Enzyme and Microbial Technology 34 (2004) 446–452

Functional production and secretion of theGluconacetobacterdiazotrophicusfructose-releasing exo-levanase (LsdB) inPichia pastoris

Carmen Menéndeza,∗, Lázaro Hernándeza, Alexander Banguelaa, José Paısb

a Plant Division, Plant-Microbe Interactions Laboratory, Center for Genetic Engineering and Biotechnology (CIGB),Ave 31 e/158 and 190, P.O. Box 6162, Havana 10600, Cuba

b Fermentation Department, Biotechnological Development Unit, CIGB, Havana 10600, Cuba

Received 22 May 2003; received in revised form 24 November 2003; accepted 25 November 2003

Abstract

The gene encoding the fructose-releasing exo-levanase (LsdB; EC 3.2.1.65) fromGluconacetobacter diazotrophicusSRT4 was expressedin Pichia pastorisusing either the methanol-inducibleAOX1or the constitutiveGAPpromoter. In both systems, the recombinant LsdBwas efficiently secreted into the culture medium driven by theSaccharomyces cerevisiaealpha-factor signal peptide. The levanase activityreached 21.1 U ml−1 in the culture supernatant of methanol-induced cells grown for 96 h to a final density of 115.2 g l−1 (dry weight) underfed-batch conditions. TheGAPpromoter-driven expression of thelsdBgene did not cause cell toxicity and provided for a higher LsdB yield(26.6 U ml−1; 0.46 g l−1 ) despite the fermentation time was only 39 h and the biomass reached 59.7 g l−1 (dry weight). The constitutivelyproduced LsdB containing a C-terminal His6-tag fusion was purified to homogeneity from the culture supernatant by nickel affinitychromatography with a process recovery of 77.3%. The purified enzyme, which was not glycosylated at its single potentialN-glycosylationsite, showed a maximal specific activity (58 U mg−1) for the substrate levan at pH 5.0 and 30◦C. The enzyme also hydrolyzed inulin,raffinose, and sucrose, but not melezitose. The reaction on levan and inulin resulted in the successive release of free fructose without theformation of intermediate oligofructans. We conclude that theP. pastoris GAPpromoter based system provides a convenient alternativefor the large-scale production and secretion of LsdB, an enzyme commercially attractive to convert polyfructans into high fructose syrups.© 2004 Elsevier Inc. All rights reserved.

Keywords:Levanase;GAPpromoter;AOX1promoter;Pichia pastoris; Gluconacetobacter diazotrophicus

1. Introduction

Fructose-releasing exo-levanases are potentially usefulfor the commercial production of ultra-high-fructose syrupsfrom the natural polyfructans levan and inulin. Theseexo-hydrolases degrade the�-(2-6)-linked levan but alsofrequently split the�-(2-1) linkages of inulin to successivelyliberate free fructose from both substrates[1–4].

Several levan-producing bacteria secrete endo- orexo-type levanases, mostly under starving conditions. Theendophytic sugarcane bacteriumGluconacetobacter dia-zotrophicusSRT4 carries a chromosomal two-gene clusterencoding a levansucrase (LsdA) and a fructose-releasingexo-levanase (LsdB), being relevant the presence of astem-loop structure in the intergenic region[4]. The first

Abbreviations:GAP, glyceraldehyde 3-phosphate dehydrogenase; AOX,alcohol oxidase; LsdA,Gluconacetobacter diazotrophicuslevansucrase;LsdB, Gluconacetobacter diazotrophicuslevanase

∗ Corresponding author.E-mail address:carmen.menendez@cigb.edu.cu (C. Menendez).

gene (lsdA) is expressed constitutively[5,6], but lsdB tran-scription is strictly regulated. The expression of thelsdBgene inEscherichia coliusing the T7 RNA polymerase sys-tem resulted in a periplasmic enzyme capable to hydrolyzedifferent substrates containing a terminal fructose, althoughwith strong preference for levan[4].

Pichia pastoris has been successfully used for func-tional expression and secretion of a broad spectrum ofheterologous proteins, most of which are eukaryotic[7].The popularity of this host can be attributed to the sim-plicity of the yeast genetic manipulation, the availabilityof the strong methanol-inducibleAOX1 promoter and theconstitutive GAP promoter, and the feasibility of pro-tein secretion driven by native or yeast signal peptidesthat combined with the low levels (about 0.5%) of en-dogenous proteins in the culture supernatants facilitatethe purification of the recombinant protein[7]. In ad-dition, P. pastoris is a host particularly well suited tothe industrial production of sucrases and fructanases dueto the lack of endogenous sucrose- or fructan-utilizingenzymes.

0141-0229/$ – see front matter © 2004 Elsevier Inc. All rights reserved.doi:10.1016/j.enzmictec.2003.11.018

C. Menendez et al. / Enzyme and Microbial Technology 34 (2004) 446–452 447

In a previous work, we succeeded to express theG. di-azotrophicuslevansucrase (LsdA) inP. pastorisusing themethanol-inducibleAOX1promoter. The recombinant LsdA,although glycosylated, retained the catalytic properties ofthe native enzyme, including the fructo-oligosaccharidesproduction from sucrose[8]. In this paper, we report theproduction and efficient secretion of theG. diazotrophicusexo-levanase (LsdB) inP. pastorisusing either theAOX1or theGAPpromoter. The constitutively produced enzyme,which was not glycosylated, was purified and shown torelease free fructose from different substrates, mainly levan.

2. Materials and methods

2.1. Microorganisms, media, and substrates

Escherichia coliXL-1 Blue (Stratagene, La Jolla, CA,USA) was used as a cloning host and for plasmid prop-agation.Pichia pastoriswild-type strain X-33 (InvitrogenBV, Groningen, The Netherlands) was used as an expressionhost.

E. coli was grown at 37◦C in LB medium or low saltLB medium prepared as described by Invitrogen[9]. Ampi-cillin (50 �g ml−1) or zeocin (25�g ml−1) were added asneeded. For plates and shake flask experiments,P. pastoriswas grown at 30◦C in the rich media YPG (1% (w/v) yeastextract, 2% (w/v) peptone, and 2% (v/v) glycerol) or YPDS(1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) glu-cose, and 1 M sorbitol). For phenotypic screening of su-crolytic activity, P. pastoris transformants were grown at30◦C in liquid or solid SGPY medium (5% (w/v) sucrose,0.5% (v/v) glycerol, 2% (w/v) peptone, 1% (w/v) yeast ex-tract, and 0.025% (w/v) bromthymol blue, pH 6.5). For fer-mentation experiments,P. pastoriswas grown during thebatch phase in minimal medium (2.5% (v/v) glycerol, 0.42%(w/v) KH2PO4, 0.37% (w/v) MgSO4·7H2O, 0.023% (w/v)CaCl2·2H2O, and 0.04% (w/v) Na-EDTA) containing vita-mins and traces prepared as recommended by Cregg et al.[10]. Solutions of 30% (v/v) ammonium hydroxide and 85%(v/v) ortho-phosphoric were used to control the culture pHat 5.0 during the batch and the feeding phases.

Levan fromErwinia herbicola, inulin from Dahlia tubers,d(+)-melezitose,d(+)-raffinose, and sucrose were used assubstrates for LsdB activity. All the substrates were fromSigma (St. Louis, MO, USA).

2.2. Construction of the lsdB expression vectors pALS175and pALS177

A 1520-bp DNA fragment coding for the predicted maturepart of levanase (LsdB) fromG. diazotrophicuswas ampli-fied by PCR using the plasmid pALS5 [6] as template andthe primers 5′CTCGGGGCATCGATCGCGGCCGATACGand 5′GGGATTTTCTAGAGCCAGCACCGCCAC withbase substitutions (bold letters) to createClaI and XbaI

restriction sites (underlined). The PCR product (withoutlsdB stop codon) wasClaI–XbaI digested and inserted inthe corresponding sites of the zeocin-resistance expressionvectors pGAPZ�C and pPICZ�C (Invitrogen BV, Gronin-gen, The Netherlands) yielding the plasmids pALS175 andpALS177, respectively. The in-frame fusions of thelsdBgene to the alpha factor signal sequence ofS. cerevisiaeatthe 5′ end and to themycepitope and the His6 tag at the 3′end in both constructs were confirmed by DNA sequencing.

2.3. Pichia pastoris transformation and phenotypicscreening of clones expressing active LsdB

P. pastorisX-33 cells were transformed by electroporationwith 5�g of either AvrII-linearized pGAPZ�C (control),AvrII-linearized pALS175, orSacI-linearized pALS177,following the conditions recommended by Invitrogen[9].Transformants were selected on YPDS plates supplementedwith zeocin (100�g ml−1) after incubation for 3 days at30◦C. Single zeocin-resistant colonies transformed withthe constitutive construct pALS175 were screened for su-crolytic activity by streaking on SGPY plates and incubatingfor 3–5 days at 30◦C. To screen for sucrolytic activity ofclones transformed with the methanol-inducible constructpALS177, single zeocin-resistant colonies were inoculatedin liquid SGPY medium and grown for 48 h at 30◦C, thenlsdB expression was induced by adding methanol 0.5%(v/v) (final concentration) every 12 h during continuousculture for other 48–72 h at 30◦C.

2.4. LsdB production in shaking batch cultures

For constitutive LsdB expression, 2-l flasks containing200 ml of YPG medium were inoculated from a fresh colonyof P. pastorisclones transformed with plasmid pALS175 andincubated during 3 days at 30◦C with shaking at 200 rpm.Cells were spun down and levanase activity was assayed inthe culture supernatants.

For methanol-inducible LsdB expression, 2-l flasks con-taining 200 ml of YPG medium were inoculated using a freshcolony of theP. pastorisclones transformed with plasmidpALS177, and incubated for 1 day at 30◦C with shakingat 200 rpm. Cells were harvested by centrifugation, washedtwice with sterile distilled water and resuspended to finalOD600 ∼ 1 in 200 ml of modified YPG medium, in whichglycerol was substituted by methanol 1% to induce expres-sion from theAOX1promoter. The cultures were transferredto 2-l flasks and grown with shaking at 200 rpm for 2 daysat 30◦C, supplying methanol pulses to a final concentrationof 0.5% every 12 h.

2.5. Fed-batch fermentation of P. pastoris clones PGAP6and PAOX12

Fermentations were performed using 7.5-l fermenters(B.E. Marubishi, Tokyo, Japan) interfaced with the

448 C. Menendez et al. / Enzyme and Microbial Technology 34 (2004) 446–452

computer-based software FERMACS for data acquisitionand supervisory control (CIGB, Havana, Cuba). Fermenterscontaining 3.5 l of the above-mentioned minimal mediumwere inoculated to an initial OD600 ∼ 2 with cultures of theclones PGAP6, PAOX12, or theP. pastoristransformed withempty vector pGAPZ�C. The operation conditions duringthe batch phase were 30◦C, pH 5.0, aeration rate constantat a flow of 4 l min−1, and agitation 500 rpm. The end ofthe batch phase upon depletion of glycerol was judged bya sharp increase of pH and pO2. For constitutive LsdBexpression, the feeding medium (50% (v/v) glycerol andtrace elements) was added with gradually increased flowsbetween 29.5 and 81.2 ml min−1 l−1 of starting volume. Forinducible LsdB expression, the feeding medium (87.5%(v/v) methanol and trace elements) was added gradually atrates between 3.1 and 7.3 ml min−1 l−1 of initial volume.The operation conditions during the feeding phase were30◦C, pH 5.0, aeration rate constant at a flow of 8 l min−1,and agitation 700 rpm. The fed-batch phase started at 16and 18 h in the constitutive and methanol-inducible systems,respectively.

2.6. Cell disruption

P. pastoriscells from 1 ml of the fermentation cultureswere collected by centrifugation, washed in distilled waterand resuspended in 0.4 ml of breaking buffer (5% (v/v) glyc-erol, 1 mM PMSF, 1 mM EDTA, 50 mM sodium phosphate,pH 6.0). After addition of equal volume of acid-washed500-�m glass beads (Sigma), the cells were mechanicallylysed by 10 cycles of vortex for 30 s and ice incubation for30 s. Levanase activity was measured in the cell extract.

2.7. LsdB purification

Purification of the constitutively produced LsdB wasperformed by immobilization-metal affinity chromatog-raphy (IMAC), using Ni2+-nitrilotriacetic acid agarosebeads (Ni–NTA) from QUIAGEN (Hilden, Germany). Theculture supernatant (4.8 l) of clone PGAP6 was five-foldconcentrated in a rotatory evaporator, adjusted to pH 7.0with sodium phosphate buffer (0.1 M final concentration),and mixed in batch with 25 ml of Ni–NTA resin overnightat 4◦C to bind the enzyme containing the polyhistidinetag. The agarose beads were recovered by centrifugationat 3500 rpm for 5 min and packed into a column. Proteinelution was carried out with 0.1 M sodium acetate (pH 5.0)containing 0.15 M imidazole. The fractions with levanaseactivity were pooled and dialyzed against 10 mM sodiumacetate (pH 5.0).

2.8. Protein quantification and enzyme assays

Proteins were quantified as described by Bradford[11].LsdB purity in the culture supernatants or the purificationfraction was determined by densitometric analysis of 12.5%

polyacrylamide gels stained with Coomassie brilliant blueR-250 (Sigma). Levanase activity was measured as the fruc-tose released from levan hydrolysis using the dinitrosalicylicacid (DNSA) test[12]. One unit of enzyme is defined asthe amount of enzyme releasing 1�mol of fructose per minbased on initial velocity measurements under the followingconditions: 1% (w/v) levan in 0.1 M sodium acetate buffer,pH 5.0 at 30◦C.

LsdB reaction products were separated by thin-layer chro-matography (TLC) on silica-gel 60 plates (Merck KGaA,Darmstadt, Germany) using acetone–water (9:1, v/v) as thesolvent. After three runs, the fructose-containing sugars weremade visible by spraying the plates with a solution of 3%(w/v) urea, 1 M phosphoric acid in water-saturated butanol,and heating at 80◦C for about 20 min.

2.9. Endoglycosidase Hf treatment

Purified LsdB (80�g) was denatured in 100�l of 0.5%(w/v) SDS, 1% (v/v) �-mercaptoethanol at 100◦C for10 min. After addition of 1:10 (v/v) 1 M sodium citratebuffer, pH 5.5 at 25◦C, the sample was reacted with endo-glycosidase Hf (New England Biolabs, USA) at 0.25 U�g−1

of total protein at 37◦C for 5 h.

2.10. Polyacrylamide gel electrophoresis (PAGE), andWestern blot

SDS–PAGE in 12.5% gels was preformed accordingto Laemmli [13]. For Western blots, proteins were elec-trotransferred onto nitrocellulose membranes (AmershamPharmacia-Biotech, Uppsala, Sweden) using a Mini Trans-Blot Electrophoresis Transfer (BIORAD, Richmond, CA,USA) at a constant current of 350 mA for 1.30 h. Theimmunological detection of LsdB was achieved using poly-clonal antibodies generated in rabbit against LsdB expressedin E. coli [4] and the ProtoBlot AP system (Promega,Madison, USA). The presence of mannose chains in therecombinant LsdB was assayed in Western blot using theDigoxigenin Detection Kit (Roche Diagnostics GmbH, Ger-many) andGalanthus nivalisagglutinin as the digoxigenin-labeled lectin. The B-ribonuclease containing threeN-glycosylation sites was used as the control glycoprotein.

3. Results and discussions

3.1. Constitutive and methanol-inducible expression of thelsdB gene in recombinant P. pastoris strains fermentedunder fed-batch conditions

The G. diazotrophicuslevanase gene (lsdB) encodes aputative precursor protein of 534 residues with a signal pep-tidase cleavage site predicted between Ala-36 and Ala-37[4]. The plasmids pALS175 and pALS177 were constructedso as to carry the DNA sequence encoding the mature

C. Menendez et al. / Enzyme and Microbial Technology 34 (2004) 446–452 449

LsdB fused at the 5′ end to the alpha factor sequence ofS. cerevisiaeand at the 3′ end to themyc epitope and theHis6 tag under the control of the constitutiveGAP pro-moter and the methanol-inducibleAOX1promoter, respec-tively. The two expression plasmids and the empty vectorspGAPZ�C and pPICZ�C were linearized at the promoterregion prior to transformation of theP. pastorishost strainX-33.

Twenty zeocin-resistant colonies electroporated with ei-ther the plasmid pALS175 or the plasmid pALS177 werephenotypically screened for sucrase activity in solid or liq-uid SGPY medium in the presence of sucrose and the pHindicator bromthymol blue, as indicated inSection 2. All thetransformants turned the medium color from initial green(pH 6.5) to yellow (pH≤ 6.0) revealing acidification dueto the consumption, via glucolysis, of the glucose releasedfrom sucrose by the action of the recombinant LsdB. On thecontrary, the yeast colonies electroporated with the emptyvectors remained unable to utilize sucrose and turned themedium color to blue (pH≥ 7.5) revealing alkalization dueto the ammonia released by the catabolic oxidation of thenitrogen-containing carbon sources yeast extract and pep-tone. The Suc+ clones expressing LsdB constitutively or bymethanol induction were referred to as PGAP and PAOXclones, respectively.

Six PGAP clones and six PAOX clones selected at ran-dom were grown in shaking batch cultures and assayed forlevanase activity in the culture supernatants. All the clonessecreted active LsdB with only slightly differences in theprotein yield. Southern blot analysis revealed that the plas-mids pALS175 and pALS177 were integrated as a singlecopy at the promoter regions of the chromosomalGAPandAOX1 loci in the PGAP and PAOX clones, respectively(data not shown). As expected, the integrations occurredby a single crossover event allowing functionality of theresidentGAPandAOX1genes of the host strain.

The constitutive clone PGAP6 and the methanol-inducibleclone PAOX12 showing the highest LsdB expression lev-els in shake-flasks experiments were further analyzed at a

0

30

60

90

120

0 7 14 21 28 35 42

cultivation time (h)

dry

biom

ass

(gD

Wl-1

)

0

4

8

12

16

20

24

28

leva

nase

act

ivity

(Um

l-1)Dry biomass PGAP6

Dry biomass X-33(pGAPZ C)levanase act. PGAP6levanase act. X-33(pGAPZ C)

0

30

60

90

120

0 20 40 60 80 100

cultivation time (h)

dry

biom

ass

(gD

Wl-1

)

0

4

8

12

16

20

24

28

leva

nase

act

ivity

(U

ml-1

)Dry biomass PAOX12

levanase act. PAOX12

(B)(A)

Fig. 1. (A) Constitutive and (B) methanol-induced expression of recombinant LsdB in 7.5-l fed-batch fermentations. The fed-batch phase started at 16and 18 h in the constitutive and methanol-inducible systems, respectively. Values represent means± standard deviations (n = 3).

fermenter scale under fed-batch conditions (Fig. 1). Theclone PGAP6 and the yeast transformed with the emptyvector pGAPZ�C displayed similar growth curves, indicat-ing that theGAPpromoter-driven constitutive expression ofthe lsdB gene was not toxic to the host cell. The biomassand the extracellular levanase activity of clone PGAP6 in-creased proportionally during fermentation reaching the re-spective maximal values of 59.7 g DW l−1 and 26.6 U ml−1

at the end of fermentation (39 h) (Fig. 1A). The LsdB pro-ductivity of clone PGAP6 was 682 U l−1 h−1. In Fig. 1B itis shown that clone PAOX12 metabolized methanol (Mut+phenotype) during the feeding phase and the cell density in-creased from 28 up to 115.2 g DW l−1. After methanol addi-tion the recombinant yeast increasingly secreted LsdB intothe culture medium up to a maximal yield of 21.1 U ml−1 atthe end of the fermentation (96 h). The LsdB productivity ofclone PAOX12 was 220 U l−1 h−1. Following disruption ofcells harvested at the end of the fermentation it was deter-mined that approximately 95% of the totally produced LsdBwas secreted into the culture media of both clones PGAP6and PAOX12.

The comparison of the LsdB productivities reached byclones PGAP6 and PAOX12 indicates that the enzyme pro-duction occurred three-fold more efficiently in the constitu-tive system than in the methanol-inducible one. Similarly,the expression of the bacterial�-lactamase under the con-trol of theGAPpromoter in glucose-grownP. pastoriscellswas significantly higher than under the control of theAOX1promoter in methanol-grown cells[14]. Goodrick et al.[15]attained similar expression levels of a human chitinase geneusing either theGAP or theAOX1promoter inP. pastorisstrains grown under fed-batch conditions. However, Boeret al.[16] and Vassileva et al.[17] reported a higher produc-tion of theTrichoderma reseeicellobiohydrolase Cel7A andthe hepatitis B surface antigen, respectively, when using theAOX1instead of theGAPpromoter. These controversial re-sults reinforce previous assumptions that the target gene andthe recombinant protein itself are key factors in determiningthe expression levels inP. pastoris.

450 C. Menendez et al. / Enzyme and Microbial Technology 34 (2004) 446–452

Table 1Purification of the recombinant LsdB–His6 secreted byP. pastorisclone PGAP6 in 7.5-l fed-batch fermentations

Purification step Volume (ml) Total activity(×103 U)

Total proteins(×103 mg)

Specific activity(U mg−1)

Recovery (%) Purificationfactor

Culture supernatant 4800 127.6±7.4 4.4± 0.30 29.0± 1.5 100.0 1Ni affinity chromatography 130 98.6± 6.4 1.7± 0.4 58.0± 6.26 77.3 2

The enzyme activity was assayed in presence of 1% (w/v) levan in 0.1 M sodium acetate buffer (pH 5.0) at 30◦C. The values represent means± standarddeviations (n = 3).

3.2. Purification and characterization of LsdB expressedconstitutively by clone PGAP6

The recombinant LsdB represented 49.5% of the totalproteins in the culture supernatant of clone PGAP6. Theenzyme containing a C-terminal His6-tag fusion was puri-fied to homogeneity by Ni affinity chromatography, witha process recovery of 77.3%. (Table 1). The purified pro-tein migrated as a single compacted band in SDS–PAGEwith an apparent molecular mass of 57 kDa (Fig. 2A).This value is consistent with the mass expected for themature non-glycosylated LsdB fused to themyc epitopeand the polyhistidine tag. The secreted LsdB did not al-ter its electrophoretic mobility in SDS–PAGE after beingtreated with endoglycosidase H (Fig. 2A and B) and didnot react with the digoxigenin-labeled lectin GNA on agel blot (Fig. 2C), indicating that it is not a glycopro-tein. The predicted recombinant LsdB contains a potentialN-glycosylation site, at position 89, conforming the gen-eral rule N-X-T/S, where X is not proline. Our findingconfirms the previous assumption that the presence of thisconsensus peptide does not always lead to glycosylation[18,19]. The Bacillus subtilisexo-levanase (SacC), whichcontains seven potentialN-glycosylation sites resultedhyperglycosylated when secreted bySaccharomyces cere-

Fig. 2. Glycosylation analysis of LsdB secreted by the constitutive clone PGAP6. (A) SDS–PAGE analysis of LsdB purified from culture supernatantand treated with endoglycosidase Hf . Proteins were denatured, separated on an SDS–12%-polyacrylamide gel and revealed by Coomassie Blue staining.Lane 1, broad-range protein marker (kDa) (New England Biolabs); lane 2, purified LsdB (1�g); lane 3, endoH-treated LsdB (1�g). (B) Western blot forimmunodetection of LsdB. Purified LsdB (1�g) (lane 1) and endoH-treated LsdB (1�g) (lane 2) were separated by 12.5% SDS–PAGE, transferred to anitrocellulose membrane and probed with polyclonal antibodies against LsdB produced inE. coli [4]. (C) Western blot for detection of mannose chains.Proteins were separated by 12.5% SDS–PAGE, transferred to a nitrocellulose membrane and probed with lectin GNA conjugated with digoxigenin. Lane1, pre-stained broad-range protein marker (kDa) (New England Biolabs); lane 2, purified LsdB (8�g); lane 3, glycosylated B-ribonuclease (1�g).

visiae. Only 30% of the total SacC activity was extracellular[20].

The influence of pH and temperature on the recombinantLsdB activity was examined for the substrates levan and su-crose in the ranges 4.0–8.0 and 20–80◦C, respectively (Fig.3). The highest levanase activity was achieved at pH 5.0and 30◦C, whereas the sucrose activity was maximal at pH5.0 and 40–50◦C. For both substrates, the enzyme activitydrastically decreased at pH 4.0 and at pH values above 7.0.The recombinant LsdB was irreversibly inactivated at tem-peratures above 60◦C. Under optimal conditions the rate oflevan versus sucrose hydrolysis (L/S ratio) was 2.4 ± 0.9,confirming that LsdB is a true fructanase.

Similarly to LsdB, theBacteroides fragilisfructanase(FruA) showed an optimum temperature of 37◦C for thehydrolysis of inulin and levan, while optimum sucrase ac-tivity was obtained at 50◦C [2]. In general, the optimumtemperature of invertases is higher than that of fructanases.Both are retaining enzymes with extensive structural sim-ilarities (see the CAZy server athttp://afmb.cnrs-mrs.fr/CAZY/families.html). We speculate that the substratesize is responsible for the different temperature profiles ofthe sucrose- and fructan-degrading activities of bacterialexo-fructanases enabling a distinct accommodation of thesubstrate in the cavity at the active site of the enzyme.

C. Menendez et al. / Enzyme and Microbial Technology 34 (2004) 446–452 451

0

20

40

60

80

100

120

3 4 5 6 7 8 9

pH

rela

tive

act

ivit

y(%

)levan acetate bufferlevan phosphate buffersucrose acetate buffersucrose phosphate buffer

0

20

40

60

80

100

120

10 20 30 40 50 60 70 80 90

temperature (˚C)

rela

tive

act

ivit

y (%

)

levan

sucrose

(A) (B)

Fig. 3. Effect of pH (A) and temperature (B) on the levanase and sucrase activities of the recombinant LsdB. The effect of pH was examined at 30◦Cusing 0.1 M sodium acetate buffer in the pH range 4.0–6.0 and 0.1 M sodium phosphate buffer in the range of pH 6.0–8.0. The effect of temperaturewas evaluated using the range 20–80◦C in 0.1 M sodium acetate buffer (pH 5.0). Purified LsdB (5 units) was incubated with 1% (w/v) levan or 0.1 Msucrose for 30 min. Reactions were stopped by heating for 5 min at 100◦C and the enzyme activity was measured as the fructose released from thesubstrate by using the DNSA method. Values represent means± standard deviations (n = 3).

To investigate the substrate specificity and the actionmode of LsdB produced inP. pastoris, the purified en-zyme was incubated with sucrose [�glu(1,2)�fru], raffinose[�gal(1,6)�glu (1,2)�fru], melezitose [�glu(1,2) �fru(3,1)�glu], inulin [�(2,1)-linked fructan], and levan [�(2,6)-linked polyfructan] at pH 5.0 and 30◦C (Fig. 4). The enzymereleased fructose from all the substrates, except melezitose.Its highest specific activity was 58 U mg−1 when reactingon levan. The hydrolysis of inulin and levan resulted in thesuccessive release of the terminal fructose units without theformation of intermediate oligofructans. The rate of levanversus inulin hydrolysis (L/I ratio) was 3.9 ± 1.1. Theseresults are in agreement with the exo-type activity andthe substrate specificity shown by the recombinant LsdB

Fig. 4. TLC analysis of reaction products from sucrose-containing sub-strates by LsdB produced constitutively inP. pastoris. Purified LsdB wasincubated for 48 h at 30◦C with the corresponding substrate in 0.1 Msodium acetate buffer (pH 5.0). Fructose-specific staining of the reactionproducts was performed as described inSection 2. Lane 1 corresponds toa control mixture of fructose (F), sucrose (S), melezitose (M), raffinose(R), and levan (L). Lanes 2–6 correspond to the LsdB reaction on levan,inulin, raffinose, melezitose, and sucrose, respectively.

produced inE. coli [4]. Other bacterial fructose-releasingexo-fructanases also have the ability to hydrolyze with dif-ferent preference a broad range of substrates containing aterminal fructose unit[1–3]. The structural and mechanisticdetails of their substrate specificity remain unknown.

Up to date, there is not a commercial system available forthe enzymatic production of ultra-high-fructose syrups fromlevan. LsdB shows an acceptable specific exo-levanase ac-tivity and appears attractive for this purpose. ThelsdBgeneis not expressed in the natural hostG. diazotrophicusgrownunder optimal culture conditions; so recombinant sourcesare required for the enzyme production at industrial scale.LsdB was functionally produced inE. coli, but the proteinaccumulated intracellularly hampering its purification[4].The expression of thelsdBgene inP. pastorisunder the con-stitutive GAP promoter did not cause cell toxicity and theenzyme productivity was three-fold higher in comparisonwith the methanol-inducibleAOX1 promoter system. Thehigh yield and efficient secretion of LsdB fused to a poly-histidine tag allowed the purification of the protein by a sim-ple affinity procedure with a good recovery. TheP. pastorisGAP promoter system obviates the need to use methanol,which is noxious and flammable, and provides a convenientalternative for the large-scale production of LsdB either ina fed-batch or a continuous fermentation process. This sys-tem is more competitive in terms of productivity, proteinsecretion and feasibility to be scaled than other recombi-nant systems that have been used so far to overexpress thebest-characterizedB. subtilisexo-levanase in different bac-teria [1,21,22]and the yeastS. cerevisiae[20].

References

[1] Wanker E, Huber A, Schwab H. Purification and characterizationof the Bacillus subtilislevanase produced inEscherichia coli. ApplMicrobiol Biotechnol 1995;61:1953–8.

452 C. Menendez et al. / Enzyme and Microbial Technology 34 (2004) 446–452

[2] Blatch GL, Woods DR. Molecular characterization of a fructanaseproduced byBacteroides fragilisB F-1. J Bacteriol 1993;175:3058–66.

[3] Bezzate S, Steinmetz M, Aymerich S. Cloning, sequencing, anddisruption of a levanase gene ofBacillus polymyxaCF43. J Bacteriol1994;176:2177–83.

[4] Menéndez C, Hernández L, Selman G, Mendoza MF, Hevia P,Sotolongo M, et al. Molecular cloning and expression inEscheri-chia coli of an exo-levanase gene from the endophytic bacteriumGluconacetobacter diazotrophicusSRT4. Current Microbiol 2002;45:5–12.

[5] Hernández L, Arrieta JG, Menéndez C, Vázquez R, Coego A, SuárezV, et al. Isolation and enzymic properties of levansucrase secretedby Acetobacter diazotrophicusSRT4, a bacterium associated withsugar cane. Biochem J 1995;309:113–8.

[6] Arrieta JG, Hernández L, Coego A, Suarez V, Balmori E, MenéndezC, et al. Molecular characterization of the levansucrase gene from theendophytic sugar cane bacteriumAcetobacter diazotrophicusSRT4.Microbiology 1996;142:1077–85.

[7] Cereghino JL, Cregg JM. Heterologous protein expression in themethylotrophic yeastPichia pastoris. FEMS Microbiol Rev 2000;24:45–66.

[8] Trujillo LE, Arrieta JG, Dafhnis F, Garcıa J, Valdés J, Tambara Y,et al. Fructo-oligosaccharides production by theGluconacetobacterdiazotrophicuslevansucrase expressed in the methylotrophic yeastPichia pastoris. Enzyme Microb Technol 2001;28:139–44.

[9] Pichia pastorisexpression kit. A manual of methods for expressionof recombinant proteins inPichia pastoris, version F. San Diego,USA: Invitrogen Corporation.

[10] Cregg JM, Tschopp JF, Stillman C, Siegel R, Akong M, Craig WS, etal. High-level expression and efficient assembly of hepatitis B surfaceantigen in the methylotrophic yeastPichia pastoris. Biotechnology1987;5:479–85.

[11] Bradford MM. A rapid and sensitive method for quantification ofmicrogram quantities of protein utilizing the principle of protein–dyebinding. Anal Biochem 1976;72:248–54.

[12] Miller GL. Use of dinitrosalicylic acid reagent for determination ofreducing sugar. Anal Chem 1959;31:426–8.

[13] Laemmli UK. Cleavage of structural proteins during the assemblyof the head of bacteriophage T4. Nature 1970;227:680–5.

[14] Waterham HR, Digan ME, Koutz PJ, Lair SV, Cregg JM. Isolation ofthe Pichia pastorisglyceraldehyde-3-phosphate dehydrogenase geneand regulation and use of its promoter. Gene 1997;186:37–44.

[15] Goodrick JC, Xu M, Finnegan R, Schilling BM, Schiavi S, HoppeH, et al. High-level expression and stabilization of recombinanthuman chitinase produced in a continuous constitutivePichia pastorisexpression system. Biotechnol Bioeng 2001;74:492–7.

[16] Boer H, Teeri TT, Koivula A. Characterization ofTrichoderma reeseicellobio-hydrolase Cel7A secreted fromPichia pastorisusing twodifferent promoters. Biotechnol Bioeng 2000;69:486–94.

[17] Vassileva A, Chugh DA, Swaminathan S, Khanna N. Expressionof hepatitis B surface antigen in the methylotrophic yeastPichiapastoris using the GAP promoter. J Biotechnol 2001;88:21–35.

[18] Gavel Y, von Heijne G. Sequence differences between glycosylatedand non-glycosylated Asn-X-Thr/Ser acceptor sites: implications forprotein engineering. Protein Eng 1990;3:433–42.

[19] Nilsson I, von Heijne G. Glycosylation efficiency of Asn-Xaa-Thrsequons depends both on the distance from the C-terminus and onthe presence of a downstream transmembrane segment. J Biol Chem2000;275:17338–43.

[20] Wanker E, Klimgsbichel E, Schwab H. Efficient secretion ofBacillussubtilis levanase bySaccharomyces cereviseae. Gene 1995;161:45–9.

[21] Leloup L, Le Saux J, Petit-Glatron MF, Chambert R. Kinetics ofthe secretion ofBacillus subtilis levanase overproduced during theexponential phase of growth. Microbiology 1999;145:613–9.

[22] Hols P, Ferain T, Garmyn D, Bernard N, Delcour J. Use ofhomologous expression-secretion signals and vector-free stablechromosomal integration in engineering ofLactobacillus plantarumfor alpha-amylase and levanase expression. Appl Environ Microbiol1994;60:1401–13.