APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Oct. 2008, p. 6385–6396 Vol. 74, No. 200099-2240/08/$08.00�0 doi:10.1128/AEM.01185-08Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Functional Expression and Subcellular Localization of the AflatoxinPathway Enzyme Ver-1 Fused to Enhanced Green

Fluorescent Protein�†Sung-Yong Hong1 and John E. Linz1,2,3,4*

Department of Food Science and Human Nutrition,1 National Food Safety and Toxicology Center,2 Department ofMicrobiology and Molecular Genetics,3 and Center for Integrative Toxicology,4 Michigan State University,

East Lansing, Michigan 48824

Received 28 May 2008/Accepted 14 August 2008

Aflatoxin, a mycotoxin synthesized by Aspergillus spp., is among the most potent naturally occurring car-cinogens known. Little is known about the subcellular organization of aflatoxin synthesis. Previously, we usedtransmission electron microscopy and immunogold labeling to demonstrate that the late aflatoxin enzymeOmtA localizes primarily to vacuoles in fungal cells on the substrate surface of colonies. In the present work,we monitored subcellular localization of Ver-1 in real time in living cells. Aspergillus parasiticus strain CS10-N2was transformed with plasmid constructs that express enhanced green fluorescent protein (EGFP) fused toVer-1. Analysis of transformants demonstrated that EGFP fused to Ver-1 at either the N or C terminusfunctionally complemented nonfunctional Ver-1 in recipient cells. Western blot analysis detected predomi-nantly full-length Ver-1 fusion proteins in transformants. Confocal laser scanning microscopy demonstratedthat Ver-1 fusion proteins localized in the cytoplasm and in the lumen of up to 80% of the vacuoles in hyphaegrown for 48 h on solid media. Control EGFP (no Ver-1) expressed in transformants was observed in only 13%of the vacuoles at this time. These data support a model in which middle and late aflatoxin enzymes aresynthesized in the cytoplasm and transported to vacuoles, where they participate in aflatoxin synthesis.

Aflatoxins (AF) are toxic and carcinogenic secondary me-tabolites synthesized primarily by the filamentous fungi As-pergillus parasiticus and Aspergillus flavus when they grow oneconomically important food and feed crops, including pea-nuts, tree nuts, corn, and cottonseed (5, 11, 12, 28, 33). AFcontamination of food and feed results in large economiclosses and significant human and animal health risks (7, 14).AF biosynthesis is a complex process that requires at least 17enzyme activities encoded by 26 or more individual genes;these are clustered within a 70-kb region on one chromosome(42, 43). The biochemistry and molecular biology of AF syn-thesis have been studied intensively, but little is known aboutthe subcellular organization of the AF pathway. Several en-zyme activities involved in AFB1 biosynthesis were detected ina microsomal fraction (4, 19, 41), suggesting membrane local-ization; other activities were found in the cytoplasm or looselybound to membranes (4, 19, 35, 41).

Previously, we used immunogold labeling and transmissionelectron microscopy (TEM) to refine the localization analysis(21). Early (Nor-1), middle (Ver-1), and late (OmtA) AF bio-synthetic pathway enzymes were observed primarily in the cy-toplasm of fungal colonies grown 24 to 48 h on a solid, AF-inducing medium. However, OmtA also was detected primarilyin vacuoles in cells near the substrate surface of fungal colonies

on solid media; we observed very little Nor-1 or Ver-1 in thislocation, and these proteins were not detected in vacuoles.

ver-1 encodes a 28-kDa NADPH-dependent reductase in-volved in conversion of versicolorin A (VA) to demethylsterig-matocystin (15, 17, 37). Only one (ver-1A) of the two copies ofver-1 (ver-1A and ver-1B) in A. parasiticus SU-1 encodes afunctional enzyme (24). In strain CS10-N2, both ver-1 genesare nonfunctional; this strain accumulates VA. VA and late AFpathway intermediates possess a bisfuran ring. The doublebond in this structure is highly susceptible to 8,9-epoxide for-mation; this mutagenic and genotoxic compound can generateadducts with DNA and protein (29). We hypothesized thatearly AF biosynthetic pathway enzymes function in the cyto-plasm, whereas middle and late pathway enzymes function invacuoles to protect cells from the toxicity associated with VAand late AF pathway intermediates.

In the present work, we developed an enhanced green flu-orescent protein (EGFP) reporter system as an independentmethod to test our hypothesis. These data support a model inwhich middle and late AF enzymes are synthesized in thecytoplasm and transported to vacuoles, where they participatein AF synthesis.

MATERIALS AND METHODS

Fungal strains and culture conditions. A. parasiticus NR-1 (carrying niaD,which encodes nitrate reductase), used as the recipient for control plasmidsexpressing EGFP (i.e., carrying the niaD selectable marker), was derived from A.parasiticus NRRL 5862 (SU-1 [ATCC 56775]) (18). A. parasiticus CS10-N2 (ver-1niaD pyrG wh-1) (kindly provided by P.-K. Chang, USDA/ARS Southern Re-gional Research Center), used as the recipient strain for plasmids expressingEGFP fused to Ver-1 (carrying niaD), was derived from A. parasiticus CS10(ver-1 pyrG wh-1) (3, 20, 38, 39). A. parasiticus was cultured in YES liquidmedium (2% yeast extract, 6% sucrose [pH 5.8]) or YES plus 20 mM uracil

* Corresponding author. Mailing address: Department of Food Sci-ence and Human Nutrition, 234B GM Trout Building, Michigan StateUniversity, East Lansing, MI 48824. Phone: (517) 355-8474. Fax: (517)353-8963. E-mail: jlinz@msu.edu.

† Supplemental material for this article may be found at http://aem.asm.org/.

� Published ahead of print on 29 August 2008.

6385

on August 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

on A

ugust 8, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

on August 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

(YES20) at 30°C in the dark with shaking at 150 rpm (batch fermentation) forgenomic DNA isolation, for total protein extraction, to measure mycelial dryweight, and to analyze EGFP fluorescence and AF concentration as describedpreviously (25, 39). Either Czapek-Dox (CZ; Difco Laboratories, Detroit, MI)supplemented with 1% peptone or YES liquid medium was used to grow therecipient strain NR-1 for transformation. Potato dextrose broth (PDB; DifcoLaboratories, Detroit, MI) supplemented with 20 mM uracil (PDB20) was usedto grow the recipient strain CS10-N2 for transformation (39). CZ agar supple-mented with 20% sucrose and CZ agar containing 20% sucrose and 20 mMuracil, (CZ20) and Cove’s trace element solution (13) were used as selectivemedia for transformants of strains NR-1 and CS10-N2, respectively. Coconutagar medium plus 20 mM uracil (CAM20) was used to screen AF accumulationin CS10-N2 transformants under UV light at 365 nm (8) and for EGFP expres-sion in transformants (fluorescence microscopy). We conducted CLSM analysisof fungal colonies grown on YES or YES20 agar blocks (slide culture). Fungalcolonies grown on YES20 agar (1.5% agar) were extracted to generate AF andAF intermediates from transformants for thin-layer chromatography (TLC) andenzyme-linked immunosorbent assay (ELISA) analyses. Either potato dextroseagar (Difco Laboratories, Detroit, MI) or CZ20 was used for conidiosporepreparation (37).

Construction of pAPGFPVNB. The expression plasmid pAPGFPVNB (Fig. 1)was constructed using the ver-1 promoter and terminator fragments, an egfp genefragment, and pNANG-3 (27) as a plasmid backbone. The 0.6-kb ver-1 promoterand 2.1-kb ver-1 terminator fragments were generated by PCR with Pfu DNApolymerase (Stratagene, La Jolla, CA), appropriate primers, and cosmid NorA(24) as a template using standard procedures (26). See Table 1 for all primersequences. The 0.7-kb egfp gene was generated by PCR using pEGFP-N1 (Clone-tech Laboratories, Palo Alto, CA) as a template. PCR was performed in a GeneAmp PCR system 2400 thermal cycler (Perkin-Elmer Life Sciences Inc., Boston,MA). The reaction conditions were as follows: 94°C for 5 min followed by 25cycles of 94°C for 1 min, annealing for 1 min (see Table 1 for annealing tem-peratures), and extension at 72°C (time dependent on PCR fragment size: 2min/1 kb). The reaction was completed with a final extension at 72°C for 10 min.The PCR fragments were digested with appropriate restriction enzymes andcloned into pNEB-N1 (27), resulting in pGFPV. DNA fragments were subclonedfrom pGFPV into pNANG-3 (27), resulting in pAPGFPVNB1. The ver-1 pro-moter and egfp gene fragments in pAPGFPVNB1 were replaced with modifiedver-1 promoter and modified egfp gene fragments to generate pAPGFPVNB2and -3 (Table 1).

Construction of plasmids expressing EGFP fused to Ver-1. pAPGFPVNB3served as the plasmid backbone. To express EGFP fused to the C terminus ofVer-1, a 2.0-kb ver-1 promoter/gene fragment was generated by PCR with PfuDNA polymerase, appropriate primers, and cosmid NorA (24) as a template(26). PCR conditions similar to those for pAPGFPVNB3 were used (Table 1).PCR fragments digested with PacI and NotI were cloned into pAPGFPVNB3(Fig. 1) cut with the same enzymes, resulting in pAPCGFPVFNB (see Fig. 3). Toexpress EGFP fused to the N terminus of Ver-1, a 0.9-kb ver-1 gene fragment wasgenerated by PCR with Pfu DNA polymerase, appropriate primers, and cosmidNorA (24) as a template using standard procedures (26). The 0.7-kb egfp genefragment was generated by PCR with Pfu DNA polymerase and appropriateprimers using pEGFP-N1 as a template. PCR fragments were cloned into the

SmaI site of pUC19, resulting in pUCGFP and pUCVER. DNA fragmentscontaining the ver-1 gene were subcloned from pUCVER into pUCGFP cut withSgfI and SalI, resulting in pUCGFPVER. DNA fragments containing the gfpgene and the ver-1 gene were then subcloned from pUCGFPVER intopAPGFPVNB3 (Fig. 1) cut with NotI and FseI, resulting in pAPNGFPVFNB.

Transformation of A. parasiticus: screening of NR-1 and CS10-N2 transfor-mants. Transformation of A. parasiticus NR-1 with pAPGFPVNB and CS10-N2with pAPCGFPVFNB or pAPNGFPVFNB was performed by a polyethyleneglycol method (30) with minor modifications as described previously (38). NR-1transformants were screened for EGFP under a Nikon Eclipse E600 fluorescencemicroscope (Nikon, Inc., Melville, NY) using a 450- to 490-nm excitation/515-nmemission filter. We screened CS10-N2 transformants for blue fluorescent haloes(AF) under UV light at 365 nm and for EGFP as described above.

Slide culture. Slide culture was performed by a published method (16) withminor modifications described previously (23).

Genomic DNA isolation from A. parasiticus. Genomic DNA was isolated by aphenol-chloroform method (1) with minor modifications as described previously(38).

Southern hybridization and PCR analyses. Southern hybridization analyseswere conducted using standard procedures (26). Approximately 10 �g ofgenomic DNA from NR-1 transformants was cut with HincII, or that from theCS10-N2 transformants was cut with PstI. The resulting fragments were sepa-rated by agarose gel electrophoresis and transferred onto Nytran superchargemembrane (Schleicher and Schell, Inc., Keene, NH) by capillary action. Weradiolabeled the 0.6-kb ver-1A promoter fragment for NR-1 transformants andthe 0.7-kb egfp gene fragment for CS10-N2 transformants to use as probes.

PCR analysis of NR-1 and CS10-N2 transformants was performed withgenomic DNA and primers specific to the promoter or terminator of ver-1 toconfirm integration sites of the plasmids and to determine if fusion proteinscarried a functional Ver-1 protein. The DNA sequence of the ver-1A gene fusedto egfp was confirmed at the Research Technology Support Facility (Macromo-lecular Structure, Sequencing and Synthesis Facility) at Michigan State Univer-sity.

AF and AF intermediate analyses by TLC and ELISA. AF and AF interme-diates were extracted by a published method (34). TLC was conducted on AFand AF intermediate extracts using a TEA solvent system (toluene-ethyl acetate-acetic acid at 50:30:4 [vol/vol/vol]) (9). The AFB1 concentration in the cellextracts was determined by direct competitive ELISA with AFB1 monoclonalantibodies (kindly provided by J. Pestka, Michigan State University) as describedpreviously (32).

Western blot analysis of EGFP fused to Ver-1. Conidiospores (2 � 106) werecultured in 100 ml of YES20 at 30°C in the dark with shaking at 150 rpm.Western blot analysis was conducted on fungal extracts prepared after 48 h usingstandard procedures (25). The protein concentration in extracts was determinedby a modified Bradford assay using a commercial protein assay reagent (Bio-RadLaboratories, Hercules, CA) (6). Approximately 30 to 50 �g of total proteins wasseparated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis(SDS-PAGE). Immunodetection was carried out with immunoglobulin G (IgG)antibody against Ver-1 protein (25) or EGFP (Clonetech Laboratories, PaloAlto, CA) as the primary antibody, goat anti-rabbit IgG-alkaline phosphataseconjugate (Sigma Chemical Co., St. Louis, MO) as a secondary antibody, andBCIP-NBT (5�-bromo-4-chloro-3-indolyl phosphate–nitroblue tetrazolium)colorimetric detection system (Roche Molecular Biochemicals, Indianapolis,IN). A Benchmark prestained protein ladder (Invitrogen, Carlsbad, CA) wasused as a molecular mass marker.

Time course of EGFP expression and AF production. Approximately 2 � 106

conidia were cultured in 100 ml of YES or YES20 at 30°C in the dark withshaking at 150 rpm as described previously (25). Flasks were removed at differenttime points after inoculation for total protein extraction and analyses of mycelialdry weight and AF concentration. Mycelia were harvested by filtration throughMiracloth (Calbiochem, La Jolla, CA), frozen in liquid nitrogen, and stored at�80°C. Slide culture was performed as described above. Coverslips were re-moved at different time points after inoculation for analysis of AF concentration.

Measurement of EGFP fluorescence. Cell extracts prepared as described forWestern blotting were analyzed for EGFP fluorescence. Samples were dispensedinto FluoroNunc Maxisorp 96-microwell plates (Nunc, Roskilde, Denmark) andanalyzed with a Cytofluor II (Biosearch Co., Bedford, MA) using 470-nm exci-tation/510-nm emission filters. Fluorescence values were normalized against totalprotein concentration and expressed as relative units of EGFP fluorescence per�g protein.

Measurement of mycelial dry weight and AF concentration. Dry weight wasdetermined after complete drying of the harvested mycelia at 100°C. The AFB1

concentration in the filtrate was determined by direct competitive ELISA (32).

FIG. 1. Restriction endonuclease map of plasmid pAPGFPVNB.The 0.6-kb ver-1 promoter was fused in frame to the 0.7-kb egfp codingregion, followed by the 2.1-kb ver-1 terminator. The 7.4-kb niaD frag-ment was inserted as a selectable marker for transformation of therecipient strain NR-1 (niaD).

6386 HONG AND LINZ APPL. ENVIRON. MICROBIOL.

on August 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

TABLE 1. Primer sequences used in this study

Primera Orientation SequencebRestriction

enzymesite

Annealingtemp(°C)

ver-1A promoterB1 Forward 5� CTCTTAATTAACAAATACACCTACTACACGAC 3� PacI 55

Reverse 5� CTCGCGGCCGCACATGCTGACGGGATCGTG 3� NotI 55

B2 Forward 5� CTCTTAATTAACAAATACACCTACTACACGAC 3� PacI 55Reverse 5� ACGGCGGCCGCTCACCATGCTGACGGGATCGTG 3� NotI 55

B3 Forward 5� CTCTTAATTAACAAATACACCTACTACACGAC 3� PacI 50Reverse 5� ATGCGGCCGCGATCGTGTATGGTAGAGATTT 3� NotI 50

ver-1A terminatorForward 5� GTCGGCCGGCCTAAACCTTCACAGCTATATACTCG 3� FseI 55Reverse 5� GCCGGCGCGCCTGCTGATGGTGGGAAGAG 3� AscI 55

egfp geneB1 Forward 5� ATAGCGGCCGCGTGAGCAAGGGCGAGGAG 3� NotI 55

Reverse 5� GTCGGCCGGCCTTTACTTGTACAGCTCGTCCAT 3� FseI 55

B2 Forward 5� ATGGTGAGCGGCCGCGAGGAGCTG 3� NotI 55Reverse 5� GTCGGCCGGCCTTTACTTGTACAGCTCGTCCAT 3� FseI 55

B3 Forward 5� CCGGGCGGCCGCATGGTGAGCAAGGGCGAG 3� NotI 55Reverse 5� GTCGGCCGGCCTTTACTTGTACAGCTCGTCCAT 3� FseI 55

egfp gene 3� integrantForward 5� GGCAACTACAAGACCCGCG 3� None 68

Downstream of ver-1A terminator Reverse 5� AGCCACCGTGAGCGTCC 3� None 68

ver-1A gene (2.6-kb marker) Forward 5� ATCCTGACCAGCTCTAACACCG 3� None 68

Upstream of ver-1A promoter(B3 5� integrant)

Forward 5� CAGAGGCTCAGTCACTTGTTC 3� None 63

egfp gene 5� integrant Reverse 5� TGCGCTCCTGGACGTAG 3� None 63

ver-1A gene 0.95-kb marker Reverse 5� CAATTCCAGCGTTCGATG 3� None 63

ver-1A promoter/gene, CForward 5� TCCGGGTTAATTAAGATGCCGAACCATTTGAC 3� PacI 55Reverse 5� ACTATAGCGGCCGCCAGCCACTCGAAAAGCGCCACC 3� NotI 55

egfp gene, NForward 5� CCGGGCGGCCGCATGGTGAGCAAGGGCGAG 3� NotI 60Reverse 5� GCCGCGATCGCCCTTGTACAGCTCGTCCATGCC 3� SgfI 60

ver-1A gene, NForward 5� CTGGCGATCGCGGAGCTGGTGCAATGTCGGATAATCA

CCGTTTAGAT 3�SgfI 60

Reverse 5� AGCGGCCGGCCATTATCGAAAAGCGCCACC 3� FseI 60

Downstream of ver-1B terminator(3� integrant)

Reverse 5� ACACATGAGAGCCAGCAAGATAA 3� None 68

a B1, B2, and B3 represent pAPGFPVNB1, pAPGFPVNB2, and pAPGFPVNB3, respectively. C represents the C-terminal egfp fusion, and N represents theN-terminal egfp fusion.

b Underlined sequences show the positions of the restriction enzyme sites.

VOL. 74, 2008 SUBCELLULAR LOCALIZATION OF EGFP FUSED TO Ver-1 6387

on August 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

For analysis of AF accumulation in slide culture, AF were extracted from agarblocks with 5 ml of chloroform and then 5 ml of acetone, dried by evaporation,and dissolved in 1 ml of 70% methanol. The AFB1 concentration was determinedby ELISA.

Microscopy. For conventional fluorescence microscopy, slide culture was per-formed as described above. Coverslips were washed three times with PBS andobserved using a Nikon Labophot fluorescence microscope (Nikon, Inc.,Melville, NY) using a 450- to 490-nm excitation/520-nm emission filter. ForCLSM, slide culture was conducted as described above. Coverslips were removedat different time points after inoculation. Fungal vacuoles were treated with FM4-64 or 7-amino-4-chloromethylcoumarin (CMAC) (31, 36) to stain vacuolarmembranes and luminal contents, respectively. Coverslips with fungal hyphaeattached were placed in YES20 medium containing 8 �M FM 4-64 or 10 �MCMAC. For FM 4-64, coverslips were incubated at 30°C for 10 min and washed

with fresh media without the dye for 30 min. For CMAC, coverslips wereincubated at 30°C for 30 min and washed with fresh media without the dye at37°C for 30 min. Coverslips were observed using a Zeiss LSM 5 Pa or Zeiss LSM510 Meta CLSM (Carl Zeiss, Inc., Germany). All single optical sections andextended-focus images from Z stacks (Z section interval, 0.46 �m) were capturedusing a Zeiss Plan-Apochromat (63x/1.40 oil) objective. EGFP fluorescence (488nm excitation/509 nm emission) was detected using a BP 505-530 emission filterset under excitation with the 488-nm argon-ion laser line. FM 4-64 fluorescence(558 nm excitation/734 nm emission) was detected using an LP 650 emission filterset under excitation with the 633-nm helium-neon laser line. CMAC fluorescence(353 nm excitation/466 nm emission) was detected using a BP 420-480 emissionfilter set under excitation with the 405-nm diode laser line.

To analyze vacuoles in liquid culture, conidiospores (2 � 106) were cultured in100 ml of YES20 medium at 30°C in the dark with shaking at 150 rpm (25).

FIG. 2. Southern hybridization and PCR analyses of integration sites, EGFP expression, and AFB1 production in transformants carryingpAPGFPVNB. For Southern hybridization analyses, genomic DNA was isolated from A. parasiticus, digested with HincII, and hybridized with thever-1A promoter probe. For PCR analyses, genomic DNA was amplified with an egfp primer and a second primer specific to a 3� or 5� ver-1Asequence, as shown in Table 1. (A) Southern hybridization analysis of transformants carrying pAPGFPVNB. Lanes: 1, strain NR-1 (recipient); 2to 11, transformants carrying pAPGFPVNB B3-1 (niaD integration), B3-15, B3-46, B3-101, B3-105, B3-120, B3-146, B3-160, B3-186, and B3-194,respectively. Plasmid integration at niaD or 3� ver-1A generates 1.0-, 2.8-, and 8.2-kb DNA fragments; plasmid integration at 5� ver-1A generates1.0-, 3.7-, and 7.2-kb DNA fragments. (B) PCR analysis of 3� ver-1A or niaD integrants of pAPGFPVNB. Lanes: 1, strain NR-1 (recipient); 2 to8, transformants carrying pAPGFPVNB B3-1 (niaD integration), B3-15, B3-101, B3-105, B3-146, B3-160, and B3-194 (3� ver-1A integration),respectively. M, � HindIII; S, 2.6-kb size marker. (C) PCR analysis of 5� ver-1A or niaD integrants of pAPGFPVNB. Lanes: 1, strain NR-1(recipient); 2 to 5, transformants carrying pAPGFPVNB B3-1 (niaD integration), B3-46, B3-120, and B3-186 (5� ver-1A integration), respectively.M, � HindIII; S, 0.95-kb size marker. For the 2.6-kb and 0.95-kb size markers, the egfp primer was replaced with a ver-1A primer to generate thesame fragment sizes as those in 3� or 5� ver-1A integrants. (D) EGFP fluorescence activity and AFB1 concentration in EGFP� transformant B3-15and the recipient strain NR-1 were measured after 24, 48, and 72 h of incubation at 30°C with shaking at 150 rpm in YES medium. D.W, dry weight.

6388 HONG AND LINZ APPL. ENVIRON. MICROBIOL.

on August 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

Flasks were removed at different time points after inoculation. Fungal vacuoleswere stained in Eppendorf tubes with FM 4-64, and fungal mycelia were ob-served using a Zeiss LSM 5-Pa CLSM (Carl Zeiss Inc., Germany).

To quantify numbers of vacuoles carrying EGFP, large and medium vacuoles(�5 �m) were counted in two or three hyphae from 1 microscopic field and thiswas repeated in a total of 30 fields. The data were analyzed by two-way analysisof variance followed by Tukey’s test for multiple comparisons using SigmaStat(SPSS, Inc., Chicago, IL).

Statistical significance among samples was defined by P � 0.05.

RESULTS

Transformation of A. parasiticus NR-1 with pAPGFPVNB:screening for EGFP-positive transformants. To effectively usethe GFP reporter system in A. parasiticus, we needed to dem-onstrate that we could drive GFP expression with an AF pro-moter, that AF promoter activity in the reporter constructwould parallel wild-type promoter activity in the chromosome,and that GFP would be stable and could be detected easily inthe A. parasiticus mycelium. To accomplish these goals, plas-mid pAPGFPVNB (Fig. 1) was constructed by standard meth-ods. This plasmid carried the ver-1 promoter and terminatorfused to EGFP and an niaD selectable marker. We trans-formed pAPGFPVNB into A. parasiticus NR-1 (niaD) andgenerated 312 transformants. All transformants were screenedfor EGFP expression (green fluorescence) on YES agar (a richAF-inducing growth medium) using a Nikon fluorescence mi-croscope. Fourteen transformants (4%) expressing EGFP(EGFP�) were identified (data not shown) and subjected tofurther analysis.

Determination of integration sites of pAPGFPVNB withinthe chromosome. Previous work in our laboratory demon-strated that integration of reporter constructs within the AFgene cluster was important for correct regulation of AF pro-moter activity (10, 25). Southern hybridization and PCR anal-yses were performed to confirm the location of reporter plas-mid integration into the fungal genome. The reporter plasmidtheoretically could integrate by homologous recombination atone or more of five sites: site 1, niaD; sites 2 and 3, ver-1terminator in the ver-1A or ver-1B locus; and sites 4 and 5, ver-1promoter within the ver-1A or ver-1B locus. Southern hybrid-ization analysis confirmed that pAPGFPVNB integration intoat least one of the five theoretical sites in each of the 14EGFP� transformants (Fig. 2A). PCR analysis with aver-1A–egfp terminator primer pair or an ver-1A–egfp promoter pair(Table 1) confirmed that all 14 EGFP� transformants carriedthe reporter at either the ver-1A promoter or terminator (Fig.2B and C). In cells transformed with pNiaD-A1 (negativecontrol that carries the niaD selectable marker only), wild-typeniaD in the vector replaced the mutant niaD allele in thechromosome by double-crossover (gene replacement) (see Fig.S1 in the supplemental material). In cells transformed withpNANG-3 (a negative control that carries niaD and a 10-amino-acid nor-1 coding region and terminator fused to the�-glucuronidase reporter gene [GUS]) (27), either the niaDselectable marker replaced the mutant niaD allele in the chro-mosome by gene replacement or the plasmid integrated in thenor-1 terminator by single crossover (see Fig. S1 in the sup-plemental material).

Time course of EGFP expression and AFB1 accumulation.Isolate B3-15, 1 of the 14 EGFP� transformants, was cultured

in a liquid, AF-inducing medium (YES) and EGFP fluores-cence (fluorometer) and AFB1 (the primary AF produced inculture) accumulation (ELISA) were analyzed after 24, 48, and72 h of incubation. Dry weights of B3-15 and the recipientstrain NR-1 were similar at each time point (Fig. 2D), suggest-ing similar growth rates in these two strains. A transition fromactive growth to the stationary phase was observed between 48and 72 h as previously reported (10, 25). AFB1 was not de-tected in B3-15 or NR-1 at 24 h, but high levels of AFB1 weredetected in both strains at 48 and 72 h (Fig. 2D); this patternof AFB1 accumulation is similar to that described previously(10, 25). EGFP fluorescence was barely detectable in NR-1, incells transformed with pNiaD-A1, or in cells transformed withpNANG-3 at any time point (Fig. 2D and data not shown). Incontrast, fluorescence was low but detectable at 24 h in B3-15,and increased at a high rate between 24 and 72 h; this patternparalleled the pattern of AF accumulation (Fig. 2D). In sum-mary, the pattern of EGFP expression driven by the ver-1promoter in B3-15 was similar to the pattern of expression ofthe wild-type ver-1 promoter (25) and paralleled AFB1 accu-mulation. These observations confirmed that we could utilizeEGFP as an effective tool to monitor Ver-1 expression andsubcellular localization.

Transformation of A. parasiticus CS10-N2 with pAPCGF-PVFNB or pAPNGFPVFNB: screening for AF and EGFP intransformants. We constructed two plasmids designed toexpress EGFP fused to Ver-1 at either the N terminus(pAPNGFPVFNB) or C terminus (pAPCGFPVFNB) (Fig. 3).Five to 10 �g of each reporter plasmid was transformed into108 protoplasts of A. parasiticus strain CS10-N2 (ver-1 wh-1niaD pyrG), generating 673 transformants. Strain CS10-N2does not accumulate AF but does accumulate the AF pathwayintermediate VA; it carries a mutant ver-1A allele that gener-ates a nonfunctional Ver-1A protein due to a specific aminoacid substitution (see below). Transformants were screened forAF production on CAM20; AF-accumulating transformantsproduce blue fluorescent haloes around colonies on CAM20,as detected under UV light (365 nm). Four transformantscarrying pAPCGFPVFNB (out of 210 transformants analyzed)produced blue fluorescent haloes, suggesting the plasmid re-stored AF synthesis. We screened all 210 transformants for

FIG. 3. Restriction endonuclease map of plasmid pAPCGFPVFNB.The 2.0-kb ver-1 promoter/ORF was fused in frame to the 0.7-kb egfpcoding region, followed by the 2.1-kb ver-1 terminator. The 7.4-kb niaDfragment was inserted as a selectable marker for transformation of therecipient strain, CS10-N2.

VOL. 74, 2008 SUBCELLULAR LOCALIZATION OF EGFP FUSED TO Ver-1 6389

on August 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

EGFP expression under the Nikon fluorescence microscope(green fluorescence within the mycelium). We observed greenfluorescence in isolates V86 and V152 (two of the four AF-producing transformants), suggesting they expressed func-tional EGFP (data not shown).

We conducted similar screening on transformants carryingpAPNGFPVFNB. The plasmid restored AF production in 7 of230 transformants analyzed (blue haloes around colonies onCAM20). These seven isolates (designated NV27, NV60,NV67, NV79, NV165, NV195, and NV218) also producedEGFP (green) fluorescence (data not shown).

TLC and ELISA analyses of transformants. To confirmcomplementation of nonfunctional Ver-1 in A. parasiticusCS10-N2 by Ver-1 fusion proteins, TLC analysis was per-formed on chloroform-acetone extracts from transformantsgrown for 4 days on YES20 agar. TLC confirmed that isolates

V86 and V152 accumulated AF and no longer accumulateddetectable VA (Fig. 4A). Using ELISA, we compared AFB1

accumulation in isolate V86 with that in wild-type strain SU-1;isolate V86 accumulated similar quantities of AFB1 to SU-1(Fig. 4B). These data suggested that isolates V86 and V152expressed a Ver-1–EGFP fusion that functionally comple-mented the nonfunctional Ver-1 in A. parasiticus CS10-N2.

TLC and ELISA analyses were also conducted on sevenisolates carrying pAPNGFPVFNB. Isolates NV27, NV60,NV67, NV79, NV165, NV195, and NV218 accumulated AFbut also accumulated reduced, but detectable quantities of VA(see Fig. S2 in the supplemental material). Isolates NV27,NV60, and NV67 were compared to SU-1 by ELISA andshown to accumulate about 33% of the AFB1 detected in SU-1(see Fig. S2 in the supplemental material). These data suggestthat isolates NV27, NV60, and NV67 express a Ver-1–EGFP

FIG. 5. Western blot analysis of Ver-1–EGFP fusions expressed in transformants carrying pAPCGFPVFNB, the recipient strain, CS10-N2, andthe wild-type strain, SU-1. Fungal proteins were extracted from transformants, and CS10-N2 and SU-1 grown in 100 ml of YES20 for 48 h at 30°Cwith shaking at 150 rpm. Approximately 30 to 50 �g of proteins were separated by 12% SDS-PAGE, transferred onto polyvinylidene difluoridemembranes, and probed with Ver-1 or EGFP polyclonal antibody. (A) Ver-1 antibody detection. Lanes: 1, SU-1; 2, CS10-N2; 3, V86 (AF� andEGFP�); and 4, V152 (AF� and EGFP�). M, molecular mass marker. Ver-1–EGFP fusion has a molecular mass of 55 kDa, and the 28-kDaprotein represents native Ver-1. (B) EGFP antibody detection. Lanes: 1, SU-1; 2, CS10-N2; 3, V86; 4, V152; and 5, recombinant EGFP (rEGFP).rEGFP was used as a positive control, and the 30-kDa rEGFP contains a 27-kDa EGFP fused to a 3-kDa protein for affinity chromatographypurification.

FIG. 4. TLC and ELISA analyses of extracts from transformants carrying pAPCGFPVFNB and the recipient strain, CS10-N2. (A) TLCanalysis. Lanes: 1, extract from the recipient strain CS10-N2; 2 and 3, V86 (AF� and EGFP�) and V152 (AF� and EGFP�), respectively.Standards: A, AFB1, -B2, -G1, and -G2 as standard mixture; V, VA standard. TEA (50:30:4 [vol/vol/vol] toluene-ethyl acetate-acetic acid) was usedas a solvent system. Fluorescence was detected under UV light at 365 nm. (B) ELISA analysis of extracts from transformants carryingpAPCGFPVFNB, the recipient strain, CS10-N2, and the wild-type strain, SU-1. Extracts from V2 (AF� and EGFP�), V1 (AF� and EGFP�),V107 (AF� and EGFP�), V86 (AF [�] and EGFP [�]), CS10-N2 (recipient strain), and SU-1 (wild-type) were analyzed for AFB1 production byELISA.

6390 HONG AND LINZ APPL. ENVIRON. MICROBIOL.

on August 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

fusion that functionally complements the nonfunctional Ver-1in A. parasiticus CS10-N2. Functional complementation of thenonfunctional Ver-1 in transformants producing Ver-1–EGFPfusions strongly suggests that these proteins localize properlyin the cell.

Western blot analysis of EGFP fused to Ver-1. To confirmthat transformed cells expressed Ver-1–EGFP fusion protein,we performed Western blot analysis on cells grown in liquidYES20 for 48 h using anti-Ver-1 antibody or anti-EGFPantibody (Fig. 5A and B, respectively). A 55-kDa fusionprotein was detected in isolates V86 and V152 (carryingpAPCGFPVFNB) with either antibody; this represents the ex-pected mass of the Ver-1–EGFP fusion (Ver-1, 28 kDa; EGFP,27 kDa). Anti-Ver-1 antibodies also detected a 28-kDa Ver-1protein in strain SU-1, CS10-N2, and all transformants. Therewas no observable degradation of either the Ver-1–EGFP fu-sion or the 28-kDa Ver-1 protein at any time point analyzed.These data suggest that full-length Ver-1 fusion protein isexpressed in isolates V86 and V152, and this protein is subjectto little or no turnover during the growth period.

Similar analysis of isolates NV27, NV60, NV67, NV79,NV165, NV195, and NV218 (carrying pAPNGFPVFNB) iden-tified a 55-kDa fusion protein that reacted with both anti-Ver-1(see Fig. S3 in the supplemental material) and anti-EGFP(data not shown) antibodies. However, isolates NV1, NV63,and NV109 used as negative controls did not accumulate AF,did not express detectable green fluorescence, and did notexpress a 55-kDa fusion protein. However, we did detect a28-kDa Ver-1 in all transformants analyzed.

Analysis of the EGFP fused to Ver-1: does it carry wild-typeVer-1? We next analyzed transformants to determine if theVer-1 fusion protein expressed in transformants was directlyresponsible for complementation of nonfunctional Ver-1 andrestored AF synthesis in the recipient strain. We knew thatCS10-N2 (ver-1 niaD pyrG wh-1) carries a nonfunctional ver-1Aallele; we did not know if this gene carried a mutation (3, 20).We cloned the nonfunctional ver-1A allele from CS10-N2 byPCR and analyzed the nucleotide sequence of this DNA frag-ment. A single point mutation (G-to-A transition) was identi-fied at nucleotide residue 287 in ver-1A in CS10-N2; this mu-tation resulted in a glycine-to-glutamic acid substitution.

We then determined if the fusion gene encoding the 55-kDafusion in transformants carried functional (wild type) or non-functional ver-1. Depending on the site of plasmid integration,theoretically one could generate protein fusions carrying eithera functional or nonfunctional Ver-1 (Fig. 6). PCR was per-formed with a ver-1A–egfp promoter primer pair or ver-1A–egfpterminator primer pair (Table 1) to ensure that we amplifiedver-1A fused to egfp; we then conducted DNA sequence anal-ysis on the recombinant DNA fragments. Isolate V86 carriedwild-type ver-1A in the egfp fusion, while isolate V152 carriednonfunctional ver-1A (data not shown). The integrationscheme (Fig. 6C) demonstrates that V152 could produce afunctional recombinant Ver-1 protein generated by integrationof the fusion plasmid downstream of the point mutation in thechromosomal copy of ver-1A. Similar analysis demonstratedthat isolates NV27, NV60, NV67, and NV79 (carryingpAPNGFPVFNB) each carried wild-type ver-1A fused to egfp(data not shown).

Determination of integration sites of pAPCGFPVFNB andpAPNGFPVFNB within the chromosome. Southern hybridiza-tion and PCR analyses were conducted on transformants car-rying pAPCGFPVFNB or pAPNGFPVFNB to identify the siteof plasmid integration; the analysis was similar to analysis ofpAPGFPVNB integration described above. The data con-firmed that a single copy of pAPCGFPVFNB integrated intothe ver-1A terminator in isolate V86 (see Fig. S4 in the sup-plemental material). In agreement with the predicted integra-tion event described above, the data also demonstrated isolateV152 carried one copy of pAPCGFPVFNB at niaD (this isprobably not expressed). The other copy integrated down-stream of the point mutation in the chromosomal copy of

FIG. 6. Schematic of how production of EGFP fused to functionalVer-1 protein depends on the integration site of pAPCGFPVFNB inthe ver-1A locus. (A) ver-1A locus. (B) Plasmid integration upstream ofthe point mutation in ver-1A results in production of EGFP fused tofunctional Ver-1 protein. (C) Plasmid integration downstream of thepoint mutation in ver-1A results in production of EGFP fused tononfunctional Ver-1 protein. However, a functional Ver-1 protein isgenerated by the recombinant ver-1 gene located adjacent to the fusiongene. (D) 3� ver-1A integration results in production of EGFP fused tofunctional Ver-1 protein. M represents a point mutation. Abbrevia-tions for the DNA fragments are as follows: ver-1 p, ver-1 promoter;ver-1 t, ver-1 terminator.

VOL. 74, 2008 SUBCELLULAR LOCALIZATION OF EGFP FUSED TO Ver-1 6391

on August 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

ver-1A. Similar analyses of isolates NV27, NV60, NV67, NV79,NV165, NV195, and NV218 demonstrated that a single copy ofpAPNGFPVFNB integrated into the ver-1A terminator (seeFig. S5 in the supplemental material).

CLSM. The subcellular location of EGFP fused to Ver-1 wasanalyzed in isolates V86 and NV27 by CLSM after growth for24, 48, and 72 h on a solid, AF-inducing medium (YES20)(slide culture) (Fig. 7). We also analyzed B3-15, NR-1, andCS10-N2 as controls. EGFP was not detected at any time pointin the recipient strains, NR-1 and CS10-N2 (data not shown).

EGFP fluorescence was not detected in B3-15, V86, and NV27at 24 h (Fig. 7H and data not shown). However, EGFP fusedto Ver-1 was detected in the cytoplasm in V86 and NV27strains at 48 h (Fig. 7B and E); Ver-1 fusion proteins alsolocalized to the lumen of up to 80% of the vacuoles in V86 andNV27 at 48 h (Fig. 7A, C, and E). The identity of thesevacuoles was confirmed with the vacuolar membrane dye FM4-64 and the vacuolar lumen dye CMAC (31, 36). FM 4-64stains endosomes as well as vacuoles in Saccharomyces cere-visiae (40). CMAC is enzymatically converted to a blue fluo-

FIG. 7. Subcellular localization of EGFP fused to Ver-1 in AF� and EGFP� transformants V86 and NV27. Fungal vacuoles were stained with8 �M FM 4-64 or 10 �M CMAC and observed using a Zeiss LSM 5 Pa or Zeiss LSM 510 Meta CLSM after 24, 48, and 72 h of incubation at 30°Con YES20 agar blocks. (A and B) V86 stained with FM 4-64 at 48 h on YES20. Ver-1–EGFP fusion localized in red fluorescent vacuoles in panelA (higher magnification) or in the cytoplasm in panel B. (C) V86 stained with CMAC at 48 h on YES20. Ver-1–EGFP fusion localized in vacuolesin hyphae. (D) V86 stained with FM 4-64 at 72 h on YES20, with Ver-1–EGFP fusion localized in vacuoles and the cytoplasm. (E) NV27 stainedwith CMAC at 48 h on YES20. Ver-1–EGFP fusions localized in vacuoles and the cytoplasm. (F and G) NV27 stained with FM 4-64 at 72 h onYES20. Ver-1–EGFP fusion localized in vacuoles. Ver-1–EGFP fusion was associated with the vacuolar membrane in panel G. (H) B3-15 stainedwith FM 4-64 at 24 h on YES medium. Red fluorescent vacuolar membranes were observed in hyphae, but green fluorescence was not detected.(I) B3-15 stained with FM 4-64 at 48 h on YES medium. EGFP localized in the cytoplasm (higher magnification). Green fluorescence was excludedfrom vacuoles. (J) B3-15 stained with CMAC at 72 h on YES medium. EGFP localized in vacuoles of hyphae. Each panel shows a red fluorescenceimage (FM 4-64) or a blue fluorescence image (CMAC) (top left), a green fluorescence image (EGFP) (top right), a transmitted image (brightfield or differential interference contrast) (bottom left), and a merged image (bottom right): the exceptions are panels A and I, in which only redand green fluorescence images are shown. Scale bars, 10 �m.

6392 HONG AND LINZ APPL. ENVIRON. MICROBIOL.

on August 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

rescent derivative in the vacuolar lumen (36). In the controlstrain B3-15 (which expresses EGFP only), we detected greenfluorescence predominantly in the cytoplasm at 48 h (13% of thevacuoles were labeled) (Fig. 7I); at 72 h, approximately 80% ofthe vacuoles were labeled (Fig. 7J). Pairwise multiple compari-sons confirmed that the level of vacuolar localization of greenfluorescence in B3-15 at 48 h was significantly lower than that inV86 and NV27 at 48 h (P 0.05) (Table 2). However, at 72 h,there was no significant difference in the levels of vacuolar local-ization in V86 (78%), NV27 (86%), and B3-15 (62%). These datasuggested that Ver-1 in the protein fusion directed EGFP to thevacuole up to 24 h earlier than EGFP alone.

Time course of AFB1 accumulation. AF accumulation by thefungus grown on YES solid medium (slide culture) was ana-lyzed to determine the relationship between AF accumulationand the time of protein localization to the vacuole. IsolatesV86 and B3-15 were cultured on YES20 agar blocks andYES20 liquid medium. AFB1 accumulation in these isolateswas analyzed after 24, 48, and 72 h of incubation. AFB1 was notdetected in either isolate at 24 h, but high levels of AFB1

accumulated between 24 and 48 h, as described previously (Fig.8A and B) (10, 25). Little additional AF accumulation wasobserved between 48 and 72 h. These data strongly suggestedthat the highest rate of AF synthesis coincided with the highestrate of Ver-1–EGFP transport to the vacuole. Therefore, it isreasonable to propose that localization of Ver-1 to the vacuoleis associated with AF biosynthesis and not with AF proteinturnover. In contrast, EGFP localized to the vacuole after mostAF synthesis occurred, suggesting that EGFP is either storedor turned over in that organelle.

DISCUSSION

In contrast to our previous TEM study (21), we concludethat the middle AF pathway enzyme Ver-1 localizes to thecytoplasm and to the vacuolar lumen in A. parasiticus coloniesgrown in slide culture on a solid, AF-inducing medium. Vac-uolar localization occurs at the highest rate between 24 and48 h; the highest rate of AF biosynthesis is observed in thesame time frame in colonies grown on solid media in slide

FIG. 7—Continued.

VOL. 74, 2008 SUBCELLULAR LOCALIZATION OF EGFP FUSED TO Ver-1 6393

on August 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

culture (in this study) and on agar plates (21). We did notobserve any detectable degradation of Ver-1 or EGFP fused toVer-1 (based on Western blotting) during the 24- to 48-h timeframe, suggesting that these proteins are not turned over atthis location (at least during active AF synthesis). These ob-servations support our hypothesis that Ver-1 and OmtA (andlikely other middle and late pathway enzymes) are synthesizedin the cytoplasm and then localize to the vacuole to conduct

AF synthesis. We are now purifying and analyzing vacuoles toconfirm this hypothesis.

In contrast to the present study, Ver-1 was observed primar-ily in the cytoplasm of 24- to 48-h-old cells using TEM afterimmunogold labeling (21). One possible explanation for thisdiscrepancy is that we conducted localization in living tissueand in real time (in the present study) instead of in fixed andsectioned samples (in the previous study). Alternatively, theacidic pH (pH 5 to 6) of vacuoles may negatively affect Ver-1antibody binding to Ver-1 localized in vacuoles in the previousstudy. However, other reports support our recent data. Liangconducted cell fractionation analysis and observed that Ver-1was associated with structures similar in size to lysosomes andcould be found in the cytoplasm fraction (23). Our data arealso consistent with a recent study using coimmunoprecipita-tion, which suggests that Ver-1, VBS, and OmtA form a mul-tiprotein complex to carry out AF synthesis (A. Chanda, un-published data).

Isolate B3-15 (control) expressed EGFP driven by the ver-1

FIG. 7—Continued.

TABLE 2. Comparison of vacuolar localization of EGFP intransformant B3-15 with that of EGFP-tagged Ver-1 in

transformants V86 and NV27

Time (h)% of green fluorescent vacuoles ina:

B3-15 V86 NV27

48 13.0 0.0 72.0 3.0 80.0 1.072 62.5 3.5 78.5 1.5 86.5 4.5

a Shown are the percentages of large- and mid-size green fluorescent vacuoles(�5 �m) in 30 microscopic fields (two to three hyphae per field).

6394 HONG AND LINZ APPL. ENVIRON. MICROBIOL.

on August 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

promoter. The growth rate and the timing and pattern ofEGFP synthesis in B3-15 paralleled the timing of Ver-1 proteinaccumulation and AF accumulation in SU-1 (wild type) andNR-1 (recipient strain). This means that EGFP in this strainwas synthesized at highest levels from 24 to 48 h, similar to theVer-1 fusion protein. Nevertheless, EGFP localized to vacu-oles at significant levels at 72 h, up to 24 h later than fusionproteins carrying Ver-1; in addition, EGFP localized to vacu-oles after the highest rate of AF synthesis diminished. Thesedata strongly suggest that the vacuole-targeting pathways rec-ognize Ver-1 at an earlier time point than the control protein,EGFP. Our data also suggest that both proteins are synthe-sized in the cytoplasm since they were first detected here priorto vacuolar localization.

There are two primary protein-targeting pathways that di-rect cytoplasmic proteins to the vacuole in fungi and plants;these are the cytoplasm-to-vacuole targeting pathway (Cvt)and the autophagy pathway (2). Aminopeptidase I (API) uti-

lizes the Cvt pathway for vacuolar targeting. API lacks N-glycosylation motifs and does not utilize the typical secretorypathway. Pro-API is synthesized on cytoplasmic ribosomes andthen packaged in vesicles that form around the protein“cargo.” The cargo protein is carried to the vacuole and be-comes incorporated via fusion of the vesicle with the develop-ing vacuole. In the process, a 45-amino-acid targeting propep-tide is cleaved from the amino terminus of pro-API by proteaseB. The Cvt pathway is constitutively expressed and demon-strates significant specificity in the proteins targeted to thevacuole; these proteins usually contain specific targeting motifswithin the open reading frame (ORF).

In contrast, the autophagy pathway is induced by nutrientlimitation, normally at or near the end of active growth (2).Cells package cellular proteins in autophagosomes that fusewith vacuoles. This generalized transport machinery demon-strates little specificity and provides a mechanism for proteinturnover to generate stores of amino acids through hydrolysisof the stored proteins in the vacuole.

Vacuolar localization of Ver-1 occurs just after its synthesisinitiates in the cytoplasm. Ver-1 (unlike another focus of ourstudies, the middle AF pathway enzyme VBS) does not carrytypical glycosylation motifs, strongly suggesting it is not trans-ported by the secretory pathway. In addition, we have noted inseveral studies that Ver-1 protein (as well as Nor-1 and OmtA)is subject to proteolytic cleavage at a single site and the level ofcleavage appears to increase in parallel with the rate of AFsynthesis (22, 25, 44). Based on these observations, we hypothe-size that Ver-1 utilizes the Cvt pathway for vacuolar localiza-tion (see the model in Fig. 9) and that control EGFP is trans-ported to vacuoles via the autophagy pathway in response tonutrient limitation. Current work is designed to test these

FIG. 8. AFB1 production in transformant V86 (expressing a Ver-1–EGFP fusion) and transformant B3-15 (expressing EGFP only) inliquid and slide cultures. AFB1 was measured after 24, 48, and 72 h ofincubation at 30°C with shaking at 150 rpm in 100 ml of YES20 or onYES20 agar. (A) Liquid culture. (B) Slide culture. D.W, dry weight.

FIG. 9. Proposed model for vacuolar localization of Ver-1 and AFproduction in fungal cells. According to the model, Ver-1 is synthe-sized in the cytoplasm and transported to vacuoles by the Cvt pathway.Ver-1 is packaged into double-membrane-bound Cvt vesicles underconditions that promote active growth. In contrast, under starvationconditions, Ver-1 is taken up into larger, double-membrane-boundautophagosomes by the autophagy pathway. The Cvt vesicles or auto-phagosomes then fuse with the vacuole, and the resulting Cvt bodies orautophagic bodies are broken down by vacuolar hydrolases to releaseVer-1 into the vacuolar lumen. We propose that AF intermediates arealso transported to vacuoles and that Ver-1 is involved in AF synthesiswithin the vacuoles. Finally, AF is released to the growth mediumthrough small vacuoles or vesicles. Black arrows indicate transport ofVer-1, and white arrows indicate transport of substrates and end prod-ucts. Acetyl CoA, acetyl coenzyme A.

VOL. 74, 2008 SUBCELLULAR LOCALIZATION OF EGFP FUSED TO Ver-1 6395

on August 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

hypotheses. Our initial focus is to identify the role of Ver-1protein cleavage in enzyme activity and vacuolar localization.

Most, if not all, vacuoles carried Ver-1 when AF synthesisoccurred at the highest rate. These data suggest most vacuolesare actively involved in AF synthesis. We are currently expand-ing these studies to include analysis of other secondary metab-olites.

ACKNOWLEDGMENTS

This work was supported by NIH grant CA52003-16 and the Mich-igan Agricultural Experiment Station.

We thank Melinda K. Frame (Center for Advanced Microscopy atMichigan State University) for help with CLSM, Perng-Kuang Chang(USDA/ARS Southern Regional Research Center) for providingstrain CS10-N2, and Stephen A. Osmani (Ohio State University) forproviding a repeated Gly-Ala sequence to construct egfp fused to ver-1.

REFERENCES

1. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A.Smith, and K. Struhl. 2003. Current protocols in molecular biology. JohnWiley and Sons, New York, NY.

2. Baba, M., M. Osumi, S. V. Scott, D. J. Klionsky, and Y. Ohsumi. 1997. Twodistinct pathways for targeting proteins from the cytoplasm to the vacuole/lysosome. J. Cell Biol. 139:1687–1695.

3. Bennett, J. W., and L. A. Goldblatt. 1973. Isolation of mutants of Aspergillusflavus and Aspergillus parasiticus with altered aflatoxin producing ability.Sabouraudia 11:235–241.

4. Bhatnagar, D., T. E. Cleveland, and E. B. Lillehoj. 1989. Enzymes in afla-toxin B1 biosynthesis: strategies for identifying pertinent genes. Mycopatho-logia. 107:75–83.

5. Bhatnagar, D., K. C. Ehrlich, and T. E. Cleveland. 2003. Molecular geneticanalysis and regulation of aflatoxin biosynthesis. Appl. Microbiol. Biotech-nol. 61:83–93.

6. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dye bind-ing. Anal. Biochem. 72:248–254.

7. CAST. 2003. Mycotoxins: risks in plant, animal, and human systems. Councilfor Agricultural Science and Technology, Ames, IA.

8. Chang, P. K., C. D. Skory, and J. E. Linz. 1992. Cloning of a gene associatedwith aflatoxin B1 biosynthesis in Aspergillus parasiticus. Curr. Genet. 21:231–233.

9. Chang, P.-K., K. Yabe, and J. Yu. 2004. The Aspergillus parasiticus estA-encoded esterase converts versiconal hemiacetal acetate to versiconal andversiconol acetate to versiconol in aflatoxin biosynthesis. Appl. Environ.Microbiol. 70:3593–3599.

10. Chiou, C.-H., M. Miller, D. L. Wilson, F. Trail, and J. E. Linz. 2002.Chromosomal location plays a role in regulation of aflatoxin gene expressionin Aspergillus parasiticus. Appl. Environ. Microbiol. 68:306–315.

11. Cotty, P. J., P. Bayman, D. S. Egel, and D. S. Elias. 1994. Agriculture,aflatoxins, and Aspergillus, p. 1–27. In K. A. Powell, A. Fenwick, and J. F.Peberdy (ed.), The genus Aspergillus. Plenum Press, New York, NY.

12. Cotty, P. J., and R. Jaime-Garcia. 2007. Influences of climate on aflatoxinproducing fungi and aflatoxin contamination. Int. J. Food Microbiol. 119:109–115.

13. Cove, D. J. 1966. The induction and repression of nitrate reductase in thefungus Aspergillus nidulans. Biochim. Biophys. Acta 113:51–56.

14. Dvorackova, I. 1990. Aflatoxins and human health. CRC Press, BocaRaton, FL.

15. Ehrlich, K. C., B. Montalbano, S. M. Boue, and D. Bhatnagar. 2005. Anaflatoxin biosynthesis cluster gene encodes a novel oxidase required forconversion of versicolorin A to sterigmatocystin. Appl. Environ. Microbiol.71:8963–8965.

16. Harris, J. L. 1986. Modified method for fungal slide culture. J. Clin. Micro-biol. 24:460–461.

17. Henry, K. M., and C. A. Townsend. 2005. Ordering the reductive and cyto-chrome P450 oxidative steps in demethylsterigmatocystin formation yieldsgeneral insights into the biosynthesis of aflatoxin and related fungal metab-olites. J. Am. Chem. Soc. 127:3724–3733.

18. Horng, J. S., P. K. Chang, J. J. Pestka, and J. E. Linz. 1990. Developmentof a homologous transformation system for Aspergillus parasiticus with thegene encoding nitrate reductase. Mol. Gen. Genet. 224:294–296.

19. Lax, A. R., T. E. Cleveland, D. Bhatnagar, and L. S. Lee. 1986. Enzymaticconversion of sterigmatocystin to aflatoxin B1 through O-methylsterigmato-cystin. Plant Physiol. 80(Suppl.):19.

20. Lee, L. S., J. W. Bennett, A. F. Cucullu, and J. B. Stanley. 1975. Synthesis of

versicolorin A by a mutant strain of Aspergillus parasiticus deficient in afla-toxin production. J. Agric. Food Chem. 23:1132–1134.

21. Lee, L. W., C. H. Chiou, K. L. Klomparens, J. W. Cary, and J. E. Linz. 2004.Subcellular localization of aflatoxin biosynthetic enzymes Nor-1, Ver-1, andOmtA in time-dependent fractionated colonies of Aspergillus parasiticus.Arch. Microbiol. 181:204–214.

22. Lee, L. W., C. H. Chiou, and J. E. Linz. 2002. Function of native OmtA invivo and expression and distribution of this protein in colonies of Aspergillusparasiticus. Appl. Environ. Microbiol. 68:5718–5727.

23. Liang, S. H. 1996. The function and expression of the ver-1 gene and local-ization of the Ver-1 protein involved in aflatoxin biosynthesis in Aspergillusparasiticus. Ph.D. dissertation. Michigan State University, East Lansing.

24. Liang, S. H., C. D. Skory, and J. E. Linz. 1996. Characterization of thefunction of the ver-1A and ver-1B genes, involved in aflatoxin biosynthesis inAspergillus parasiticus. Appl. Environ. Microbiol. 62:4568–4575.

25. Liang, S. H., T. S. Wu, R. Lee, F. S. Chu, and J. E. Linz. 1997. Analysis ofmechanisms regulating expression of the ver-1 gene, involved in aflatoxinbiosynthesis. Appl. Environ. Microbiol. 63:1058–1065.

26. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold SpringHarbor, NY.

27. Miller, M. J. 2003. Transcriptional regulation of the Aspergillus parasiticusaflatoxin biosynthetic pathway gene nor-1. Ph.D. dissertation. Michigan StateUniversity, East Lansing.

28. Miller, M. J., and J. E. Linz. 2006. Genetic mechanisms involved in regula-tion of mycotoxin biosynthesis, p. 1505–1542. In K. Shetty, G. Paliyath, A.Pometto, and R. E. Levin (ed.), Food biotechnology, 2nd ed. Taylor andFrancis Group, New York, NY.

29. Mori, H., J. Kitamura, S. Sugie, K. Kawai, and T. Hamasaki. 1985. Geno-toxicity of fungal metabolites related to aflatoxin B1 biosynthesis. Mutat.Res. 143:121–125.

30. Oakley, B. R., J. E. Rinehart, B. L. Mitchell, C. E. Oakley, C. Carmona, G. L.Gray, and G. S. May. 1987. Cloning, mapping and molecular analysis of thepyrG (orotidine-5�-phosphate decarboxylase) gene of Aspergillus nidulans.Gene 61:385–399.

31. Ohneda, M., M. Arioka, H. Nakajima, and K. Kitamoto. 2002. Visualizationof vacuoles in Aspergillus oryzae by expression of CPY-EGFP. Fungal Genet.Biol. 37:29–38.

32. Pestka, J. J. 1988. Enhanced surveillance of foodborne mycotoxins by im-munochemical assay. J. Assoc. Off. Anal. Chem. 71:1075–1081.

33. Richard, J. L. 2007. Some major mycotoxins and their mycotoxicoses—anoverview. Int. J. Food Microbiol. 119:3–10.

34. Roze, L. V., R. M. Beaudry, N. P. Keller, and J. E. Linz. 2004. Regulation ofaflatoxin synthesis by FadA/cAMP/protein kinase A signaling in Aspergillusparasiticus. Mycopathologia 158:219–232.

35. Sakuno, E., K. Yabe, and H. Nakajima. 2003. Involvement of two cytosolicenzymes and a novel intermediate, 5�-oxoaverantin, in the pathway from5�-hydroxyaverantin to averufin in aflatoxin biosynthesis. Appl. Environ.Microbiol. 69:6418–6426.

36. Shoji, J. Y., M. Arioka, and K. Kitamoto. 2006. Vacuolar membrane dynam-ics in the filamentous fungus Aspergillus oryzae. Eukaryot. Cell 5:411–421.

37. Skory, C. D., P. K. Chang, J. Cary, and J. E. Linz. 1992. Isolation andcharacterization of a gene from Aspergillus parasiticus associated with theconversion of versicolorin A to sterigmatocystin in aflatoxin biosynthesis.Appl. Environ. Microbiol. 58:3527–3537.

38. Skory, C. D., J. S. Horng, J. J. Pestka, and J. E. Linz. 1990. Transformationof Aspergillus parasiticus with a homologous gene (pyrG) involved in pyrim-idine biosynthesis. Appl. Environ. Microbiol. 56:3315–3320.

39. Takahashi, T., P.-K. Chang, K. Matsushima, J. Yu, K. Abe, D. Bhatnagar,T. E. Cleveland, and Y. Koyama. 2002. Nonfunctionality of Aspergillus sojaeaflR in a strain of Aspergillus parasiticus with a disrupted aflR gene. Appl.Environ. Microbiol. 68:3737–3743.

40. Vida, T. A., and S. D. Emr. 1995. A new vital stain for visualizing vacuolarmembrane dynamics and endocytosis in yeast. J. Cell Biol. 128:779–792.

41. Yabe, K., M. Nakamura, and T. Hamasaki. 1999. Enzymatic formation ofG-group aflatoxins and biosynthetic relationship between G- and B-groupaflatoxins. Appl. Environ. Microbiol. 65:3867–3872.

42. Yu, J., P.-K. Chang, J. W. Cary, M. Wright, D. Bhatnagar, T. E. Cleveland,G. A. Payne, and J. E. Linz. 1995. Comparative mapping of aflatoxin pathwaygene clusters in Aspergillus parasiticus and Aspergillus flavus. Appl. Environ.Microbiol. 61:2365–2371.

43. Yu, J., P.-K. Chang, K. C. Ehrlich, J. W. Cary, D. Bhatnagar, T. E. Cleve-land, G. A. Payne, J. E. Linz, C. P. Woloshuk, and J. W. Bennett. 2004.Clustered pathway genes in aflatoxin biosynthesis. Appl. Environ. Microbiol.70:1253–1262.

44. Zhou, R. 1997. The function, accumulation, and localization of the Nor-1protein involved in aflatoxin biosynthesis: the function of the fluP geneassociated with sporulation in Aspergillus parasiticus. Ph.D. dissertation.Michigan State University, East Lansing.

6396 HONG AND LINZ APPL. ENVIRON. MICROBIOL.

on August 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Feb. 2009, p. 1220 Vol. 75, No. 40099-2240/09/$08.00�0 doi:10.1128/AEM.02925-08

ERRATUM

Functional Expression and Subcellular Localization of the Aflatoxin PathwayEnzyme Ver-1 Fused to Enhanced Green Fluorescent Protein

Sung-Yong Hong and John E. LinzDepartment of Food Science and Human Nutrition, National Food Safety and Toxicology Center, Department of Microbiology and

Molecular Genetics, and Center for Integrative Toxicology, Michigan State University, East Lansing, Michigan 48824

Volume 74, no. 20, p. 6385–6396, 2008. Page 6390, Fig. 4B: On the x axis, “CS10” should read “SU-1” and “SU1” should read“CS10.”

1220