Functional Modulation of the Mouse Prefrontal Cortex by ... dissertation.pdf · Nicotinic...

Functional Modulation of the Mouse Prefrontal Cortex by

Nicotinic Acetylcholine Receptors

The research presented in this thesis was carried out at the Vrije Universiteit--Amsterdam in the Netherlands and at the Ecole Polytechnique Fédérale de Lausanne in Switzerland.

©J. J. Couey, Trondheim, Norway, 2009.No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form without express written permission from the author and/or the Vrije Universiteit--Amsterdam.

Front Cover: A diagram depicting a paired recording using an image from a biocytin staining prepared from a seven cell whole cell patch experiment (taken from Chapter IV, figure 1) in the mouse prefrontal cortex. Original image and staining by Sonia Garcia (EPFL).

Back Cover: A photo submitted to the journal Neuron as a cover design for the issue featuring the data from Chapters II and III. Design and photography by the author and Rogier Min.

VRIJE UNIVERSITEIT

Functional Modulation of the Mouse Prefrontal Cortex by

Nicotinic Acetylcholine Receptors

ACADEMISCH PROEFSCHRIFT

ter verkrijging van de graad Doctor aande Vrije Universiteit Amsterdam,op gezag van de rector magnificus

prof.dr. L.M. Bouter,in het openbaar te verdedigen

ten overstaan van de promotiecommissievan de faculteit der Aard- en Levenswetenschappen

op woensdag 24 juni 2009 om 13.45 uurin de aula van de universiteit,

De Boelelaan 1105

door

Jonathan Jay Couey

geboren te Chippewa Falls, Verenigde Staten

promotor: prof.dr. H.D. Mansveldercopromotoren: prof.dr. A.B. Brussaard

prof.dr. A.B. Smitdr. S. Spijker

promotor: prof.dr. H.D. Mansveldercopromotoren: prof.dr. A.B. Brussaard

prof.dr. A.B. Smitdr. S. Spijker

For my grandmother,Edith Benson Couey (1914-2007)

Table of Contents

Chapter I: General Introduction 8

Chapter II: 36Differential Modulation of Prefrontal Cortical Interneurons by Nicotine Introduction 38 Materials and Methods 39 Results 42

Discussion 50

Chapter III: 62Distributed Network Actions by Nicotine Increase the Threshold for Spike-Timing-Dependent Plasticity in Prefrontal Cortex Introduction 64 Materials and Methods 66 Results 69 Discussion 76

Chapter IV: 88Functional Modulation of Interpyramidal Disynaptic Inhibition by Nicotine Introduction 90 Materials and Methods 91 Results 93 Discussion 97

Chapter V: General Discussion 104Toward an Understanding of Nicotinic Receptors in the Cortex Summary 122Nederlandse Samenvatting 124Dankwoord 126 About the author 127

8

Chapter I

General Introduction

Jonathan Jay Couey, Karlijn van Aarde, Arjen B. Brussaard& Huibert D. Mansvelder.

Original text published in Psychopharmacology 184(3&4):292-305.

9


The vertebrate brain is an assembly of highly specialized electrically and chemically coupled cells which are collectively capable of orchestrating goal-directed behavior in the face of a flood of incoming sensory information about the environment. Our species’ experience with this phenomenon has produced human concepts which bar explanation and exist outside of logic like love, gezelligheid, jealousy, anger, and fear. At first take, unraveling the inner workings of that which produces who we are seems an impossible task. Yet closer examination of what we ourselves know of the vertebrate brain gives us reason to believe otherwise. The anatomy of the brain hasn’t changed so much since our ancestors developed a spine. Although the number of cells has increased in some vertebrate brains, the essential question is: Does this increase in cell number underlie essential functional differences? As a biologist, I would suggest it does not. Rather, the differences in behavior and internal experience are likely the primary results of this increase in cell number. This implies that more “complex” behavior is not really what it purports to be. The fact that humans, monkeys, dogs, cats, rats, and mice are similarly affected by fear, pain, and addiction certainly suggests that much of the same circuitry is working behind the scenes. Even our capabilities for language comprehension are not that unusual. Just ask any dog owner what their dog understands. They will swear it’s more than just “sit”, “stay”, and “roll over”.

While this thesis will not attempt to explain any of the latter mentioned human concepts, it will attempt to add a small piece to our understanding of how the vertebrate cortex—specifically the prefrontal cortex—as a chorus of cells might function. One consensus idea in neurobiology is that the brain of any vertebrate is inundated with sensory information from the peripheral nervous system. After the information is coded, the brain must effectively focus on and use what is most relevant and filter out the rest. An inability to cope with this task is thought to underlie many mental disorders from ADHD to autism and schizophrenia. While each sensory modality (audition, vision, mechanoperception, olfaction, and taste?) has its dedicated cortical region, the prefrontal cortex—covering about 30% of the entire human cortex—is

10

Chapter I

a multimodal association cortex which plays key roles in higher order operations like attention (filtering) and working memory (holding relevant information for integration or later application) (Groenewegen and Uylings 2000). The PFC is also involved in executive control over behavior, and it has been argued that these PFC functions combine to temporally organize goal-directed behavior (Fuster 2000a; 2000b; Goldman-Rakic 1995; Lee et al. 2005; Miller 2000). How the cortex actually achieves this monumental computation feat is far from being described.

On the cellular level, the cortex is a highly organized layered structure composed of interconnected networks of excitatory and inhibitory cells. The entirety of the cortex is very similar in histological structure, and it is logical to assume that many of the same neuronal microcircuits are found throughout. The hypothesis that there exists a basic wiring diagram for the mammalian neocortex which is modified by experience (i.e. thalamic input) to produce the exquisitely arranged adult neocortex is an enticing one. The stereotypy which is visible on nearly every level of analysis could imply a strict determinism in cortical development based on the interaction of gene expression and environmental conditions, and thus a strict relationship between structure and function within different cortical areas. Still, because of the incredible complexity of the cortex, finding and describing these canonical neuronal microcircuits has proved difficult to this point. What are much better described are the individual cell types which make up the cortex.

Anatomical characterization of the brain at the cellular level began already in the late 1800’s with the work of Santiago Ramón y Cajal. It was clear very early on that the cortex was a highly organized structure composed of distinct cells types, the most famous of which is perhaps the pyramidal cell. Pyramidal cells are the main excitatory cells of the cortex, and are so named for their anatomical resemblance to a pyramid, especially in what we now know to be poor histological preparations. Pyramidal cells and their inhibitory counterparts—interneurons—are now also described in detail in many different cortical regions, as well as in other brain areas. We know that these neurons express a huge collection of ion channels, pumps, and receptors

11


which allow each cell to maintain a resting voltage across their cell membrane and to respond uniquely to incoming electrical and chemical stimuli. This unique electrical property of neurons is used to trigger other cellular events like action potentials and vesicle release with split second timing. These processes are ultimately the underpinnings of the cellular networks on which love, anger, and fear rely.

The brain is of course much more than the neocortex, and the function of the neocortex is entirely dependent on inputs it receives from elsewhere in the brain. Sensory information is processed first in the various nuclei in the thalamus. As sensory information passes through the thalamus, it is sorted and routed to specific locations in the cortex. These thalamic inputs generate synchronous activity in the cortex which is thought to be important for sensory processing. Synchrony between cortical areas has long been hypothesized to be coordinated by the hippocampus, and recent evidence has emerged confirming this idea (Sirota et al. 2008). One interesting and well-studied aspect of cortical function is the key role played by neuromodulation from lower brain areas in activation of cortical networks. Dopamine, serotonin, and noradrenalin are all neuromodulators originating from subcortical nuclei which have a great effect on cortical function. Sustained attention is thought to be crucially dependent on the ascending cholinergic (ACh) system originating in the basal forebrain and projecting to most of the cortex (Lee et al. 2005; Muir et al. 1995). Release of acetylcholine from the brain stem into the cortex is also thought to play a key role in the gating of thalamic information into the cortex, and indeed these two roles may be intertwined. Nicotine, an agonist for nicotinic acetylcholine receptors (nAChRs), has been shown to improve cognitive function in humans and other primates as well as in rodents (Hahn et al. 2003; Levin and Simon 1998; Rezvani and Levin 2001; Stein et al. 1998). Particularly, performance on attention and working memory tasks is improved by nicotine. In line with these assertions, immunostainings and radiolabelling reveal that while sensory cortices tend to stain for nAChRs specifically on thalamic terminals ending in layers I/II and IV, while expression of these receptors is much more robust and found

12

Chapter I

throughout all layers in the PFC. This would seem to be indicative of both the general role of nAChRs in sensory gating, and an as yet unspecified more dynamic role in PFC function. Another observation which ties together nAChRs, the frontal cortex, and attention is an fMRI study showing that nicotine increases the activation of frontal networks during attention tasks (Lawrence et al. 2002). Activation of nAChRs by nicotine has also been shown to increase some EEG frequencies and reduce some others in humans (Kadoya et al. 1994; Lindgren et al. 1999). Interestingly, during visual attention tasks acetylcholine release in the medial prefrontal cortex increases (Passetti et al. 2000), again suggesting that cholinergic signaling, network oscillations and attention are correlated. These data taken together give us hints at what role nAChRs play in cognition. Perhaps by modulating the cortical network in relation to thalamic inputs, nAChRs help to facilitate cortical activation or even synchronized activity.

While this hypothesis is beyond the scope of the present work, we will try to tackle one small aspect of it. The work in this thesis uses electrical recordings from individual neurons to describe how nAChRs contribute to PFC function at the cellular level using acute brain slices as an experimental model. Thus, background regarding the structure and function of nAChRs, as well as some of their effects on cognition will be useful as part of this synopsis.

Nicotinic Acetylcholine ReceptorsNicotinic AChRs are cation-selective ligand-gated channels

whose endogenous agonist is acetylcholine (ACh). Although the nicotinic acetylcholine receptor was not purified until the 1970’s, it was already in 1857 that the first ideas about this receptor developed when Claude Bernard observed that curare had a paralyzing effect on the site where peripheral motor fibers communicate with skeletal muscle. Nearly fifty years after Bernard made his first observations, the British pharmacologist John Newport Langeley offered the hypothesis that this communication was mediated by a “receptor substance” in 1905. For another half century, this hypothesis would

13


be subject of much debate and skepticism. In 1959, Jean-Pierre Changeux proposed that a receptor worked as a sort of molecular switch, moving between an open state and a closed state. The physiological signal (acetylcholine) or agonist established the open state and the antagonist (curare) established a closed stated. Early experiments by Changeux suggested that nAChRs were indeed channels. However, it was not until the discovery of α-bungarotoxin (a chemical produced by a cobra snake which irreversibly binds to nAChRs) that the receptor could be purified and biochemically characterized. The neuromuscular junction has since been studied extensively. The muscle nAChR consists of five subunits which form a pentameric protein; these are two α1 subunits, one β1 subunit, one δ subunit and one ε. The embryonic form of this protein contains a γ subunit in place of the ε subunit. Until late in the twentieth century, investigations into nAChR function were largely confined to the neuromuscular junction for several reasons: (1) the great diversity of nAChRs in the CNS, (2) the lack of specific ligands that bound to the different receptor types making it possible to identify them, (3) the fast activation/inactivation rate of some nAChRs especially those bearing the α7 subunit and (4) the relatively low density of nAChRs in some areas of the brain during development. (Albuquerque et al. 1995). The patch clamp technique was also(Albuquerque et al. 1995). The patch clamp technique was also a pivotal development to the study of nAChRs in the CNS. pivotal development to the study of nAChRs in the CNS. to the study of nAChRs in the CNS.study of nAChRs in the CNS. of nAChRs in the CNS. nAChRs in the CNS. in the CNS. CNS..

Neuronal nAChRs are pentameric combinations of twelve genetically distinct homologous subunits (α2 - α10 and β2 - β4), each combination potentially having a distinct single channel conductance, agonist sensitivity, and activation/desensitization kinetics (McGehee and Role 1995). Most nAChRs are assumed to be heterooligomeric (i.e. composed from various combinations of α and β subunits), and there is evidence that some α subunits also form homooligomeric proteins (Drisdel and Green 2000; McGehee and Role 1995). An open nicotinic receptor channel allows the movement of Na+, K+, and Ca++ across the cell membrane, and at resting membrane potential of a typical cortical cell this manifests as a depolarizing current. The calcium permeability of nAChRs is generally thought to play a crucial role in the central effects of nicotine (Dajas-Bailador and Wonnacott 2004), and it has

14

Chapter I

been long established that the subunit composition of the nAChRs influences their intrinsic calcium permeability (McGehee and Role 1995). Indeed, a significant proportion of the total charge passing through nAChRs is carried by calcium; in heteromeric nAChRs composed of α and β subunits the fractional calcium current is 2-5%. Homomeric α7 nAChRs exhibit a much larger fractional calcium current (6 - 12%) that appears similar to NMDA

receptors (Burnashev et al. 1995; Fucile 2004; Reyes et al. 1998).Early studies of nAChRs in the brain, two distinct binding sites for

nicotine were recognized. The α4β2-containing nAChRs were identified as the high-affinity nicotine binding site, whereas the neuronal bungarotoxin (αBTX) sensitive α7-containing nAChRs represented the low-affinity nicotine binding sites (Couturier et al. 1990; McGehee and Role 1995; Reboreda et al. 2007). Analysis of mRNA content of neurons showed that neurons in different brain areas express many more subunits (Alonso and Klink 1993; Charpantier et al. 1998; Porter et al. 1999). Recently, in studies using sub-micromolar concentrations of nicotine (concentrations experienced by smokers), it has become clear that the physiological importance of high- and low-affinity nicotine-binding sites may not so much be found in the activation properties of nAChRs but more in desensitization properties (Mansvelder et al. 2002; Wooltorton et al. 2003). At these low nicotine concentrations (100-250 nM) both α4β2 nAChRs and α7 nAChRs are activated, but α4β2 nAChRs desensitize much more. At 250 nM α4β2 nAChRs are completely desensitized within minutes, whereas α7 nAChRs are not and remain available for activation (Mansvelder et al. 2002; Wooltorton et al. 2003). Thus, both activation and desensitization properties have to be considered when trying to understand nicotinic modulation of neuronal networks.

Synaptic and Non-Synaptic Cholinergic TransmissionCNS neurons are thought to communicate via both synaptic and

non-synaptic chemical signals, although the extent to which non-synaptic neurotransmission is utilized in the cortex is unknown. This concept is vital

15


to our understanding the function of nAChRs in reference to their endogenous agonist ACh, as it is currently a central debate with regard to cholinergic transmission. Synapses (or synaptic junctions) are characterized by close appositions between the pre- and postsynaptic neuronal membrane specialized for communication. The percentage of GABAergic and glutamatergic axons which terminate on a post-synaptic site approaches 100% (Reboreda et al. 2007; Umbriaco et al. 1995; Umbriaco et al. 1994). In contrast, ultrastructural analyses of some monoaminergic nerve terminals in the cortex (Audet et al. 1989; Audet et al. 1988) and hippocampus (Vizi and Kiss 1998) show that the majority of these nerve terminals do not make contact with a post-synaptic density. These terminals are equipped for vesicle release despite not making direct synaptic contacts (Descarries and Mechawar 2000; Reboreda et al. 2007).

Cholinergic transmission is present in the early developing parietal cortex already at birth (Descarries et al. 1997; Mechawar and Descarries 2001). In the first two weeks after birth, the cholinergic innervation can be seen to increase greatly both in number of varicosities and number of branches per axon. However, the association of these new cholinergic terminals to post-synaptic densities (<15%) remains constant throughout adulthood (Mechawar et al. 2002). These studies point to a role for cholinergic volume transmission during development of the cortex. Microdialysis studies also support the idea of non-synaptic neurotransmission by showing that nearly all transmitters are present in the extracellular fluid. Cholinergic innervation has been reported to be almost exclusively extra-synaptic in several areas of the rat brain including the parietal cortex (Mechawar et al. 2002; Umbriaco et al. 1994), hippocampus(Mechawar et al. 2002; Umbriaco et al. 1994), hippocampus (Umbriaco et al. 1995), neostriatum (Contant et al. 1996), visual, sensory and parietal cortices (Avendano et al. 1996; Turrini et al. 2001). The co-existence of synaptic and a non-synaptic cholinergic transmission in the CNS has wide-ranging implications for our understanding of how nicotinic receptors affect neuronal networks, especially taking differences in activation and desensitization properties of nAChRs into account (Mansvelder et al. 2002; Quick and Lester 2002). Clues as to whether or not activation of specific cells

16

Chapter I

as opposed to excitation of whole microcircuits occurs in the PFC may be found in cellular data we find in the current investigation.

Location of Nicotinic Receptors in Hippocampus and CortexNicotinic receptors are ion channels and as such their subcellular

localization is critical to understanding their physiological impact on neuronal activity. Nicotinic AChRs have been shown to modulate presynaptic glutamate release (Gray et al. 2006; MacDermott et al. 1999; McGehee et al. 1995;(Gray et al. 2006; MacDermott et al. 1999; McGehee et al. 1995; McGehee and Role 1996). In addition, nAChRs can modulate GABAergic. In addition, nAChRs can modulate GABAergicIn addition, nAChRs can modulate GABAergic transmission in multiple brain areas, such as ventral tegmental area (VTA), thalamus, cortex and hippocampus (Albuquerque et al. 1997; Alkondon et(Albuquerque et al. 1997; Alkondon et al. 2000; Fisher and Dani 2000; Lena and Changeux 1997; Lena et al. 1993; Mansvelder et al. 2002; Zarei et al. 1999). Modulation of GABA neuronsModulation of GABA neurons by nAChRs has been most extensively studied in the hippocampus, where GABAergic interneurons express multiple nAChR subtypes (Albuquerque et al. 1997; Alkondon et al. 1999; Alkondon et al. 2004; Frazier et al. 1998; Ji and Dani 2000; Jones and Yakel 1997; McQuiston and Madison 1999). There is evidence for nAChR expression both on presynaptic terminals, where they directly modulate GABA release, independent of action potential firing (Fisher and Dani 2000; Lu et al. 1999; Zarei et al. 1999), and away from synaptic terminals, where modulation of GABA release is dependent on action potential firing (Albuquerque et al. 1997; Alkondon et al. 1999; Frazier et al. 1998). The expression of nAChRs is dependent on the interneuron subtype (Alkondon et al. 2004; McQuiston and Madison 1999).

Activation of nAChRs on cortical and hippocampal interneurons results either in inhibition or disinhibition of pyramidal neurons (Alkondon et al. 2000; Ji and Dani 2000; Ji et al. 2001). Inhibition is likely to be induced via nAChR-mediated increase in the GABAergic transmission directly onto pyramidal cells. Disinhibition of pyramidal neurons results from an increase of inhibitory GABAergic transmission to GABAergic interneurons by activation of nAChRs. Consequently, pyramidal neurons may receive less GABAergic input and are disinhibited.

17


There is significantly less data on nicotinic modulation of different types of neurons in the PFC. As in other parts of the neocortex, the PFC has a layered structure in which the majority of the cells are pyramidal. In rodents, several pyramidal and interneuron cell types have been identified physiologically, morphologically, as well as immunocytochemically (Gabbott et al. 1997; Gabbott et al. 2003; Kawaguchi 1993; 1995; Kawaguchi and Kondo 2002). In rat, thalamocortical inputs impinge on pyramidal neurons in layer V as well as in more superficial layers in the PFC. These inputs have been shown to be modulated by α4β2-containing nAChRs (Gil et al. 1997; Gioanni et al. 1999; Lambe et al. 2003). Nicotinic modulation of thalamocortical projections by. Nicotinic modulation of thalamocortical projections byNicotinic modulation of thalamocortical projections by α4β2-containing nAChRs appears to be a general phenomenon in the cortex (Metherate 2004). If glutamatergic thalamocortical projections also terminate on interneurons in the PFC, these may also be modulated by α4β2-containing nAChRs (Fig. 1A).

An elegant study in the rat motor cortex revealed distinct interneuron subtypes which both express nAChR mRNA for α4, α5, and β2 subunits and showed somatic nicotinic currents (Porter et al. 1999). Pyramidal cells, as well as interneurons expressing either parvalbumin or somatostatin, showed no effect of agonist application in this study. Interneurons expressing vasoactive intestinal peptide (VIP) and cholecystokinin (CCK) did show nicotinic currents, and pharmacological analysis implicated non-α7 nAChRs. In human cerebral cortical slices bipolar and multipolar interneurons exhibited either α7 or α4β2 nAChR-mediated currents (Alkondon et al. 2000). Rat PFC interneurons have been characterized extensively in medial and lateral agranular cortex and anterior cingulated cortex (Kawaguchi and Kubota 1996; Kawaguchi and Kubota 1997), but nicotinic effects on these neurons have not been tested. With specific interneuron subtypes and thalamic inputs to pyramidal cells regulated by nAChRs as in other cortical areas, nicotinic modulation of PFC neuronal networks may be similar to that in other cortical areas and hippocampus. In this way, nicotinic signaling could serve to fine-tune microcircuit function through inhibitory and disinhibitory mechanisms. However, this conclusion awaits experimental testing.

18

Chapter I

An interesting but seldom addressed aspect of cholinergic signaling in the cortex is the role of cholinergic interneurons in cortical microcircuit function. Cholinergic interneurons in the nucleus accumbens (NAc) can affect GABAergic transmission within the NAc itself via nAChR activation (de Rover et al. 2002). In addition, these cholinergic interneurons could be important in lasting changes in microcircuitries that affect animal behavior, since their intrinsic firing properties are altered during behavioral sensitization to amphetamine (de Rover et al. 2004). Furthermore, it is known from immunohistochemical data that a small fraction of bipolar interneurons in layer II/III of the sensory and motor cortices are cholinergic (Houser et al. 1985). A more recent study using single cell RT-PCR found a subgroup of cortical interneurons that were positive for vasoactive intestinal protein and calretinin and were also positive for ChAT transcripts (Cauli et al. 1997). These same VIP-positive cells were shown to be the main interneuron subtype also expressing nicotinic currents and nAChR mRNA (Porter et al. 1999). In addition, the NINDS GENSAT BAC Transgenics Project found choline acetyltransferase (Chat) positive staining in almost every part of the cortex, including the PFC (http://www.gensat.org/makeconnection.jsp). The putative presence of cholinergic interneurons in the PFC introduces the possibility of nicotine-induced ACh release independent of release from cholinergic terminals that originate from lower brain areas. Since the PFC is implicated in behavioral sensitization (see below), intrinsic properties of cholinergic interneurons and ACh release in the PFC could also be modified during behavioral sensitization, as was found by our group in the NAc (de Rover et al. 2004).

Tobacco, nicotine and cognitionNicotine is a plant-synthesized alkaloid whose primary evolutionary

value was most likely as an insecticide. Most chemical neurotransmission in the insect nervous system uses acetylcholine, and it is the action of the acetylcholine which nicotine can mimic. By gating cholinergic ion channels,

19


nicotine can disrupt normal neurotransmission and cause massive systemic failure. Although also poisonous to most vertebrates, because nAChRs play a much different role in the vertebrate central nervous system, small doses can have various stimulatory effects. These effects provide important clues the role of nAChRs in normal brain function.

Tobacco and nicotine have complex effects on human performance, determined in part by whether human subjects are in a state of tobacco deprivation. In nicotine deprived individuals an impaired attention and cognitive ability may become apparent within 12 h of smoking cessation, while nicotine administration (either via smoking or via transdermal deposition) may reverse such deficits to preabstinence levels (Krenz et al. 2001). In a variety of human disorders, such as attention deficit/hyperactivity disorder (ADHD) and schizophrenia, nicotinic drugs may act beneficial on attention and sensory gating (Newhouse et al. 2004). A significantly higher percentage of adults and adolescents that have been diagnosed with ADHD smoke and have a lower chance of quitting smoking (Lambert and Hartsough 1998) than unaffected human subjects. Also among schizophrenic patients smoking rates are much higher (90%) compared to the general population (20-30%) (Lohr and Flynn 1992; Picciotto et al. 2000), thus it has been postulated that nicotine may ameliorate some of the major cognitive deficits associated with this disease (Martin et al. 2004; Newhouse et al. 2004).

Nicotine may exert its cognitive effects by modulating activity in one or more cortical regions associated with mechanisms of sustained attention (Coull 1998; Sarter et al. 2001), including the prefrontal, parietal, and occipital cortex (Cabeza and Nyberg 2000; Rueckert and Grafman 1996; 1998). Funtional MRI studies have shown that nicotine improves attention in smokers by extra activation of the cortical areas traditionally associated with visual attention, arousal, and motor activation (Lawrence et al. 2002). Also in non smokers, nicotine appears to produce an increased fMRI signal in the anterior cingulate, superior frontal cortex, and superior parietal cortex, which suggests that nicotine may alter neuronal activity in a distributed neural network associated with on-line task monitoring and attention and

20

Chapter I

arousal (Kumari et al. 2003). In addition, nicotine may influence focusing of attention in smokers as well as nonsmokers. However there are also trait-like differences in some cognitive domains, such as working memory in smokers versus non-smokers, which in turn may be long-term effects and etiological factors related to smoking (Krenz et al. 2001).

It is debated whether improved performance associated with relief from withdrawal in abstinent smokers should be considered as cognitive enhancement (Newhouse et al. 2004). However, it was shown that also in nonsmokers visual attention performance is increased by nicotine (Lawrence et al. 2002) and nicotine reduced attention reaction time both in abstinent smokers and in non-smokers (Krenz et al. 2001). However, many studies show performance impairment by nicotine in non-smokers (Newhouse et al. 2004). In line with this, chronic cigarette smoking generally does not improve cognitive processing (Ascioglu et al. 2004), while nicotine deprivation tends to affect cognitive performance (Havermans et al. 2003). It is likely that transient exposure and long-term exposure to nicotine affect neuronal circuits in the brain very differently.

To understand how nicotine exerts these effects on cognitive performance, its short-term and long-term impact on neuronal circuitries involved has to be assessed. However, we are only beginning to understand some of the processes involved. Several factors can be distinguished in how nicotine can alter neuronal network properties and information processing, and these factors press for an analysis at multiple levels of organization. First of all, how a neuronal network will be affected by nAChR activation depends on which neurons in the network express nAChRs: interneurons, pyramidal neurons or other types of neurons. Secondly, the subcellular location where these receptors are expressed will strongly impact neuronal and synaptic modulation. The receptors can be located on the cell body, presynaptic terminals or at postsynaptic sites on dendrites. Thirdly, the type or types of nAChRs that are expressed will determine how the network is affected by nicotinic modulation: activation and desensitization kinetics, agonist sensitivity and single channel conductance. Fourthly, whether cholinergic signaling in the

21


network occurs through direct synaptic or indirect non-synaptic transmission will also impact nicotinic modulation. These factors will combine to alter neuronal network properties that may last as long as nicotine or acetylcholine is present.

Pharmacology of nAChRs in cognitionEndogenous cholinergic signaling in the PFC is important to cognitive

processing. When the α7 selective antagonist αBTX (McGehee and Role 1995; Reboreda et al. 2007) or the β2 selective antagonist DHβE (Alkondon and Albuquerque 1993; Luetje et al. 1990; McGehee and Role 1995) are injected into the prelimbic area of rat PFC, delayed response tasks requiring effortful processing for response selection are hampered while general working memory and memory processes are unimpaired (Maskos et al. 2005). Thus while nAChR activation in sensory cortical brain areas may contribute to improved behavioral performance in sensory-cognitive tasks by enhancing sensory responsiveness (Metherate 2004), the endogenous nAChR activation in the PFC of rats appears to distinctly control executive functions. This was confirmed in studies where cholinergic transmission in the medial PFC was reduced by injection of the cholinergic immunotoxin 192 IgG-saporin (SAP) (McGaughy et al. 2005). In the five-choice serial reaction time task (5-CSRTT), a behavioral paradigm that tests for attention performance, rats injected with SAP and thus reduced acetylcholine efflux in the medial frontal cortex showed impaired attentional function (McGaughy et al. 2005).

As rats, mice may also show complex behaviors geared toward far-removed goals, which depend primarily on prefrontal cortex function. The effects of endogenous activation of nicotinic transmission in this species have been assessed by means of genetic deletion of β2-containing nAChR (Maskos et al. 2005). It was found that PFC-based cognitive functions in these mutant mice, such as spatiotemporal organization of locomotor behavior, together with conflict resolution and social interactions, were clearly affected and dissociated from unimpaired memory and anxiety. Since the behavior of β2-mutant mice resembled that exhibited by rats with lesions of the prefrontal

22

Chapter I

(and cingulated) cortex, it seems that endogenous activation of nAChR in the PFC in rodents is involved in supervisory planning of locomotor and conflict resolution behavior.

In contrast to endogenous activation of nAChRs in the PFC, the behavioral effects of exogenous activation of nAChRs in PFC have been more difficult to assess. Intraperitoneal injections of nicotine in rats decreased reaction time and increased anticipatory responses in the 5-CSRTT, (Blondel et al. 1999; Hahn et al. 2003). All the effects of nicotine in the 5-CSRTT were antagonized by the non-α7-containing nAChR antagonist MEC and DHβE, but not by hexamethonium or methylylcaconitine (MLA, more selective for α7-containing nAChRs) (Blondel et al. 2000), which suggested that α7-contaning nAChR are less likely to mediate these behavioral effects of exogenous nicotine (but see below). Although effects of nicotine on other cognitive tasks have been reported, nicotine improvement of tasks assessing attentional performance are most consistently seen (Blondel et al. 2000; Blondel et al. 1999). Also in mice, tested in a modified version of the 5-CSRTT with graded levels of difficulty, it was found that nicotine produced a consistent reduction in the level of omissions and thus a demonstrable improvement in attention behavior (Young et al. 2004). Thus sustained attention behavior in rodents, which includes proper target detection, time-related performance and appropriate reaction time of higher-order cognitive processing, is likely to improve both in acute as well as in chronic nicotine treatment paradigms.

One problem faced when identifying nAChR subtypes underlying the beneficial effects of nicotine on sustained attention is the current lack of truly selective compounds and difficulties of producing more nAChR subtype specific drugs. Hence various labs have recently taken a transgenic approach to delineate the nAChR receptor subtypes involved in PFC based cognition (Cordero-Erausquin et al. 2004). In a hallmark study in this respect, Young et al. (2004) examined the performance of α7 nAChR knockout mice in the 5-SCRTT and found that these mutants not only acquired the task more slowly than their wild type littermates, but on attained asymptotic performance they exhibited a higher level of omissions. Even in a simpler version of 5-SCRTT,

23


the α7 knockout mice performed less well (Young et al. 2004). Importantly, these mice were previously shown to behave normally in a number of other behavioral tests, including contextual and fear conditioning, spatial memory and anxiety tests (Broide et al. 2002).

Several studies have previously indicated that α7 nAChRs may be crucial in attention performance, and more specifically in sensory gating (Martin et al. 2004). Schizophrenic patients and their unaffected relatives show reduced auditory gating. Genetic analysis shows that this was linked to chromosome 15q14, in a region proximal to the α7 locus. However, studies on α7 nAChR mediated improvement of sensory gating in animal models for schizophrenia clearly show that this aspect of the attention phenotype is not located in the PFC but rather in the hippocampus (Martin et al. 2004). DBA/2 inbred mice, which display a reduced α7 nAChR density in CA3, show sensory gating deficits that can be ameliorated with partial α7 agonists. Surprisingly, α7 nAChR knock out mice did not show sensory gating deficits (Broide et al. 2002). To date there is no satisfying explanation for this outcome, although compensatory mechanisms, such as alterations in nAChR density, distribution and/or subtype, may result in different results from those observed in pharmacological studies (Young et al. 2004).

The distribution of nicotine binding in monkeys corresponds broadly to the patterns observed in rodents, but the distribution of the binding sites for αBTX appears larger in the brains of rhesus monkeys than in rodent brains, suggesting a more important role of α7 receptors in primates (Han et al. 2003). αBTX binding was dense in layer I of most cortical areas, and a moderate labeling was found in layers V and VI of the prefrontal and other frontal cortices (Han et al. 2003). Also in monkeys, nicotine and other agonists of nAChRs improve cognitive performance, in particular visual recognition memory (Katner et al. 2004). In rhesus monkeys trained to perform a battery of six behavioral tasks nicotine improved performance on tests that assay visual recognition memory, spatial working memory and visuo-spatial associative memory. MEC impaired visuo-spatial associative memory (Katner et al. 2004). Further, ballistic and fine motor performance was not significantly

24

Chapter I

improved by nicotine although fine motor performance appeared impaired by MEC. It was not further investigated to which extent, nAChR activation in PFC was specifically involved in this study, but visual recognition is likely to involve frontal cortices.

Monkeys that have previously received a chronic low dose of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) may develop attentional deficits and it has been reported that SIB-1553A, a novel agonist with selectivity for β4-containing nAChRs, may counteract this type of cognitive deficit (Schneider et al. 2003). It is of particular interest that at lower doses, SIB-1553A appeared more effective in improving attentional deficits in monkeys associated with chronic MPTP exposure, whereas at higher doses, SIB-1553A appeared to effectively improve both attentional and memory performances (Schneider et al. 2003). As in rodents, various types of cognitive brain functions appear to also be under control of nAChRs in the primate PFC. However, although some attention functions were tested, albeit under extreme circumstances (Schneider et al. 2003), it is less clear to what extent sustained attention behavior is affected by nAChR activation in this species. Moreover, the putative predominant involvement of one particular α-subunit nAChR subtype at present cannot be confirmed.

A major challenge in mechanistically understanding nicotinic actions on cognition is to pinpoint nAChR location in neuronal networks. At present it is unknown where in the PFC the α7 containing nAChRs that facilitate sustained attention behavior may be localized. Many options are open. The effects could be mediated by α7-containing nAChRs on interneurons in the PFC, as has been shown in other cortical areas both in rodents and human cortex (Alkondon et al. 2000; Alkondon et al. 2004). Interestingly, α7 nAChR immunoreactivity in the prefrontal cortex of patients with schizophrenia may be reduced, whereas α4, α3 or β2 immunoreactivity or α7 mRNA expression appeared comparable to those observed in unaffected subjects (Martin-Ruiz et al. 2003). Alternatively, α7 nAChR involved in sustained attention could be located on corticocortical efferent terminals in the PFC. Then again, the effects could be less direct. For instance, α7-containing nAChRs are

25


abundantly present in the VTA, as described above (Alonso and Klink 1993; Jones and Wonnacott 2004; Mansvelder and McGehee 2000; Pidoplichko et al. 1997). Activation of these receptors increases firing rates of dopamine and. Activation of these receptors increases firing rates of dopamine andActivation of these receptors increases firing rates of dopamine and GABA neurons some of which project to the PFC, thereby potentially altering PFC function. Further research will have to target these types of questions.

Synopsis of the thesisThis thesis addresses the role of nAChRs in the mouse prefrontal

cortex cortical network by exploring the effects that nAChR activation can have on individual PFC neurons and their inputs, and how these changes can impact PFC microcircuit function. Understanding how nAChRs contribute to cortical function at this level will logically require placing them accurately into a functional description of a cortical microcircuit. Experimental emphasis is placed on cellular mechanisms of nicotinic modulation of prefrontal cortex neurons as can be measured using electrophysiological techniques. The activation of nAChRs in the mPFC network of a brain slice is used as an experimental model to characterize how nAChRs are positioned within the network and demonstrate possible physiological consequences of nAChR activation. This study of nicotinic modulation of the mPFC microcircuit is comprised of three experimental chapters.

Pyramidal cells of layer V, like in other cortical areas, are thought to be the principle output cells of the PFC. Understanding how nAChRs can impact pyramidal cell function is central to understanding their contribution to the PFC network. Pyramidal cells sit within a complex network of neurons, many of which are inhibitory GABAergic neurons. Achieving a precise balance between excitation and inhibition is thought to be vital to normal cortical function. As previously stated, interneurons are also essential to oscillatory behavior in the hippocampus and cortex. The extent to which nAChRs—through modulation of interneurons in particular—play a role in PFC neuronal function is characterized in Chapter II.

Building on chapter II, we examine the function of layer V pyramidal cells in the context of this network. Pyramidal cells regulate the strength

26

Chapter I

of their synaptic connections using a complex mechanism of molecular coincidence detectors, calcium signals, and second messengers collectively termed “spike timing dependent plasticity” or STDP. To demonstrate an exemplary physiological role for nAChRs in the PFC network, we investigated the STDP phenomenon in layer V pyramidal cells as the subject of chapter III. While pyramidal cells do not express nAChRs, we demonstrate that the nAChRs described in chapter II can directly affect STDP in pyramidal cells.

Pyramidal cells are known to be connected to one another also via interneurons. One recent study characterized a feedforward inhibitory loop involving LTS interneurons and layer V pyramids. These connections are thought to be crucial to providing critical surround inhibition in layer V. How nAChRs can change the functional consequences of this disynaptic inhibitory loop on the pyramidal cell network is the subject of chapter IV.

The results of this work, although specific for the mouse PFC, are likely a reflection of a general phenomenon, not only in the PFC of other vertebrates, but also generally throughout the vertebrate neocortex. I will conclude my thesis in Chapter V by arguing that nAChRs throughout the cortex represent a sub-cellular correlate of how thalamic information is differentially processed throughout the cortex. Unveiling the neuronal mechanisms important for nicotinic modulation will not only contribute to our understanding of the cholinergic system in normal brain function, but also will be valuable when exploring the treatment of human disorders in which cholinergic signaling have been implicated, such as schizophrenia, attention deficit/hyperactivity disorder (ADHD) and addiction.

27


ReferencesAlbuquerque EX, Alkondon M, Pereira EFR, Castro NG, Schrattenholz

A, Barbosa CTF, Bonfante-Cabarcas R, Aracava Y, Eisenberg HM, Maelicke A (1997) Properties of Neuronal Nicotinic Acetylcholine Receptors: Pharmacological Characterization and Modulation of Synaptic Function,. J Pharmacol Exp Ther 280: 1117-1136

Alkondon M, Albuquerque EX (1993) Diversity of nicotinic acetylcholine receptors in rat hippocampal neurons. I. Pharmacological and functional evidence for distinct structural subtypes. J Pharmacol Exp Ther 265: 1455-1473

Alkondon M, Pereira EF, Eisenberg HM, Albuquerque EX (2000) Nicotinic receptor activation in human cerebral cortical interneurons: a mechanism for inhibition and disinhibition of neuronal networks. J.Neurosci. 20: 66-75

Alkondon M, Pereira EFR, Eisenberg HM, Albuquerque EX (1999) Choline and Selective Antagonists Identify Two Subtypes of Nicotinic Acetylcholine Receptors that Modulate GABA Release from CA1 Interneurons in Rat Hippocampal Slices. J. Neurosci. 19: 2693-2705

Alkondon M, Pereira EFR, Yu P, Arruda EZ, Almeida LEF, Guidetti P, Fawcett WP, Sapko MT, Randall WR, Schwarcz R, Tagle DA, Albuquerque EX (2004) Targeted Deletion of the Kynurenine Aminotransferase II Gene Reveals a Critical Role of Endogenous Kynurenic Acid in the Regulation of Synaptic Transmission via {alpha}7 Nicotinic Receptors in the Hippocampus. J. Neurosci. 24: 4635-4648

Alonso A, Klink R (1993) Differential electroresponsiveness of stellate and pyramidal-like cells of medial entorhinal cortex layer II. J Neurophysiol 70: 128-143

Ascioglu M, Dolu N, Golgeli A, Suer C, Ozesmi C (2004) Effects of cigarette smoking on cognitive processing. Int J Neurosci 114: 381-90

Audet MA, Descarries L, Doucet G (1989) Quantified regional and laminar distribution of the serotonin innervation in the anterior half of adult rat cerebral cortex. J Chem Neuroanat 2: 29-44

Audet MA, Doucet G, Oleskevich S, Descarries L (1988) Quantified regional and laminar distribution of the noradrenaline innervation in the anterior half of the adult rat cerebral cortex. J Comp Neurol 274: 307-18

Avendano C, Umbriaco D, Dykes RW, Descarries L (1996) Acetylcholine

28

Chapter I

innervation of sensory and motor neocortical areas in adult cat: a choline acetyltransferase immunohistochemical study. J Chem Neuroanat 11: 113-30

Blondel A, Sanger DJ, Moser PC (2000) Characterisation of the effects of nicotine in the five-choice serial reaction time task in rats: antagonist studies. Psychopharmacology (Berl) 149: 293-305

Blondel A, Simon H, Sanger DJ, Moser P (1999) The effect of repeated nicotine administration on the performance of drug-naive rats in a five-choice serial reaction time task. Behav Pharmacol 10: 665-73

Broide RS, Salas R, Ji D, Paylor R, Patrick JW, Dani JA, De Biasi M (2002) Increased Sensitivity to Nicotine-Induced Seizures in Mice Expressing the L250T alpha 7 Nicotinic Acetylcholine Receptor Mutation. Mol Pharmacol 61: 695-705

Burnashev N, Zhou Z, Neher E, Sakmann B (1995) Fractional calcium currents through recombinant GluR channels of the NMDA, AMPA and kainate receptor subtypes. J Physiol 485 ( Pt 2): 403-18

Cabeza R, Nyberg L (2000) Imaging cognition II: An empirical review of 275 PET and fMRI studies. J Cogn Neurosci 12: 1-47

Cauli B, Audinat E, Lambolez B, Angulo MC, Ropert N, Tsuzuki K, Hestrin S, Rossier J (1997) Molecular and physiological diversity of cortical nonpyramidal cells. J Neurosci 17: 3894-906

Charpantier E, Barneoud P, Moser P, Besnard F, Sgard F (1998) Nicotinic acetylcholine subunit mRNA expression in dopaminergic neurons of the rat substantia nigra and ventral tegmental area. Neuroreport 9: 3097-3101

Contant C, Umbriaco D, Garcia S, Watkins KC, Descarries L (1996) Ultrastructural characterization of the acetylcholine innervation in adult rat neostriatum. Neuroscience 71: 937-47

Cordero-Erausquin M, Pons S, Faure P, Changeux J-P (2004) Nicotine differentially activates inhibitory and excitatory neurons in the dorsal spinal cord. Pain 109: 308-318

Coull JT (1998) Neural correlates of attention and arousal: insights from electrophysiology, functional neuroimaging and psychopharmacology. Prog Neurobiol 55: 343-61

Couturier S, Bertrand D, Matter JM, Hernandez MC, Bertrand S, Millar N, Valera S, Barkas T, Ballivet M (1990) A neuronal nicotinic acetylcholine receptor subunit (alpha 7) is developmentally regulated and forms a homo-oligomeric channel blocked by alpha-BTX. Neuron 5: 847-56

29


Dajas-Bailador F, Wonnacott S (2004) Nicotinic acetylcholine receptors and the regulation of neuronal signalling. Trends Pharmacol Sci 25: 317-24

de Rover M, Lodder JC, Kits KS, Schoffelmeer AN, Brussaard AB (2002) Cholinergic modulation of nucleus accumbens medium spiny neurons. Eur J Neurosci 16: 2279-90.

de Rover M, Mansvelder HD, Lodder JC, Wardeh G, Schoffelmeer ANM, Brussaard AB (2004) Long-lasting nicotinic modulation of GABAergic synaptic transmission in the rat nucleus accumbens associated with behavioural sensitization to amphetamine. Eur J Neurosci 19: 2859-2870

Descarries L, Gisiger V, Steriade M (1997) Diffuse transmission by acetylcholine in the CNS. Prog Neurobiol 53: 603-25

Descarries L, Mechawar N (2000) Ultrastructural evidence for diffuse transmission by monoamine and acetylcholine neurons of the central nervous system. Prog Brain Res 125: 27-47

Drisdel RC, Green WN (2000) Neuronal alpha-bungarotoxin receptors are alpha7 subunit homomers. J Neurosci 20: 133-9

Fisher JL, Dani JA (2000) Nicotinic receptors on hippocampal cultures can increase synaptic glutamate currents while decreasing the NMDA-receptor component. Neuropharmacology 39: 2756-2769

Frazier CJ, Rollins YD, Breese CR, Leonard S, Freedman R, Dunwiddie TV (1998) Acetylcholine activates an alpha-bungarotoxin-sensitive nicotinic current in rat hippocampal interneurons, but not pyramidal cells. J.Neurosci. 18: 1187-1195

Fucile S (2004) Ca2+ permeability of nicotinic acetylcholine receptors. Cell Calcium 35: 1-8

Fuster JM (2000a) Executive frontal functions. Exp Brain Res 133: 66-70Fuster JM (2000b) Prefrontal neurons in networks of executive memory.

Brain Res Bull 52: 331-6Gabbott PL, Dickie BG, Vaid RR, Headlam AJ, Bacon SJ (1997) Local-

circuit neurones in the medial prefrontal cortex (areas 25, 32 and 24b) in the rat: morphology and quantitative distribution. J Comp Neurol 377: 465-99

Gabbott PL, Warner TA, Jays PR, Bacon SJ (2003) Areal and synaptic interconnectivity of prelimbic (area 32), infralimbic (area 25) and insular cortices in the rat. Brain Res 993: 59-71

Gil Z, Connors BW, Amitai Y (1997) Differential Regulation of Neocortical Synapses by Neuromodulators and Activity. Neuron 19: 679-686

30

Chapter I

Gioanni Y, Rougeot C, Clarke PBS, Lepouse C, Thierry AM, Vidal C (1999) Nicotinic receptors in the rat prefrontal cortex: increase in glutamate release and facilitation of mediodorsal thalamo-cortical transmission. Eur J Neurosci 11: 18-30

Goldman-Rakic PS (1995) Cellular basis of working memory. Neuron 14: 477-85.

Gray NW, Weimer RM, Bureau I, Svoboda K (2006) Rapid Redistribution of Synaptic PSD-95 in the Neocortex In Vivo. PLoS Biol 4

Groenewegen HJ, Uylings HB (2000) The prefrontal cortex and the integration of sensory, limbic and autonomic information. Prog Brain Res 126: 3-28

Hahn B, Shoaib M, Stolerman IP (2003) Involvement of the prefrontal cortex but not the dorsal hippocampus in the attention-enhancing effects of nicotine in rats. Psychopharmacology 168: 271-279

Han ZY, Zoli M, Cardona A, Bourgeois JP, Changeux JP, Le Novere N (2003) Localization of [3H]nicotine, [3H]cytisine, [3H]epibatidine, and [125I]alpha-bungarotoxin binding sites in the brain of Macaca mulatta. J Comp Neurol 461: 49-60

Havermans RC, Debaere S, Smulders FT, Wiers RW, Jansen AT (2003) Effect of cue exposure, urge to smoke, and nicotine deprivation on cognitive performance in smokers. Psychol Addict Behav 17: 336-9

Houser CR, Crawford GD, Salvaterra PM, Vaughn JE (1985) Immunocytochemical localization of choline acetyltransferase in rat cerebral cortex: a study of cholinergic neurons and synapses. J Comp Neurol 234: 17-34

Ji D, Dani JA (2000) Inhibition and Disinhibition of Pyramidal Neurons by Activation of Nicotinic Receptors on Hippocampal Interneurons. J Neurophysiol 83: 2682-2690

Ji D, Lape R, Dani JA (2001) Timing and location of nicotinic activity enhances or depresses hippocampal synaptic plasticity. Neuron 31: 131-141

Jones IW, Wonnacott S (2004) Precise Localization of {alpha}7 Nicotinic Acetylcholine Receptors on Glutamatergic Axon Terminals in the Rat Ventral Tegmental Area. J. Neurosci. 24: 11244-11252

Jones S, Yakel JL (1997) Functional nicotinic ACh receptors on interneurones in the rat hippocampus. J Physiol 504 ( Pt 3): 603-10

Kadoya C, Domino EF, Matsuoka S (1994) Relationship of electroencephalographic and cardiovascular changes to plasma nicotine levels in tobacco smokers. Clin Pharmacol Ther 55: 370-7

31


Katner SN, Davis SA, Kirsten AJ, Taffe MA (2004) Effects of nicotine and mecamylamine on cognition in rhesus monkeys. Psychopharmacology (Berl) 175: 225-40

Kawaguchi Y (1993) Groupings of nonpyramidal and pyramidal cells with specific physiological and morphological characteristics in rat frontal cortex. J Neurophysiol 69: 416-431

Kawaguchi Y (1995) Physiological subgroups of nonpyramidal cells with specific morphological characteristics in layer II/III of rat frontal cortex. J Neurosci 15: 2638-55

Kawaguchi Y, Kondo S (2002) Parvalbumin, somatostatin and cholecystokinin as chemical markers for specific GABAergic interneuron types in the rat frontal cortex. Journal of Neurocytology 31: 277-287

Kawaguchi Y, Kubota Y (1996) Physiological and morphological identification of somatostatin- or vasoactive intestinal polypeptide-containing cells among GABAergic cell subtypes in rat frontal cortex. J. Neurosci. 16: 2701-2715

Kawaguchi Y, Kubota Y (1997) GABAergic cell subtypes and their synaptic connections in rat frontal cortex. Cereb. Cortex 7: 476-486

Krenz I, Kalkan D, Wevers A, de Vos RAI, Jansen Steur ENH, Lindstrom J, Pilz K, Nowacki S, Schütz U, Moser N, Witter B, Schröder H (2001) Parvalbumin-containing interneurons of the human cerebral cortex express nicotinic acetylcholine receptor proteins. Journal of Chemical Neuroanatomy 21: 239-246

Kumari V, Gray JA, ffytche DH, Mitterschiffthaler MT, Das M, Zachariah E, Vythelingum GN, Williams SC, Simmons A, Sharma T (2003) Cognitive effects of nicotine in humans: an fMRI study. Neuroimage 19: 1002-13

Lambe EK, Picciotto MR, Aghajanian GK (2003) Nicotine induces glutamate release from thalamocortical terminals in prefrontal cortex. Neuropsychopharmacology 28: 216-25

Lambert NM, Hartsough CS (1998) Prospective study of tobacco smoking and substance dependencies among samples of ADHD and non-ADHD participants. J Learn Disabil 31: 533-44

Lawrence NS, Ross TJ, Stein EA (2002) Cognitive Mechanisms of Nicotine on Visual Attention. Neuron 36: 539-548

Lee JL, Di Ciano P, Thomas KL, Everitt BJ (2005) Disrupting reconsolidation of drug memories reduces cocaine-seeking behavior. Neuron 47: 795-801

32

Chapter I

Lena C, Changeux JP (1997) Role of Ca2+ ions in nicotinic facilitation of GABA release in mouse thalamus. J Neurosci 17: 576-85

Lena C, Changeux JP, Mulle C (1993) Evidence for “preterminal” nicotinic receptors on GABAergic axons in the rat interpeduncular nucleus. J Neurosci 13: 2680-8

Levin ED, Simon BB (1998) Nicotinic acetylcholine involvement in cognitive function in animals. Psychopharmacology (Berl) 138: 217-230

Lindgren M, Molander L, Verbaan C, Lunell E, Rosen I (1999) Electroencephalographic effects of intravenous nicotine--a dose-response study. Psychopharmacology (Berl) 145: 342-50

Lohr JB, Flynn K (1992) Smoking and schizophrenia. Schizophr.Res. 8: 93-102

Lu Y, Marks MJ, Collins AC (1999) Desensitization of nicotinic agonist-induced [3H]gamma-aminobutyric acid release from mouse brain synaptosomes is produced by subactivating concentrations of agonists. J Pharmacol Exp Ther 291: 1127-34

Luetje CW, Patrick J, Seguela P (1990) Nicotine receptors in the mammalian brain. Faseb J 4: 2753-60

MacDermott AB, Role LW, Siegelbaum SA (1999) Presynaptic ionotropic receptors and the control of transmitter release. Annu Rev Neurosci 22: 443-85

Mansvelder HD, Keath JR, McGehee DS (2002) Synaptic Mechanisms Underlie Nicotine-Induced Excitability of Brain Reward Areas. Neuron 33: 905-919

Mansvelder HD, McGehee DS (2000) Long-term potentiation of excitatory inputs to brain reward areas by nicotine. Neuron 27: 349-357

Martin-Ruiz CM, Haroutunian VH, Long P, Young AH, Davis KL, Perry EK, Court JA (2003) Dementia rating and nicotinic receptor expression in the prefrontal cortex in schizophrenia. Biological Psychiatry 54: 1222-1233

Martin LF, Kem WR, Freedman R (2004) Alpha-7 nicotinic receptor agonists: potential new candidates for the treatment of schizophrenia. Psychopharmacology (Berl)

Maskos U, Molles BE, Pons S, Besson M, Guiard BP, Guilloux J-P, Evrard A, Cazala P, Cormier A, Mameli-Engvall M, Dufour N, Cloez-Tayarani I, Bemelmans A-P, Mallet J, Gardier AM, David V, Faure P, Granon S, Changeux J-P (2005) Nicotine reinforcement and cognition restored by targeted expression of nicotinic receptors. 436:

33


103-107McGaughy J, Koene RA, Eichenbaum H, Hasselmo ME (2005) Cholinergic

Deafferentation of the Entorhinal Cortex in Rats Impairs Encoding of Novel But Not Familiar Stimuli in a Delayed Nonmatch-to-Sample Task. J. Neurosci. 25: 10273-10281

McGehee DS, Heath MJ, Gelber S, Devay P, Role LW (1995) Nicotine enhancement of fast excitatory synaptic transmission in CNS by presynaptic receptors. Science 269: 1692-1696

McGehee DS, Role LW (1995) Physiological diversity of nicotinic acetylcholine receptors expressed by vertebrate neurons. Annu.Rev.Physiol 57: 521-546

McGehee DS, Role LW (1996) Presynaptic ionotropic receptors. Curr.Opin.Neurobiol. 6: 342-349

McQuiston AR, Madison DV (1999) Nicotinic receptor activation excites distinct subtypes of interneurons in the rat hippocampus. J Neurosci 19: 2887-96

Mechawar N, Descarries L (2001) The cholinergic innervation develops early and rapidly in the rat cerebral cortex: a quantitative immunocytochemical study. Neuroscience 108: 555-67

Mechawar N, Watkins KC, Descarries L (2002) Ultrastructural features of the acetylcholine innervation in the developing parietal cortex of rat. J Comp Neurol 443: 250-8

Metherate R (2004) Nicotinic Acetylcholine Receptors in Sensory Cortex. Learn. Mem. 11: 50-59

Miller EK (2000) The prefrontal cortex and cognitive control. Nat Rev Neurosci 1: 59-65.

Muir JL, Everitt BJ, Robbins TW (1995) Reversal of visual attentional dysfunction following lesions of the cholinergic basal forebrain by physostigmine and nicotine but not by the 5-HT3 receptor antagonist, ondansetron. Psychopharmacology (Berl) 118: 82-92

Newhouse PA, Potter A, Singh A (2004) Effects of nicotinic stimulation on cognitive performance. Current Opinion in Pharmacology 4: 36-46

Passetti F, Dalley JW, O’Connell MT, Everitt BJ, Robbins TW (2000) Increased acetylcholine release in the rat medial prefrontal cortex during performance of a visual attentional task. Eur.J.Neurosci. 12: 3051-3058

Picciotto MR, Caldarone BJ, King SL, Zachariou V (2000) Nicotinic receptors in the brain. Links between molecular biology and behavior. Neuropsychopharmacology 22: 451-65

34

Chapter I

Pidoplichko VI, DeBiasi M, Williams JT, Dani JA (1997) Nicotine activates and desensitizes midbrain dopamine neurons. Nature 390: 401-404

Porter JT, Cauli B, Tsuzuki K, Lambolez B, Rossier J, Audinat E (1999) Selective Excitation of Subtypes of Neocortical Interneurons by Nicotinic Receptors. J. Neurosci. 19: 5228-5235

Quick MW, Lester RA (2002) Desensitization of neuronal nicotinic receptors. J Neurobiol 53: 457-78

Reboreda A, Raouf R, Alonso A, Seguela P (2007) Development of Cholinergic Modulation and Graded Persistent Activity in Layer V of Medial Entorhinal Cortex. J Neurophysiol 97: 3937-3947

Reyes A, Lujan R, Rozov A, Burnashev N, Somogyi P, Sakmann B (1998) Target-cell-specific facilitation and depression in neocortical circuits. Nat Neurosci 1: 279-85

Rezvani AH, Levin ED (2001) Cognitive effects of nicotine. Biol Psychiatry 49: 258-67

Rueckert L, Grafman J (1996) Sustained attention deficits in patients with right frontal lesions. Neuropsychologia 34: 953-63

Rueckert L, Grafman J (1998) Sustained attention deficits in patients with lesions of posterior cortex. Neuropsychologia 36: 653-60

Sarter M, Givens B, Bruno JP (2001) The cognitive neuroscience of sustained attention: where top-down meets bottom-up. Brain Res Brain Res Rev 35: 146-60

Schneider JS, Tinker JP, Menzaghi F, Lloyd GK (2003) The subtype-selective nicotinic acetylcholine receptor agonist SIB-1553A improves both attention and memory components of a spatial working memory task in chronic low dose 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-treated monkeys. J Pharmacol Exp Ther 306: 401-6

Sirota A, Montgomery S, Fujisawa S, Isomura Y, Zugaro M, Buzsáki G (2008) Entrainment of Neocortical Neurons and Gamma Oscillations by the Hippocampal Theta Rhythm. Neuron 60: 683-697

Stein EA, Pankiewicz J, Harsch HH, Cho JK, Fuller SA, Hoffmann RG, Hawkins M, Rao SM, Bandettini PA, Bloom AS (1998) Nicotine-induced limbic cortical activation in the human brain: a functional MRI study. Am J Psychiatry 155: 1009-15.

Turrini P, Casu MA, Wong TP, De Koninck Y, Ribeiro-da-Silva A, Cuello AC (2001) Cholinergic nerve terminals establish classical synapses in the rat cerebral cortex: synaptic pattern and age-related atrophy. Neuroscience 105: 277-85

35


Umbriaco D, Garcia S, Beaulieu C, Descarries L (1995) Relational features of acetylcholine, noradrenaline, serotonin and GABA axon terminals in the stratum radiatum of adult rat hippocampus (CA1). Hippocampus 5: 605-20

Umbriaco D, Watkins KC, Descarries L, Cozzari C, Hartman BK (1994) Ultrastructural and morphometric features of the acetylcholine innervation in adult rat parietal cortex: an electron microscopic study in serial sections. J Comp Neurol 348: 351-73

Vizi ES, Kiss JP (1998) Neurochemistry and pharmacology of the major hippocampal transmitter systems: synaptic and nonsynaptic interactions. Hippocampus 8: 566-607

Wooltorton JRA, Pidoplichko VI, Broide RS, Dani JA (2003) Differential Desensitization and Distribution of Nicotinic Acetylcholine Receptor Subtypes in Midbrain Dopamine Areas. J. Neurosci. 23: 3176-3185

Young JW, Finlayson K, Spratt C, Marston HM, Crawford N, Kelly JS, Sharkey J (2004) Nicotine improves sustained attention in mice: evidence for involvement of the alpha7 nicotinic acetylcholine receptor. Neuropsychopharmacology 29: 891-900

Zarei MM, Radcliffe KA, Chen D, Patrick JW, Dani JA (1999) Distributions of nicotinic acetylcholine receptor [alpha]7 and [beta]2 subunits on cultured hippocampal neurons. Neuroscience 88: 755-764

36

Chapter II

Differential Modulation of Prefrontal Cortical Interneurons by Nicotine

Jonathan Jay Couey, Rhiannon M. Meredith, Sabine Spijker, Rogier B. Poorthuis, August B. Smit, Arjen B. Brussaard & Huibert D. Mansvelder.

Published in Neuron 54(1):73-87.

37

Abstract: Nicotine can enhance attention and working memory in primates and rodents by activating nicotinic acetylcholine receptors (nAChRs). The prefrontal cortex (PFC) is critical for these cognitive functions and is also rich in nAChR expression. Nonetheless, the specific cellular and synaptic mechanisms underlying nicotine’s beneficial effects on cognition remain elusive. Previous studies have emphasized that nicotine augments excitatory glutamatergic synaptic transmission, but did not study nicotinic actions on GABAergic interneurons in PFC. Here, we find that nicotine increases inhibitory GABAergic synaptic transmission received by layer V pyramidal neurons in PFC. This results from a series of presynaptic actions involving different PFC interneurons and distributed mechanisms of modulation by multiple nAChR subtypes. In contrast to fast spiking interneurons, both low threshold spiking and regular spiking non-pyramidal interneurons express nicotinic receptors on their somata. This was confirmed by single cell RT-PCR. Pyramidal neurons do not express somatic nicotinic receptors. Thus, nicotine simultaneously increases excitatory as well as inhibitory synaptic transmission in principal output neurons of the PFC, by activating different types of PFC interneurons through different mechanisms.

38

Chapter II

IntroductionNicotine is the addictive ingredient in tobacco that drives people to

dependence, but it has also been shown to improve cognitive function in humans and laboratory animals (Levin et al. 2005; Levin 1992; Mansvelder(Levin et al. 2005; Levin 1992; Mansvelder et al. 2006; Newhouse et al. 2004). In smokers and patients suffering from. In smokers and patients suffering fromIn smokers and patients suffering from a variety of neuropsychiatric disorders, nicotinic agonists act beneficially onicotinic agonists act beneficially on several aspects of cognition, including working memory, attention, learning and memory. In fact, nicotinic treatments are being developed as therapy for cognitive dysfunction in disorders such as Alzheimer’s disease, Parkinson’s disease, schizophrenia and ADHD (Levin et al. 2005; Newhouse et al. 2004; Picciotto and Zoli 2002). In contrast, in normal nonsmokers, nicotine tends to have deleterious effects on cognitive performance (Newhouse et al. 2004). Although it is likely that many brain areas contribute to the nicotinic effects on cognition, based on animal studies nicotinic acetylcholine receptors (nAChRs) in the prefrontal cortex (PFC) mediate the effects on attention and working memory performance (Levin 1992; Maskos et al. 2005; Muir et al.(Levin 1992; Maskos et al. 2005; Muir et al. 1995). The rodent medial PFC is considered to be functionally homologous to. The rodent medial PFC is considered to be functionally homologous to the primate dorsolateral PFC and has been shown to be involved in attention and working memory (Dalley et al. 2004; Groenewegen and Uylings 2000). Despite this understanding of nicotinic effects on working memory and attention performance, very little is known of the cellular and synaptic mechanisms involved in the enhancement of these functions.

Excitatory glutamatergic synapses in the PFC are plastic and changes in synaptic strength occur in the rodent PFC during working memory-related tasks (Jay et al. 1995; Laroche et al. 2000; Laroche et al. 1990). To understand nicotinic modulation of information processing in a particular brain area, one needs to understand how nicotine affects the different cell types in the neuronal network. More specifically, nicotinic modulation of a neuronal network depends on 1) the types of neurons in the network that express nAChRs; 2) the types of nAChRs expressed; and 3) the subcellular location of these nAChRs (Alkondon et al. 2004; Ji et al. 2001; MacDermott(Alkondon et al. 2004; Ji et al. 2001; MacDermott et al. 1999; Mansvelder et al. 2002; McGehee and Role 1996; Rousseau et al.

39

PFC Interneurons and Nicotine

2005). None of these aspects have been addressed in the PFC (Gioanni et al.None of these aspects have been addressed in the PFC (Gioanni et al.(Gioanni et al. 1999; Lambe et al. 2003; Mansvelder et al. 2006)..

Therefore, to understand the synaptic and cellular mechanisms underlying nicotinic enhancement of PFC-based cognition, we investigated how nicotine modulates the PFC neuronal network. Our study demonstrates that specific classes of PFC interneurons express nAChRs, and that specific inputs to these cell types in the medial PFC neuronal circuitry are modulated by nAChR stimulation.

Material and MethodsSlice preparation

Prefrontal coronal cortical slices (300 µm) were prepared from P14-23 C57 BL/6 mice, in accordance with Dutch licence procedures. Brainmice, in accordance with Dutch licence procedures. Brain, in accordance with Dutch licence procedures. Brain slices were prepared in ice-cold artificial cerebrospinal fluid (ACSF) which contained in (mM): NaCl 125; KCl 3; NaH2PO4 1.25; MgSO4 3; CaCl2 1; NaHCO3 26; glucose 10; 300mOsm. Slices were then transferred to holding chambers in which they were stored in ACSF which contained (in mM): NaCl 125; KCl 3; NaH2PO4 1.25; MgSO4 2; CaCl2 1; NaHCO3 26; glucose 10, bubbled with carbogen gas (95% O2/ 5% CO2).

ElectrophysiologyPyramidal cells and interneurons in the medial PFC were first visualized

using Hoffman modulation or infrared differential interference contrast microscopy. After the whole cell configuration was established, recorded responses to steps of current injection allowed us to classify each cell as one of several well known cortical cell types. In many experiments two-photon imaging was also used to produce an overview of the cell’s morphology. All experiments were performed at 31-34 oC.

Recordings were made using Axopatch or Multiclamp 700A amplifiers (Axon Instruments, CA, USA) sampling at intervals of 50 or 100 s, digitized by the pClamp software (Axon), and later analyzed off-line (Igor Pro software, Wavemetrics, Lake Oswego, OR, USA). Whole cell

40

Chapter II

current injection and extracellular stimulation (both timing and levels) were controlled with a Master-8 stimulator (A.M.P.I., Jerusalem, Israel) triggered by the data acquisition software. Patch pipettes (3-5 MOhms) were pulled from standard-wall borosilicate capillaries and were filled with one of three intracellular solutions. For the measurement of EPSCs in pyramidal cells and interneurons we used a solution containing (in mM): K-gluconate 140; KCl 1; HEPES 10; K-phosphocreatine 4; ATP-Mg 4; GTP 0.4, pH 7.2-7.3, pH adjusted to 7.3 with KOH; 290-300 mOsm. The chloride concentration in this intracellular solution was chosen so that the calculated chloride reversal potential was far below the resting membrane potential (-120 mV) and IPSCs would show as outward current in the recording, while EPSCs would show as inward current. This solution was not used in experiments looking specifically at GABAergic activity, where we used an elevated chloride concentration (potassium gluconate 78 mM, KCl 70 mM) to make detection of GABA events more reliable. Series resistance was not compensated.

For the experiments in Figures 1C and 3D-F, nicotine was applied by pressure ejection from a glass electrode with a tip opening of ~1 µm. Pressure was on for 100 ms. Care was taken that nicotine-containing solution did not leak out of the electrode when no positive pressure was applied by including Alexa488 (100 µM) in the application pipette so that any leaking solution could be easily visualized using two photon microscopy. During application, the extent of application was visualized by monitoring the green fluorescence signal of Alexa488 in some of the experiments.

Two-photon imagingPipettes were tip-filled with intracellular medium and back-filled

with intracellular solution containing Alexa 594 (40 µM) to reveal neuronal(40 µM) to reveal neuronal morphology and the calcium-indicator Fluo-4 (100 or 200 µM, Molecular Probes). Following breakthrough, cells were monitored for a minimum of 15 minutes to allow diffusion and equilibration of the dye intracellularly beforeto allow diffusion and equilibration of the dye intracellularly beforebefore fluorescence measurements were taken. A Leica (Mannheim, Germany) RS2. A Leica (Mannheim, Germany) RS2 A Leica (Mannheim, Germany) RS2 two-photon laser scanning microscope was used with a x63 objective and

41


with a Ti:Sapphire laser (Tsunami, SpectraPhysics, CA, USA) tuned to a wavelength of 840 nM for excitation.

Single-cell RT-PCRFor single-cell analyses, we used the same solution as was used for the measurement of spontaneous activity. After recordings were made, the cell was aspirated and the content (~7.5 µl) was expelled in a tube containing 2 µl RT-buffers (final concentrations: 10 mM DTT, 0.5 µM dNTP, 5 µM random hexamers). An enzyme mixture was added (0.5 µl, containing: 50 U MMLV (Promega); 5 U RNAguard (Amersham)), and after gently mixing, the reaction was performed O/N at 37 °C. After precipitation (final concentration: 2 M NH4Ac, 75% EtOH, 0.1 µg linear acrylamide) on ice for 30 min, samples were spun (14,000 g, 30 min), washed twice with 75% EtOH, and collected in 10 µl water. Reactions were stored at 4° C.For PCR analysis, a pre-amplification (nAChR subunits, 25 cycles; others, 15 cycles) was followed by amplification (45 cycles) using real-time PCR (10 µl; ABI PRISM 7900, Applied Biosystems). Nested primer sets (Suppl. table 1) were used for amplification. Whereas the pre-amplification of GAD, calbindin, cholecystokinin and somatostatin was carried out in separate reactions (triplicate) using 0.3 µl cDNA, preamplification of the nAChR subunits was performed with a mixture of primers for the α4, α 7, and α2 subunits (triplicate) using 1.5 µl cDNA. The amplification was carried out on 2% volume of the pre-amplification reaction. For each transcript analyzed, a negative control (H2O) reaction was performed. For both reactions, the SYBR-reagents (2x SYBR-mix; Applied Biosystems) were used, with the following PCR parameters: 10 min at 95 °C, followed by 45 cycles using 15 sec at 95 °C, 1 min 60 °C. For each primer, a positive control (1:10,000 dilution of mouse PFC cDNA) and a negative control (H2O) were used. At the end of each PCR, a dissociation stage was performed in order to check for specificity of the formed product (from 60° to 95°C in 15 min; Suppl figure 4). A single PCR round (45 cycles) using α-actin was performed to detect the formation of cDNA, resulting in 52 cells positive out of 54.

42

Chapter II

ResultsDirect nicotinic actions on evoked glutamatergic transmission

Since nicotine alters cognitive performance of rodents in behavioral tasks that involve PFC function (Maskos et al. 2005) and changes in excitatory synapse strength occur during such tasks (Jay et al. 1995; Laroche et al. 2000; Laroche et al. 1990), we asked whether nicotine alters excitatory glutamatergic synaptic transmission. In other brain areas, nicotine is known to increase glutamatergic synaptic transmission through activation of either postsynaptic nAChRs, or presynaptic nAChRs on the glutamatergic terminals. Activation of nAChRs located on presynaptic glutamatergic terminals can increase release of glutamate directly (Gray et al. 2006; McGehee et al. 1995). In VTA, activation of these presynaptic nAChRs can induce LTP (Mansvelder and McGehee 2000). In PFC, nicotine also augments spontaneous excitatorynicotine also augments spontaneous excitatory glutamatergic synaptic transmission to layer V pyramidal neurons by activating presynaptic nAChRs (Gioanni et al. 1999; Lambe et al. 2003). This effect depends on action potential firing, indicating that nAChRs are located away from the presynaptic terminals. In our hands, nicotine also induced an increase in frequency and amplitude of spontaneous excitatory postsynaptic currents (EPSCs, Fig 1A, B). The EPSCs disappeared in the presence of the AMPA-R blocker DNQX (10 µM, n�4, Suppl Fig 1A, B). Since the spontaneousµM, n�4, Suppl Fig 1A, B). Since the spontaneousM, n�4, Suppl Fig 1A, B). Since the spontaneous EPSC amplitude distribution was shifted to larger amplitudes, we next tested if nicotine affected evoked glutamatergic transmission by stimulating either in layer II/III or in layer V, while recording from layer V pyramidal neurons (Fig 1D). Evoked EPSCs resulting from either stimulating layer II/III or layer V were not increased in amplitude by nicotine (Fig 1E, F). Instead, evoked EPSC amplitude showed a small transient reduction that hardly outlasted the nicotine application (Fig 1F). Furthermore, puffing nicotine directly onto pyramidal neurons did not elicit an inward current (n�15, Fig 1C), suggesting that like in other neocortical areas, PFC layer V pyramidal neurons do not express functional nAChRs. These results indicate that layer V pyramidal neurons experience an increased frequency of spontaneous excitatory inputs in the presence of nicotine.

43


Nicotine enhances inhibitory GABAergic transmission to pyramidal neuronsIn many cortical and sub-cortical brain areas, nicotine affects not many cortical and sub-cortical brain areas, nicotine affects not

only glutamatergic but also GABAergic synaptic transmission (Alkondon(Alkondon et al. 2004; Dani and Harris 2005; Mansvelder et al. 2006; Mansvelder et al. 2002; Metherate 2004). In hippocampus, timed activation of GABAergicIn hippocampus, timed activation of GABAergic interneurons by nicotine diminishes or prevents long-term potentiation in pyramidal neurons (Ji et al. 2001). To assess to what extent nicotine affects inhibitory GABAergic transmission received by layer V pyramidal neurons, inhibitory postsynaptic currents were evoked by stimulating layer II/III while recording from layer V pyramidal neurons. The amplitude of evoked IPSCs was transiently enhanced by nicotine (Fig 2A, B). On average nicotine increased the GABAergic synaptic strength by 141±11%, which subsided when nicotine was washed out (Fig 2B). Nicotine also affected spontaneous inhibitory synaptic transmission. Both frequency and amplitude

Figure 1: Glutamatergic inputs to layer V pyramidal cells. A Example trace with spontaneous EPSCs recorded in layer V pyramidal cell. Top trace: control; Lower trace: in the presence of nicotine (10 µM). Scale bar 100pA, 500ms. Inset below: frequency histogram for spontaneous EPSCs (n=6). B Cumulative EPSC amplitude distribution be-fore (grey) and after (black) nicotine application. Data is taken from experiment shown in A. C Voltage clamp trace from a layer V pyramidal cells where nicotine was locally applied at the arrow and no current was observed (n=14). Inset above shows experimental set-up. D Experimental set-up for E. E Normalized amplitude of evoked EPSPs (grey circles) and mean amplitude per minute (black circles) recorded from the two stimulation locations depict-ed in D. F Average plot of evoked EPSP experiments from layer II/III (white circles) and layer V (black circles) (n=6).

44

Chapter II

of spontaneous IPSCs strongly increased when nicotine (10 µM) was bath applied in all cells tested (n�7, Fig 2C-E). IPSC frequency was increased to 246±72%. Low nicotine concentrations (300 nM) also augmented spontaneous IPSC frequency by 131.5 ± 3% (n�5, Fig 2F). IPSC amplitude distribution was increased in all cells tested. Cumulative amplitude distributions showed that nicotine had a strong effect on larger amplitude synaptic currents (Fig 2E). IPSCs disappeared when bicuculline (10 µM) was applied (n�3, Suppl Fig1C, D) and nicotine’s effect was blocked by TTX (n�3, Suppl Fig 2B). These experiments show that in addition to augmenting excitatory synaptic

Figure 2: GABAergic transmission to layer V pyramidal cells. A Example evoked IPSCs before (black trace) and after (red trace) nicotine application. Inset, Temporal plot of normalized amplitude (white circles) and mean per minute (black circles) from a single experiment. B Summary of evoked IPSC experiments (n=6). C Example spontaneous IPSCs recorded from a layer V pyramidal cell in the absence (top trace) and presence of 10 µM nicotine. D Average IPSC frequency histogram (n=7). E Cumulative IPSC amplitude dis-tribution from experiment shown in D (p<0.001). F Average IPSC frequency histogram with 300nM nico-tine application (n=5) G Average IPSC frequency histogram (n=4). Duration of MLA and nicotine applica-tion is indicated by bars above graph. H Average IPSC frequency histogram with the application of MEC and nicotine (n=7). I Cumulative IPSC amplitude distribution from a single MEC/NIC experiment (p=0.3).

45


transmission to PFC pyramidal neurons, inhibitory GABAergic transmission is also enhanced by nicotine.

As an initial pharmacological characterization of the nAChRs subtypes involved in augmenting spontaneous GABAergic transmission in PFC pyramidal neurons, we tested the effect of nicotine in the presence of MEC and methyllycaconitine (MLA), which is more selective for α7-containing nAChRs. In the presence of MLA (10 nM), nicotine still increased the frequency of spontaneous IPSCs but not in all cells tested. In 3 out of 4 cells, nicotine increased the IPSC frequency to 294±18% (Fig 2G). The IPSC amplitude distribution was also shifted to larger amplitudes in 3 out of 4 cells (Suppl Fig 2A). This suggests that MLA sensitive nAChRs do contribute to the effect of nicotine on spontaneous IPSCs. In the presence of MEC (1 µM), nicotine application did not affect the frequency of spontaneous IPSCs in 5 out of 7 cells. Also the effect of nicotine on amplitude distribution was blocked in 5 out of 7 cells (Fig 2H, I). Nicotine most likely activates multiple types of nAChRs to increase both frequency and amplitude of spontaneous IPSCs and augment inhibition of PFC pyramidal neurons.

Nicotine excites different types of interneurons through multiple mechanismsTo delineate which types of interneurons express functional nAChRs,

we targeted different classes of interneurons for whole-cell recording. In rat PFC several types of pyramidal neurons and interneurons have been described based on electrophysiological profile, morphology and expression of calcium-binding proteins (Gabbott et al. 1997; Gulledge et al. 2007; Kawaguchi 1993; Kawaguchi and Kondo 2002; Kawaguchi and Kubota 1997; Yang et al. 1996). A characterization of interneurons in mouse medial PFC has not been described in the literature thus far, and we identified three different classes of interneurons based on action potential firing profile in response to current steps (Fig 3A-C). Their morphological appearance was clearly distinct from the typical layer V pyramidal neuron morphology (Fig. 3A-C insets).

The first type of interneuron had the typical characteristics of fast spiking (FS) interneurons in other cortical areas (Kawaguchi and Kondo

46

Chapter II

2002). They were multi-polar with round cell bodies. In response to step current injections they showed non-adapting, tonic firing behavior with a firing frequency that was proportional to the amount of depolarizing current injection (Fig 3A). Local puffs (100 ms) of nicotine to the cell body region of this type of interneuron did not elicit inward currents in any of the cells tested (n�24; Fig 3D, G, H).

The action potential profile of a different type of interneuron showed slight adaptation in response to step current injections (Fig 3B). These cells had a multi-polar appearance similar to FS cells. These cells were named regular spiking non-pyramidal neurons (RSNP). In response to local application of nicotine, a fast inward current of 12±6 pA was activated in about half of the RSNP neurons (n� 60; Fig 3E, G, H).

The third type of interneuron showed strong adaptation of firing frequency in response to step depolarizations, and had a lower threshold for

Figure 3: Local application of nicotine onto PFC interneurons. A-C Example current-clamp recordings and mor-phology of Alexa-filled cells illustrating the three basic interneurons observed in mouse PFC: fast spiking cells (FS), regular spiking non-pyramidals (RSNP), and low-threshold spiking cells (LTS). D-F Example voltage-clamp traces in each of the three cell types depicted in (A) where nicotine was locally applied to the soma (100 ms pressure ejec-tion at arrow). F Inset: current-clamp recording showing that single somatic application of nicotine onto LTS cells can induce spiking. G Histogram comparing the number of cells in each cell class that were positive (black) and negative (white) for nicotinic currents. H Histogram showing average current observed in positive cells from G.

47


firing (Fig 3C). In many cases, these cells fired rebound spikes after a step hyperpolarization. Therefore, these cells were named low-threshold spiking (LTS) cells. As FS cells, LTS cells had a bi-polar appearance or showed in addition to smaller multi-polar dendrites one dendrite of larger diameter that pointed towards layer VI. These cells often also showed a limited number of dendritic spines. Upon application of nicotine to their somatic region a large inward current was activated in all cells tested of 28±10 pA, with a faster rise-time than the nicotine-induced current in RSNP cells (n�10; Fig 3F, G, H). The amplitude of nicotine-induced currents were largest in these cells, and nearly double the amplitude of nicotine-induced currents in RSNP cells (Fig 3H).

During and after pressure application of nicotine, noise levels in recordings from RSNP and LTS cells increased. In RSNP cells (Fig 3E), the noise at the peak of the nicotine-induced current was increased from 29.9±0.026 pA to 52.1±16.0 pA and diminished in 4 sec to 42.4±20.9 pA. In contrast, in LTS cells (Fig 3F), the noise at the peak of the nicotine-induced current was not larger than at baseline (29.8±0.018 pA vs 29.7±0.19 pA), but steadily increased during 4 sec to 49.4±1.54 pA at the end of the trace. Most likely, open channel noise from nAChRs contributes to the noise in both neurons, but nicotine might also activate synaptic currents in these neurons.

Different types of interneurons differentially express mRNA for nAChRsTo test which nAChR subunits were expressed by the different types of

interneurons we determined the presence of mRNAs for the most abundant nAChRs in the brain, α4, β2, and α7 using single-cell PCR (Cauli et al. 2000; Liss 2002). After establishing the whole-cell configuration in the PFC slice and applying step current injections to obtain the action potential profile of the interneuron, the cell contents were aspirated into the recording pipette and real-time PCR was performed on the tip contents (Table 1). GAD2 mRNA, encoding the glutamic acid decarboxylase enzyme GAD65, was abundantly detected in all three interneuron types, suggesting that these cells synthesize the neurotransmitter GABA. In addition, expression of genes encoding different

48

Chapter II

calcium-binding proteins and peptides was detected in these cells. RSNP cells abundantly expressed Calbindin (CB) and cholecystokinin (CCK), but to a lesser extend somatostatin (SOM). In contrast, a much smaller proportion of FS cells expressed CCK, whereas the majority of FS cells expressed CB and SOM. LTS cells expressed CB, CCK and SOM to a similar degree (Table 1). Nicotinic AChR mRNA expression patterns were in line with the responses of interneurons to nicotine puffs to the soma. FS cells did not show inward currents upon nicotine application (Fig 5) and hardly any FS cells showed expression for nAChR mRNA. In contrast, LTS and RSNP cells both showed functional responses to nicotine application to the soma (Fig 3), and in both cell types mRNA encoding nAChR subunits were found (Table 1). The largest number of LTS and RSNP cells expressed α4 subunits, but β2 and α7 mRNA was also found in these cell types. These data are also in line with the finding that the augmentation of spontaneous IPSCs by nicotine has a mixed pharmacological profile (Fig 2G and H, Suppl Fig 2).

Excitatory inputs to different types of interneurons are differentially affected by nicotine

We have shown that the mouse medial PFC harbors at least three classes of interneurons that show similar functional and morphological properties as interneurons found in other cortical areas, but differ in functional nAChR expression. FS cells do not express nAChRs somatically, whereas RSNP and LTS cells express functional nAChRs and contain mRNA for α4, β2 and α7 subunits. These cell types are directly depolarized by nAChR activation expressed on their cell bodies or proximal dendrites, and LTS cells could even be made to spike when nicotine was applied in current clamp (Fig 3F inset).

49


These somatic nAChRs could account for the increase in IPSC frequency and amplitude by nicotine observed in recordings from pyramidal neurons (Fig 2). However, as excitatory inputs to pyramidal neurons are modulated by nicotine, excitatory inputs to interneurons could also be modulated by nAChR activation, which would also contribute to increased GABAergic activity by nicotine. Therefore, we monitored spontaneous EPSCs in whole-cell recordings from the three interneuron types.

Figure 4: Nicotinic modulation of spontaneous EPSCs received by PFC interneurons. A,D,G Example EPSC traces recorded from (A) fast spiking (FS), (D) regular spiking non-pyramidal (RSNP), and (G) low threshold spiking (LTS) cells respectively. B,E,H Average EPSC frequency histograms for (B) FS, n=7; (E) RSNP, n=11; and (H) LTS cells, n=3. C,F,I Cumulative amplitude distributions for each of the three cell types are shown. Each graph represents data from the experiments depicted in A,D and G. Significance indicated * for p<0.05.

50

Chapter II

Nicotine differentially modulated spontaneous excitatory transmission in medial PFC interneurons. Spontaneous EPSCs in FS cells showed a substantial increase in both EPSC frequency and amplitude (Fig 4A-C). EPSC frequency increased by 360±144% and the cumulative distribution of EPSC amplitudes showed that significantly more EPSCs with amplitudes above 25 pA were recruited by nicotine (Fig 4B,C). This effect was blocked by MEC (n�10, Suppl Fig 3A) and TTX (n�6, Suppl Fig 3B). In contrast, spontaneous EPSCs recorded in RSNP cells were negatively modulated by nicotine. EPSC frequency but not amplitude was significantly lower in the presence of bath applied nicotine (Fig 4D-F). Spontaneous EPSCs recorded in LTS cells were increased by nicotine. Both EPSC frequency and amplitude were increased significantly by nicotine application (Fig 4G-I).

Thus, although FS cells do not seem to express functional nAChRs, their excitatory glutamatergic inputs are increased by nicotine, and thus they will receive an increased excitatory drive in the presence of nicotine. Nicotine will directly depolarize RSNP cells by activating nAChRs on their cell body, but excitatory inputs to these cells are not decreased in amplitude. LTS cells experience an increased excitatory drive from both activated nAChRs on their cell body and an increased glutamatergic input. Our data suggest that all interneuron classes we encountered potentially contribute to the increased inhibition observed in pyramidal neurons in the presence of nicotine.

DiscussionNicotinic receptor stimulation alters PFC-based cognitive performance

in primates and rodents (Levin et al. 2005; Levin 1992; Mansvelder et al.(Levin et al. 2005; Levin 1992; Mansvelder et al. 2006; Newhouse et al. 2004). In this study, we find that activity of different. In this study, we find that activity of differentIn this study, we find that activity of different types of PFC interneurons is increased by nicotine, and we find that different mechanisms are involved (Fig 5). Some interneuron types express nAChRs somatically, such as RSNP and LTS cells. Single-cell PCR data suggest that both cell types express the abundant subunit types α4, β2 and α7. FS interneurons do not express nAChRs somatically, but excitatory inputs to these neurons are augmented by nAChR stimulation. Very little mRNA

51


for α4, β2 and α7 subunits was found in these cells. Excitatory inputs to LTS cells are also stimulated by nicotine. The net result of these effects is increased GABAergic neurotransmission to pyramidal neurons, and the cell type specific results are a reflection of the precise wiring and organization of this cortical microcircuit around different types of inhibition (Wang et al. 2004a).

The enhancement of excitatory transmission to layer V pyramidal cells by nicotine has been linked to thalamic projections (Lambe et al. 2003). The parallel enhancement of excitatory input to both pyramidal cells and FS cells in layer V in light of this finding is not unexpected. Many putative FS cells in the cortex are basket cells or chandelier cells, both types providing inhibitory inputs to somatic and axonal regions of post synaptic pyramids (Kawaguchi and Kondo 2002; Wang et al. 2002). FS cells sit in a computationally ideal position to govern the precise activation of pyramidal cells by converging or coincident inputs. Any cells postsynaptic to a thalamically activated FS cell can only fire if their thalamic input arrives earlier than the IPSP from the FS cell. Thus, any enhancement of thalamic input to pyramidal cells might be expected to be seen in these cells as well, maintaining their crucial role in the microcircuit.

Activation of nAChRs with respect to LTS cells also has many interesting implications. LTS cells are often anatomically termed Martinotti

Fig. 5. Schematic of the neuronal network of mouse layer V PFC depicting the distribution of nAChRs. P Layer V py-ramidal cell, FS Fast-spiking interneuron, RSNP Regu-lar-spiking non-pyramidal neuron, LTS Low-threshold spiking neuron. LTS cells were drawn to synapse on the apical dendrites of pyramidal neurons, in line with the description of PFC Martinotti cells provided by Sil-berg and Markram (Silberberg and Markram 2007).

52

Chapter II

cells in the cortex. These cells are characterized by a local dendritic arbour and an axon which projects to other cortical layers, typically from V to II or from II/III to V/VI (Kawaguchi and Kondo 2002; Kawaguchi and Kubota 1996; Wang et al. 2004b). The LTS cell appears to provide inhibition to pyramidal cells across layers (Kapfer et al. 2007; Silberberg and Markram 2007). Their position in the microcircuit appears to be downstream from activated pyramidal cells, and the kinetics of this synapse suggest a different role for LTS mediated inhibition. What is most intriguing is the dual action of nAChRs with respect to LTS cell mediated inhibition. Whereas with FS cells, only excitatory inputs were enhanced, LTS are also depolarized at their soma by nicotine. Depending on the how these effects combine, a number of changes could occur. Unlike FS cells which can maintain a relatively high rate of discharge, the LTS cell shows a great deal of spike frequency adaptation. Depolarization of the LTS cell (by both increases excitatory transmission as well as direct somatic currents) could change the timing of their inhibition by making them easier to activate by a presynaptic cell. It could also result in tonic firing in the LTS cell, which could reduce the strength of the inhibition through rundown of the inhibitory synapse. It should be noted that because LTS downstream targets are pyramidal cells, the specific properties of the target postsynaptic compartments could contribute greatly to the effects of their inhibition (Larkum et al. 1999). The apical dendrites of pyramidal cells have been known for some time to be highly excitable, and shunting mechanisms governed by inhibitory synapses in these regions are likely to be critical to their function.

The selective activation of a subset of RSNP cells we observed implies that this group of cells is actually composed of more than one functional group of interneurons. It is probable that those cells which did respond directly to nicotine are a functional subgroup of cells sharing a common function. However, unlike FS and LTS interneurons, these cells have been shown in previous studies to have a more diverse electrophysiological, morphological, and neurochemical profile making them comparatively harder to classify (Gupta et al. 2000; Kawaguchi and Kondo 2002; Kawaguchi and

53


Kubota 1997; Kawaguchi and Kubota 1998). Indeed some data suggest that RSNP and LTS classes used here are overlapping in function (Kawaguchi and Kubota 1996). This ambiguity makes hypothesizing about the functional contribution of their nAChRs to PFC function more difficult as well. More detailed analysis of this cell group is needed to discern what role this group of nicotinic interneurons play in the PFC microcircuit, especially in reference to them as a separate functional group distinct from the putative LTS cells.

Nicotinic AChR stimulation increases GABAergic transmission in hippocampus (Alkondon and Albuquerque 2001; Alkondon et al. 2004). Augmentation of GABAergic transmission by nAChR stimulation prevents long-term potentiation induced by 100 Hz stimulation for 1 sec (Ji et al. 2001). We would expect to find similar mechanisms at work in the cortex. As weAs we will demonstrate in chapter 3, nicotine alters the rules for synaptic plasticity resulting from timed presynaptic and postsynaptic activity by increasing the threshold. Thereby the function of the medial PFC network will most likely change in the presence of nicotine. Increased activity in pyramidal neurons at least partially restores the conditions for STDP to occur. The presence of nicotine and increased threshold for STDP could reduce cognitive performance in healthy naïve rodents (Wang et al. 2006). Alternatively, since PFC neuronal activity could be increased during PFC-based cognitive behavior, nicotine may provide conditions under which signal to noise ratio in PFC information processing is enhanced, thereby improving cognitive performance (Mirza and Stolerman 1998; Wang et al. 2006).

54

Chapter II

ReferencesAlkondon M, Albuquerque EX (2001) Nicotinic Acetylcholine Receptor

alpha 7 and alpha 4beta 2 Subtypes Differentially Control GABAergic Input to CA1 Neurons in Rat Hippocampus. J Neurophysiol 86: 3043-3055

Alkondon M, Pereira EFR, Yu P, Arruda EZ, Almeida LEF, Guidetti P, Fawcett WP, Sapko MT, Randall WR, Schwarcz R, Tagle DA, Albuquerque EX (2004) Targeted Deletion of the Kynurenine Aminotransferase II Gene Reveals a Critical Role of Endogenous Kynurenic Acid in the Regulation of Synaptic Transmission via {alpha}7 Nicotinic Receptors in the Hippocampus. J. Neurosci. 24: 4635-4648

Cauli B, Porter JT, Tsuzuki K, Lambolez B, Rossier J, Quenet B, Audinat E (2000) Classification of fusiform neocortical interneurons based on unsupervised clustering. PNAS 97: 6144-6149

Dalley JW, Cardinal RN, Robbins TW (2004) Prefrontal executive and cognitive functions in rodents: neural and neurochemical substrates. Neuroscience & Biobehavioral Reviews 28: 771-784

Dani JA, Harris RA (2005) Nicotine addiction and comorbidity with alcohol abuse and mental illness. 8: 1465-1470

Gabbott PL, Dickie BG, Vaid RR, Headlam AJ, Bacon SJ (1997) Local-circuit neurones in the medial prefrontal cortex (areas 25, 32 and 24b) in the rat: morphology and quantitative distribution. J Comp Neurol 377: 465-99


Gray NW, Weimer RM, Bureau I, Svoboda K (2006) Rapid Redistribution of Synaptic PSD-95 in the Neocortex In Vivo. PLoS Biol 4

Groenewegen HJ, Uylings HB (2000) The prefrontal cortex and the integration of sensory, limbic and autonomic information. Prog Brain Res 126: 3-28

Gulledge AT, Park SB, Kawaguchi Y, Stuart GJ (2007) Heterogeneity of phasic cholinergic signalling in neocortical neurons. J Neurophysiol: 00493.2006

Gupta A, Wang Y, Markram H (2000) Organizing Principles for a Diversity of GABAergic Interneurons and Synapses in the Neocortex. Science 287: 273-278

55


Jay TM, Burette F, Laroche S (1995) NMDA receptor-dependent long-term potentiation in the hippocampal afferent fibre system to the prefrontal cortex in the rat. Eur J Neurosci 7: 247-50

Ji D, Lape R, Dani JA (2001) Timing and location of nicotinic activity enhances or depresses hippocampal synaptic plasticity. Neuron 31: 131-141

Kapfer C, Glickfeld LL, Atallah BV, Scanziani M (2007) Supralinear increase of recurrent inhibition during sparse activity in the somatosensory cortex. Nat Neurosci 10: 743-753




Kawaguchi Y, Kubota Y (1997) GABAergic cell subtypes and their synaptic connections in rat frontal cortex. Cereb. Cortex 7: 476-486

Kawaguchi Y, Kubota Y (1998) Neurochemical features and synaptic connections of large physiologically-identified GABAergic cells in the rat frontal cortex. Neuroscience 85: 677-701


Larkum ME, Zhu JJ, Sakmann B (1999) A new cellular mechanism for coupling inputs arriving at different cortical layers. Nature 398: 338-341

Laroche S, Davis S, Jay TM (2000) Plasticity at hippocampal to prefrontal cortex synapses: dual roles in working memory and consolidation. Hippocampus 10: 438-46

Laroche S, Jay TM, Thierry A-M (1990) Long-term potentiation in the prefrontal cortex following stimulation of the hippocampal CA1/subicular region. Neuroscience Letters 114: 184-190

Levin E, McClernon F, Rezvani A (2005) Nicotinic effects on cognitive function: behavioral characterization, pharmacological specification,

56

Chapter II

and anatomic localization. Psychopharmacology: 1-17Levin ED (1992) Nicotinic systems and cognitive function.

Psychopharmacology (Berl) 108: 417-431Liss B (2002) Improved quantitative real-time RT-PCR for expression

profiling of individual cells. Nucleic Acids Res 30: e89MacDermott AB, Role LW, Siegelbaum SA (1999) Presynaptic ionotropic

receptors and the control of transmitter release. Annu Rev Neurosci 22: 443-85

Mansvelder H, van Aerde K, Couey J, Brussaard A (2006) Nicotinic modulation of neuronal networks: from receptors to cognition. Psychopharmacology 184: 292-305

Mansvelder HD, Keath JR, McGehee DS (2002) Synaptic Mechanisms Underlie Nicotine-Induced Excitability of Brain Reward Areas. Neuron 33: 905-919

Mansvelder HD, McGehee DS (2000) Long-term potentiation of excitatory inputs to brain reward areas by nicotine. Neuron 27: 349-357

Maskos U, Molles BE, Pons S, Besson M, Guiard BP, Guilloux J-P, Evrard A, Cazala P, Cormier A, Mameli-Engvall M, Dufour N, Cloez-Tayarani I, Bemelmans A-P, Mallet J, Gardier AM, David V, Faure P, Granon S, Changeux J-P (2005) Nicotine reinforcement and cognition restored by targeted expression of nicotinic receptors. 436: 103-107

McGehee DS, Heath MJ, Gelber S, Devay P, Role LW (1995) Nicotine enhancement of fast excitatory synaptic transmission in CNS by presynaptic receptors. Science 269: 1692-1696

McGehee DS, Role LW (1996) Presynaptic ionotropic receptors. Curr.Opin.Neurobiol. 6: 342-349


Mirza NR, Stolerman IP (1998) Nicotine enhances sustained attention in the rat under specific task conditions. Psychopharmacology (Berl) 138: 266-74

Muir JL, Everitt BJ, Robbins TW (1995) Reversal of visual attentional dysfunction following lesions of the cholinergic basal forebrain by physostigmine and nicotine but not by the 5-HT3 receptor antagonist, ondansetron. Psychopharmacology (Berl) 118: 82-92

Newhouse PA, Potter A, Singh A (2004) Effects of nicotinic stimulation on cognitive performance. Current Opinion in Pharmacology 4: 36-46

Picciotto MR, Zoli M (2002) Nicotinic receptors in aging and dementia. J

57


Neurobiol 53: 641-55Rousseau SJ, Jones IW, Pullar IA, Wonnacott S (2005) Presynaptic [alpha]7

and non-[alpha]7 nicotinic acetylcholine receptors modulate [3H]d-aspartate release from rat frontal cortex in vitro. Neuropharmacology 49: 59-72

Silberberg G, Markram H (2007) Disynaptic inhibition between neocortical pyramidal cells mediated by Martinotti cells. Neuron 53: 735-46

Wang X-J, Tegner J, Constantinidis C, Goldman-Rakic PS (2004a) Division of labor among distinct subtypes of inhibitory neurons in a cortical microcircuit of working memory. PNAS 101: 1368-1373

Wang Y, Gupta A, Toledo-Rodriguez M, Wu CZ, Markram H (2002) Anatomical, Physiological, Molecular and Circuit Properties of Nest Basket Cells in the Developing Somatosensory Cortex. Cereb. Cortex 12: 395-410

Wang Y, Toledo-Rodriguez M, Gupta A, Wu C, Silberberg G, Luo J, Markram H (2004b) Anatomical, physiological and molecular properties of Martinotti cells in the somatosensory cortex of the juvenile rat. J Physiol (Lond) 561: 65-90

Wang Z, Kai L, Day M, Ronesi J, Yin HH, Ding J, Tkatch T, Lovinger DM, Surmeier DJ (2006) Dopaminergic control of corticostriatal long-term synaptic depression in medium spiny neurons is mediated by cholinergic interneurons. Neuron 50: 443-52

Yang C, Seamans J, Gorelova N (1996) Electrophysiological and morphological properties of layers V-VI principal pyramidal cells in rat prefrontal cortex in vitro. J. Neurosci. 16: 1904-1921

58

Chapter II

Supplementary Figure 1: A. upper trace: Example trace with spontaneous excitatory postsynaptic cur-rents (EPSCs) recorded from layer 5 pyramidal neurons. Inhibitory postsynaptic currents (IPSCs) are not visible since the membrane potential was clamped at the reversal potential for chloride. lower trace: Ex-ample trace in the presence of the AMPA receptor blocker DNQX (10 µM). Note that no EPSCs are present any longer. B. Average frequency histogram of EPSCs (n=4). C. upper trace: Example trace with spontane-ous IPSCs recorded from layer 5 pyramidal neurons. EPSCs were blocked by DNQX (10 µM). lower trace: Example trace in the presence of bicuculline (10 µM). D. Average frequency histogram of IPSCs (n=3).

59


Supplementary Figure 3: A. Average histogram of spontaneous EPSCs recorded from FS interneurons in the presence of mecamylamine (1 µM, n=10). Nicotine (10 µM) no longer increases the frequency of EP-SCs. B. The effect of nicotine on EPSC frequency in FS interneurons is also prevented by TTX (1 µM, n=6).

Supplementary Figure 2: A. IPSC amplitude distributions recorded from four pyramidal neurons in the pres-ence of MLA before (black) and after (red) application of nicotine (10 µM). Nicotine shifted the amplitude distribution to larger amplitudes. B. TTX (1 µM) prevented the effect of nicotine on the frequency of IPSCs.

60

Chapter II

Supplementary Figure 4: Dissociation curves were performed for each reaction after 45 cycles of the re-am-plification (real-time PCR) to check the specificity of the formed product. Examples are given for the posi-tive control and positive cells (colored lines), as well as for the negative control (dark gray) and negative cells (gray lines). Note that in some cases, the negative control yielded a product only after re-amplification. Nega-tive cells could be discriminated based on the melting temperature of the product, which is represented by peak of the curve. Relative fluorescence (i.e. the derivative of the fluorescence) and temperature are indicated.

61


Gene Outer primer Inner primerCCK F: CGACCTGTCTGCATTTGGCTTG F: TCCTTCTGGCCGCATGTC

CCK R: AATCCATCCAGCCCATGTAGTC R:CCCGGTCACTTATTCTATGGCT

Calbindin F: ACTCTCAAACTAGCCGCTGCA F: CTGACAGAGATGGCCAGGTTAC

Calbindin R: TCCAGGTAACCACTTCCGTCA R: TCTATGTATCCGTTGCCATCCT

GAD2 F: GCTTCTGGTTTGTACCTCCTAG F:TTTGCGCACTCTGGAAGACA

GAD2 R: CCTAAGGGTTGGTAGCTGAC R:GCTGACCATTGTGGTCCCATA

Somatostatin F: ACCGGGAAACAGGAACTGG F: GAGCCCAACCAGACAGAGAATG

Somatostatin R: TGCTGGGTTCGAGTTGGC R: CTGCAGCTCCAGCCTCATC

nAChR α4 F: CAAGATTGACTTGGTGAGCATG F: CGTGTGGACCAACTGGACTTC

nAChR α4 R: GGTGATGTCAGGATAGATCTCG R: CACAGCATTCATACTTCCTGGTGT

nAChR α7 F: GAGAAGTTCTATGAATGCTGCAA F: GAGCCATACCCAGATGTCACCTAC

nAChR α7 F: AGCAAGAATACCAGCAAAGCCA R: GCTGAAATGAGCACACAAGGAAT

nAChR β2 R: CAGCTCATGGTATCATTGGCAC F: ACGAGCGGGAGCAGATCAT

nAChR β2 R: AGTCGGACTTTCTTCATATTGTC R: TCGAAATCCTCAGGCTTCCAT

α-actin NA F: GCTCCTCCTGAGCGCAAG

α-actin NA R: CATCTGCTGGAAGGTGGACA

Supplementary Table 1: The sequences (5’ to 3’) of the outer and inner (nested) primers used for real-time single cell PCR are shown for each gene. F: forward primer; R: reverse primer.

62

Chapter III

Distributed Network Actions by Nicotine Increase the Threshold for Spike-Timing-Dependent Plasticity in Prefrontal Cortex

Jonathan Jay Couey, Rhiannon M. Meredith, Sabine Spijker, Rogier B. Poorthuis, August B. Smit, Arjen B. Brussaard & Huibert D. Mansvelder.

Published in Neuron 54(1):73-87.

63

Abstract: Nicotine can enhance attention and working memory in primates and rodents by activating nicotinic acetylcholine receptors (nAChRs). The prefrontal cortex (PFC) is critical for these cognitive functions and is also rich in nAChR expression. Nonetheless, the specific cellular and synaptic mechanisms underlying nicotine’s beneficial effects on cognition remain elusive. During cortical function, the strength of excitatory glutamatergic synapses is thought to be regulated through Hebbian-like mechanisms. Here we show that nicotine exposure can increase the threshold for synaptic spike-timing-dependent potentiation (STDP) in layer V pyramidal neurons of the mouse PFC. During coincident presynaptic and postsynaptic activity, nicotine reduces dendritic calcium signals associated with action potential propagation by enhancing GABAergic transmission. This results from a series of presynaptic actions involving different PFC interneurons and distributed mechanisms of modulation by multiple nAChR subtypes. Pharmacological block of nAChRs or GABAA-Rs prevented nicotine’s actions and restored STDP, as did increasing dendritic calcium signals with stronger postsynaptic activity. Thus, by activating nAChRs distributed throughout the PFC neuronal network, nicotine has an impact on PFC information processing and storage by increasing the amount of postsynaptic activity necessary to induce STDP, an effect that outlasts nAChR stimulation.

64

Chapter III

IntroductionNicotine is the addictive ingredient in tobacco that drives people to

dependence, but it has also been shown to improve cognitive function in humans and laboratory animals (Levin et al., 2005; Levin, 1992; Mansvelder(Levin et al., 2005; Levin, 1992; Mansvelder et al., 2006; Newhouse et al., 2004b). In smokers and patients suffering fromIn smokers and patients suffering from a variety of neuropsychiatric disorders, nicotinic agonists act beneficially onicotinic agonists act beneficially on several aspects of cognition, including working memory, attention, learning and memory. In fact, nicotinic treatments are being developed as therapy for cognitive dysfunction in disorders such as Alzheimer’s disease, Parkinson’s disease, schizophrenia and ADHD (Levin et al., 2005; Newhouse et al., 2004a; Newhouse et al., 2004b; Picciotto and Zoli, 2002). In contrast, in normal nonsmokers, nicotine tends to have deleterious effects on cognitive performance (Newhouse et al., 2004b). Although it is likely that many brain areas contribute to the nicotinic effects on cognition, based on animal studies nicotinic acetylcholine receptors (nAChRs) in the prefrontal cortex (PFC) mediate the effects on attention and working memory performance (Granon et al., 1995; Levin, 1992; Muir et al., 1995). The rodent medial PFC. The rodent medial PFC is considered to be functionally homologous to the primate dorsolateral PFC and has been shown to be involved in attention and working memory (Dalley et al., 2004; Groenewegen and Uylings, 2000). Despite this understanding of nicotinic effects on working memory and attention performance, very little is known of the cellular and synaptic mechanisms involved in the enhancement of these functions.

Excitatory glutamatergic synapses in the PFC are plastic and changes in synaptic strength occur in the rodent PFC during working memory-related tasks (Jay et al., 1995; Laroche et al., 2000; Laroche et al., 1990). Changes in strength of cortical synapses are thought to occur depending on the precise timing of pre- and postsynaptic activity, a process known as spike-timing-dependent plasticity (Bi and Poo, 1998; Magee and Johnston, 1997; Markram et al., 1997). The relative timing of pre- and postsynaptic activity results in specific postsynaptic changes in calcium concentration that determine whether synaptic strength will increase or decrease (Koester and

65

Spike Timing Dependent Plasticity and Nicotine

Sakmann, 1998; Sjostrom and Nelson, 2002). Nicotinic AChRs are ligand-gated cation channels that — depending on their subcellular location — can alter presynaptic release of neurotransmitters, as well as alter somatic or dendritic membrane potential (MacDermott et al., 1999; McGehee and Role, 1995). These nicotine-induced cellular and synaptic alterations have been shown to affect the induction of long-term changes in synaptic strength in the ventral tegmental area (VTA) and hippocampus (Ge and Dani, 2005; Ji et al., 2001; Mansvelder and McGehee, 2000). These and other studies highlight that in order to understand nicotinic modulation of information processing in a particular brain area, one needs to understand how nicotine affects the different cell types in the neuronal network. In Chapter 2 it was shown that nicotine alter both excitatory and inhibitory synaptic transmission received by layer V pyramidal neurons. Nicotine increased the excitation of GABAergic interneurons by acting either directly on somatic nAChRs, or on excitatory inputs to these interneurons. Whether these actions on excitatory and inhibitory synaptic transmission in the PFC affect synaptic plasticity is not know.

Therefore, to understand the synaptic and cellular mechanisms underlying nicotinic enhancement of PFC-based cognition, we investigated how nicotinic modulation of the PFC neuronal network affects STDP. We find that nicotine increases the threshold for induction of STDP in pyramidal neurons. This effect is caused by a reduction of dendritic calcium signaling in these neurons as a result of nicotine-induced augmentation of GABAergic inhibition. Our study also demonstrates that both specific classes of PFC interneurons express nAChRs, and that specific inputs to these cell types in the medial PFC neuronal circuitry are modulated by nAChR stimulation. By affecting different parts of the PFC neuronal network through activating different nAChR types, nicotine raises the threshold for the induction of STDP in PFC output neurons.

66

Chapter III

Materials and MethodsSlice preparation

Prefrontal coronal cortical slices (300 µm) were prepared from P14-23 C57 BL/6 mice, in accordance with Dutch licence procedures. Brainmice, in accordance with Dutch licence procedures. Brain, in accordance with Dutch licence procedures. Brain slices were prepared in ice-cold artificial cerebrospinal fluid (ACSF) which contained in (mM): NaCl 125; KCl 3; NaH2PO4 1.25; MgSO4 3; CaCl2 1; NaHCO3 26; glucose 10; 300mOsm. Slices were then transferred to holding chambers in which they were stored in ACSF which contained (in mM): NaCl 125; KCl 3; NaH2PO4 1.25; MgSO4 2; CaCl2 1; NaHCO3 26; glucose 10, bubbled with carbogen gas (95% O2/ 5% CO2).

ElectrophysiologyPyramidal cells and interneurons in the medial PFC were first visualized

using Hoffman modulation or infrared differential interference contrast microscopy. After the whole cell configuration was established, recorded responses to steps of current injection allowed us to classify each cell as one of several well known cortical cell types. In many experiments two-photon imaging was also used to produce an overview of the cell’s morphology. All experiments were performed at 31-34 oC.

Recordings were made using Axopatch or Multiclamp 700A amplifiers (Axon Instruments, CA, USA) sampling at intervals of 50 or 100 µs, digitized by the pClamp software (Axon), and later analyzed off-line (Igor Pro software, Wavemetrics, Lake Oswego, OR, USA). Whole cell current injection and extracellular stimulation (both timing and levels) were controlled with a Master-8 stimulator (A.M.P.I., Jerusalem, Israel) triggered by the data acquisition software. Patch pipettes (3-5 MOhms) were pulled from standard-wall borosilicate capillaries and were filled with one of three intracellular solutions. For the STDP experiments, we used a solution that had a lower osmolarity (potassium gluconate 110 mM, KCl 10 mM; 270-275 mOsm) and an elevated phosphocreatine (10 mM) concentration. Series resistance was not compensated.In the experiments in Figure 2A we blocked GABAA receptors to investigate

67


the involvement of GABAergic transmission in the effects of nicotine on STDP. Both bicuculline (1-10 µM) and Gabazine (0.25-1 µM) strongly increased the excitability of the PFC network. In some slices, excitation was so strong that spontaneous seizure-like network discharges appeared (Suppl Fig 1B). During these discharges, pyramidal neurons received a barrage of synaptic inputs and their membrane potential depolarized by 20-40 mV. In addition, the intracellular calcium concentration in dendrites increased markedly (Suppl Fig 1C, D). To prevent these bursts from compromising our experiments in any way, we only analyzed experiments during which no network discharges appeared.

Spike-timing-dependent plasticityEPSPs were evoked every 10s using an extracellular stimulation

electrode positioned in L2/3 (Fig 1A), ~ 100 µm lateral to the recorded pyramidal cell. The slope of the initial 2.5 ms of the EPSP was analyzed to ensure that the data reflected only the monosynaptic component of each experiment (Froemke et al., 2005). Synaptic gain was measured as the change in average EPSP slope when comparing a five minute period 20-30 minutes post-conditioning to the baseline EPSP slope measured in the last 5 minutes of control recording. During the induction protocol spike-timings were measured from the onset of the evoked EPSP to the peak of the postsynaptic AP. Mean baseline EPSP slopes were averaged from at least 30 sweeps. During the conditioning period pre-postsynaptic stimulus pairing was repeated 50 times, with a 10s interval between each pairing. An interval between presynaptic stimulation and postsynaptic action potential of 5 ms resulted in reliable potentiation of synaptic strength under control conditions (Fig 1). During experiments cell input resistance was monitored throughout by applying a 10 pA, 500 ms hyperpolarizing pulse at the end of each sweep. Subtle changes in series resistance were usually first detected as a change in the evoked AP waveform, and experiments were not included in the analysis if the cell input resistance varied by more than ±30% during the experiment. To assess the effect of nicotine in these experiments, nicotine was applied

68

Chapter III

during the induction phase (1 minute before through +3 minutes after start of the 8 minute pairing protocol). The Wilcoxon’s signed rank test and the Mann-Whitney U-test were used to assess significance. Data are given as mean ± SEM, with p< 0.05 indicating significance.

Two-photon imagingPipettes were tip-filled with intracellular medium and back-filled

with intracellular solution containing Alexa 594 (40(40 µM) to reveal neuronal morphology and the calcium-indicator Fluo-4 (100 or 200 µM, Molecular Probes). Following breakthrough, cells were monitored for a minimum of 15 minutes to allow diffusion and equilibration of the dye intracellularlyto allow diffusion and equilibration of the dye intracellularly before fluorescence measurements were taken. Responses were measured. Responses were measured Responses were measured to individual APs or to 3 APs (“burst”) during a 20 msec period of current injection. Somatic APs were observed during all line scans analyzed in this data set. To stimulate EPSPs, an extracellular stimulation electrode was placed within 100 µm laterally to the region of apical dendrite being line-scanned in layer II/III. Approximately five minutes after baseline linescan measurements in aCSF were made, the dendritic region of interest (ROI) was moved approx. 5 µm closer to the soma and further linescans were taken in either aCSF or following bath-application of nicotine (10 µM).A Leica (Mannheim, Germany) RS2 two-photon laser scanning microscope was used with a x63 objective and with a Ti:Sapphire laser (Tsunami, SpectraPhysics, CA, USA) tuned to a wavelength of 840 nM for excitation. Line-scan imaging of spines and dendrites was carried out at a temporal resolution of 2 msec/line. Line-scan imaging and electrophysiological recordings were synchronized and all image acquisition was controlled by custom-written macros based on Leica confocal software. Fluorescence was measured across the apical dendrite at a distance of approximately 110 ± 6 µm from the soma. Before stimulation, fluorescence was measured for approx 85 msec to obtain basal fluorescence measurements (Fo). A region of line scan outside of any indicator-filled ROI was used to measure background fluorescence (Fb). Relative fluorescence changes were calculated as follows:

69


∆G/R�(F(t)-Fo)/(Ro-Rb), where Ro is the baseline signal measured with Alexa594 and Rb is the background signal measured in this channel. ∆F/F and ∆G/R signals were measured by detecting the peak change in a trace, averaging a 10 millisecond region around the peak change and expressing it as a percentage change from baseline level. Fluorescence traces for single APs and bursts of APs are averages of 3-5 traces. Offline data analysis was carried out using in house written procedures in Igor Pro software. Differences between groups were tested using ANOVA and t-tests (paired or two-tailed independent samples) in SPSS statistical software with p< 0.05 indicating significance.

ResultsNicotine blocks spike-timing-dependent potentiation of glutamatergic transmission

Since nicotine alters cognitive performance of rodents in behavioral tasks that involve PFC function (Granon et al., 1995) and changes in excitatory synapse strength occur during such tasks (Jay et al., 1995; Laroche et al., 2000; Laroche et al., 1990), we asked whether nicotine alters synaptic plasticity in medial PFC. To test this, we made whole-cell recordings from layer V pyramidal neurons and stimulated glutamatergic inputs by extracellular stimulation (Fig 1A). Pyramidal neurons were identified based on morphological appearance in the DIC image and action potential profile in response to step depolarizations (Fig 1B). To induce spike-timing-dependent potentiation (STDP), extracellular stimulation of presynaptic glutamatergic input was paired with a single postsynaptic action potential evoked by somatic current injection (Fig 1A, inset). Repeated pairing of the EPSP with a single postsynaptic action potential (5 ms after start of EPSP, 50x at 0.1 Hz) resulted in a lasting increase of both EPSP amplitude and slope (increase slope: 133.3±19.7%; Fig 1D, H).

When nicotine (10 µM) was applied briefly during the start of the pairing period, glutamatergic synaptic strength failed to increase (Fig 1E, H). Instead, nicotine induced a small and significant reduction in synaptic weight

70

Chapter III

to 87.0±10.3% of control after induction (Fig 1H, I). During cigarette smoking, blood levels of nicotine rapidly increase to 300-500 nM (Henningfield et al., 1993). Application of 300 nM nicotine during pairing of pre- and postsynaptic activity also prevented the increase of synaptic weight (n�5, Fig 1F, H). Similar to 10 µM nicotine, application of 300 nM nicotine tended towards a reduction of synaptic strength (Fig 1H, I), but this did not reach significance. The broad-spectrum nicotinic receptor antagonist mecamylamine (MEC, 1 µM) prevented the effect of nicotine (Fig 1G, H). In the presence of both MEC and nicotine, the pairing of EPSP and postsynaptic action potential induced

Figure 1: Spike-timing-dependent potentiation in layer V pyramidal cells of the mouse prefrontal cortex. A Graphic scheme of experimental set-up depicting placement of extracellular stimulating electrode and timing of STDP in-duction protocol (inset). B Representative current clamp traces from a layer V pyramidal cells (injection of -100 and +50pA). C Example EPSPs recorded before (smaller) and after (larger) STDP induction. D-G Example experiments showing spike-timing-dependent potentiation in a layer V pyramidal cell for (D) control, (E) 10 µM nicotine, (F) 300nM nicotine and (G) nicotine (10 µM) and mecamylamine (MEC, 1 µM). Duration of applications is indicated by the bars above the graphs. Synaptic gain at 35-45 minutes after induction is significantly above baseline (p<0.05), in line with the average shown in H. H Average temporal plot comparing change in EPSP slope in control (black circles; n=6), nicotine (10 µM; red circles; n=7, 300nM: green circles; n=5) and nicotine with MEC (yellow circles; n=8). I Bar graph summarizing STDP in control, nicotine, and MEC. Statistical significance indicated * for p<0.05.

71


a synaptic gain that was indistinguishable from control conditions (n�8, Fig 1H, I). Thus, activation of nicotinic receptors in medial PFC prevents STDP of inputs (evoked in layer II/III) to layer V pyramidal cells and induces LTD instead.

Blocking GABAA receptors but not GABAB receptors, strongly reduces nicotine’s impact on STDP

The most straightforward mechanism by which nicotine alters synaptic plasticity is through activation of either postsynaptic nAChRs, or presynaptic nAChRs on the glutamatergic terminals. In Chapter 2 it was found that although nicotine increases spontaneous glutamatergic transmission, evoked glutamatergic transmission was not increased by nicotine. An alternative mechanism by which nicotine could affect STDP in PFC is through activation of nAChRs, either on the terminals or somata of inhibitory GABAergic neurons. Indeed, in many corticalIndeed, in many cortical and sub-cortical brain areas, nicotine affects not only glutamatergic but also GABAergic synaptic transmission (Alkondon and Albuquerque, 2004; Dani and Harris, 2005; Mansvelder et al., 2006; Mansvelder et al., 2002; Metherate, 2004). In hippocampus,In hippocampus, timed activation of GABAergic interneurons by nicotine diminishes or prevents long-term potentiation in pyramidal neurons (Ji et al., 2001). In

Figure 2: Effect of GABAergic inhibition on spike tim-ing-dependent LTP. A Example trace of spike tim-ing-dependent potentiation in a layer V pyramidal neuron in the presence of 10µM nicotine and the GABAA antagonist, gabazine (1 µM) B Example trace of blocked potentiation in the presence of 10 µM nicotine and the GABAB receptor blocker CGP-54626 (5µM). C Summary bar graph. * indicates p<0.05.

72

Chapter III

Chapter 2, we found that nicotine indeed increases GABAergic transmission received by pyramidal neurons, through multiple actions on different types of interneurons. To investigate whether GABAergic transmission mediates nicotine’s effect on STDP, we tested how the GABAA receptor blocker Gabazine and the GABAB receptor blocker CGP-54626 affected nicotine’s impact on STDP. In the presence of Gabazine (0.25 – 1 µM), the reduction of STDP by nicotine was much less than with nicotine alone (n�8, p<0.05; Fig 2A, C). In contrast, CGP-54626 (5 µM) did not affect the block of potentiation by nicotine (n�5, Fig 2B, C). From these results indicate that increased GABAergic signaling through GABAA receptors mediates nicotine’s block of spike-timing-dependent potentiation in PFC.

Dendritic calcium signaling is reduced by nicotine during induction of STDP

Inhibitory GABAergic synaptic transmission controls dendritic action potential propagation in pyramidal neurons. In the hippocampus, IPSPs modulate action potential propagation and calcium signaling, and during development, increased GABAergic inhibition changes the rules for STDP in these neurons (Meredith et al., 2003; Tsubokawa and Ross, 1996). Postsynaptic calcium transients provide an associative link between synapse activation, postsynaptic cell firing and synaptic plasticity (Koester and Sakmann, 1998; Malenka et al., 1988). Since IPSCs in PFC pyramidal cells are increased in amplitude by nicotine (Chapter 2), this could reduce dendritic action potential propagation and subsequent calcium signaling in dendrites of PFC pyramidal neurons. We first tested whether changes in intracellular calcium concentration are necessary for STDP in mouse PFC layer V pyramidal neurons. When exogenous calcium chelators such as BAPTA are present in the intracellular solution, incoming calcium ions are rapidly buffered and free calcium concentration changes are strongly reduced (Helmchen, 2002; Tsien, 1980). In the presence of BAPTA (10 mM), pairing pre- and postsynaptic activity did not result in an increase of synaptic strength (n�5, Fig 3A, B). Thus, changes in calcium concentration during STDP induction are necessary

73


for changes in synaptic strength to occur.To investigate whether nicotine reduced calcium transients related to

dendritic action potential propagation, we monitored postsynaptic calcium signaling in apical dendrites of layer V pyramidal neurons during timed pre-

Figure 3. Reduction of AP-induced dendritic calcium signaling in nicotine. A Example trace showing spike-timing-dependent potentiation is abolished in the presence of the calcium chelator BAPTA (10 mM). B Summary of effects of BAPTA on STDP (n=5). C Layer V pyramidal cell filled with Alexa 594 indicating typi-cal position of stimulation electrode and line-scanned ROI (white arrow) Scale bar 20µm . C Lower panel, Experimental stimulation and line-scan protocol. D Example of calcium transient trace in response to AP burst shows clear stimulation-induced change in fluorescence across apical dendrite (middle panel). E and F Example traces of single EPSP-AP induced calcium transients in ACSF (E) and nicotine (F; 10µM) re-spectively. G EPSP-AP induced calcium transients were significantly lower in the presence of nicotine (64± 6%, n=6) than ACSF (85±4%, n=12, * p<0.05). H Nicotine did not induce a significant decrease in AP-in-duced calcium transients from baseline in the absence of extracellular stimulation (89±20%, n=3, p>0.3).

74

Chapter III

and postsynaptic activity. Pyramidal neurons were filled with Alexa594 andyramidal neurons were filled with Alexa594 and the calcium indicator Fluo4 through patch pipettes and were visualized with two-photon imaging to select a region on the apical dendrite for line-scanning (Fig 3C). As in rat PFC (Gulledge and Stuart, 2003), action potentials invade apical dendrites and induce calcium changes throughout the dendritic tree of mouse pyramidal neurons (Fig 3D-F). Somatic action potentials were preceded by extracellular stimulation of synaptic input by 5 ms, as was used for the induction of STDP. Line scans of the apical dendrite were taken 50-100STDP. Line scans of the apical dendrite were taken 50-100. Line scans of the apical dendrite were taken 50-100 µm from soma, parallel to the location of extracellular stimulation. After three initial line-scans to obtain baseline measurements, either ACSF or nicotine-containing ACSF was allowed to wash-in for 5 minutes, after which three line-scans were taken (Fig 3D-F right panels). In the presence of nicotine, fluorescence changes of Fluo4 were reduced by approximately 40% when compared to control conditions in the absence of nicotine (Fig 3E-G). Thus, in the presence of nicotine, postsynaptic calcium signals associated with coincident pre- and postsynaptic activity were markedly reduced in apical dendrites of PFC pyramidal neurons. In the absence of extracellular stimulation, nicotine did not alter fluorescence changes associated with postsynaptic action potential firing (Fig 3H). It suggests that PFC pyramidal neurons do not express nAChRs that alter dendritic action potential propagation directly. In fact, during application of nicotine in these experiments, the membrane potential of layer V pyramidal neurons did not depolarize, but instead slightly hyperpolarized by –1.7±0.6 mV. In addition, nicotine did not induce changesnicotine did not induce changes in baseline fluorescence. In ACSF conditions, baseline fluorescence increased

Figure 4 (opposite page): AP bursts rescue nicotine-impaired synaptic plasticity and increase calcium signaling. A Diagram of experimental set-up. Time delay between EPSP and postsynaptic action potential burst of 5ms during STDP induction is illustrated. B and C Normalized EPSP slope (white circles) and mean slope per minute (black cir-cles) recorded from single experiments in control (B) and nicotine (C). D Summary bar graph of potentiation fol-lowing EPSP-burst pairing stimulation at 15 min and 25 min after induction. E-H EPSP-AP burst pairings induced significantly larger dendritic calcium transients in layer V pyramidal neurons in both the absence (F) and presence of nicotine (H) than compared with EPSP-single AP pairings in similar conditions (E,G, respectively; ACSF: n=12 pairwise comparisons, p<0.05; NIC: n=6, p<0.05). Arrow heads indicate time point of stimulation. I Nicotine induc-es a significantly greater decrease in fluorescence following EPSP-single AP pairing compared with ACSF condi-tions (NIC: 64± 6%, n=6; ACSF: 85±4%, n=12, independent samples t-test, * p<0.05, data from same experiments as in figure 7G), but shows similar increase in EPSP-AP burst-induced calcium transients to those in ACSF (p=0.5).

75


by 3±2%. In the presence of nicotine, baseline fluorescence increased by 4±1.5%, which was not significantly different from ACSF conditions. These data suggest that dendrites of PFC pyramidal neurons do not contain functional nicotinic receptors that directly affect dendritic calcium signaling.

Inhibition of STDP by nicotine can be overcome by increased postsynaptic activity

Our data suggest that nicotine prevents STDP by decreasing dendritic calcium signaling in pyramidal neurons, not by reducing the calcium signal

76

Chapter III

directly, but indirectly by increasing GABAergic inhibition. It follows then that increased postsynaptic action potential firing might overcome the nicotine-induced augmentation of inhibition and block of synaptic potentiation. To test this, we paired single presynaptic events with short bursts of postsynaptic activity with the same delay of 5 ms (Fig 4A). In the absence of nicotine, short bursts of two or three somatic action potentials during a 20 ms depolarization induced an increase in EPSP slope of 151±15% (Fig 4B, D). When nicotine was applied during pairing of presynaptic events with postsynaptic bursts, the EPSP slope was still increased (n�7, Fig 4C, D). Thus, the block of STDP by nicotine can be overcome by increased postsynaptic activity, which most likely induced larger calcium changes than a single postsynaptic action potential. To confirm that short bursts of action potentials induced increased postsynaptic calcium signaling in the presence of nicotine, we studied dendritic calcium signaling in response to postsynaptic bursts of action potentials. Short bursts of two or three somatic action potentials during a 20 ms depolarization induced larger changes in calcium indicator fluorescence in dendrites than single action potentials (Fig 4E-I). Bath application of nicotine reduced calcium transients induced by single action potentials, but a short burst of action potentials restored calcium signaling (Fig 4I). These data suggest that spike-timing-dependent plasticity in PFC is blocked by nicotine because calcium signaling during dendritic propagation of single action potentials is altered. This block can be overcome by bursts of action potentials that induce larger calcium signals in dendrites, partially restoring spike-timing-dependent plasticity.

DiscussionNicotinic receptor stimulation alters PFC-based cognitive performance

in primates and rodents (Levin et al., 2005; Levin, 1992; Mansvelder et al.,(Levin et al., 2005; Levin, 1992; Mansvelder et al., 2006; Newhouse et al., 2004b). In this study, we find that during nAChRIn this study, we find that during nAChR activation the timed pairing of presynaptic activity with single postsynaptic action potentials in pyramidal neurons is no longer sufficient to induce long-term potentiation of excitatory synapses. Increased postsynaptic activity can overcome this blockade of spike-timing-dependent potentiation. During

77


nAChR activation dendritic calcium signaling is reduced, most likely due to increased inhibitory synaptic transmission to pyramidal neurons. Activity of different types of PFC interneurons is increased by nicotine, and we find that different mechanisms are involved (Chapter 2). The net result of these effects is increased GABAergic neurotransmission to pyramidal neurons, reduced dendritic calcium signaling and an increased threshold for spike-timing-dependent potentiation.

Somatic action potentials propagate deep into the dendritic tree and activate voltage-gated calcium channels in proximal and distal parts of dendrites, inducing substantial amounts of calcium influx in dendrites and dendritic spines (Koester and Sakmann, 1998; Stuart et al., 1997; Yuste and Denk, 1995). The control of dendritic action potential propagation, calcium signaling and spike-timing-dependent plasticity by inhibitory GABAergic transmission has been described in hippocampus (Meredith et al., 2003; Tsubokawa and Ross, 1996). Coincident activation of GABAergic inputs reduced dendritic action potential amplitude and the dendritic calcium signal associated with the action potential (Tsubokawa and Ross, 1996). Pairing of presynaptic activity with single postsynaptic action potentials becomes less effective at potentiating glutamatergic synapses with advancing developmental age. This results from increasing GABAergic inhibition during postnatal development, and can be overcome by pairing presynaptic activity with a burst of several postsynaptic action potentials (Meredith et al., 2003). Nicotinic AChR stimulation increases GABAergic transmission in hippocampus (Alkondon and Albuquerque, 2001; Alkondon and Albuquerque, 2004). Augmentation of GABAergic transmission by nAChR stimulation prevents long-term potentiation induced by 100 Hz stimulation for 1 sec (Ji et al., 2001). Which postsynaptic mechanisms are involved in this blockade of LTP is not known. In the PFC, we find that with the block of spike-timing-dependent potentiation of excitatory transmission dendritic calcium signaling is strongly reduced when GABAergic transmission is augmented by nicotine. Since transient increases in calcium concentration are fundamental to the induction of long-term potentiation (Koester and Sakmann, 1998; Magee and

78

Chapter III

Johnston, 1997; Sjostrom and Nelson, 2002), also in PFC pyramidal neurons (Fig 3), this most likely explains why synaptic potentiation fails in the PFC in the presence of nicotine. Thus, stimulation of nAChRs on different types of neurons can change the rules for induction of spike-timing-dependent plasticity in PFC, requiring stronger postsynaptic activity for potentiation to occur.

Nicotine reduced the amount of synaptic potentiation when presynaptic activity was paired to bursts of postsynaptic action potentials. The calcium transients induced by postsynaptic action potential bursts were similar in the presence and absence of nicotine (Fig 4). This suggests that nicotine could be affecting the synaptic plasticity machinery in PFC pyramidal neurons by other mechanisms in addition to reducing calcium signalling. It is well known that in other brain areas, nicotinic AChRs are also located on presynaptic neurons that are not glutamatergic or GABAergic, such as dopamine neurons (Wonnacott et al., 2000). It is unknown whether nAChRs are present on any of the monaminergic nuclei that project to the PFC. Dopamine is known to affect synaptic plasticity in PFC (Matsuda et al., 2006; Otani et al., 2003). Nicotinic modulation of dopamine and other monaminergic neurotransmission in the PFC could contribute to the observed modulation of STDP.

Modification of plasticity rules in cortical neuronal networks by nAChR activation may be a general phenomenon, extending beyond PFC and hippocampus. GABAergic interneurons and inhibitory synaptic transmission are affected by nAChR stimulation in many brain areas (Alkondon and(Alkondon and Albuquerque, 2004; Mansvelder et al., 2006; Mansvelder et al., 2002; Metherate, 2004). Just as in hippocampus and PFC, pyramidal neurons inJust as in hippocampus and PFC, pyramidal neurons in sensory cortical areas are not directly affected by nicotinic agonists, but different types of interneurons are strongly excited by postsynaptic nAChR activation (Alkondon and Albuquerque, 2004; Alkondon et al., 2000; Metherate, 2004; Xiang et al., 1998). Different types of nAChR subunits are involved, both α7 and α4β2-containing receptors. Many of these interneurons innervate pyramidal neurons, and therefore nAChR-mediated stimulation of interneurons would increase inhibition of pyramidal neurons. Just as we

79


found in PFC pyramidal neurons, this could lead to reduced dendritic action potential propagation and reduced calcium signaling. As a result, stronger postsynaptic activity would be required to overcome this increased dendritic inhibition to induce STDP.

In vivo recordings show that glutamatergic projections between ventral hippocampus and prefrontal cortex can alter in strength during behavior (Laroche et al., 2000). Projections from the ventral hippocampus CA1 area enter the medial PFC through superficial layers I and II and project to all layers (Jay and Witter, 1991; Laroche et al., 2000). The extent to which synaptic plasticity of these inputs will be affected by nAChR stimulation will most likely depend on the dendritic location of the synapse. Since we found that nAChR stimulation can reduce dendritic calcium signaling associated with postsynaptic action potentials in apical dendrites of layer V pyramidal neurons, it is very likely that plasticity in glutamatergic synapses located distally are most affected by this reduction. At present, it is unknown whether glutamatergic fibers between hippocampus and prefrontal cortex express nAChRs. Glutamatergic fibers from thalamus that project to PFC layer V pyramidal neurons do express nAChRs and are directly stimulated by nAChR activation (Lambe et al., 2003). These receptors contain β2 subunits and are most likely not situated on the presynaptic glutamatergic terminals, since the effect of nicotine is mediated by an increase in action potential firing. Projections from the thalamus terminate in deep as well as superficial layers of the rodent medial PFC (Berendse and Groenewegen, 1991; Heidbreder and Groenewegen, 2003). Most likely, synaptic plasticity of thalamocortical terminals synapsing on the distal apical dendrite of layer V pyramidal neurons in superficial layers will suffer more from the nicotinic mechanisms we found to block STDP than the synapses that are located closer to the cell body. By reducing dendritic action potential propagation in apical dendrites, nicotine hampers communication between cell body and distal synapses in layer V pyramidal neurons. This potentially could strongly affect information processing in the neuronal network of the medial PFC as a whole, and will alter the output of the PFC.

80

Chapter III

The activation of distributed nAChRs provides the PFC neuronal network with a wide range of computational possibilities. Nicotine alters the rules for synaptic plasticity resulting from timed presynaptic and postsynaptic activity by increasing the threshold. Thereby the function of the medial PFC network will most likely change in the presence of nicotine. Increased activity in pyramidal neurons at least partially restores the conditions for STDP to occur. The presence of nicotine and increased threshold for STDP could reduce cognitive performance in healthy naïve rodents (Day et al., 2006). Alternatively, since PFC neuronal activity could be increased during PFC-based cognitive behavior, nicotine may provide conditions under which signal to noise ratio in PFC information processing is enhanced, thereby improving cognitive performance (Day et al., 2006; Mirza and Stolerman, 1998).

81


ReferencesAlkondon, M., and Albuquerque, E. X. (2001). Nicotinic acetylcholine

receptor alpha7 and alpha4beta2 subtypes differentially control GABAergic input to CA1 neurons in rat hippocampus. J Neurophysiol 86, 3043-3055.

Alkondon, M., and Albuquerque, E. X. (2004). The nicotinic acetylcholine receptor subtypes and their function in the hippocampus and cerebral cortex. Prog Brain Res 145, 109-120.

Alkondon, M., Pereira, E. F., Eisenberg, H. M., and Albuquerque, E. X. (2000). Nicotinic receptor activation in human cerebral cortical interneurons: a mechanism for inhibition and disinhibition of neuronal networks. JNeurosci 20, 66-75.

Berendse, H. W., and Groenewegen, H. J. (1991). Restricted cortical termination fields of the midline and intralaminar thalamic nuclei in the rat. Neuroscience 42, 73-102.

Bi, G. Q., and Poo, M. M. (1998). Synaptic modifications in cultured hippocampal neurons: dependence on spike timing, synaptic strength, and postsynaptic cell type. J Neurosci 18, 10464-10472.

Cauli, B., Porter, J. T., Tsuzuki, K., Lambolez, B., Rossier, J., Quenet, B., and Audinat, E. (2000). Classification of fusiform neocortical interneurons based on unsupervised clustering. Proc Natl Acad Sci U S A 97, 6144-6149.

Dalley, J. W., Cardinal, R. N., and Robbins, T. W. (2004). Prefrontal executive and cognitive functions in rodents: neural and neurochemical substrates. Neuroscience & Biobehavioral Reviews 28, 771-784.

Dani, J. A., and Harris, R. A. (2005). Nicotine addiction and comorbidity with alcohol abuse and mental illness. 8, 1465-1470.

Day, M., Pan, J. B., Buckley, M. J., Cronin, E., Hollingsworth, P. R., Hirst, W. D., Navarra, R., Sullivan, J. P., Decker, M. W., and Fox, G. B. (2006). Differential effects of ciproxifan and nicotine on impulsivity and attention measures in the 5-choice serial reaction time test. Biochemical Pharmacology In Press, Corrected Proof.

Froemke, R. C., Poo, M. M., and Dan, Y. (2005). Spike-timing-dependent synaptic plasticity depends on dendritic location. Nature 434, 221-225.

Gabbott, P. L., Dickie, B. G., Vaid, R. R., Headlam, A. J., and Bacon, S. J. (1997). Local-circuit neurones in the medial prefrontal cortex (areas 25, 32 and 24b) in the rat: morphology and quantitative distribution. J

82

Chapter III

Comp Neurol 377, 465-499.Ge, S., and Dani, J. A. (2005). Nicotinic acetylcholine receptors at glutamate

synapses facilitate long-term depression or potentiation. J Neurosci 25, 6084-6091.

Gioanni, Y., Rougeot, C., Clarke, P. B., Lepouse, C., Thierry, A. M., and Vidal, C. (1999). Nicotinic receptors in the rat prefrontal cortex: increase in glutamate release and facilitation of mediodorsal thalamo-cortical transmission. EurJNeurosci 11, 18-30.

Granon, S., Poucet, B., Thinus-Blanc, C., Changeux, J. P., and Vidal, C. (1995). Nicotinic and muscarinic receptors in the rat prefrontal cortex: differential roles in working memory, response selection and effortful processing. Psychopharmacology (Berl) 119, 139-144.

Gray, R., Rajan, A. S., Radcliffe, K. A., Yakehiro, M., and Dani, J. A. (1996). Hippocampal synaptic transmission enhanced by low concentrations of nicotine. Nature 383, 713-716.

Groenewegen, H. J., and Uylings, H. B. (2000). The prefrontal cortex andThe prefrontal cortex and the integration of sensory, limbic and autonomic information. Prog Brain Res 126, 3-28.

Gulledge, A. T., Park, S. B., Kawaguchi, Y., and Stuart, G. J. (2007). Heterogeneity of phasic cholinergic signalling in neocortical neurons. J Neurophysiol, 00493.02006.

Gulledge, A. T., and Stuart, G. J. (2003). Action potential initiation and propagation in layer 5 pyramidal neurons of the rat prefrontal cortex: absence of dopamine modulation. J Neurosci 23, 11363-11372.

Heidbreder, C. A., and Groenewegen, H. J. (2003). The medial prefrontal cortex in the rat: evidence for a dorso-ventral distinction based upon functional and anatomical characteristics. Neurosci Biobehav Rev 27, 555-579.

Helmchen, F. (2002). Raising the speed limit - fast Ca(2+) handling in dendritic spines. Trends Neurosci 25, 438.

Henningfield, J. E., Stapleton, J. M., Benowitz, N. L., Grayson, R. F., and London, E. D. (1993). Higher levels of nicotine in arterial than in venous blood after cigarette smoking. Drug Alcohol Depend 33, 23-29.

Jay, T. M., Burette, F., and Laroche, S. (1995). NMDA receptor-dependent long-term potentiation in the hippocampal afferent fibre system to the prefrontal cortex in the rat. Eur J Neurosci 7, 247-250.

Jay, T. M., and Witter, M. P. (1991). Distribution of hippocampal CA1 and subicular efferents in the prefrontal cortex of the rat studied by means

83


of anterograde transport of Phaseolus vulgaris-leucoagglutinin. J Comp Neurol 313, 574-586.

Ji, D., Lape, R., and Dani, J. A. (2001). Timing and location of nicotinic activity enhances or depresses hippocampal synaptic plasticity. Neuron 31, 131-141.

Kawaguchi, Y. (1993). Groupings of nonpyramidal and pyramidal cells with specific physiological and morphological characteristics in rat frontal cortex. J Neurophysiol 69, 416-431.

Kawaguchi, Y., and Kondo, S. (2002). Parvalbumin, somatostatin and cholecystokinin as chemical markers for specific GABAergic interneuron types in the rat frontal cortex. J Neurocytol 31, 277-287.

Kawaguchi, Y., and Kubota, Y. (1997). GABAergic cell subtypes and their synaptic connections in rat frontal cortex. Cereb Cortex 7, 476-486.

Koester, H. J., and Sakmann, B. (1998). Calcium dynamics in single spines during coincident pre- and postsynaptic activity depend on relative timing of back-propagating action potentials and subthreshold excitatory postsynaptic potentials. ProcNatlAcadSciUSA 95, 9596-9601.

Lambe, E. K., Picciotto, M. R., and Aghajanian, G. K. (2003). Nicotine Induces Glutamate Release from Thalamocortical Terminals in Prefrontal Cortex. Neuropsychopharmacology 28, 216-225.

Laroche, S., Davis, S., and Jay, T. M. (2000). Plasticity at hippocampal to prefrontal cortex synapses: dual roles in working memory and consolidation. Hippocampus 10, 438-446.

Laroche, S., Jay, T. M., and Thierry, A.-M. (1990). Long-term potentiation in the prefrontal cortex following stimulation of the hippocampal CA1/subicular region. Neuroscience Letters 114, 184-190.

Levin, E., McClernon, F., and Rezvani, A. (2005). Nicotinic effects on cognitive function: behavioral characterization, pharmacological specification, and anatomic localization. Psychopharmacology, 1-17.

Levin, E. D. (1992). Nicotinic systems and cognitive function. Psychopharmacology (Berl) 108, 417-431.

Liss, B. (2002). Improved quantitative real-time RT-PCR for expression profiling of individual cells. Nucleic Acids ResNucleic Acids Res 30, e89.

MacDermott, A. B., Role, L. W., and Siegelbaum, S. A. (1999). PresynapticPresynaptic ionotropic receptors and the control of transmitter release. Annu Rev Neurosci 22, 443-485.

Magee, J. C., and Johnston, D. (1997). A synaptically controlled, associative signal for Hebbian plasticity in hippocampal neurons. ScienceScience 275,

84

Chapter III

209-213.Malenka, R. C., Kauer, J. A., Zucker, R. S., and Nicoll, R. A. (1988).

Postsynaptic calcium is sufficient for potentiation of hippocampal synaptic transmission. Science 242, 81-84.

Mansvelder, H., van Aerde, K., Couey, J., and Brussaard, A. (2006). Nicotinic modulation of neuronal networks: from receptors to cognition. Psychopharmacology 184, 292-305.

Mansvelder, H. D., Keath, J. R., and McGehee, D. S. (2002). Synaptic mechanisms underlie nicotine-induced excitability of brain reward areas. Neuron 33, 905-919.

Mansvelder, H. D., and McGehee, D. S. (2000). Long-term potentiation of excitatory inputs to brain reward areas by nicotine. Neuron 27, 349-357.

Mansvelder, H. D., and McGehee, D. S. (2002). Cellular and synaptic mechanisms of nicotine addiction. J NeurobiolJ Neurobiol 53, 606-617.

Markram, H., Lubke, J., Frotscher, M., and Sakmann, B. (1997). RegulationRegulation of synaptic efficacy by coincidence of postsynaptic APs and EPSPs. Science 275, 213-215.

Matsuda, Y., Marzo, A., and Otani, S. (2006). The Presence of Background Dopamine Signal Converts Long-Term Synaptic Depression to Potentiation in Rat Prefrontal Cortex. J Neurosci 26, 4803-4810.

McGehee, D. S., Heath, M. J., Gelber, S., Devay, P., and Role, L. W. (1995). Nicotine enhancement of fast excitatory synaptic transmission in CNS by presynaptic receptors. Science 269, 1692-1696.

McGehee, D. S., and Role, L. W. (1995). Physiological diversity of nicotinic acetylcholine receptors expressed by vertebrate neurons. AnnuRevPhysiol 57, 521-546.

McGehee, D. S., and Role, L. W. (1996). Presynaptic ionotropic receptors. CurrOpinNeurobiol 6, 342-349.

Meredith, R. M., Floyer-Lea, A. M., and Paulsen, O. (2003). Maturation of long-term potentiation induction rules in rodent hippocampus: role of GABAergic inhibition. J Neurosci 23, 11142-11146.

Metherate, R. (2004). Nicotinic acetylcholine receptors in sensory cortex. Learn Mem 11, 50-59.

Mirza, N. R., and Stolerman, I. P. (1998). Nicotine enhances sustained attention in the rat under specific task conditions. Psychopharmacology (Berl) 138, 266-274.

Muir, J. L., Everitt, B. J., and Robbins, T. W. (1995). Reversal of visual attentional dysfunction following lesions of the cholinergic basal

85


forebrain by physostigmine and nicotine but not by the 5-HT3 receptor antagonist, ondansetron. Psychopharmacology (Berl) 118, 82-92.

Newhouse, P., Singh, A., and Potter, A. (2004a). Nicotine and nicotinic receptor involvement in neuropsychiatric disorders. Curr Top Med Chem 4, 267-282.

Newhouse, P. A., Potter, A., and Singh, A. (2004b). Effects of nicotinic stimulation on cognitive performance. Curr Opin Pharmacol 4, 36-46.

Otani, S., Daniel, H., Roisin, M. P., and Crepel, F. (2003). Dopaminergic modulation of long-term synaptic plasticity in rat prefrontal neurons. Cereb Cortex 13, 1251-1256.

Picciotto, M. R., and Zoli, M. (2002). Nicotinic receptors in aging and dementia. J Neurobiol 53, 641-655.

Silberberg, G., and Markram, H. (2007). Disynaptic Inhibition between Neocortical Pyramidal Cells Mediated by Martinotti Cells. Neuron 53, 735-746.

Sjostrom, P. J., and Nelson, S. B. (2002). Spike timing, calcium signals and synaptic plasticity. Curr Opin Neurobiol 12, 305-314.

Stuart, G., Spruston, N., Sakmann, B., and Hausser, M. (1997). Action potential initiation and backpropagation in neurons of the mammalian CNS. Trends Neurosci 20, 125-131.

Tsien, R. Y. (1980). New calcium indicators and buffers with high selectivity against magnesium and protons: design, synthesis, and properties of prototype structures. Biochemistry 19, 2396-2404.

Tsubokawa, H., and Ross, W. N. (1996). IPSPs modulate spike backpropagation and associated [Ca2+]i changes in the dendrites of hippocampal CA1 pyramidal neurons. J Neurophysiol 76, 2896-2906.

Vidal, C., and Changeux, J. P. (1989). Pharmacological profile of nicotinic acetylcholine receptors in the rat prefrontal cortex: an electrophysiological study in a slice preparation. Neuroscience 29, 261-270.

Vidal, C., and Changeux, J. P. (1993). Nicotinic and muscarinic modulations of excitatory synaptic transmission in the rat prefrontal cortex in vitro. Neuroscience 56, 23-32.

Wonnacott, S., Kaiser, S., Mogg, A., Soliakov, L., and Jones, I. W. (2000). Presynaptic nicotinic receptors modulating dopamine release in the rat striatum. Eur J Pharmacol 393, 51-58.

Wonnacott, S., Sidhpura, N., and Balfour, D. J. (2005). Nicotine: from molecular mechanisms to behaviour. Curr Opin Pharmacol 5, 53-59.

86

Chapter III

Xiang, Z., Huguenard, J. R., and Prince, D. A. (1998). Cholinergic Switching Within Neocortical Inhibitory Networks. Science 281, 985-988.

Yang, C. R., Seamans, J. K., and Gorelova, N. (1996). Electrophysiological and morphological properties of layers V-VI principal pyramidal cells in rat prefrontal cortex in vitro. JNeurosci 16, 1904-1921.

Yuste, R., and Denk, W. (1995). Dendritic spines as basic functional units of neuronal integration. Nature 375, 682-684.

87


88

Chapter IV

Functional Modulation of Interpyramidal Disynaptic Inhibition by Nicotine

Jonathan Jay Couey, Henry Markram, August B. Smit, Arjen B. Brussaard& Huibert D. Mansvelder

Manuscript in preparation.

89

Abstract: Nicotine enhances attention performance in humans and in rodents. One of the brain areas involved in attention performance is the prefrontal cortex (PFC) and sustained pyramidal cell activation in the PFC has been proposed as the cellular correlate of attention and working memory. PFC layer 5 pyramidal cells do not express nicotinic receptors, but GABA signaling in this layer is modulated by nicotine. We have shown previously that specific non-fast spiking interneurons express nAChRs in the mouse PFC. Non-fast spiking interneurons in the PFC can mediate feedforward inhibition between pyramidal cells. Here, we asked the question whether nicotine would alter interpyramidal cell inhibition by activating nicotinic receptors on the interneurons that mediate this inhibition. Our data confirm that the pyramidal cell network in layer V of the mouse PFC is connected by both depressing and facilitating synaptic connections similar to those reported in the ferret and rat PFC. We also find a disynaptic inhibitory loop between mouse PFC layer 5 pyramidal neurons, similar to the inhibitory loop described in the rat somatosensory cortex. The amount of interpyramidal inhibition in the PFC is reduced by nicotinic receptor activation. Activation of nAChRs on specific low-threshold spiking (LTS) interneurons leads to depolarization and tonic firing. This change in the LTS cells is likely to cause short term depression of the synapse between the interneuron and post synaptic pyramid which results a reduction of feedforward inhibitory strength. By uncoupling interpyramidal neuron inhibition, nicotine could affect cortical functions like attention and working memory.

90

Chapter IV

IntroductionA large body of work indicates that nicotine can specifically enhance

cognitive functions associated with the prefrontal cortex, including attention and working memory (Levin et al. 2006; Mansvelder et al. 2006). At the cellular level, activation of nicotinic acetylcholine receptors (nAChRs) by acetylcholine and agonists such as nicotine depolarize cells, changing their computational properties as well as their roles within the local microcircuitry (Ji et al. 2001). The output from layer V pyramidal cells in the PFC is a key component of the PFC’s computational contribution to behavior, and both long term potentiation and the direct gating of thalamic input to these cells are modulated by nAChR activation (Couey et al. 2007; Lambe et al. 2003). A majority of the nAChRs in the hippocampus have been associated with interneurons and GABA signaling, rather than on pyramidal cells (Alkondon et al. 2000a; Alkondon et al. 1999; Ji and Dani 2000). Interestingly, a majority of the nAChRs expressed by neurons in the PFC are also not on pyramidal cells, but rather on non-fast spiking interneuron subtypes (Couey et al. 2007; Gulledge et al. 2007). The nAChRs present on these interneurons have been proposed to be part of a cholinergic switching mechanism (Xiang et al. 1998). While this study shows that nAChR activation can depolarize interneurons, how this actually influences the contribution of these interneurons to the microcircuit remains poorly understood.

The Martinotti cell is an anatomical class of non-fast spiking GABAergic interneuron whose axons target cortical layers far removed from their soma and dendritic arborization. These cells have also been characterized as low threshold spiking (LTS) interneurons and are thought to mediate feedforward inhibition in the cortex (Goldberg et al. 2004). Whole cells patch was recently used to record simultaneously from the three cells involved in this feedforward inhibitory circuit connecting layer V pyramidal cells via Martinotti cells in the somatosensory cortex of adolescent rats (Silberberg and Markram 2007). This circuit was also demonstrated to be present in layer II/III, and also between layer II/III and layer V pyramidal cells (Kapfer et al. 2007). These studies confirm the existence of a cortical feedforward

91

Disynaptic Inhibition and Nicotine

inhibitory circuit between pyramidal cells via interneurons, allowing activated pyramidal cells to inhibit the postsynpatic targets. Critical to understand the function of this feedforward circuit was careful characterization of the short term plasticity of the synapses involved. The facilitating synapse which is characteristic of the connection between pyramidal cells and Martinotti cells seems to be critical for the functional timing of this loop. We hypothesized that this feedforward inhibitory loop is likely present between layer V pyramidal cells in the PFC. Since we and others have shown with our previous work that LTS interneurons exhibit nicotinic currents (Alkondon et al. 2000b; Couey et al. 2007; Goldberg et al. 2004), we also hypothesized that nAChRs could play a crucial role in regulating the function of this feedforward inhibition within PFC.

Multi-cell patch recordings were used to measure the rate of connectivity between layer V pyramidal cells in the mouse PFC. Direct synaptic connections, feedforward excitation, and feedforward inhibition were detectable between layer V pyramids when evoked using whole cell presynaptic current injection. Identification of a similar feedforward inhibitory loop in the mouse PFC suggests that this microcircuit may be a stereotypic feature of several cortical areas in the mammalian brain. Application of 300nM nicotine reduced the strength of interpyramidal feedforward inhibition without affecting the resting membrane potential of the pyramidal cell. Nicotine sufficiently depolarized LTS cells to induce tonic firing. Tonic firing likely reduces the ready-releasable pool of vesicles in the depressing synapse from the LTS cell to the pyramid thereby reducing the strength of the inhibition seen in the post-synaptic pyramid.

Materials and MethodsSlice preparation

Prefrontal coronal cortical slices (300 µm) were prepared from P14-23 C57 BL/6 mice, in accordance with Dutch and Swiss license procedures.mice, in accordance with Dutch and Swiss license procedures., in accordance with Dutch and Swiss license procedures. Brain slices were prepared in ice-cold artificial cerebrospinal fluid (ACSF) which contained in (mM): NaCl 125; KCl 3; NaH2PO4 1.25; MgSO4 2; CaCl2

92

Chapter IV

1; NaHCO3 26; glucose 10; 300mOsm. Slices were then transferred to holding chambers in which they were stored inz ACSF which contained (in mM): NaCl 125; KCl 3; NaH2PO4 1.25; MgSO4 1; CaCl2 2; NaHCO3 26; glucose 10, bubbled with carbogen gas (95% O2/ 5% CO2).

ElectrophysiologyMultiple whole cell recordings were made in slices as described

previously (Le Be and Markram 2006; Le Be et al. 2006; Wang et al. 2002), using a standard intracellular solution containing (in mM): K-gluconate 120; KCl 10; HEPES 10; K-phosphocreatine 10; ATP-Mg 4; GTP 0.4, pH 7.2-7.3, pH adjusted to 7.3 with KOH; 270-285 mOsm. Pyramidal cells and interneurons in the medial PFC were first visualized using infrared differential interference contrast microscopy. Pyramidal cells in layer V were identified as a group so that up to seven cells could be targeted for whole cell patch. All cells were first maintained in the “on cell” configuration until all contacts had achieved a +1Gohm resistance. The entire cluster was then opened to whole cell mode. After the whole cell configuration was established in all cells, recorded responses to steps of current injection allowed us to electrophysiologically verify each cell as a pyramidal cell and also to characterize any direct connectivity. All experiments were performed at 31-34 oC. Feedforward inhibition was evoked as described previously (Silberberg and Markram 2007). Briefly, individual pyramidal cells were stimulated by a high frequency train (15 APs at 70Hz), while simultaneously recording the membrane potential in surrounding pyramids held at -55mV. GABA responses were enhanced at this potential making detection more reliable, and all loop parameters were measured from this depolarized potential in the post synaptic pyramid. Nicotine was bath applied (approx. 4ml per minute) at a concentration of 300nM.

Recordings were made using Axopatch 200B amplifiers (Axon Instruments, CA, USA) sampling at intervals of 50 or 100 µs, digitized using an ITC-18 interface in combination with custom acquisition software written by Funetics (Lausanne, CH) for Igor Pro from Wavemetrics (Lake Oswego,

93


OR, USA). This same software was also used to control whole cell current injection (both timing and levels). Patch pipettes (3-5 MOhms) were pulled from standard-wall borosilicate capillaries and were filled with a standard intracellular solution containing. Series resistance was not compensated. Data analysis was done offline using Igor (Wavemetrics), Excel (Microsoft), and Sigma Plot. Data in figures is always displayed as a mean ± S.E. unless otherwise noted. 2D distribution of cellular connections was determined using the coordinates generated by the Luigs and Neumann positioning software. Statistical significance of the effect of nicotine on the kinetics of the disynaptic inhibition was determined using an unpaired two-tailed student’s T test.

ResultsMono-synaptic connectivity between Layer V pyramidal cells in PFC. Layer V cortical cells have been shown to consist of at least two cell types in the PFC of the ferret and rat, and two main types of pyramidal to pyramidal synapses have been described (Wang et al. 2006). These two cell types have been shown to be preferentially connected into subnetworks. To find evidence of similar microcircuitry in the mouse PFC, we used multiple patch clamp recordings to first measure pyramidal to pyramidal cell connectivity. Four to seven layer V pyramidal cells were recorded simultaneously (Fig. 1A and 1B). Each cell was stimulated to fire action potentials (APs) at low frequencies (see Materials and Methods) to identify and characterize any direct synaptic connections within the set (Fig. 1C and 1D). For each cluster of cells, there are (n)*(n-1) possible direct connections, i.e. each cluster of 7 cells represented 42 possible direct connections. Direct synaptic connections were characterized by averaging between 20 and 30 individual sweeps at each presynpatic stimulation frequency. Stimulation of synaptic connections at 70Hz frequency with 15APs could occasionally evoke feedforward excitation visible in the post synaptic cell. Traces taken from pairs of cells showing no functional connectivity produced a flat Vm trace with no upward or downward deflections in the would-be post synaptic cell (See figure 1). The kinetics of the synapses found between layer V pyramidal cells were often facilitating

94

Chapter IV

(increasing raw EPSC amplitude) for up to 3 EPSCs (Fig 2Ai, Aii, B; 84.2%), although depressing connections (15.8%) were also observed (Figure 2, Aiii and B). Direct synaptic connections occurred between 3.2% of the total possible connections tested (291 cells; n�891). The frequency of reciprocity in connectivity was 42.9%.

Interpyramidal feedforward inhibitionThe rate of direct connectivity among layer V pyramidal neurons

in mouse PFC is low, with only 3.2% of the cells connected within ~150 um distance. Recently, it was found that rat cortical pyramidal neurons can communicate through a disynaptic connection involving the activation of Martinotti interneurons (Kapfer et al. 2007; Silberberg and Markram 2007). We tested whether a disynaptic inhibitory loop exists in the mouse PFC that links neighboring pyramidal neurons through activation of interneurons. As in

A

B

C D Cell 2 to Cell 4Cell 3 to Cell 5

Figure 1: Multiple whole cell patch recordings in layer V pyramidal cells. A Schematic representation of a seven cell cluster recording. B Photograph of a recorded seven cell cluster after biocytin staining. C and D Membrane potential traces taken from cells recorded in B, illustrating two synaptic connections found in this cluster. Scale bar for x-axis values in traces C and D shown in upper right (20mV) for stimulated cell, and at lower right for C and D the other traces (2mV). Scale for y-axis (time) is identical for all traces (100ms).

95


the experiments above, four to seven pyramidal cells in layer V of the mouse medial PFC were recorded in the whole cell configuration. Next, disynaptic inhibition was evoked by stimulating each cell in succession (15AP@70Hz; Figure 3A) while the voltage responses in the other cells were recorded simultaneously. We observed disynaptic inhibition between 14% of the connections tested (48 cells; n�204; 29 disynaptic loops observed). The onset latency from the first presynaptic action potential was 303±8 ms (Fig 3; n�18) and the average amplitude of this disynaptic inhibition was 0.638±0.07mV (Fig 3C). These values are in agreement with those presented by Silberberg and Markram in 2007 (where they demonstrated that this depended on the short term plasticity of the excitatory synapse on the Martinotti cell). In contrast to direct connectivity, pyramidal cells in mouse PFC are more connected to each other by disynaptic inhibitory connections.

Nicotinic effects on feedforward inhibtionIt has been previously shown that LTS cells express nicotinic receptors

(Couey et al. 2007; Xiang et al. 1998). Assuming that our LTS cells group

C

Aiii

Aii-200 -150 -100 -50 0 50 100 150 200

-200

-150

-100

-50

0

50

100

150

200 Unconnected Unidirectional Reciprocal

57.9%

26.3%

15.8%0.5mV

200ms

Ai B

Figure 2: Direct synaptic connectivity between layer V pyramidal cells. Ai and Aii Two types of facilitating con-nections found between layer V pyramids. Aiii Typical depressing pyramidal to pyramidal synaptic connection. Scale bar in Aiii applies to all three example traces. B Pie graph depicting the proportion of total measured synaptic connections represented by each major type. C 2D plot representing the approximate spacial relation-ship between recorded cells and connectivity observed (units in µm). All connections (red) are shown originat-ing from a single cell at the origin, and as such all reciprocal connections (blue) are mirrored across the origin.

96

Chapter IV

contains the putative Martinotti cells, activation of these receptors could affect the strength of inhibition between pyramidal neurons. We tested whether activation of nAChRs by concentrations of nicotine experienced by smokers (300 nM) would affect the amplitude and timing of the disynaptic inhibition between pyramidal neurons. Once the presence of an inhibitory disynaptic connection was characterized in control conditions, we applied 300nM nicotine to the bath. In the presence of nicotine, the amplitude of disynaptic inhibitory potentials was significantly reduced by 60% (0.231±0.06mV; Fig 3C). However, the peak latency was not significantly affected by nicotine (Fig 3B). Thus, nicotine reduces the strength of disynaptic inhibitory connections between PFC pyramidal neurons.

A Bi Ci

con

nic

1mV

100ms

Bii Cii

Figure 3: Nicotine reduces the strength of feedforward inhibition. A Presynaptic pyramidal cells were stimulated at high frequency (upper trace). Average inhibitory responses (black traces) were recorded in surrounding py-ramidals cells by averaging 30 sweeps (yellow traces) in control conditions and after nicotine application. Bi and Bii Individual and average peak latency times of the inhibitory response (when still detectable) were not changed in nicotine. Ci and Cii Individual and average amplitude of the inhibitory response was reduced in nicotine.

97


Nicotinic effects in layer V LTS cellsActivation of nAChRs on LTS cells is likely affecting the function of

the inhibitory loop, but how is not immediately clear. We hypothesized that the resting state of the LTS interneuron is altered in the presence of nicotine, changing also the function of the synapse between the LTS cell and the post synaptic pyramid. We tested the effects of nicotine on the resting properties of LTS cells in layer V. We made single cell recordings from LTS cells and exposed them to an identical concentration and time course of nicotine as that applied in the loop recordings. LTS cells depolarized in the presence of

the 300nM nicotine and began to tonically fire (Figure 4B and 4C). The synapse between LTS cells and pyramids has been shown to be depressing (Goldberg et al. 2004; Reyes et al. 1998; Silberberg and Markram 2007). The inhibitory synapses between LTS cells and pyramidal cells are thus likely to have their ready releasable pool

of vesicles reduced in the presence of nicotine. This would result ultimately in the disynaptic inhibition between pyramidal cells being temporarily reduced in the strength during nicotinic or cholinergic stimulation, while at the same time increasing spontaneous GABA release from LTS cells onto the apical dendrites of the pyramidal cell network (Figure 5).

Discussion The activity of pyramidal cells in the PFC has been proposed as the cellular correlate of attention and working memory (Cohen et al. 1997;

A B

Figure 5: Schematic representation of nicotinic effects on feed-forward inhibition. A In control conditions, single pyramidal cells (pre) are able to inhibit their neighbors (post) at their api-cal dendrites via LTS cell mediated inhibition. The excitatory synapse between the pyramid and the LTS cell is facilitating (1). The inhibitory synapse between the LTS cell and down-stream pyramid is depressing (2). B In the presence of nicotine, LTS cells enter into a tonic firing mode (gray). While synapse 1 is unaffected, synapse 2 is effectively run down by the tonic fir-ing. The apical dendrites of the post LTS pyramids are likely hy-perpolarized by the tonic release of GABA from LTS cells (grey).

98

Chapter IV

Marklund et al. 2007). Activation of nAChRs in the PFC can alter attention processing, yet it is interneurons which express nAChRs. In the mouse PFC, we found a layer V pyramidal cell network connected by both facilitating and depressing direct excitatory connections, similar to those reported in the rat and ferret. The present study provides novel evidence for a feedforward inhibitory circuit between these cells which is modulated by nicotine. Electrophysiologically, this feedforward inhibition was similar to that recently found in the rat somatosensory cortex. We demonstrate here that the strength of this disynaptic inhibitory loop is reduced by the activation of nAChRs, that are most likely expressed by the mediating interneuron. The LTS cells of the PFC convert to a tonic firing mode in the presence of nicotine. Tonic firing in the mediating interneuron would result in the observed reduction in synaptic strength of evoked interpyramidal feedforward inhibition. Nicotinic modulation of this microcircuit in the PFC is likely to be a crucial component of nicotine’s effects on attention processing.

Layer V pyramidal cells integrate inputs across cortical layers (Spruston 2008). Different interneurons synapse on different dendritic compartments, and thus control different pyramidal cell inputs and functions (Kawaguchi and Kondo 2002; McBain and Fisahn 2001). The distal apical dendrites of pyramidal cells can generate calcium spikes which result in burst firing, and this function is gated by GABA inputs to the apical dendrite (Larkum et al. 1999; Larkum et al. 2001). The feedforward inhibition we found in the mouse PFC has been shown in other cortical areas to be mediated by interneurons targeting the apical dendrite of pyramidal cells (Silberberg and Markram 2007), making it likely to play a crucial role in regulating how pyramidal cells integrate information across layers. Our previous work also demonstrated a link between apical dendritic calcium signaling, GABA, and nicotine (see Chapter 3) in the mouse PFC. These results combine to suggest that apical dendritic excitability—and thus the impact that inputs to the apical dendrite have on action potential generation at the soma—may be under the control of GABA inputs originating from LTS interneurons expressing nAChRs, and that this might be a general feature of several cortical regions.

99


LTS cells have been shown to be a population of interneurons expressing somatostatin, most of which can be classified anatomically as Martinotti cells (Goldberg et al. 2004). These interneurons have typically a bipolar cell body, a local dendritic tree in layer V, and an axon projecting to upper layers (Kawaguchi and Kubota 1996; Wang et al. 2004). LTS interneurons have been shown to be electrically coupled (Gibson et al. 1999; Gibson et al. 2005) and potentially provide synchronous inhibition over a large cortical domain. Thus, single activated pyramids may be able to inhibit potentially hundreds of surrounding cells through the LTS cell network. The feedforward inhibition mediated by LTS interneurons appears ideal for preventing overactivation of the pyramidal network by apical dentritic input. The kinetics of the synapse between the pyramid and the LTS interneuron (Reyes et al. 1998) and between the LTS cell and pyramid (Gupta et al. 2000) were described separately by previous studies. The details of the specific synapses involved in this microcircuit dovetail nicely with the present data, and seem to offer a simple mechanistic explanation for the nicotinic modulation of the feedforward inhibition observed in the mouse PFC.

A cholinergic mechanism to switch between inhibitory pathways in the cortex has been suggested by at least one previous study (Xiang et al. 1998). In the visual cortex, acetylcholine was observed not only to depolarize LTS cells through activation of nAChRs, but also hyperpolarize FS cells via the activation of muscarinic AChRs. The depolarization of LTS interneurons was assumed to strengthen the inhibition mediated by these cells. Our data show that nicotine decreases the strength of this inhibitory connection, and we postulate that tonic firing in the LTS cells results in a weakened evoked inhibitory response in the neighboring pyramids. Tonic firing of LTS cells in nicotine is also likely to underlie some of the dramatic increase in spontaneous GABA release we previously reported in layer V pyramids (see Chapter 2). Activation of nAChRs which leads to tonic firing in interneurons will also result in tonic release of GABA onto post synaptic cells. If the target of these synapses is the apical dendrite, this tonic release will potentially hyperpolarize the target dendrite for the duration of the nAChR stimulation.

100

Chapter IV

While the strength of feedforward inhibition is effectively reduced by nAChR activation, the synaptic signals in the apical dendrites of the pyramidal cell network are likely to be dampened by the tonically firing LTS cell network. Further experiments are necessary to address whether the LTS cells in the PFC are electrically coupled, and whether the spread of inhibitory activity through this network of LTS cells would be affected by nAChR activation.

Inhibition is thought to be a key factor in how thalamic information flows through the cortex (Gabernet et al. 2005) and hippocampus (Alkondon and Albuquerque 2002; Pouille and Scanziani 2001). GABAergic synapses have been shown to couple with thalamocortical inputs in the frontal cortex (Kubota et al. 2007), and these inputs are modulated by nAChR activation (Kawai et al. 2007; Lambe et al. 2003). Development of corticothalamic projection cells in layer VI of the frontal cortex also appears to be modulated by nAChRs during a specific time window around adolescence (Kassam et al. 2008). This disynaptic inhibitory loop could also be pivotal part of the computation mechanism determining what cells in layer V are activated by incoming thalamic inputs (Disney et al. 2007). These data seem to provide a compelling cellular mechanism by which nicotine might alter the development of thalamocortical circuitry, and this could contribute significantly adolescent nicotine addiction.

101


ReferencesAlkondon M, Albuquerque EX (2002) A Non-alpha 7 Nicotinic Acetylcholine

Receptor Modulates Excitatory Input to Hippocampal CA1 Interneurons. J Neurophysiol 87: 1651-1654

Alkondon M, Braga MFM, Pereira EFR, Maelicke A, Albuquerque EX (2000a) [alpha]7 Nicotinic acetylcholine receptors and modulation of gabaergic synaptic transmission in the hippocampus. European Journal of Pharmacology 393: 59-67

Alkondon M, Pereira EFR, Eisenberg HM, Albuquerque EX (1999) Choline and Selective Antagonists Identify Two Subtypes of Nicotinic Acetylcholine Receptors that Modulate GABA Release from CA1 Interneurons in Rat Hippocampal Slices. J. Neurosci. 19: 2693-2705

Alkondon M, Pereira EFR, Eisenberg HM, Albuquerque EX (2000b) Nicotinic Receptor Activation in Human Cerebral Cortical Interneurons: a Mechanism for Inhibition and Disinhibition of Neuronal Networks. J. Neurosci. 20: 66-75

Cohen JD, Perlstein WM, Braver TS, Nystrom LE, Noll DC, Jonides J, Smith EE (1997) Temporal dynamics of brain activation during a working memory task. Nature 386: 604-608

Couey JJ, Meredith RM, Spijker S, Poorthuis RB, Smit AB, Brussaard AB, Mansvelder HD (2007) Distributed Network Actions by Nicotine Increase the Threshold for Spike-Timing-Dependent Plasticity in Prefrontal Cortex. Neuron 54: 73-87

Disney AA, Aoki C, Hawken MJ (2007) Gain Modulation by Nicotine in Macaque V1. Neuron 56: 701-713

Gabernet L, Jadhav SP, Feldman DE, Carandini M, Scanziani M (2005) Somatosensory Integration Controlled by Dynamic Thalamocortical Feed-Forward Inhibition. Neuron 48: 315-327

Gibson JR, Beierlein M, Connors BW (1999) Two networks of electrically coupled inhibitory neurons in neocortex. Nature 402: 75-79

Gibson JR, Beierlein M, Connors BW (2005) Functional Properties of Electrical Synapses Between Inhibitory Interneurons of Neocortical Layer 4. J Neurophysiol 93: 467-480

Goldberg JH, Lacefield CO, Yuste R (2004) Global dendritic calcium spikes in mouse layer 5 low threshold spiking interneurones: implications for control of pyramidal cell bursting. J Physiol (Lond) 558: 465-478

Gulledge AT, Park SB, Kawaguchi Y, Stuart GJ (2007) Heterogeneity of phasic cholinergic signalling in neocortical neurons. J Neurophysiol

Gupta A, Wang Y, Markram H (2000) Organizing Principles for a Diversity

102

Chapter IV

of GABAergic Interneurons and Synapses in the Neocortex. Science 287: 273-278


Ji D, Lape R, Dani JA (2001) Timing and Location of Nicotinic Activity Enhances or Depresses Hippocampal Synaptic Plasticity. Neuron 31: 131-141


Kassam SM, Herman PM, Goodfellow NM, Alves NC, Lambe EK (2008) Developmental Excitation of Corticothalamic Neurons by Nicotinic Acetylcholine Receptors. J. Neurosci. 28: 8756-8764



Kawai H, Lazar R, Metherate R (2007) Nicotinic control of axon excitability regulates thalamocortical transmission. Nat Neurosci

Kubota Y, Hatada S, Kondo S, Karube F, Kawaguchi Y (2007) Neocortical inhibitory terminals innervate dendritic spines targeted by thalamocortical afferents. J Neurosci 27: 1139-50


Larkum ME, Zhu JJ, Sakmann B (1999) A new cellular mechanism for coupling inputs arriving at different cortical layers. Nature 398: 338-341

Larkum ME, Zhu JJ, Sakmann B (2001) Dendritic mechanisms underlying the coupling of the dendritic with the axonal action potential initiation zone of adult rat layer 5 pyramidal neurons. J Physiol 533: 447-466

Le Be JV, Markram H (2006) Spontaneous and evoked synaptic rewiring in the neonatal neocortex. Proc Natl Acad Sci U S A

Le Be JV, Silberberg G, Wang Y, Markram H (2006) Morphological, Electrophysiological, and Synaptic Properties of Corticocallosal

103


Pyramidal Cells in the Neonatal Rat Neocortex. Cereb Cortex Levin E, McClernon F, Rezvani A (2006) Nicotinic effects on cognitive

function: behavioral characterization, pharmacological specification, and anatomic localization. Psychopharmacology 184: 523-539

Mansvelder HD, van Aerde KI, Couey JJ, Brussaard AB (2006) Nicotinic modulation of neuronal networks: from receptors to cognition. Psychopharmacology: 1-14

Marklund P, Fransson P, Cabeza R, Petersson KM, Ingvar M, Nyberg L (2007) Sustained and Transient Neural Modulations in Prefrontal Cortex Related to Declarative Long-Term Memory, Working Memory, and Attention. Cortex 43: 22-37

McBain CJ, Fisahn A (2001) Interneurons unbound. Nat Rev Neurosci 2: 11-23

Pouille F, Scanziani M (2001) Enforcement of Temporal Fidelity in Pyramidal Cells by Somatic Feed-Forward Inhibition. Science 293: 1159-1163

Reyes A, Lujan R, Rozov A, Burnashev N, Somogyi P, Sakmann B (1998) Target-cell-specific facilitation and depression in neocortical circuits. Nat Neurosci 1: 279-85


Spruston N (2008) Pyramidal neurons: dendritic structure and synaptic integration. Nat Rev Neurosci 9: 206-221


Wang Y, Markram H, Goodman PH, Berger TK, Ma J, Goldman-Rakic PS (2006) Heterogeneity in the pyramidal network of the medial prefrontal cortex. Nat Neurosci 9: 534-542

Wang Y, Toledo-Rodriguez M, Gupta A, Wu C, Silberberg G, Luo J, Markram H (2004) Anatomical, physiological and molecular properties of Martinotti cells in the somatosensory cortex of the juvenile rat. J Physiol (Lond) 561: 65-90

Xiang Z, Huguenard JR, Prince DA (1998) Cholinergic Switching Within Neocortical Inhibitory Networks. Science 281: 985-988

104

Chapter V

General Discussion:Toward an Understanding of Nicotinic Receptors in the Cortex

Jonathan Jay Couey & Huibert D. Mansvelder

105

Abstract: Neocortical nicotinic receptors play a vital role in the cognitive processes attention and working memory. While their molecular function is well-described, the contribution of nAChRs at the cellular circuit level is still poorly understood. This chapter seeks to place nAChR function within the context of a generic cortical microcircuit. General stereotypy in the arrangement of nAChRs within the architecture of cortical circuits among conspecifics and across species suggests a general role for nAChRs in cortical function. We hypothesize that differences in nAChR expression are a direct correlate of how thalamic information is differentially processed in any given cortical area. We propose that by altering how thalamic signals enter the cortex and which interneurons play a more dominant role, nAChRs can alter how cortical microcircuits process incoming information. Exploring differences in nAChR expression between cortical networks will provide clues central to understanding how thalamic information is differentially processed throughout the neocortex and ultimately to how nAChRs can enhance cognitive processing.

106

Chapter V

IntroductionThe large body of evidence demonstrating that nAChRs can affect

cognitive processes offers an enticing chance to link protein function to complex behaviour (Levin et al. 2006; Mansvelder et al. 2006; Picciotto 2003). However, there are several bridges yet to be built. On one hand as ligand-gated ion channels, nAChRs are functionally well understood (McGehee 1999). The functions of the individual elements of the cortex, including pyramidal cells and various classes of interneurons, are also well described (Markram et al. 2004). Thus, how nAChRs can contribute to individual neuronal function has been explored in several experimental paradigms. On the other hand, the function of the neocortex as a cell ensemble is relatively undefined, making it as yet difficult to place nAChR function into a proper physiological context beyond that of a single neuron. The laminar organization of the cells in the neocortex has been studied in fine detail by anatomists already for more than 100 years, and several aspects of neocortical microstructure imply a general recurrent wiring diagram might underlie its functions (Douglas and Martin 2004; Douglas and Martin 2007; Kozloski et al. 2001; Silberberg et al. 2002). However, the physiological correlates of these anatomical patterns at the cellular level remain enigmatic. There is also compelling evidence that thalamic inputs play a large role in determining the architecture of the cortex (Roe et al. 1990). This chapter seeks to place nAChR activation into the context of functional cortical microcircuits, and explores the possibility that they might play a similar role in many cortical areas.

There are two main mechanisms by which nAChRs can alter cortical circuit function. First, nAChRs expressed in axons or axon terminals can alter release of neurotransmitter at specific sites, even independent of action potential depolarization. This often results in an increased probability of release at these sites, changing how the information carried by these synapses enters and is processed by the cortex. Secondly, nAChRs can alter whole neuron functions by altering resting membrane potentials (via Na, K, and Ca current flow). These nicotinic currents can drastically alter the availability of Na and K channels available for action potential generation (through

107

General Discussion

inactivation), affect resting membrane potential (depolarization), and even potentially alter regional voltage signals via shunting. Taking these cellular mechanisms into account will be central to understanding nicotine’s effects on higher cognitive functions. This chapter will look to various cortical regions as representative neocortical arrangements and attempt to assess the literature to map the location and function of nAChRs in these areas. We argue that these arrangements are quite similar, and that this arrangement is likely to be a universal cortical wiring principle.

The thalamus and the neocortex One central problem currently confronting neuroscience is to explain how relevant processes in distant neocortical regions (as well as subcortical) are combined to produce conscious thought. This has been termed the ‘binding problem’. There is now ample evidence supporting a dual role for the thalamus in brain function, and this dual role could provide a mechanism explaining how binding is accomplished. More than just a relay station for inbound sensory information, recent data indicates that the thalamus is a central structure in the synchronization of cortical activity, especially across cortical regions, during conscious thought (Edward 2002). This mechanism has been proposed to underlie not only sensory processing and consciousness, but learning itself (Gilbert 2001; Grossberg and Versace 2008). For quite some time, interactions between the cortex and the thalamus have been known to induce synchronous activity, and this is thought to be a neural correlate of conscious state (McCormick and Bal 1997). While this idea has been around for some time, the anatomical evidence for this has only more recently been delineated. The thalamus contains two populations of cells projecting to different cortical layers with differing specificity (Jones 2001). These two cell populations and their projection patterns may provide the anatomical basis by which the thalamus coordinates cortical activation and synchronization. Furthermore, this concept is compelling as an explanation for why the higher cortical areas involved in attention have such rich thalamic projections, despite their indirect role in sensory processing. It could be that attention is simply

108

Chapter V

the synchronization between specific cell ensembles in the sensory cortices with those in higher order cortical areas like the PFC. As we will outline below, because nAChRs are so often associated with various aspects relating to thalamic information throughout the cortex, we hypothesize that their role in cortical function could be central to understanding how the thalamus and cortex interact.

Sensory processing One of the main functions of the neocortex is of course the processing of sensory information from the thalamus. There is a great deal of evidence which suggests that nAChRs play a key role in regulating the transmission of thalamic information to the cortex (Metherate 2004). Certainly anatomical data point to a major role for nAChRs in regulating thalamic synapses (Clarke 2003). Neocortical inhibitory synapses are often in direct opposition to thalamocortical synapses which implies an intimate connection between thalamic activation of the cortex and internal inhibition (Kubota et al. 2007). There is also overwhelming physiological evidence. Transdermal administration of nicotine to non-smokers does not affect cochlear activity but does affect the neural transmission of acoustic information (Harkrider et al. 2001). A similar result was observed in the rat auditory cortex (Liang et al. 2008). Critically, in this study antagonists of nAChRs reduced the evoked signal in the cortex, suggesting that endogenous ACh acts through nAChRs to regulate thalamic transmission. The barrel cortex of the rat is perhaps the best studied model of thalamocortical transmission, and here too nicotinic agonists can alter cortical processing. Topical application of nicotinic agonist to the exposed cortex in-vivo increased the size of a whisker’s function representation in the cortex (Silke Penschuck 2002). Earlier patch recordings made in thalamocortical slices from the barrel cortex support this result by demonstrating that thalamic synapses, unlike intracortical synapses, are modulated by nAChRs (Gil et al. 1997). Even in the visual cortex, nicotine can increase responsiveness to visual stimuli (Disney et al. 2007; Lawrence et al. 2002). Although the prefrontal cortex is thought to be a higher order

109

General Discussion

processing area, it receives thalamic input from the dorsal medial nucleus of the thalamus. Thalamocortical transmission to the PFC is also enhanced by nicotine (Gioanni et al. 1999). Lesioning this region of the thalamus abolishes nicotine’s effects on spontaneous glutamate release onto layer V pyramids in the rat (Lambe et al. 2003). Neonatal subplate neurons under layer VI are thought to direct the development of thalamic wiring in the cortex, and these cells express nAChRs as well (Hanganu and Luhmann 2004). In line with this, developmental irregularities associated with nAChRs have been shown to have a critical time window (Aramakis et al. 2000). Taken as a whole, these results combine to suggest a general role for nAChRs in the gating of thalamic inputs to the entire neocortex. Placing nAChRs into the context of what we know about cortical circuitry will help us to understanding the cellular basis for this modulation, and how these effects contribute to nicotine’s effects on attention and working memory.

Principle cells and nAChRs Pyramidal cells in both superficial (layer II/III) and deeper layers (V/VI) of the neocortex, as well as those in the hippocampus, have a similar structure with apical dendrites projecting up from the soma toward the molecular layer. Their dendritic compartments have been shown to function independently in processes like spike timing dependent plasticity (Froemke et al. 2005). This functional morphology suggests that these cells are responsible for integrating information arriving in and originating from multiple layers. Subclasses of layer V pyramidal cells have also been defined around their apical dendritic morphology and these definitions have been shown to correlate with their cortical and subcortical axonal targets (Molnar and Cheung 2006). Understanding how nAChRs can affect the function of these cells is essential to understanding nicotine’s effects on cognition; however, the task is significantly more complicated. While so many aspects of pyramidal cell function are well described, nAChRs are rarely found on pyramidal cells in the cortex (Couey et al. 2007; Gulledge et al. 2007). A recent study has found nAChRs on layer VI pyramidal cells; however, this is not in opposition

110

Chapter V

to our hypothesis (Kassam et al. 2008). This specific population represents pyramidal cells projecting back to the thalamus. Despite the fact that nAChRs are rarely found on pyramidal cells, nicotine can still affect their function in many ways. We have previously mentioned that in the mouse PFC, thalamic inputs to layer V pyramidal cells are enhanced by nicotinic stimulation (Lambe et al. 2003). This might serve to alter the balance between intracortical and thalamic information by increasing gain on a specific input stream.

Synaptic plasticity in pyramidal cells is thought to be critical in cognitive processing, and is also thought to play a major role in the developmental organization of microcircuits and memory formation. Because pyramidal cells can form literally thousands of synapses, synapse specific modulation of connection strength is critical to their function. Spike timing dependent plasticity (STDP) is now the consensus mechanism by which pyramidal cells regulate synaptic strength (Kampa et al. 2007; Markram et al. 1997). Our recent work demonstrated that STDP in layer V pyramidal cells can be altered by nicotine application (Couey et al. 2007). STDP was blocked by nicotine application, and this effect was reversed by the GABAa antagonist gabazine. This finding was extended to show that calcium signalling in the pyramidal cell was reduced by nicotine via these GABAergic inputs, raising the level of post-synaptic activity necessary to induce STDP.

Similar phenomenon also appear in the hippocampus (Ji and Dani 2000; Ji et al. 2001) However, there are some indications that pyramidal cells there may also express nAChRs (Nakauchi et al. 2007; Sudweeks and Yakel 2000). While the mechanism of disinhibition might be used in both cortical and hippocampal circuits, the role played by nAChRs in the two areas is likely to be somewhat different (Ge and Dani 2005). Still, most of these studies directly or indirectly implicate inhibitory neurons in the effects observed in pyramidal cells. Thus, nicotine alters the balance between excitation and inhibition in the cortex by not only altering the strength of the incoming thalamic information, but also by acting via inhibition to alter processing within the neocortical microcircuit.

111

General Discussion

Interneurons and nAChRs Inhibitory neurons of the neocortex comprise a comparatively more diverse population of cells than the excitatory cells. This is apparent already in early development. The principle excitatory cells of the cortex all arise locally from the dorsal ventricular zone of the developing embryo, and to organize locally to form the columns visible in young neocortex. In contrast, interneuron subtypes have their origin in developing subcortical regions (Foldy et al. 2005) in the ventral portion of the embryo and migrate long distances to reach their final destination. There is now some general consensus on how interneurons in the cortex can be classified (Kawaguchi 1993; Kawaguchi and Kondo 2002; Markram et al. 2004). At least two types of interneuron are recognized to be morphologically and functionally distinct classes: fast spiking cells (FS) and low-threshold spiking cells (LTS) (Gupta et al. 2000; Kawaguchi and Kubota 1996; Wang et al. 2002). Fast spiking cells (FS) are physiologically equipped for high frequency firing, show little adaptation, and have been shown to synapse on or near the somata of their target cells (Angulo et al. 2003; Gonzalez-Burgos et al. 2005; Kawaguchi and Kondo 2002; Kawaguchi and Kubota 1998). As such, they occupy an ideal functional and morphological position to regulate the input window of pyramidal cells (Klyachko and Stevens 2006). At least one studying the somatosensory cortex has demonstrated this functional position for FS cells (Sun et al. 2006). Their functional role also appears to extend to regulating plasticity in this microcircuit (Bacci and Huguenard 2006). Their abundance in layer 4 of somatosensory cortex also seem to indicate their importance to regulating specifically thalamic inputs (Beierlein et al. 2000). This association with thalamic inputs has also been confirmed in the PFC (Rotaru et al. 2005). Our recent data from the PFC indicate that excitatory inputs to FS cells are modulated by nicotine, and this might be an indication that thalamic inputs terminate onto both pyramids and FS cells here in a similar fashion as was reported in the barrel cortex (Couey et al. 2007). While there is some disagreement as to whether this class of cell expresses nAChRs, this discrepancy appears to be species specific. Studies

112

Chapter V

in rodents have failed to find nAChRs on FS cells in the cortex (Couey et al. 2007; Gulledge et al. 2007). In contrast, in at least one study FS cells in human cortex appear to express nAChRs (Krenz et al. 2001). FS cells appear to be important in regulating the precise timing of information coming into the cortex, and there is emerging consensus evidence that LTS interneurons play a role in shaping feedforward inhibition between excitatory cells (Kapfer et al. 2007; Silberberg and Markram 2007). Like FS cells, LTS cells target specific dendritic subdomains of their target pyramids. In contrast to FS cells which are thought to regulate target cell activation and activity, LTS

cells appear to regulate specific inputs to pyramidal cell apical dendrites, as well as mediating interlaminar feedforward inhibition in the cortex. These interneurons express large nicotinic currents, and excitatory input to these cells is also enhanced by nicotine (Couey et al. 2007; Gulledge et al. 2007; Xiang et al. 1998). We have recently demonstrated that nAChRs play an important role in shaping the activity of these cells in the context of this

A B

Figure 1. Cortical circuit changes due to nAChR activation. A Under normal circumstances when nAChRs are not activated, thalamic inputs arrive in the cortex at both FS interneurons and pyramidals cells (circuit 1). Activa-tion of a pyramidal cell must occur before or at the same time as activation of the FS cell, or the inhibition from the FS cell will prevent the activation of the pyramidal cell. Activated presynaptic pyramids can inhibit their neighbors at their apical dendrites via a feedforward inhibitory loop mediated by LTS interneurons (circuit 2). B In the presence of nicotine or nicotinic agonists, modulated elements of the cortical circuit are highlighted in red. Glutamate release at both the pyramidal cell and FS cell are enhanced, increasing the weight of incoming thalamic information. At the same time, LTS cells begin to tonically fire, dampening inputs at the apical dendrites of post synaptic pyramidal cells, while remaining available for activation by presynaptic activated pyramids.

113

General Discussion

functional feedforward microcircuit (see Chapter 4).The general importance of interneurons in regulating the processing of

thalamic information was highlighted recently by a detailed anatomical study showing that inhibitory synapses tend to oppose thalamocortical synapses in the cortex (Kubota et al. 2007). This picture is further complicated by the fact that both of these interneuron populations form electrically coupled networks amongst themselves (Beierlein et al. 2000). How this coupling contributes to their functional role in the neocortex has yet to be fully explored. However, an activated network of LTS cells would certainly drastically alter the computational properties of the cortical microcircuit given what we now know about their role in feedforward inhibition.

Proposed model of nAChR function in the cortex We have identified two key microcircuits at which we propose nAChRs can regulate the processing of thalamic information. One of these is comprised of a pyramidal cell and an FS interneuron. By increasing the release probability at thalamic synapses at both cell types, nAChRs are able to emphasize the precise selection of activated targets by assuring that both FS and pyramidal cells fire reliably in response to input (See figure, circuit 1). This parallel modulation also serves to balance the simultaneous enhanced activity at pyramidal thalamic synapses preventing over-excitation. This change is likely not only to enhance the reliability and accuracy of thalamic input, but also to shift the balance in favour of thalamic inputs versus other streams of incoming information (i.e. intracortical). When trying to extend this hypothesis to address the cognitive effects of nicotine, it is critical to note that we suggest this mechanism is present in all cortical areas. Nicotine’s cognitive effects would then stem from the sharpening of the responses both in sensory areas as well as in higher association areas like the PFC by enhancing thalamic control over both simultaneously. The second microcircuit regulated by nAChRs is a feedforward stream between pyramidal cells mediated by LTS interneurons. Activated pyramidal cells can inhibit their neighbors at the apical dendrite through these

114

Chapter V

interneurons (See Figure, circuit 2). This effect was illustrated in chapters three and four of this thesis. By altering the conductive properties of the apical dendrite, interneurons are able to raise the threshold of plasticity for synapses in this region of the pyramidal cells. This effect is dependent on the precise activation of inhibitory inputs to the pyramidal cell. We have also shown that nicotine can depolarize LTS cells, bringing them to fire tonically (Chapter 4, figure 4). This tends to weaken the apparent synaptic strength of the LTS to pyramidal cell connection. One might argue that this is evidence that the LTS cell is not the primary GABA source underlying the increase in plasticity threshold we observed in chapter 3. However, the data from chapter four clearly shows the synapse is still functional, and critically that the timing of this feedforward inhibition was not changed. Thus, it is likely the crucial contribution of this connection to the microcircuit remains intact. Rather, this tonic firing is probably part of the total shift in the cortex due to nAChR activation and is necessary to prevent over-excitation. This means that the net effect is not to alter feedforward inhibition, but to preserve it in light of the shift to nAChR modulated inputs. We know that in control conditions, the stronger synaptic strength will result in more GABA release, and thus a broader time window of inhibition. Activation of nAChRs would then act to sharpen the window of feedforward inhibition governed by these cells, again enhancing the fine processing of the circuit.

ConclusionsNicotine’s effects on cognition imply a vital role for nAChRs in cortical

function. As ligand-gated ion channels, their function within the context of a microcircuit can be ascertained more easily than their G-protein coupled counterparts, the muscarinic receptor. While there are studies which point to nAChRs in specifically the PFC as vital to nicotine’s effects on attention, these studies are not in contention with our hypothesis that nAChR regulation of thalamic input is universal in the neocortex. There is no doubt that in these studies, the systemic nicotine activated all the nAChRs in the brain. Rather, it might only be that changing the balance of excitation in particular

115

General Discussion

sensory regions was not adequately isolated by the experimental methods. An important caveat which has yet to be properly addressed in the cortex is the role of different subtypes of nAChRs. In the hippocampus, specific sources of GABA input to CA1 cells are modulated by different nAChR subtypes (Alkondon and Albuquerque 2001). It is likely that a similar arrangement exists in the cortex.

Perhaps the best experimental preparation for exploring the validity of the current hypothesis is the thalamocortical slice. There are several tested versions of this preparation, including somatosensory cortex (Agmon and Connors 1991), visual cortex (MacLean et al. 2006), and auditory cortex (Cruikshank et al. 2002). These preparations have already been used to demonstrate the important role interneurons play in determining how the cortex processes this incoming thalamic information (Cruikshank et al. 2007). Characterizing the processing of incoming thalamic information in the cortex, and specifically how this changes in nicotine, will shed light on how cortical processing differs between brain areas as well as what mechanisms are more universal in the cortex.

An interesting aspect of this discussion is that a deficit in sensory gating has been reported in schizophrenics, and nicotine has been shown to relieve this symptom of the disease. This has been offered as an explanation for the extraordinary high percentage of schizophrenics who smoke. Future work should also examine the possibility that the cognitive benefits associated with nicotine are likely are major factor in determining the success of smoking cessation regimes, and understanding its effects on cognition are likely to contribute positively to the refinement of these regimes.

The long range implications of the hypothesis that the main role of nAChRs in cortical circuits is one of regulating thalamocortical processing are two fold. On one hand, similarities between cortical areas will help to identify key organizing principles of the cortex relative to thalamic input. Characterizing common microcircuitry will enable models of generic microcircuits to be developed which can more directly address the question of how thalamic cortical activation occurs, how synchronization might arise,

116

Chapter V

and how these processes contribute to consciousness. On the other hand, differences in cortical wiring and nAChR expression will offer insight into how the various cortical microcircuits differ in reference to thalamic activation. These differences can then be used to explore how the cortex organizes and differentially processes the diverse sensory input it receives. We can also then start to imagine how one might address how thalamic input influences cortical development and differentiation.

117

General Discussion

ReferencesAgmon A, Connors BW (1991) Thalamocortical responses of mouse

somatosensory (barrel) cortexin vitro. Neuroscience 41: 365-379Alkondon M, Albuquerque EX (2001) Nicotinic Acetylcholine Receptor

alpha 7 and alpha 4beta 2 Subtypes Differentially Control GABAergic Input to CA1 Neurons in Rat Hippocampus. J Neurophysiol 86: 3043-3055

Angulo MC, Staiger JF, Rossier J, Audinat E (2003) Distinct Local Circuits Between Neocortical Pyramidal Cells and Fast-Spiking Interneurons in Young Adult Rats. J Neurophysiol 89: 943-953

Aramakis VB, Hsieh CY, Leslie FM, Metherate R (2000) A Critical Period for Nicotine-Induced Disruption of Synaptic Development in Rat Auditory Cortex. J. Neurosci. 20: 6106-6116

Bacci A, Huguenard JR (2006) Enhancement of spike-timing precision by autaptic transmission in neocortical inhibitory interneurons. Neuron 49: 119-30

Beierlein M, Gibson JR, Connors BW (2000) A network of electrically coupled interneurons drives synchronized inhibition in neocortex. 3: 904-910

Clarke PB (2003) Nicotinic modulation of thalamocortical neurotransmission. Prog. Brain Res. 145: 253-260

Couey JJ, Meredith RM, Spijker S, Poorthuis RB, Smit AB, Brussaard AB, Mansvelder HD (2007) Distributed Network Actions by Nicotine Increase the Threshold for Spike-Timing-Dependent Plasticity in Prefrontal Cortex. Neuron 54: 73-87

Cruikshank SJ, Lewis TJ, Connors BW (2007) Synaptic basis for intense thalamocortical activation of feedforward inhibitory cells in neocortex. Nat Neurosci 10: 462-8

Cruikshank SJ, Rose HJ, Metherate R (2002) Auditory Thalamocortical Synaptic Transmission In Vitro. J Neurophysiol 87: 361-384

Rotaru GB, Barrionuevo G, Sesack SR (2005) Mediodorsal thalamic afferents to layer III of the rat prefrontal cortex: Synaptic relationships to subclasses of interneurons. The Journal of Comparative Neurology 490: 220-238

Disney AA, Aoki C, Hawken MJ (2007) Gain Modulation by Nicotine in Macaque V1. Neuron 56: 701-713

Douglas RJ, Martin KAC (2004) Neuronal Circuits of the Neocortex. Annual Review of Neuroscience 27: 419-451

Douglas RJ, Martin KAC (2007) Mapping the Matrix: The Ways of

118

Chapter V

Neocortex. Neuron 56: 226-238Edward GJ (2002) Thalamic circuitry and thalamocortical synchrony.

Philosophical Transactions of the Royal Society B: Biological Sciences 357: 1659-1673

Foldy C, Dyhrfjeld-Johnsen J, Soltesz I (2005) Structure of cortical microcircuit theory. J Physiol 562: 47-54

Froemke RC, Poo M-m, Dan Y (2005) Spike-timing-dependent synaptic plasticity depends on dendritic location. 434: 221-225

Ge S, Dani JA (2005) Nicotinic Acetylcholine Receptors at Glutamate Synapses Facilitate Long-Term Depression or Potentiation. J. Neurosci. 25: 6084-6091

Gil Z, Connors BW, Amitai Y (1997) Differential Regulation of Neocortical Synapses by Neuromodulators and Activity. Neuron 19: 679-686

Gilbert PFC (2001) An outline of brain function. Cognitive Brain Research 12: 61-74


Gonzalez-Burgos G, Krimer LS, Povysheva NV, Barrionuevo G, Lewis DA (2005) Functional Properties of Fast Spiking Interneurons and Their Synaptic Connections With Pyramidal Cells in Primate Dorsolateral Prefrontal Cortex. J Neurophysiol 93: 942-953

Grossberg S, Versace M (2008) Spikes, synchrony, and attentive learning by laminar thalamocortical circuits. Brain Research 1218: 278-312

Gulledge AT, Park SB, Kawaguchi Y, Stuart GJ (2007) Heterogeneity of phasic cholinergic signalling in neocortical neurons. J Neurophysiol

Gupta A, Wang Y, Markram H (2000) Organizing Principles for a Diversity of GABAergic Interneurons and Synapses in the Neocortex. Science 287: 273-278

Hanganu IL, Luhmann HJ (2004) Functional Nicotinic Acetylcholine Receptors on Subplate Neurons in Neonatal Rat Somatosensory Cortex. J Neurophysiol 92: 189-198

Harkrider AW, Champlin CA, McFadden D (2001) Acute effect of nicotine on non-smokers: I. OAEs and ABRs. Hearing Research 160: 73-88


Ji D, Lape R, Dani JA (2001) Timing and Location of Nicotinic Activity

119

General Discussion

Enhances or Depresses Hippocampal Synaptic Plasticity. Neuron 31: 131-141

Jones EG (2001) The thalamic matrix and thalamocortical synchrony. Trends in Neurosciences 24: 595-601

Kampa BM, Letzkus JJ, Stuart GJ (2007) Dendritic mechanisms controlling spike-timing-dependent synaptic plasticity. Trends Neurosci


Kassam SM, Herman PM, Goodfellow NM, Alves NC, Lambe EK (2008) Developmental Excitation of Corticothalamic Neurons by Nicotinic Acetylcholine Receptors. J. Neurosci. 28: 8756-8764




Kawaguchi Y, Kubota Y (1998) Neurochemical features and synaptic connections of large physiologically-identified GABAergic cells in the rat frontal cortex. Neuroscience 85: 677-701

Klyachko VA, Stevens CF (2006) Excitatory and Feed-Forward Inhibitory Hippocampal Synapses Work Synergistically as an Adaptive Filter of Natural Spike Trains. PLoS Biol 4: e207

Kozloski J, Hamzei-Sichani F, Yuste R (2001) Stereotyped Position of Local Synaptic Targets in Neocortex. Science 293: 868-872

Krenz I, Kalkan D, Wevers A, de Vos RA, Steur EN, Lindstrom J, Pilz K, Nowacki S, Schutz U, Moser N, Witter B, Schroder H (2001) Parvalbumin-containing interneurons of the human cerebral cortex express nicotinic acetylcholine receptor proteins. J Chem Neuroanat 21: 239-46

Kubota Y, Hatada S, Kondo S, Karube F, Kawaguchi Y (2007) Neocortical inhibitory terminals innervate dendritic spines targeted by thalamocortical afferents. J Neurosci 27: 1139-50

120

Chapter V


Lawrence NS, Ross TJ, Stein EA (2002) Cognitive Mechanisms of Nicotine on Visual Attention. Neuron 36: 539-548

Levin E, McClernon F, Rezvani A (2006) Nicotinic effects on cognitive function: behavioral characterization, pharmacological specification, and anatomic localization. Psychopharmacology 184: 523-539

Liang K, Poytress BS, Weinberger NM, Metherate R (2008) Nicotinic modulation of tone-evoked responses in auditory cortex reflects the strength of prior auditory learning. Neurobiology of Learning and Memory 90: 138-146

MacLean JN, Fenstermaker V, Watson BO, Yuste R (2006) A visual thalamocortical slice. Nat Methods 3: 129-34

Mansvelder HD, van Aerde KI, Couey JJ, Brussaard AB (2006) Nicotinic modulation of neuronal networks: from receptors to cognition. Psychopharmacology: 1-14

Markram H, Lubke J, Frotscher M, Sakmann B (1997) Regulation of Synaptic Efficacy by Coincidence of Postsynaptic APs and EPSPs. Science 275: 213-215

Markram H, Toledo-Rodriguez M, Wang Y, Gupta A, Silberberg G, Wu C (2004) Interneurons of the Neocortical Inhibitory System. Nature Reviews Neuroscience

Nat Rev Neurosci 5: 793-807McCormick DA, Bal T (1997) Sleep and Arousal: Thalamocortical

Mechanisms. Annual Review of Neuroscience 20: 185McGehee DS (1999) Molecular Diversity of Neuronal Nicotinic

Acetylcholine Receptors. Annals of the New York Academy of Sciences 868: 565-577


Molnar Z, Cheung AF (2006) Towards the classification of subpopulations of layer V pyramidal projection neurons. Neurosci Res

Nakauchi S, Brennan RJ, Boulter J, Sumikawa K (2007) Nicotine gates long-term potentiation in the hippocampal CA1 region via the activation of nicotinic ACh receptors. European Journal of Neuroscience 25: 2666-2681

Picciotto MR (2003) Nicotine as a modulator of behavior: beyond the inverted U. Trends in Pharmacological Sciences 24: 493-499

121

General Discussion

Roe AW, Pallas SL, Hahm JO, Sur M (1990) A map of visual space induced in primary auditory cortex. Science 250: 818-820

Silberberg G, Gupta A, Markram H (2002) Stereotypy in neocortical microcircuits. Trends Neurosci 25: 227-30


Penschuck S, Chen-Bee CH, Prakash N, Frostig RD (2002) In vivo modulation of a cortical functional sensory representation shortly after topical cholinergic agent application. The Journal of Comparative Neurology 452: 38-50

Sudweeks SN, Yakel JL (2000) Functional and molecular characterization of neuronal nicotinic ACh receptors in rat CA1 hippocampal neurons. J Physiol 527: 515-528

Sun QQ, Huguenard JR, Prince DA (2006) Barrel cortex microcircuits: thalamocortical feedforward inhibition in spiny stellate cells is mediated by a small number of fast-spiking interneurons. J Neurosci 26: 1219-30


Xiang Z, Huguenard JR, Prince DA (1998) Cholinergic Switching Within Neocortical Inhibitory Networks. Science 281: 985-988

122

Functional Modulation of the Mouse Prefrontal Cortex by Nicotinic Acetylcholine Receptors

Summary

This dissertation addresses the role nicotinic acetylcholine receptors (nAChRs)dissertation addresses the role nicotinic acetylcholine receptors (nAChRs) play in cortical function. nAChRs are ligand gated ion channels that allow a nAChRs are ligand gated ion channels that allow a non-specific (K) cation current to flow across the cell membrane when gated by acetylcholine or the exogenous agonist nicotine. Activation of nAChRs by acetylcholine and nicotine has been linked to cortical functions important during attention and working memory. The whole cell patch clamp technique and two-photon calcium imaging were used to assess the cellular effects of their activation in an acute cortical slice preparation experimentally relevant to attention processing. Specific interneurons but not pyramidal cells in layer V (primary output layer) of the mouse prefrontal cortex were found to express ionic conductances activated by nicotine. The expression of nAChRs in these cells types was confirmed using single cell PCR to screen for the corresponding mRNA transcripts. Spontaneous excitatory and inhibitory inputs to these cell types are also differentially modulated by nicotine application. The main experimental finding of the present work demonstrates that activation of nAChRs in the PFC can alter the threshold required to engage the calcium dependent process spike timing dependent plasticity (STDP) in layer V pyramidal cells. In line with our initial data that nAChRs in the PFC are expressed predominantly by GABAergic interneurons, this nicotine induced change in pyramidal cell STDP and the underlying calcium signalling was dependent on GABA transmission. Finally, we used multiple whole cell recordings to measure interpyramidal connectivity and the strength of disynaptic feedforward inhibition between layer V pyramidal cells of the mouse PFC. Our results confirmed the existence of a feedforward inhibitory loop between layer V pyramidal cells in the mouse similar to that found in the rat and ferret, and demonstrated that activation of nAChRs on the interceding

123

interneuron can alter the strength of this feedforward loop. The present work has identified several cellular mechanisms by which nAChRs can alter PFC function. These processes are likely to be important to our understanding of the cognitive and addictive effects of nicotine, as well as the endogenous functional role of cortical nAChRs within the cholinergic system.

124

Functionele Modulatie van de Muis Prefrontale Cortex door Nicotinerge Acetylcholine Receptoren

Nederlandse Samenvatting Dit proefschrift beschrijft de rol die nicotinerge acetylcholine receptoren (nAChRs) spelen in het functioneren van de prefrontale cortex. nAChRs zijn ligand-gestuurde ionkanalen. Wanneer ze geopend worden door de endogeneWanneer ze geopend worden door de endogene agonist acetylcholine, of door de exogene agonist nicotine, laten nAChRs een non-specifieke kation stroom over het membraan lopen. Eerdere studies hebben aangetoond dat activatie van nAChRs door acetylcholine of nicotine een belangrijke rol speelt bij hersenfuncties als attentie en werkgeheugen. In dit proefschrift hebben wij een combinatie van de “whole-cell patch clamp” techniek en “two-photon calcium imaging” gebruikt, om de cellulaire effecten van nAChR activatie te onderzoeken in acute hersenplakken van het muizenbrein. WehebbenhierbijgekekennaarhersenplakkenvandeprefrontaleWe hebben hierbij gekeken naar hersenplakken van de prefrontale cortex (PFC), een hersengebied dat essentieel is voor de eerder genoemde hersenfuncties. In bepaalde interneuronen in laag V van de prefrontale cortex van de muis konden wij nicotine-geactiveerde ionstromen meten, terwijl pyramidaal cellen daarentegen geen ionstromen lieten zien. We hebben de expressie van nAChRs in deze interneuronen bevestigd met behulp van ‘single-cell PCR’, om te kijken naar de betreffende mRNA transcripten. SpontaneSpontane excitatoire en inhibitoire input naar deze cell typen werd ook gemoduleerd na toediening van nicotine. De belangrijkste experimentele bevinding van dit proefschrift is dat activatie van nAChRs in de PFC de drempelwaarde voor activatie van calcium afhankelijke synaptische plasticiteit kan veranderen in pyramidaal cellen in laag V. Deze verschuiving van de drempelwaarde was afhankelijk van GABAerge neurotransmissie, in overeenstemming met onze eerdere bevinding dat nAChRs voornamelijk voorkomen op GABAerge interneuronen. Ten slotte hebben we “whole cell” afleidingen van meerdere pyramidaal cellen tegelijkertijd gemaakt, om de connectiviteit tussen deze

125

cellen te bepalen, en om disynaptische “feedforward” inhibitie in kaart te brengen. Onze resultaten bevestigen het bestaan van eenzelfde inhibitoireOnze resultaten bevestigen het bestaan van eenzelfde inhibitoire ”feedforward” lus tussen laag V pyramidaal cellen van de muis als eerder geobserveerd in ratten en fretten. Bovendien laten we zien dat activatie van nAChRs op het tussenliggende interneuron de kracht van deze ‘feedforward’ lus kan veranderen. De studies beschreven in dit proefschrift beschrijven een aantal cellulaire mechanismen waarmee nAChRs de werking van de PFC kunnen beinvloeden. Het begrijpen van deze mechanismen is van fundamenteel belang voor ons begrip van de cognitieve en verslavende effecten van nicotine, alsook voor het begrijpen van de normale rol die corticale nAChRs spelen in het cholinerge systeem.

126

To the optimist, life is a series of opportunities;to the pessimist, a series of challenges.

Either way, these are at the heart of an interesting life.

In October 2002, an invitation to work and study in Amsterdam was an opportunity that I had never imagined. Yet it took me only a few days to decide to pack up and leave.

It was the best decision of my life.

Dankwoord:

To Veerle: Thank you for loving me for who I am. I know it hasn’t been easy, despite what the brochure said.

To Huib: You have given me an indescribable gift, for which there are no words of gratitude suitable or adequate. In the Lonely Planet guide you gave me when I first accepted the position, you wrote: “Four years…science and city!” Needless to say, it has been a hell of a lot more than that.

To Arjen, Guus, and Sabine: Thank you for the guidance, advice, support, and hard work you have contributed to the completion of this thesis.

To my reading committee, Dan, Ole, Christian, and Rhiannon: Thank you for your critical reading and comments on this work, and of course for supporting my promotion.

To (Super) Hans: You are the heart of the laboratory as I know it…a true juggernaut of knowledge, skill, and wisdom whose hands lifted each of us up at the start, and upon whose shoulders we all have stood to reach higher until the very end.

To Jur: Thank you. It is a privilege to know you and call you my friend.

To Eisuke: You are my brotha’ from anotha’ motha’. Dr. Dan K. is now in the house!

To Henri: You know what I want to say without me saying it. Thanks for everything.

To Hadi: You are perhaps the finest example of a gentleman I know. Your modesty and humility are examples I will spend my life trying to equal.

127

To Rhi, Carl, Rogier, Tim, Karlijn, Keimpe, and the rest of the gang who had to put up with me for longer than a few weeks: Thanks for your humor, your tolerance of my many moods, and for making Amsterdam so easy to call home.

To Nail: Thank you for all the stories and wild tales, for the wise advice regarding the respect of my peers, and for teaching me that to smoke a pipe is the ultimate in cool.

To Henry, Raphael, Thomas, Rodrigo, Sonia, Tania, Jean-Vincent, Michele, Luca, Guilherme and Sandrine in Lausanne (CH): Thanks for everything. I will remember my short time with all of you well and fondly. I wish you all the best in the future, and hope we will see each other again soon.

To Jim Jensen: Thank you for nurturing in me an insatiable curiosity for all things biological. You really are the best teacher I have ever had.

To Khaled: Thank you for trusting your instincts and hiring an out of work bartender/teacher. I am forever in your debt.

To Ruth: You were my first real friend in Amsterdam, and a big part of what was and is Amsterdam for me. I am sorry we have not kept in better contact and hope that will change in the future.

To Pierre, Carlo, Bram, Lars, Paul, and all the Dutch fliers I have come to call my friends: Are we going to the Hei this weekend or what?

To Nathan and Anne, Amy and Duane, Robb and Jennifer, Jimmy, Matt, and the rest of the Northside crew, who handed Big Whiskey a bucket whenever he needed it, and supported his decision to leave Chicago to do this: Thank you for your friendship. I miss each of you dearly. Please know that a part of this work belongs to all of you.

And to my family…Mom, Dad, Robby, and Jane: No matter who I have been, tried to be, or hoped to become, and no matter where I have lived or how long I have stayed away, you have always been there for me. I love you with all my heart.

128

About the Author

J. Jay Couey was born on January 28, 1972 in Chippewa Falls, WI (USA). He did his undergraduate and master’s studies at DePaul University in Chicago where he majored in biology with hopes of attending medical school. These plans did not work out. After working briefly as an operating room pharmacy technician, Jay found himself teaching high school biology, chemistry, and physics while bartending on the side. Four years later in 2000, after answering an advertisement looking for “someone with microscope experience”, Jay

took a technician position at the University of Chicago in the lab of Khaled Houamed. The laboratory’s focus was small conductance (SK or KCNN) potassium channels, and it was in Khaled’s lab that Jay first learned many of the techniques used in this thesis, including whole cell patch clamp.

Serendipitously, the laboratory next door was that of Dan McGehee, where at the time, Huibert Mansvelder was working as a post-doc. After Huib moved back the Netherlands to take a position in the lab of Arjen Brussaard, Jay was invited for an interview with the group in October 2002. One month later on November 17th, Jay moved to Amsterdam to begin the work described in this thesis.

While working at the VU, Jay Google™-ed and eventually fell in love with another Ph.D. student, and they married in July 2007. He and Veerle currently live in Trondheim with their two dogs, where Jay is working as a post-doc with Menno Witter at the NTNU-Kavli Institute for Neuroscience. His current work focuses on using multiple cell patch clamp to describe the functional microcircuitry in the entorhinal cortex.

In his spare time, Jay is a semi-professional competitive stunt kite pilot. He rose to be ranked among the top 20 in the Benelux kite circuit during 2007 (his debut season), and he is currently ranked number 1 in the Trøndelag region of Norway.

129

Bibliography

Couey JJ, Markram H, Mansvelder HD. Disynaptic inhibition between layer V pyramidal cells in the PFC is modulated by nicotine. (Manuscript in Preparation.)

Couey JJ, Meredith RM, Spijker S, Poorthuis RB, Smit AB, Brussaard AB and Mansvelder HD. Distributed Network Actions by Nicotine Increase the Threshold for Spike-Timing-Dependent Plasticity in Prefrontal Cortex. Neuron. 2007 Apr 5;53(7).

Mansvelder HD, van Aerde KI, Couey JJ, Brussaard AB. Nicotinic modulation of neuronal networks: from receptors to cognition. Psychopharmacology (Berl). 2006 Mar;184(3-4):292-305.

Additional publications not in this thesis:

de Kock CP, Cornelisse LN, Burnashev N, Lodder JC, Timmerman AJ, Couey JJ, Mansvelder HD, Brussaard AB. NMDA receptors trigger neurosecretion of 5-HT within dorsal raphe nucleus of the rat in the absence of action potential firing. J Physiol. 2006 Dec 15;577(Pt 3):891-905.

Chakravarthy S, Saiepour MH, Bence M, Perry S, Hartman R, Couey JJ, Mansvelder HD, Levelt CN. Postsynaptic TrkB signaling has distinct roles in spine maintenance in adult visual cortex and hippocampus. Proc Natl Acad Sci U S A. 2006 Jan 24;103(4):1071-6. Cao YJ, Dreixler JC, Couey JJ, Houamed KM. Modulation of recombinant and native neuronal SK channels by the neuroprotective drug riluzole. Eur J Pharmacol. 2002 Aug 2;449(1-2):47-54. Couey JJ, Ryan DP, Glover JT, Dreixler JC, Young JB, Houamed KM. Giant excised patch recordings of recombinant ion channel currents expressed in mammalian cells. Neurosci Lett. 2002 Aug 23;329(1):17-20.

Functional Modulation of the Mouse Prefrontal Cortex by ... dissertation.pdf · Nicotinic...

Documents

Transcript of Functional Modulation of the Mouse Prefrontal Cortex by ... dissertation.pdf · Nicotinic...