 14 and appendix 6). The translocation efficiency of Fe does not

differ significantly between the vector-only or knock-down plants within a treatment or between

treatments. In the case of Mn, translocation efficiency is significantly higher for the knock-down

plants on 10µM Zn compared to plants grown on 1000µM Zn.

The translocation efficiency of Zn shows that there is a significant difference in a number of cases,

starting with a significantly higher T.E. knock-down plants on the 10µM Zn treatment compared to

the vector-only plants. The translocation efficiency of vector-only and knock-down on 0.05µM Zn

treatment is significantly higher compared to the other treatments (except vector-only plants on

10µM Zn). There seems to be a decline in the translocation efficiency of Zn in the knock-down plants

with increasing Zn concentration in the medium. This is a trend however, the difference in T.E. of Zn

on 10µM Zn and 1000µM Zn is not significant.

Figure 14. Translocation efficiencies (T.E. in %) for the metals Zn, Fe and Mn. Standard error is indicated by the error bars.

Asterisks indicate a significant difference in metal concentration between Vector-only and Knock-down plants calculated

using a one-way ANOVA. The letters a, b and c are the result of the univariate analysis. Note the difference in scale of the

vertical axis.

Concluding, there are some significant differences between RNAi:NcbZIP19 knock-down plants

and vector-only plants. This might be caused by changes in NcbZIP19-regulated genes, the next step

would then be to identify possible targets of NcbZIP19 and check their gene expression in

RNAi:NcbZIP19 knock-down plants.

Vector-only plants

Knock-down plants

33

Identification of possible targets of NcbZIP19 and NcbZIP23

In order to find possible targets of NcbZIP19 and -23 (i.e. genes with a ZDRE region) I first started

by retrieving sequences of A. thaliana genes known to contain a ZDRE element in their promoter

region. Their sequences were retrieved from TAIR (www.arabidopsis.org) after which they were

BLASTed (using the BLAST tool on biotools.wurnet.nl) against the Noccaea Scaffold database. As

shown in table 9, homologues of A. thaliana’s ZIP4, ZIP10, ZIP12, IRT3 and NAS1 to -4 are found in N.

caerulescens. The homologues of AtIRT3 (NcZNT2) and AtNAS2 were found twice in the Noccaea

genome. They are referred to as ZNT2-1/ZNT2-2 and NcNAS2-1/NcNAS2-2 respectively. N.

caerulescens has however only one functional copy of NcNAS2, the other one terminates

prematurely due to an inserted stop-codon.

Table 9. Regions on a certain scaffold in the database ‘Noccaea Scaffold database’ found on the website biotool.wurnet.nl.

The column ‘Species’ shows the name of the gene of interest in Arabidopsis thaliana (and Genebank number from TAIR)

and the name of the homologue in Noccaea caerulescens (with -2 indicating a possible second copy). The column ‘Scaffold

nr.’ shows the scaffold in the Noccaea database to which the Arabidopsis gene shows resemblance. The column ‘Regions of

homology’ show the region in which (part of) the Arabidopsis gene (retrieved from TAIR) corresponds to the depicted

region in the Noccaea database. Species

Scaffold nr. Regions of homology

Arabidopsis gene Noccaea gene Arabidopsis gene Noccaea gene

AtZIP4 AT1G10970.1

NcZNT1

Scaffold 10

1 – 472 645 – 1331

2937572 – 2937100 2937052 – 2936354

1543 – 1661 2936200 – 2936083 AtZIP10 AT1G31260.1

NcZIP10

Scaffold 34

133 – 461 1130 – 1293 1526 – 1804

2222770 – 2223098 2224256 – 2224419 2224589 – 2224867

AtIRT3 AT1G60960.1

NcZNT2-1

Scaffold 225

2 – 462 645 – 1303 1473 – 1556

203679 – 203219 203071 – 202404 202181 – 202098

AtIRT3 AT1G60960.1

NcZNT2-2

Scaffold 225

6 – 462 645 – 1303 1473 – 1553

184223 – 183767 183617 – 182950 182727 – 182647

AtZIP12 AT5G62160.1

NcZIP12

Scaffold 20

5 – 611 698 – 852 850 – 1157

370304 – 370901 371046 – 371200 371289 – 371596

AtNAS1 AT5G04950.1

NcNAS1 Scaffold 1 1 – 963 1552946 – 1551981

AtNAS2 AT5G56080.1

NcNAS2-1 Scaffold 30 1 – 963 242336 – 241374

AtNAS2 NcNAS2-2

Scaffold 30

1 – 371 341 – 963

234564 – 234194 234180 – 233558

AtNAS3 AT1G09240.1

NcNAS3 Scaffold 10 1 – 854 3707376 – 3706523

AtNAS4 AT1G56430.1

NcNAS4 Scaffold 35 1 – 947 137901 – 138847

The search for ZDRE elements therefore focussed on the N. caerulescens genes homologues to

genes of A. thaliana. A region of approximately 2 kb upstream of the gene (2000 bp before START-

codon) was downloaded from the Noccaea database. This region was analysed for the presence of

the ZDRE element, results can be found in table 10 and figure 5.

34

Table 10. Localization of ZDRE elements in N. caerulescens and A. thaliana.

A. thaliana gene ZDRE in A. thaliana Homologue in N. caerulescens

ZDRE in N. caerulescens

ZIP1 1936bp upstream NcZIP1 none found

ZIP3 1566bp upstream NcZIP3 none found

ZIP4 246- and 118bp upstream ZNT1 256- and 174bp upstream

ZIP10 117bp upstream NcZIP10 149bp upstream

ZIP12 157bp upstream NcZIP12 148bp upstream

IRT3 156- and 264bp upstream ZNT2-1 140bp upstream

ZNT2-2 276-, 209- and 115bp upstream

AtNAS1 90bp downstream NcNAS1 8bp upstream and 90bp downstream

AtNAS2 8bp upstream and 90bp downstream NcNAS2-1 8bp upstream and 90bp downstream

NcNAS2-2 8bp upstream and 90bp downstream

AtNAS3 8bp upstream NcNAS3 8bp upstream

AtNAS4 8bp upstream and 93bp downstream NcNAS4 8bp upstream and 93bp downstream

What can be seen in figure 14 is that the ZDRE region in N. caerulescens consists of a 8-bp

palindrome [TGTCGACA] with an adenine or guanine at the 5’ side and a cytosine or thymine at the 3’

side. Because these nitrogenous bases are consistently found outside the 8-bp palindrome of the

ZDRE region I included them as part of the ZDRE region. Therefore three types of ZDREs are identified

(figure 15): ZDRE1: A[TGTCGACA]T; ZDRE2: G[TGTCGACA]T and ZDRE3: A[TGTCGACA]C

Figure 15. Graphic representation of the position of the ZDRE elements in N. caerulescens genes. ZDRE1: A[TGTCGACA]T;

ZDRE2: G[TGTCGACA]T; ZDRE3: A[TGTCGACA]C

35

NcbZIP19-regulated gene expression in RNAi:NcbZIP19 knock-down plants

We decided to check whether the significant differences between RNAi:NcbZIP19 knock-down

plants and vector-only plants in their metal concentration might be caused by changes in NcbZIP19-

regulated genes. For this we have identified ZNT1, -2, NAS1 to NAS4, ZIP10 and ZIP12 as possible

targets of NcbZIP19 because of the presence of a ZDRE element in their promoter region (for details

on the location of the ZDRE element see figure 14).

The plants that had shown a clear down-regulation of NcbZIP19 (figure 10) were further tested on

their gene expression of known targets of NcbZIP19. Due to time constraints the expression analysis

was performed on ZNT1 and NAS1 to NAS4 (table 4). As shown in ‘NcbZIP19 expression in

RNAi:NcbZIP19 knock-down plants’ there were 36 plants that showed a downregulation of 75% or

more, they are used in this test as the RNAi-NcbZIP19 knock-down plants.

By calculating the average expression and standard error of the vector-only plants and compare

them with those values of the knock-down plants I was able to calculate significant differences

between the two. For the significance test I used a one-way ANOVA which compares the means of

two groups; in this case vector-only (pK7GWIWG2-DsRed) versus knock-down (pK7GWIWG2-DsRed-

NcbZIP19). By performing the qPCR it was found that of these genes, only the genes ZNT1 and NAS4

showed a significantly lower expression in RNAi:NcbZIP19 knock-down plants compared to vector-

only (figure 16).

Figure 16. Relative transcript levels (RTL) of root tissue of Vector-only plants versus NcbZIP19 Knock-down plants. Relative

expression of NcbZIP19 in vector-only plants was used as a reference. Average expression is calculated of all knock-down

plants and all controls, error bars show standard error. Indicated with an asterisk are the significantly different transcript

levels of knock-down versus control. Note the difference in scale of the vertical axis.

* *

*

36

Comparing sequences of NcbZIP23 in Ganges and La Calamine.

The N. caerulescens accession used in this study is the La Calamine type. The sequence file used to

derive all genes, primers etc. has been compiled from N. caerulescens accession Ganges. This raised

the question what the differences are in sequence of La Calamine (LC) and Ganges (GA). Because of

the difficulties finding an expression of NcbZIP23 in the LC plants an attempt was made to isolate

NcbZIP23 from genomic DNA. Isolating NcbZIP23 from both LC and GA (figure 17) was done in order

to compare both sequences and at the same time checking whether the primers used to isolate the

whole gene were performing according to the expectations.

The isolated fragments (more than one fragment was amplified with the particular primers) were

ligated in the pGEM®-T Easy vector according to the manufacturer’s instructions (Promega). The

plasmids were checked for the presence of the right insert by enzyme digestion by EcoRI and NotI

(figure 18). For EcoRI the fragment-sizes are not according to the expected sizes, therefore multiple

fragments were send for sequencing by Eurofins MWG Operon.

Figure 18. Results of the ligation of the pGEM-T Easy vector with NcbZIP23 as possible insert. 2-# represents the bottom

band from Ganges, 3-# the top band from La Calamine, 4-# the bottom band from La Calamine; all from the NcbZIP23 whole

gene amplification (respectively band 2, 3 and 4 from figure 17). NotI and EcoRI represent the restriction enzymes used in

the reaction. Expected sizes for digestion by NotI are: 1153 bp and 2981 bp; for EcoRI the expected sizes are: 120 bp, 1017

bp and 3032 bp. Resulting fragment sizes are shown in the figure for those samples that were send for sequencing.

Figure 17. Fragments that were extracted from the gel

(by primer sam003004) in order to isolate NcbZIP23

from both the La Calamine and Ganges accession of N.

caerulescens. Two annealing temperatures were

tested, as shown: both result in the same fragments.

The two bands per accession were treated as one and

isolated as such. The expected size for the whole gene

is 1119bp. Accordingly bands 2 and 4 seem to be of the

expected size.

37

Sequencing revealed that band 2-8 and 2-9 from accession GA (as shown in figure 17) contained

the actual NcbZIP23 (appendix 9). The fragments amplified from the LC accession on the other hand

showed that band 3 has a similarity with gb|CP002684.1|: ‘Arabidopsis thaliana chromosome 1

complete sequence’ (TAIR website) in the vicinity of gene SRD2 (region 10038700- to 10040000 bp).

The sequence is a match with Scaffold 24 of the Noccaea database as opposed to Scaffold 3 were

NcbZIP23 is found. It therefore seems that a different gene is amplified in this case. Fragment 4 does

not show any similarities with any regions of notable size. The culturing of bacteria with the plasmid

containing fragment 1 did not work (no colonies showed up in the blue/white screening) and

therefore the sequence of that fragment remains elusive. As its size seems to be similar to that of

fragment 3 it can be hypothesised that also the sequence would be similar.

Figure 19. Results of gradient PCR for the amplification of bZIP23. Six primer combination were used on each five

temperatures. The bottom row shows the results from GA-accession, the top row from LC-accession. Numbers 1-5 indicate

the temperatures: 1-48.0°C; 2-49.7°C; 3-52.6°C; 4-57.0°C; 5-62.3°C. Indicated by a square box are the fragments of La

Calamine cDNA.

To explore all possibilities to amplify (a fragment of) NcbZIP23 a gradient PCR reaction was set up

to try a number of primer combinations. Annealing temperatures ranged from 48°C to 62,3°C and

elongation times were set according to the expected fragment length (table 6, materials and

methods). As shown in figure 19; both primer combination 003-008 as well as primer combination

003-018 show a fragment from La Calamine gDNA, however not close to the expected size (which

was 653bp and 728bp respectively). The other primer combinations resulted in no fragment on any

of the annealing temperatures from the gradient PCR. Contrary to this, all primer combinations seem

to have resulted in the right fragment sizes for Ganges gDNA; this obvious difference in result from

GA and LC might lead to the assumption that no NcbZIP23 is present in the N. caerulescens La

Calamine accession.

38

Discussion

Previous research has shown that in A. thaliana, AtbZIP19, AtbZIP23 and AtZIP4 are induced upon

zinc deficiency and that AtZIP4 is regulated by AtbZIP19 and -23 (Assunção, Herrero et al. 2010)

whereas its homolog NcZNT1 is constitutively expressed in N. caerulescens (Verbruggen, Hermans et

al. 2009). This raised the question as to whether NcZNT1 is regulated by both NcbZIP19 and -23.

Therefore the first aim of this thesis was to identify homologues of AtbZIP19 and -23 in N.

caerulescens. Finding NcbZIP19 succeeded, NcbZIP23 prove itself to be more elusive (more about

identifying NcbZIP23 below). NcbZIP19 was found in both the ‘Noccaea caerulescens ESTs’

(isotig08734: position 296 to 1169) and the ‘Noccaea Scaffold database’ (Scaffold 8: position 2213739

to 2215245, table 7). Knowing that NcbZIP19 is present in the Noccaea genome brought the question

as to whether its function would be comparable to that of AtbZIP19; namely regulating the

expression of metal homeostasis genes in A. thaliana (Assunção, Herrero et al. 2010). The next

experiment was therefore to check for possible differences in expression between N. caerulescens

and A. thaliana, expecting to see the regulatory elements to be differentially expressed as NcZNT1

was earlier found to be constitutively expressed in N. caerulescens (Verbruggen, Hermans et al.

2009).

Comparing metal homeostasis genes in A. thaliana and N. caerulescens

For this gene expression analysis the housekeeping NcClathrin was used as a reference gene as

they were previously shown to be stable reference genes (Gendre, Czernic et al. 2007; Nguyen 2010).

Using the geNORM program in the qBASEplus software showed however that the gene was not as

stable as hoped. With an M value of 1.057 it just exceeded the threshold and only after removing the

data obtained from the high cadmium and nickel treatment did it reach a value <1 (0.875). This does

mean that the expression data obtained from the high nickel and cadmium treatments might be

attributed to low reference gene stability. This might be explained by the negative effects of both

cadmium or nickel to the plants health since both metals were administered in high concentrations.

As a result we should tread carefully to conclude anything on the difference between A. thaliana and

N. caerulescens in the aforementioned treatments.

The relative gene expression of AtbZIP19 showed some different results as compared to the gene

expression study done by Assunção et al. (2010). As can be seen in figure 16; in shoot tissue there is

no significant difference in the expression of AtbZIP19 between the different treatments. Only under

the high cadmium treatment expression seems to be a little lower but this might be due to the

unstable reference gene. For NcbZIP19, expression seemed to be higher than AtbZIP19; however only

significant in zinc deficient and high cadmium treatments. In root tissue however, it seems to be

opposite; AtbZIP19 seems to be higher expressed than NcbZIP19. This seems to be a trend; relative

expression of AtbZIP19 is significantly higher expressed than NcbZIP19 in high zinc, nickel and

cadmium treatments only; not in the low and normal zinc treatments. Found in earlier research

performed in A. thaliana by Assunção et al. (2010), AtbZIP19 was significantly higher expressed under

zinc deficient conditions, I on the other hand, found AtbZIP19 to be expressed in zinc deficient and

normal treatments, not significantly different from one another in both root and shoot tissue. In root

tissue, AtbZIP19 seems to be higher expressed according to the increase of zinc concentration in the

treatments. This results in a two-fold difference from zinc deficient to high zinc concentrations which

39

is significant according to the univariate analysis (appendix 7). We can conclude that AtbZIP19 is

constitutively expressed in shoot tissue of A. thaliana, regardless of the metal treatment. NcbZIP19 is

also constitutively expressed in shoot tissue of N. caerulescens. In root tissue AtbZIP19 is also

constitutively expressed and shows an almost twofold higher expression under high zinc treatment.

NcbZIP19 shows a lower expression in root tissue compared to AtbZIP19 and a higher expression of

NcbZIP19 is found in shoot tissue compared to AtbZIP19. This might be explained by the difference in

metal homeostasis between N. caerulescens and A. thaliana if bZIP19 is responsible for the transport

or storage of metals. Hyperaccumulators are able to store a large amount of metals in their

aboveground tissue for which a highly complex network of genes is involved (van de Mortel, 2006).

One possibility is that NcbZIP19 regulates the expression of genes involved in the aforementioned

processes in order to accommodate the accumulation of heavy metals.

However, there is a difference in outcome of the expression analysis in this thesis and in the

research done by Assunção et al. (2010), why? This might be caused by a difference in plant rearing

conditions; we used ½Hoaglands’ solution whereas ½MS media was used to grow the plants by

Assunção et al. As reviewed by Poorter et al. (2012), differences in plants breeding conditions can

have quite an effect on the outcome of the study (in this case gene expression analysis). It is

hypothesised that replicability and reproducibility are expected to increase when environmental

conditions are under stricter control (Poorter, Fiorani et al. 2012). Plant tissue in the Assunção paper

consists of pulled root and shoots whereas in this thesis the root and shoot tissue was analyzed

separately. Concluding: it might be expected that plants grown on different media and samples

consisting of different tissue types might not be easily comparable with regard to their gene

expression.

Earlier research has found AtZIP4 to be regulated by AtbZIP19; this lead to the expectation that

(with AtbZIP19 constitutively expressed) AtZIP4 will be constitutively expressed in root and shoot

tissue of A. thaliana. We also hypothesised that NcZNT1 (being homologues to AtZIP4) is regulated by

NcbZIP19 which resulted in the expectation that the expression of NcZNT1 in shoot tissue is higher

than that of AtZIP4 and vice versa in root tissue (as a result of the expression of At/NcbZIP19). This is

not what we found; as can be seen in figure 5. In shoot tissue ZNT1 is not constitutively expressed in

N. caerulescens. Except for the expression of AtZIP4 under zinc deficiency, NcZNT1 is higher

expressed under all treatments (significantly higher in the high Zn, -Cd and -Ni treatments). It seems

as if both NcZNT1 and AtZIP4 are induced in zinc deficient conditions in shoot tissue which does not

seem to be a direct effect of the expression of bZIP19 in shoot tissue of both A. thaliana and N.

caerulescens. In root tissue there seem to be more differences between A. thaliana and N.

caerulescens. AtZIP4 is induced in zinc deficient conditions and is very low expressed in the other

treatments. NcZNT1 however increases its expression as the zinc concentration increases, although

not significantly according to the univariate analysis (appendix 6). There seems to be a trend that in

high metal concentrations NcZNT1 is upregulated in root tissue as opposed to the very low

expression of AtZIP4 under high metal concentrations. In a recent study performed by Milner et al.

(2012) it was shown that NcZNT1 is higher expressed in root tissue than in shoot tissue, contradictory

to what I find. The decrease of NcZNT1 expression with increasing zinc concentrations does show

also in their results (Milner, Craft et al. 2012). What has to be noted is the fact that the plant growth

conditions from Milner et al. (2012) are again different from what we did and might account (in part)

for the difference in results (Poorter, Fiorani et al. 2012).

40

The upregulation of NcZNT1 does make sense, genes from the ZIP-family are thought to play a

major role in metal uptake in plants (Guerinot 2000) and one of the mechanisms of heavy metal

hyperaccumulators is to enhance the uptake of heavy metals (Hassan and Aarts 2011). Therefore an

increase in expression of NcZNT1 in N. caerulescens might very well be one of the mechanisms

responsible for its hyperaccumulating abilities.

As a result of this analysis the question raised as to whether NcbZIP19 is regulating the expression

of NcZNT1 for instance. Also the expression analysis of other possible targets is of importance since

bZIP19 is expected to regulate more genes than ZIP4/ZNT1. The main conclusion that can be drawn

from the former experiment is that there are serious differences in gene expression of our genes of

interest between N. caerulescens and A. thaliana. This implies a functional difference of our genes of

interest in the two species; since AtbZIP19 and AtZIP4 have been analysed before (Assunção, Herrero

et al. 2010) we chose to take a closer look art NcbZIP19 and its targets. For this an RNAi knock-down

approach was chosen; NcbZIP19 was knocked-down in N. caerulescens after which gene expression-

and metal content analysis was performed.

RNAi::NcbZIP19 knock-down plants, gene expression- and metal content analysis

Creating knock-down mutants using RNA interference is a fast and effective method (Limpens,

Ramos et al. 2004). The RNAi::NcbZIP19 knock-down construct I created was quite effective in

downregulating the expression of NcbZIP19 (as can be seen in figure 10). From all plants that

germinated (485 out of the 500 seeds sown) 169 were successfully transformed, either with vector-

only or with the knock-down construct (table 8). From these plants a selection was chosen for the

actual experiments on different metals, mainly judged on size of roots and aboveground tissue. A

total of 46 plants were tested on the expression of NcbZIP19, only two of them showed no

downregulation whereas it was expected.

For the transformation two batches of seeds were used from the same accession of N.

caerulescens (La Calamine A522, LC42 1-4 and 1-11). I decided to pull the data from both batches and

use their average (gene expression, metal concentration etc.) values for analysis. To check whether

there is a difference between both batches I checked the average values from batch 1-4 and

compared them with 1-11 using a one-way ANOVA; no statistically significant difference was found

between the two batches. I therefore decided to treat them as one seed-batch for my analysis. We

can conclude that the knock-down construct is a very efficient one; all NcbZIP19 expression was 5-

22% of those of the vector-only plants with an average of 12% (88% downregulation). An average of

12% is deduced from an average expression level of 0.12 (appendix 4).

Transformation mediated by A. rhizogenes only results in transformed roots (Limpens, Ramos et

al. 2004), a downside of that is that no shoot tissue is transformed. However, hyperaccumulation of

Zn is mostly affected by root processes (Guimarães, Gustin et al. 2009); it can therefore be

speculated that a knock-down in root tissue will have an effect on the Zn homeostasis and Zn

accumulation in shoot tissue as well.

The first thing we looked at when examining the effect of a knock down of NcbZIP19 was the

phenotype of plants grown on different concentrations of zinc. A phenotypic effect of a knock-down

of NcbZIP19 (e.g. chlorosis in the case of zinc deficiency) was not visible after three weeks growth on

the different media (appendix 3). Also the control (vector-only) plants did not show a phenotype.

41

This lack of phenotype might have been due to the fact that the plants were only growing on the

different zinc treatments for three weeks whereas other researchers usually grow the plants for four

weeks (Van De Mortel, Villanueva et al. 2006). Another possibility might be that the plants were

grown on a normal zinc treatment for the first three weeks on ½Hoagland solution (Assunção,

Bookum et al. 2003) supplied with 10µM of zinc. This might have given the plants enough time to

accumulate a sufficient amount of zinc which explains the lack of a phenotypic response. Due to time

constraints the decision was made to harvest the plants anyway. The expectation was that the knock-

down of NcbZIP19 would have an effect on the expression of its target genes which on their turn

would have an effect on the metal uptake and -transport. This would not immediately give rise to a

phenotype but will be preceded by changes in gene expression. Hence; analysis gene expression

might reveal those changes before a change in phenotype becomes apparent.

As bZIP19 is known to be involved in regulation of metal homeostasis genes in A. thaliana with a

ZDRE in their promoter region (AtZIP1, -3, -4, -5, -9, -12, and IRT3) (Assunção, Herrero et al. 2010),

the search for ZDRE regions focussed on those genes in N. caerulescens. Considering the sequence

analysis for the ZDRE element in the Noccaea GA accession nine genes were found to contain at least

one ZDRE element in their promoter region (table 9). If these nine genes are direct targets of

NcbZIP19 this would mean that all nine genes would be affected by a downregulated transcription

factor. Due to time-constraints and primers that were not specifically available for the second copy

of ZNT2 not all nine genes were tested. In the next paragraphs I will try to explain gene expression (or

a lack thereof), metal content and transformation efficiency and find out whether there is a link

between them.

When looking into the metal concentration of the plants grown on different media not many

differences between vector-only plants and knock-down plants can be found (figure 14). The plants

were tested on three different metals in shoot tissue: Zn, Mn and Fe. On root tissue four metals were

tested: Zn, Mn, Fe and Cu. Zinc was the obvious choice as the plants were grown on media with

different concentrations of Zn. Iron, Cupper and Manganese are all divalent ions and important

micronutrients for plants like zinc (Marschner 1995); therefore chosen to be measured. We found

little difference between the knock-down plants and vector-only with respect to their metal content.

In shoot tissue, vector only plants were found to contain more Zn when grown on normal Zn

treatments and more Fe when grown on high Zn treatment. In root tissue, NcbZIP19 knock-down

plants were found to contain more Fe when grown on low Zn.

The absence of a major effect on metal sequestration in the knock-down plants raises the

question whether the targets of NcbZIP19 are responsible for the uptake of metals. It has been

suggested that ZNT1 is a root zinc uptake transporter (Pence, Larsen et al. 2000), however if that

were true, you would expect to see a difference in Zn concentration, especially in root tissue. Since

no difference in Zn concentration is found when comparing vector-only plants and NcbZIP19 knock-

down plants the question raises whether ZNT1 is actually the zinc uptake transporter that it is

thought to be.

The transcription factor bZIP19 has been found to regulate genes involved in the metal

homeostasis network in A. thaliana (Assunção, Herrero et al. 2010). Part of the metal homeostasis

network is the transport of metals throughout the plant. Therefore; if bZIP19 is downregulated in N.

caerulescens there might be an effect on the transport of metals. A logical step seemed therefore to

calculate the translocation efficiencies of the different metals. The translocation efficiency is a way to

42

check the ability of the plant to transport of metals from root to shoot tissue. This gave some

interesting results for the translocation efficiency of Zn (figure 15 and appendix 4). No significant

difference was found in the translocation efficiency of Fe and Mn, the concentrations of both Fe and

Mn were constant in the different metal treatments; this might also confirm the specificity of the

targets of NcbZIP19 for Zn. The transformation efficiency for Zn in the knock-down plants shows a

declining trend in increasing Zn concentrations in growth medium. These findings together with the

fact that the vector-only plants do not show the severe decrease in translocation efficiency on 10µM

Zn (on the contrary, they show a T.E. of ±170%) suggests that targets of NcbZIP19 are part of the

transportation mechanism of Zn.

The relative expression of the tested genes (ZNT1 and NAS1-4) can be found in figure 13. As can

be seen only ZNT1 and NAS4 are downregulated in response to the knock-down of NcbZIP19. The

average level of expression of ZNT1 in vector-only plants is roughly the same as that of bZIP19 in

vector-only plants whereas the average expression level of ZNT1 in knock-down plants is 5% of that

in vector-only plants. This implies that ZNT1 is controlled only by bZIP19, downregulation of bZIP19

results in a direct downregulation of ZNT1. To prove this; a gene expression analysis on for instance

different time points and treatments could be done, whereby the expression of NcbZIP19 and ZNT1

should be closely monitored in both a NcbZIP19 knock-down plant and control (vector-only) plants.

This experiment would also be an appropriate follow-up in the case of NAS4. NAS4 was the only

NAS-gene tested that showed a downregulation in response to a downregulated NcbZIP19. The

average expression of NAS4 in vector-only plants is 39% of that of NcbZIP19 in those plants. The

average expression of NAS4 in knock-down plants is significantly lower than its expression in vector-

only plants; with an average expression of 0.11 it can be concluded that also NAS4 is regulated by

NcbZIP19, downregulation of bZIP19 results in a direct downregulation of NAS4. For NAS1-3 can be

postulated that there is another regulatory element involved in the expression of those genes since

the knock-down of NcbZIP19 did not yield a significant change in expression as compared to the

vector-only plants.

NAS4 in N. caerulescens is constitutively expressed in the roots and leaves under different zinc

conditions which imply an important role in the trafficking of zinc (van de Mortel, Villanueva et al.,

2006). A downregulated transcription factor of NAS4 would then result in a lower root to shoot

translocation of heavy metals. This has been found in the case of zinc where the NcbZIP19 knock-

down plant showed significant lower translocation efficiency compared to vector-only plants in

plants grown on 10µM of zinc. The difference was not significant in the other treatments (0.05µM

and 1000µM Zn) but there seems to be a trend that with increasing zinc concentrations the

translocation efficiency goes down. Also the downregulation of ZNT1 can be of effect on the

translocation efficiency of zinc. It has been hypothesised that since ZNT1 is expressed in the stele of

N. caerulescens (Milner, Craft et al. 2012) it is associated with long distance transport of zinc. So since

no obvious difference in metal concentrations are found in knock-down versus control plants but the

translocation of zinc does show a significant difference when comparing the two, NAS4 and ZNT1 are

most likely involved in the transport of zinc in N. caerulescens.

As explained earlier, not all possible targets of NcbZIP19 were tested on their level of expression.

Both ZNT2 and NcZIP10 are known to be higher expressed in N. caerulescens than their homologues

(IRT3 and AtZIP10) in A. thaliana (Van De Mortel, Villanueva et al. 2006), this implies a function for

43

those genes in the metal accumulation pathway. Further gene expression analysis is therefore

needed to find out whether the expression of ZNT2 and NcZIP10 and -12 is influenced by the

downregulation of NcbZIP19.

There is a hiatus in this research however; the gene expression analysis was performed with plant

material of plants grown on their normal zinc treatment (10µM Zn) and the metal content analysis

was performed on plant tissue grown on different zinc treatments. This could mean that comparing

the metal measurement study (including translocation efficiencies) and the gene expression study is

not fully appropriate. For all we know, the transcript levels of for instance ZNT1 could have gone up,

explaining the lack of difference in metal content comparing vector-only and NcbZIP19 knock-down

plants. Luckily plant material for all treatments is available and it is therefore highly recommendable

to check this material for the gene expression of NcbZIP19 and its suspected targets. It would be very

interesting to analyse the gene expression of RNAi:NcbZIP19 knock-down plants and compare it to

the metal content analysis. This would give us a better overview on the effect of gene expression on

for instance the metal content and translocation efficiency.

Isolating NcbZIP23 from N. caerulescens

One of the aims of my thesis was to create knock-down mutants of both NcbZIP19 and -23. For

the NcbZIP23 this proved itself to be a lot harder than expected. For instance: in the ‘Noccaea

caerulescens ESTs’ genome (transcriptomics) database, NcbZIP23 was not found in there. This does

not necessarily mean that the gene is nowhere expressed; the transcriptomics database is

constructed of root- and shoot tissue grown in ½Hoagland’s solution (10µM Zn) and from flowers of

plants grown on soil (Lin, personal communication). This led us to believe that we might find

NcbZIP23 by checking a number of different treatments. For this we checked cDNA from N.

caerulescens grown on the different treatments as shown in figure 3 (root and shoot tissue) and the

fragments of which we thought was NcbZIP23 were (by sequencing) found to be NcbZIP19. This

raised the thought that the La Calamine accession we were using in our experiments might have a

sequential difference compared to the Ganges accession on which the sequence databases are

constructed. In order to find out we tried to amplify the whole gene from both GA and LC and got

them sequenced. The GA accession contained NcbZIP23 (fragment 2, figure 17). For La Calamine

however, fragment 3 and 4 showed no resemblance to NcbZIP23.

This might be explained by the phenomena of interspecies variation. Interspecies variation in the

accumulation of for instance Cd is present in N. caerulescens, a difference in gene copy number of

HMA4 was found to be responsible for the difference between different N. caerulescens accessions

in their ability to accumulate Cd (Craciun, Meyer et al. 2012). This raises the question as to whether a

difference in gene copy number might also play a role in the case of NcbZIP23. Further attempts to

amplify NcbZIP23 were therefore conducted to find out whether NcbZIP23 is absent or present. One

of the approaches would be a southern blot in order to be absolutely positive of the presence of

NcbZIP23. However, due to time constraints, this has not been an option during my thesis. Therefore

other approaches were preferred. I tried to increase the chances of amplification by combining

different primers and perform a gradient PCR (figure 18). All primer combinations and annealing

temperatures gave no fragments (of expected sizes that is) in the case of La Calamine. The Ganges

accession showed fragments for all primer combinations as was expected. It might be interesting to

44

speculate on the difference in metal hyperaccumulating abilities of GA and LC (Assunção, Bookum et

al. 2003) and whether these differences can be explained by the (possible) lack of NcbZIP23 in La

Calamine. It has been shown for instance that the La Calamine accession shows a lower metal

concentration in root- and shoot tissue in the case of Zn, Cd and Ni compared to plants of the Ganges

accession. Whether this difference can partly be accounted for by the lack of NcbZIP23 would be

interesting to research.

Concluding: the only way to be absolutely certain of the absence of NcbZIP23 in La Calamine is to

perform a Southern Blot. Due to time constraints this was not done but is still highly

recommendable.

45

Conclusions

The goal of my thesis was to perform a ‘functional studies of NcbZIP19 and -23 in N. caerulescens

and A. thaliana’. For this gene expression A. thaliana and N. caerulescens were compared by

analysing the expression of At/NcbZIP19 and ZIP4/ZNT1, an RNAi:NcbZIP19 knock-down construct

was used to transform N. caerulescens plants after which a gene expression, metal content and

translocation efficiency analysis was performed and finally a search for NcbZIP23 in N. caerulescens

was commenced.

In summary; what can be concluded or hypothesised from all the experiments that I have

performed is for instance the role of NcZNT1 and NcNAS4 in the translocation or transport of metals

from root to shoot tissue. Knocking down of NcbZIP19 resulted in a downregulation of NcZNT1 and

NAS4 which in its turn might have caused the decreased translocation efficiency. A big reservation

has to be made however; tissue for the gene expression analysis was different from the tissue used

for metal concentration measurements. In order to create a more complete picture I strongly advice

to use the tissue harvested from the plants the moment they were harvested for metal

concentration measurements. By doing this the actual (relative) gene expression can be analysed and

properly compared to the metal concentration data.

From comparing the relative gene expression between A. thaliana and N. caerulescens I found

AtbZIP19 to be higher expressed in root tissue and NcbZIP19 to be higher expressed in shoot tissue.

From this we can hypothesise that targets of NcbZIP19 are involved in the transport of metals more

than the uptake; which confirms the findings in the NcbZIP19 knock-down experiment. Also the

expression of ZIP4/ZNT1 was analysed; ZNT1 was higher expressed than ZIP4 except for zinc-deficient

conditions. This might also point in the direction of the metal transport: no metals present means no

need for transport, when zinc becomes available so does the need to transport it to aboveground

tissue for storage. No clear connection was found however between the expression of bZIP19 and

ZIP4/ZNT1; I would suggest to test more possible targets of bZIP19 in both plants such as the NAS-

genes to complete the picture.

Knocking down of NcbZIP19 with the construct I used prove itself to be a very effective one, it

resulted in a downregulation of 5-22% with only few plants that showed no downregulation whereas

they were transformed. So for further experiments I would suggest to use this construct to perform

more analysis on the function of NcbZIP19.

I also found that NcbZIP23 is most likely not present in N. caerulescens accession La Calamine, the

only way to be absolutely sure about this is to perform a Southern Blot analysis and I therefore

strongly recommend it to be done. It could prove itself to be a nice example of interspecies variation.

As said earlier, there are two sides of the problem; on the one hand there is pollution of soil with

heavy metals and on the other hand there are places around the world where plants face metal

deficiency, both of which cause global health issues. Research on metal homeostasis in plants will

provide valuable insight in these problems and may find ways to solve them.

46

References

Assunção, A. G. L., W. M. Bookum, et al. (2003). "Differential metal-specific tolerance and accumulation patterns among Thlaspi caerulescens populations originating from different soil types." New Phytologist 159(2): 411-419.

Assunção, A. G. L., P. Da CostaMartins, et al. (2001). "Elevated expression of metal transporter genes in three accessions of the metal hyperaccumulator Thlaspi caerulescens." Plant, Cell and Environment 24(2): 217-226.

Assunção, A. G. L., E. Herrero, et al. (2010). "Arabidopsis thaliana transcription factors bZIP19 and bZIP23 regulate the adaptation to zinc deficiency." Proceedings of the National Academy of Sciences of the United States of America 107(22): 10296-10301.

Assunção, A. G. L., H. Schat, et al. (2003). "Thlaspi caerulescens, an attractive model species to study heavy metal hyperaccumulation in plants." New Phytologist 159(2): 351-360.

Baker, A. J. M. and P. L. Walker (1990). Ecophysiology of metal uptake by tolerant plants, heavy metal tolerance in plants. Shaw AJ Evolutionaty Aspects. Boca Raton, CRC: 155-177.

Banerjee, S. and H. Flores-Rozas (2005). "Cadmium inhibits mismatch repair by blocking the ATPase activity of the MSH2-MSH6 complex." Nucleic Acids Research 33(4): 1410-1419.

Brown, S. L., R. L. Chaney, et al. (1995). "Zinc and cadmium uptake by hyperaccumulator Thlaspi caerulescens grown in nutrient solution." Soil Science Society of America Journal 59(1): 125-133.

Cha-aim, K., T. Fukunaga, et al. (2009). "Reliable fusion PCR mediated by GC-rich overlap sequences." Gene 434(1-2): 43-49.

Chaffai, R. and H. Koyama (2011). Heavy metal tolerance in Arabidopsis thaliana. Advances in Botanical Research. 60: 1-49.

Clemens, S. (2001). "Molecular mechanisms of plant metal tolerance and homeostasis." Planta 212(4): 475-486.

Clemens, S. (2006). "Toxic metal accumulation, responses to exposure and mechanisms of tolerance in plants." Biochimie 88(11): 1707-1719.

Clemens, S., M. G. Palmgren, et al. (2002). "A long way ahead: Understanding and engineering plant metal accumulation." Trends in Plant Science 7(7): 309-315.

Corpet, F. (1988). "Multiple sequence alignment with hierarchical clustering." Nucleic Acids Research 16(22): 10881-10890.

Corrêa, L. G., D. M. Riaño-Pachón, et al. (2008). "The role of bZIP transcription factors in green plant evolution: adaptive features emerging from four founder genes." PLoS ONE 3(8).

Craciun, A. R., C.-L. Meyer, et al. (2012). "Variation in HMA4 gene copy number and expression among Noccaea caerulescens populations presenting different levels of Cd tolerance and accumulation " J. Exp. Bot. 63 (11): 4179-4189.

Dainty, S. J., C. A. Kennedy, et al. (2008). "Response of Schizosaccharomyces pombe to zinc deficiency." Eukaryotic Cell 7(3): 454-464.

Ehrensberger, K. M. and A. J. Bird (2011). "Hammering out details: Regulating metal levels in eukaryotes." Trends in Biochemical Sciences 36(10): 524-531.

Eide, D. J. (2006). "Zinc transporters and the cellular trafficking of zinc." Biochimica et Biophysica Acta - Molecular Cell Research 1763(7): 711-722.

Epstein, E. and A. Bloom (2005). Mineral nutrition of plants: Principles and perspectives, Sinauer Associates, Sunderland, Maryland.

Freeman, J. L., M. W. Persans, et al. (2004). "Increased glutathione biosynthesis plays a role in nickel tolerance in Thlaspi nickel hyperaccumulators W inside box sign." Plant Cell 16(8): 2176-2191.

Gendre, D., P. Czernic, et al. (2007). "TcYSL3, a member of the YSL gene family from the hyper-accumulator Thlaspi caerulescens, encodes a nicotianamine-Ni/Fe transporter." Plant Journal 49(1): 1-15.

47

Göhre, V. and U. Paszkowski (2006). "Contribution of the arbuscular mycorrhizal symbiosis to heavy metal phytoremediation." Planta 223(6): 1115-1122.

Guerinot, M. L. (2000). "The ZIP family of metal transporters." Biochimica et Biophysica Acta - Biomembranes 1465(1-2): 190-198.

Guerinot, M. L. and D. Eide (1999). "Zeroing in on zinc uptake in yeast and plants." Current Opinion in Plant Biology 2(3): 244-249.

Guimarães, M. D. A., J. L. Gustin, et al. (2009). "Reciprocal grafting separates the roles of the root and shoot in zinc hyperaccumulation in Thlaspi caerulescens." New Phytologist 184(2): 323-329.

Hall, J. L. (2002). "Cellular mechanisms for heavy metal detoxification and tolerance." Journal of Experimental Botany 53(366): 1-11.

Hanikenne, M. and C. Nouet (2011). "Metal hyperaccumulation and hypertolerance: A model for plant evolutionary genomics." Current Opinion in Plant Biology 14(3): 252-259.

Hänsch, R. and R. R. Mendel (2009). "Physiological functions of mineral micronutrients (Cu, Zn, Mn, Fe, Ni, Mo, B, Cl)." Current Opinion in Plant Biology 12(3): 259-266.

Hassan, Z. and M. G. M. Aarts (2011). "Opportunities and feasibilities for biotechnological improvement of Zn, Cd or Ni tolerance and accumulation in plants." Environmental and Experimental Botany 72(1): 53-63.

Hellemans, J., G. Mortier, et al. (2007). "qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data." Genome biology 8(2).

Herrero Serrano, E. (2007). Identification of DNA binding proteins that interact with the promoter of the Arabidopsis ZIP4 zinc transporter. Department of Genetics. Wageningen, Wageningen University and Research Centre. Master thesis.

Jakoby, M., B. Weisshaar, et al. (2002). "bZIP transcription factors in Arabidopsis." Trends in Plant Science 7(3): 106-111.

Järup, L. (2003). "Hazards of heavy metal contamination." British Medical Bulletin 68: 167-182. Jiménez-Ambriz, G., C. Petit, et al. (2007). "Life history variation in the heavy metal tolerant plant

Thlaspi caerulescens growing in a network of contaminated and noncontaminated sites in southern France: Role of gene flow, selection and phenotypic plasticity." New Phytologist 173(1): 199-215.

Koch, M., K. Mummenhoff, et al. (1998). "Systematics and evolutionary history of heavy metal tolerant Thlaspi caerulescens in Western Europe: Evidence from genetic studies based on isozyme analysis." Biochemical Systematics and Ecology 26(8): 823-838.

Krämer, U., I. N. Talke, et al. (2007). "Transition metal transport." FEBS Letters 581(12): 2263-2272. Küpper, H. and L. V. Kochian (2010). "Transcriptional regulation of metal transport genes and mineral

nutrition during acclimatization to cadmium and zinc in the Cd/Zn hyperaccumulator, Thlaspi caerulescens (Ganges population)." New Phytologist 185(1): 114-129.

Limpens, E., J. Ramos, et al. (2004). "RNA interference in Agrobacterium rhizogenes-transformed roots of Arabidopsis and Medicago truncatula." Journal of Experimental Botany 55(399): 983-992.

Lin, Y. F. and M. G. M. Aarts (2012). "The molecular mechanism of zinc and cadmium stress response in plants." Cellular and Molecular Life Sciences: 1-20.

Lin, Y. F., H. M. Liang, et al. (2009). "Arabidopsis IRT3 is a zinc-regulated and plasma membrane localized zinc/iron transporter." New Phytologist 182(2): 392-404.

Livak, K. J. and T. D. Schmittgen (2001). "Analysis of relative gene expression data using real-time quantitative PCR and the 2 -ΔΔCT method." Methods 25(4): 402-408.

Lombi, E., F. J. Zhao, et al. (2000). "Cadmium accumulation in populations of Thlaspi caerulescens and Thlaspi goesingense." New Phytologist 145(1): 11-20.

Marschner, H. (1995). Mineral nutrition of higher plants, Academic Press, London. McLaughlin, M. J., D. R. Parker, et al. (1999). "Metals and micronutrients - Food safety issues." Field

Crops Research 60(1-2): 143-163.

48

Milner, M. J., E. Craft, et al. (2012). "Characterization of the high affinity Zn transporter from Noccaea caerulescens, NcZNT1, and dissection of its promoter for its role in Zn uptake and hyperaccumulation." New Phytologist 195(1): 113-123.

Milner, M. J. and L. V. Kochian (2008). "Investigating heavy-metal hyperaccumulation using Thlaspi caerulescens as a model system." Annals of Botany 102(1): 3-13.

Murphy, A. and L. Taiz (1995). "Comparison of metallothionein gene expression and nonprotein thiols in ten Arabidopsis thaliana ecotypes. Correlation with copper tolerance." Plant Physiology 109(3): 945-954.

Nguyen, D. (2010). Contribution of nas1 knockout in evolution of heavy metal hyperaccumulation trait in Thlaspi caerulescens. Laboratory of Genetics. Wageningen, Wageningen UR. Master.

Nriagu, J. O. and J. M. Pacyna (1988). "Quantitative assessment of worldwide contamination of air, water and soils by trace metals." Nature 333(6169): 134-139.

Peer, W. A., M. Mamoudian, et al. (2003). "Identifying model metal hyperaccumulating plants: Germplasm analysis of 20 brassicaceae accessions from a wide geographical area." New Phytologist 159(2): 421-430.

Pence, N. S., P. B. Larsen, et al. (2000). "The molecular physiology of heavy metal transport in the Zn/Cd hyperaccumulator Thlaspi caerulescens." Proceedings of the National Academy of Sciences of the United States of America 97(9): 4956-4960.

Pollard, A. J., K. D. Powell, et al. (2002). "The genetic basis of metal hyperaccumulation in plants." Critical Reviews in Plant Sciences 21(6): 539-566.

Poorter, H., F. Fiorani, et al. (2012). "The art of growing plants for experimental purposes: a practical guide for the plant biologist." CSIRO PUBLISHING, Functional Plant Biology.

Riechmann, J. L., J. Heard, et al. (2000). "Arabidopsis transcription factors: Genome-wide comparative analysis among eukaryotes." Science 290(5499): 2105-2110.

Rigola, D., M. Fiers, et al. (2006). "The heavy metal hyperaccumulator Thlaspi caerulescens expresses many species-specific genes, as identified by comparative expressed sequence tag analysis." New Phytologist 170(4): 753-766.

Risse and J. Sachs (1865). Handbuch der Experimental-Physiologie der Pflanzen. Leipzig, Germany, Verlag von Wilhelm Engelmann.

Sanità Di Toppi, L. and R. Gabbrielli (1999). "Response to cadmium in higher plants." Environmental and Experimental Botany 41(2): 105-130.

Schat, H., M. Llugany, et al. (2000). Metal-specific patterns of tolerance, uptake, and transport ofheavy metals in hyperaccumulating and non-hyperaccumulating metallophytes. Terry N, Banuelos G, eds. Phytoremediation of contaminated soils and water. Boca Raton, FL, USA, CRC Press LLC: 171-188.

Schat, H. and R. Vooijs (1997). "Multiple tolerance and co-tolerance to heavy metals in Silene vulgaris: A co-segregation analysis." New Phytologist 136(3): 489-496.

Tutin, T. G., N. A. Burges, et al. (1993). Flora Europaea. Cambridge, UK, University Press. Van De Mortel, J. E., L. A. Villanueva, et al. (2006). "Large expression differences in genes for iron and

zinc homeostasis, stress response, and lignin biosynthesis distinguish roots of Arabidopsis thaliana and the related metal hyperaccumulator Thlaspi caerulescens." Plant Physiology 142(3): 1127-1147.

Verbruggen, N., C. Hermans, et al. (2009). "Molecular mechanisms of metal hyperaccumulation in plants." New Phytologist 181(4): 759-776.

49

Appendices

Appendix 1 Comparing coding sequences from bZIP19 and bZIP23 Page 48

Appendix 2 Sequence alignment pENTR/D-TOPO® with insert NcbZIP19 Page 50

Appendix 3 Plant photos in metal treatments of different time-points Page 51

Appendix 4 CaMV35Spro::RNAi-NcbZIP19. Average gene expression in root tissue Page 53

Appendix 5 CaMV35Spro::RNAi-NcbZIP19. Average metal concentration in root Page 56

and shoot tissue

Appendix 6 CaMV35Spro::RNAi-NcbZIP19. Average translocation efficiency Page 58

between root and shoot tissue

Appendix 7 Univariate analysis of bZIP19 in root tissue of Page 60

A. thaliana and N. caerulescens

Appendix 8 Univariate analysis of ZIP4/ZNT1 in root tissue of Page 62

A. thaliana and N. caerulescens

Appendix 9 Sequence alignment of N. caerulescens (Ganges) whole gene Page 64

amplification for samples 2-8 and 2-9

50

Appendix 1. Comparing coding sequences from bZIP19 and bZIP23. A. NcbZIP19 vs. NcbZIP23; B.

AtbZIP23 vs. NcbZIP23; C. AtbZIP19 vs. AtbZIP23; D. AtbZIP19 vs. NcbZIP19 using the ‘Multiple

sequence alignment tool’ version 5.4.1 (http://multalin.toulouse.inra.fr/multalin/) (Corpet 1988)

using the following parameters: Gap weight = 12; GAP length weight = 2; Consensus levels: High =

90%; Low = 50%.

A. NcbZIP19 vs. NcbZIP23 - A sequence similarity of 73.2% was found.

B. AtbZIP23 vs. NcbZIP23 - A sequence similarity of 84.5% was found.

51

C. AtbZIP19 vs. AtbZIP23 - A sequence similarity of 73.8% was found.

D. AtbZIP19 vs. NcbZIP19 - A sequence similarity of 87.7% was found.

52

Appendix 2. Sequence alignment of fragments NcbZIP19-4 and NcbZIP19-7 compared to the

supposed NcbZIP19 fragment in entry vector pENTR/D-TOPO®-NcbZIP19. Expected fragment is 217bp

long and situated from base pair 153 until 369 in this picture. The figure is made using the sequence

alignment tool in CLC Main workbench version 6.6.1.

53

Appendix 3. Plant photos of different time-points.

Photos were taken at the start of the different

metal treatments. After two-and-a-half and three

weeks new pictures were taken. The Green label is

the 0.05µM Zn treatment, orange label is the 10µM

Zn treatment and the red label is the 1000µM Zn

treatment.

0

1

Appendix 4. CaMV35Spro::RNAi-NcbZIP19. Average gene expression in root tissue, standard deviation,

standard error and the One-Way ANOVA test to test for significant differences between Vector-only

(pK7GWIWG2-DsRed) and Knock-down (pK7GWIWG2-DsRed-NcbZIP19) plants. Indicated in green are

significance levels <0,05 (significant); in red the significance >0,05 (not significant)

ANOVA

NcbZIP19

bZIP19 expression

Expression (avg.) S.D. S.E.

Sum of Squares df

Mean Square F Sig.

Vector-only 1.047 0.379 0.169

Between Groups 3.795 1 3.795 226.984 .000

Knock-down 0.118 0.047 0.008

Within Groups .652 39 .017

Total 4.447 40

ZNT1

ZNT1 expression

Expression (avg.) S.D. S.E.

Sum of Squares df

Mean Square F Sig.

Vector-only 1.111 0.684 0.306

Between Groups 4.987 1 4.987 98.299 .000

Knock-down 0.045 0.056 0.009

Within Groups 1.979 39 .051

Total 6.966 40

NAS1

NAS1 expression

Expression (avg.) S.D. S.E.

Sum of Squares df

Mean Square F Sig.

Vector-only 0.341 0.224 0.100

Between Groups .008 1 .008 .117 .735

Knock-down 0.299 0.258 0.043

Within Groups 2.536 39 .065

Total 2.543 40

NAS2

NAS2 expression

Expression (avg.) S.D. S.E.

Sum of Squares df

Mean Square F Sig.

Vector-only 2.316 1.492 0.667

Between Groups .091 1 .091 .036 .851

Knock-down 2.460 1.598 0.266

Within Groups 98.288 39 2.520

Total 98.379 40

NAS3

NAS3 expression

Expression (avg.) S.D. S.E.

Sum of Squares df

Mean Square F Sig.

Vector-only 0.002 0.001 0.000

Between Groups .000 1 .000 1.141 .292

Knock-down 0.002 0.001 0.000

Within Groups .000 39 .000

Total .000 40

NAS4

NAS4 expression

Expression (avg.) S.D. S.E.

Sum of Squares df

Mean Square F Sig.

Vector-only 0.387 0.119 0.053

Between Groups .341 1 .341 76.343 .000

Knock-down 0.108 0.058 0.010

Within Groups .174 39 .004

Total .515 40

2

Appendix 5. CaMV35Spro::RNAi-NcbZIP19. Average metal concentration in root and shoot tissue, standard

deviation, standard error and the One-Way ANOVA test to test for significant differences between Vector-only

(pK7GWIWG2-DsRed) and Knock-down (pK7GWIWG2-DsRed-NcbZIP19) plants. Indicated in green are

significance levels <0,05 (significant).

Treatment Zn Metal conc.avg SD SE

ANOVA (sig.) F

Treatment Zn

Metal conc.avg SD SE

ANOVA (sig.) F

Vector-only 0.055 0.006 0.005 0.828 0.049

Knock-down 0.103 0.033 0.009 0.218 1.691

Knock-down 0.058 0.021 0.006

Vector-only 0.072 0.007 0.005

Shoot 0.05 µM Zn Fe

Root 0.05 µM Zn Fe

Vector-only 0.049 0.019 0.013 0.537 0.403

Knock-down 6.361 1.609 0.464 0.045 5.03

Knock-down 0.071 0.049 0.014

Vector-only 3.698 0.722 0.511

Mn

Cu

Vector-only 0.038 0.038 0.022 0.614 0.269

Knock-down 0.188 0.053 0.015 0.204 1.803

Knock-down 0.034 0.010 0.003

Vector-only 0.127 0.103 0.073

Mn

Knock-down 0.137 0.080 0.023 0.371 0.865

Vector-only 0.203 0.183 0.130

Zn

Metal conc.avg SD SE

ANOVA (sig.) F

Zn

Metal conc.avg SD SE

ANOVA (sig.) F

Knock-down 0.141 0.051 0.015 0.000 53.169

Knock-down 0.952 0.836 0.264 0.278 1.316

Vector-only 0.411 0.081 0.047

Vector-only 0.248 0.028 0.011

Shoot 10 µM Zn Fe

Root 10 µM Zn Fe

Knock-down 0.061 0.033 0.010 0.565 0.351

Knock-down 5.066 1.090 0.345 0.055 4.716

Vector-only 0.049 0.013 0.007

Vector-only 6.813 0.293 0.207

Mn

Cu

Knock-down 0.046 0.021 0.006 0.994 0.000

Knock-down 0.163 0.074 0.023 0.264 1.398

Vector-only 0.046 0.004 0.002

Vector-only 0.098 0.027 0.019

Mn

Knock-down 0.114 0.046 0.015 0.721 0.135

Vector-only 0.128 0.058 0.041

Zn

Metal conc.avg SD SE

ANOVA (sig.) F

Zn

Metal conc.avg SD SE

ANOVA (sig.) F

Knock-down 3.344 0.891 0.269 0.186 1.966

Knock-down 89.374 38.535 11.619 0.589 0.308

Vector-only 4.686 2.996 1.730

Vector-only 105.335 65.449 37.787

Shoot 1000 µM Zn Fe

Root 1000 µM Zn Fe

Knock-down 0.031 0.007 0.002 0.021 7.023

Knock-down 3.889 1.357 0.409 0.839 0.043

Vector-only 0.065 0.045 0.026

Vector-only 4.110 2.605 1.504

Mn

Cu

Knock-down 0.035 0.005 0.002 0.476 0.542

Knock-down 0.178 0.054 0.017 0.157 2.313

Vector-only 0.038 0.012 0.007

Vector-only 0.227 0.016 0.009

Mn

Knock-down 0.164 0.060 0.018 0.993 0.000

Vector-only 0.164 0.092 0.053

3

Appendix 6. CaMV35Spro::RNAi-NcbZIP19. Average translocation efficiency between root and shoot tissue,

standard deviation, standard error and the One-Way ANOVA test to test for significant differences between

Vector-only and Knock-down plants grown on different zinc concentrations. Indicated in green are significance

levels <0,05 (significant).

ANOVA

Translocation efficiency of Zinc on 0,05 µM Zn Zn05TEZn

Average T.E. S.D. S.E.

Sum of Squares df Mean Square F Sig.

Control 76.207 1.348 0.953

Between Groups 330.549 1 330.549 .382 .548

Knock-down 62.321 30.716 8.867

Within Groups 10379.992 12 864.999

Total 10710.541 13

Zn10TEZn

Translocation efficiency of Zinc on 10 µM Zn Sum of Squares df Mean Square F Sig.

Average T.E. S.D. S.E.

Between Groups 34632.138 1 34632.138 99.987 .000

Control 169.261 25.765 18.219

Within Groups 3117.290 9 346.366

Knock-down 23.783 17.512 5.837

Total 37749.429 10

Zn1000TEZn

Translocation efficiency of Zinc on 1000 µM Zn Sum of Squares df Mean Square F Sig.

Average T.E. S.D. S.E.

Between Groups 46.341 1 46.341 .664 .431

Control 10.371 14.372 8.297

Within Groups 837.298 12 69.775

Knock-down 5.937 6.513 1.964

Total 883.639 13

Zn05TEFe

Translocation efficiency of Iron on 0,05 µM Zn Sum of Squares df Mean Square F Sig.

Average T.E. S.D. S.E.

Between Groups .002 1 .002 .001 .977

Control 1.289 0.252 0.178

Within Groups 21.656 12 1.805

Knock-down 1.320 1.401 0.404

Total 21.657 13

Zn10TEFe

Translocation efficiency of Iron on 10 µM Zn Sum of Squares df Mean Square F Sig.

Average T.E. S.D. S.E.

Between Groups .244 1 .244 2.148 .177

Control 0.728 0.300 0.212

Within Groups 1.021 9 .113

Knock-down 1.114 0.341 0.114

Total 1.265 10

Zn1000TEFe

Translocation efficiency of Iron on 1000 µM Zn Sum of Squares df Mean Square F Sig.

Average T.E. S.D. S.E.

Between Groups .947 1 .947 4.670 .052

Control 1.546 0.576 0.332

Within Groups 2.433 12 .203

Knock-down 0.912 0.421 0.127

Total 3.380 13

4

ANOVA

Zn05TEMn

Translocation efficiency of Manganese on 0,05 µM Zn Sum of Squares df Mean Square F Sig.

Average T.E. S.D. S.E.

Between Groups 29.669 1 29.669 .057 .815

Control 29.610 23.940 16.928

Within Groups 6226.560 12 518.880

Knock-down 33.770 22.670 6.544

Total 6256.228 13

Zn10TEMn

Translocation efficiency of Manganese on 10 µM Zn Sum of Squares df Mean Square F Sig.

Average T.E. S.D. S.E.

Between Groups 32.105 1 32.105 .128 .729

Control 37.625 15.628 11.051

Within Groups 2255.489 9 250.610

Knock-down 42.054 15.856 5.285

Total 2287.595 10

Zn1000TEMn

Translocation efficiency of Manganese on 1000 µM Zn Sum of Squares df Mean Square F Sig.

Average T.E. S.D. S.E.

Between Groups 457.331 1 457.331 1.339 .270

Control 38.015 39.860 23.013

Within Groups 4097.335 12 341.445

Knock-down 24.086 9.590 2.892

Total 4554.665 13

5

Appendix 7. Univariate analysis results. Comparison of bZIP19 expression in root tissue of A. thaliana

and N. caerulescens. Indicated in green are significance levels <0,05 (significant). An explanation of

the number 1-10 can be found on the next page.

Multiple Comparisons

bZIP19 A.t. vs. N.c. in root tissue

Treatment (I) Treatment (J) Mean Difference (I-J) Std. Error Sig. 95% Confidence Interval

Lower Bound Upper Bound

1 2 -.120 .375 .753 -.898 .659

3 -.523 .375 .178 -1.301 .256

4 -.219 .325 .508 -.893 .455

5 -1.021 .375 .013 -1.799 -.242

6 .320 .375 .403 -.458 1.098 7 -.898 .420 .044 -1.768 -.028

8 .275 .375 .471 -.503 1.053

9 -.494 .375 .201 -1.273 .284

10 .402 .375 .295 -.376 1.181

2 1 .120 .375 .753 -.659 .898

3 -.403 .375 .294 -1.181 .375

4 -.099 .325 .764 -.773 .575

5 -.901 .375 .025 -1.679 -.123

6 .440 .375 .254 -.339 1.218

7 -.779 .420 .077 -1.649 .092

8 .395 .375 .304 -.384 1.173

9 -.375 .375 .329 -1.153 .404

10 .522 .375 .178 -.256 1.300

3 1 .523 .375 .178 -.256 1.301

2 .403 .375 .294 -.375 1.181

4 .304 .325 .360 -.370 .978

5 -.498 .375 .198 -1.276 .280

6 .843 .375 .035 .064 1.621

7 -.376 .420 .380 -1.246 .495 8 .798 .375 .045 .019 1.576

9 .028 .375 .940 -.750 .807 10 .925 .375 .022 .147 1.703

4 1 .219 .325 .508 -.455 .893

2 .099 .325 .764 -.575 .773

3 -.304 .325 .360 -.978 .370 5 -.802 .325 .022 -1.476 -.128

6 .539 .325 .112 -.135 1.213

7 -.680 .375 .084 -1.458 .099

8 .494 .325 .143 -.180 1.168

9 -.276 .325 .405 -.950 .398

10 .621 .325 .069 -.053 1.295

5 1 1.021 .375 .013 .242 1.799

2 .901 .375 .025 .123 1.679

3 .498 .375 .198 -.280 1.276

4 .802 .325 .022 .128 1.476

6 1.341 .375 .002 .562 2.119

7 .123 .420 .773 -.748 .993

8 1.296 .375 .002 .517 2.074 9 .526 .375 .175 -.252 1.305

10 1.423 .375 .001 .645 2.201

6 1 -.320 .375 .403 -1.098 .458

2 -.440 .375 .254 -1.218 .339 3 -.843 .375 .035 -1.621 -.064

4 -.539 .325 .112 -1.213 .135 5 -1.341 .375 .002 -2.119 -.562

7 -1.218 .420 .008 -2.088 -.348

8 -.045 .375 .906 -.823 .733

9 -.814 .375 .041 -1.593 -.036

10 .082 .375 .828 -.696 .861

6

Treatment (I) Treatment (J) Mean Difference (I-J) Std. Error Sig. 95% Confidence Interval

Lower Bound Upper Bound

7 1 .898 .420 .044 .028 1.768

2 .779 .420 .077 -.092 1.649

3 .376 .420 .380 -.495 1.246 4 .680 .375 .084 -.099 1.458

5 -.123 .420 .773 -.993 .748

6 1.218 .420 .008 .348 2.088

8 1.173 .420 .011 .303 2.043

9 .404 .420 .346 -.466 1.274

10 1.301 .420 .005 .430 2.171

8 1 -.275 .375 .471 -1.053 .503

2 -.395 .375 .304 -1.173 .384

3 -.798 .375 .045 -1.576 -.019

4 -.494 .325 .143 -1.168 .180

5 -1.296 .375 .002 -2.074 -.517

6 .045 .375 .906 -.733 .823

7 -1.173 .420 .011 -2.043 -.303

9 -.769 .375 .052 -1.548 .009

10 .127 .375 .738 -.651 .906

9 1 .494 .375 .201 -.284 1.273

2 .375 .375 .329 -.404 1.153

3 -.028 .375 .940 -.807 .750

4 .276 .325 .405 -.398 .950 5 -.526 .375 .175 -1.305 .252

6 .814 .375 .041 .036 1.593

7 -.404 .420 .346 -1.274 .466

8 .769 .375 .052 -.009 1.548

10 .897 .375 .026 .118 1.675

10 1 -.402 .375 .295 -1.181 .376

2 -.522 .375 .178 -1.300 .256

3 -.925 .375 .022 -1.703 -.147

4 -.621 .325 .069 -1.295 .053

5 -1.423 .375 .001 -2.201 -.645

6 -.082 .375 .828 -.861 .696

7 -1.301 .420 .005 -2.171 -.430

8 -.127 .375 .738 -.906 .651

9 -.897 .375 .026 -1.675 -.118

Based on observed means. The error term is Mean Square(Error) = .211. > The mean difference is significant at the 0.05 level.

1. A. thaliana Zn Low

2. N. caerulescens Zn Low

3. A. thaliana Zn Normal

4. N. caerulescens Zn Normal

5. A. thaliana Zn High

6. N caerulescens Zn High

7. A. thaliana Ni High

8. N. caerulescens Ni High

9. A. thaliana Cd High

10. N. caerulescens Cd High

7

Appendix 8. Univariate analysis results. Comparison of ZIP4/ZNT1 expression in root tissue of A.

thaliana and N. caerulescens. Indicated in green are significance levels <0,05 (significant). An

explanation of the number 1-10 can be found on the next page.

Multiple Comparisons

ZNT1 AT vs Ncroot

(I) treatment (J) treatment Mean Difference (I-J) Std. Error Sig. 95% Confidence Interval

Lower Bound Upper Bound

1 2 0.732 .227 .004 .261 1.203

3 0.866 .227 .001 .395 1.337

4 0.678 .203 .003 .257 1.099

5 0.896 .227 .001 .425 1.367

6 0.439 .227 .066 -.032 .910

7 0.921 .227 .001 .450 1.391

8 0.330 .227 .160 -.141 .801

9 0.915 .227 .001 .444 1.386

10 0.394 .227 .097 -.077 .865

2 1 -0.732 .227 .004 -1.203 -.261

3 0.134 .203 .517 -.287 .555

4 -0.054 .176 .762 -.419 .311

5 0.164 .203 .428 -.257 .585 6 -0.293 .203 .163 -.714 .128

7 0.188 .203 .364 -.233 .609

8 -0.402 .203 .060 -.823 .019

9 0.183 .203 .377 -.238 .604

10 -0.338 .203 .110 -.759 .083

3 1 -0.866 .227 .001 -1.337 -.395

2 -0.134 .203 .517 -.555 .287

4 -0.188 .176 .298 -.552 .177

5 0.030 .203 .883 -.391 .451

6 -0.427 .203 .047 -.848 -.006

7 0.055 .203 .790 -.366 .476

8 -0.536 .203 .015 -.957 -.115

9 0.049 .203 .810 -.372 .470

10 -0.472 .203 .030 -.893 -.051

4 1 -0.678 .203 .003 -1.099 -.257

2 0.054 .176 .762 -.311 .419

3 0.188 .176 .298 -.177 .552

5 0.218 .176 .228 -.147 .583

6 -0.240 .176 .187 -.604 .125 7 0.242 .176 .182 -.123 .607

8 -0.348 .176 .060 -.713 .017 9 0.237 .176 .192 -.128 .602

10 -0.285 .176 .120 -.649 .080

5 1 -0.896 .227 .001 -1.367 -.425

2 -0.164 .203 .428 -.585 .257 3 -0.030 .203 .883 -.451 .391

4 -0.218 .176 .228 -.583 .147

6 -0.457 .203 .035 -.878 -.036

7 0.024 .203 .906 -.397 .445

8 -0.566 .203 .011 -.987 -.145

9 0.019 .203 .926 -.402 .440

10 -0.502 .203 .022 -.923 -.081

6 1 -0.439 .227 .066 -.910 .032

2 0.293 .203 .163 -.128 .714

3 0.427 .203 .047 .006 .848

4 0.240 .176 .187 -.125 .604

5 0.457 .203 .035 .036 .878

7 0.482 .203 .027 .061 .903 8 -0.109 .203 .598 -.530 .312

9 0.476 .203 .028 .055 .897 10 -0.045 .203 .827 -.466 .376

8

(I) treatment (J) treatment Mean Difference (I-J) Std. Error Sig. 95% Confidence Interval

Lower Bound Upper Bound

7 1 -0.921 .227 .001 -1.391 -.450

2 -0.188 .203 .364 -.609 .233

3 -0.055 .203 .790 -.476 .366

4 -0.242 .176 .182 -.607 .123

5 -0.024 .203 .906 -.445 .397 6 -0.482 .203 .027 -.903 -.061

8 -0.590 .203 .008 -1.011 -.169 9 -0.005 .203 .979 -.426 .416

10 -0.527 .203 .017 -.948 -.106

8 1 -0.330 .227 .160 -.801 .141

2 0.402 .203 .060 -.019 .823 3 0.536 .203 .015 .115 .957

4 0.348 .176 .060 -.017 .713

5 0.566 .203 .011 .145 .987

6 0.109 .203 .598 -.312 .530

7 0.590 .203 .008 .169 1.011

9 0.585 .203 .009 .164 1.006

10 0.064 .203 .757 -.357 .485

9 1 -0.915 .227 .001 -1.386 -.444

2 -0.183 .203 .377 -.604 .238

3 -0.049 .203 .810 -.470 .372

4 -0.237 .176 .192 -.602 .128

5 -0.019 .203 .926 -.440 .402

6 -0.476 .203 .028 -.897 -.055

7 0.005 .203 .979 -.416 .426

8 -0.585 .203 .009 -1.006 -.164 10 -0.521 .203 .018 -.942 -.100

10 1 -0.394 .227 .097 -.865 .077

2 0.338 .203 .110 -.083 .759

3 0.472 .203 .030 .051 .893

4 0.285 .176 .120 -.080 .649

5 0.502 .203 .022 .081 .923 6 0.045 .203 .827 -.376 .466

7 0.527 .203 .017 .106 .948

8 -0.064 .203 .757 -.485 .357

9 0.521 .203 .018 .100 .942

Based on observed means. The error term is Mean Square(Error) = .062.

> The mean difference is significant at the 0.05 level.

1. A. thaliana Zn Low

2. N. caerulescens Zn Low

3. A. thaliana Zn Normal

4. N. caerulescens Zn Normal

5. A. thaliana Zn High

6. N caerulescens Zn High

7. A. thaliana Ni High

8. N. caerulescens Ni High

9. A. thaliana Cd High

10. N. caerulescens Cd High

9

Appendix 9. Alignment of sample 2-8 and 2-9 sequence results with the coding sequence of

NcbZIP23 using the sequence alignment tool in CLC Main workbench version 6.6.1.

10

11

12