Functional characterization of three specific acyl-coenzyme A synthetases 1

involved in anaerobic cholesterol degradation in Sterolibacterium denitrificans 2

Chol1S 3

4

Markus Warnkea, Tobias Junga, Christian Jacobya, Michael Agnea,b, Franziska Maria Fellerc, Bodo Philippc, 5

Wolfgang Seiched, Bernhard Breitd, and Matthias Bolla,# 6

7

8

aFaculty of Biology – Microbiology, Albert-Ludwigs-University Freiburg, Freiburg, Germany 9

bSpemann Graduate School of Biology and Medicine (SGBM), Albert-Ludwigs-University Freiburg 10

cInstitute of Molecular Microbiology and Biotechnology, University of Münster, Münster, Germany 11

dInstitute of Organic Chemistry, Albert-Ludwigs-University Freiburg, Freiburg, Germany 12

13

14

15

16

17

18

19

20

21

22

23

24

Running title: Acyl-CoA synthetases in anaerobic steroid degradation 25

26

27

28

#Correspondent footnote: 29

M Boll, Institute for Biology II, Faculty of Biology, University of Freiburg, 30

Schänzlestr. 1, 79104 Freiburg, Germany 31

E-mail: matthias.boll@biologie.uni-freiburg.de 32

33

AEM Accepted Manuscript Posted Online 26 January 2018Appl. Environ. Microbiol. doi:10.1128/AEM.02721-17Copyright © 2018 American Society for Microbiology. All Rights Reserved.

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

Abstract 34

35

The denitrifying -proteobacterium Sterolibacterium denitrificans Chol1S catabolizes steroids such as 36

cholesterol via an oxygen-independent pathway. It involves enzyme reaction sequences described for 37

aerobic cholesterol and bile acid degradation as well as enzymes uniquely found in anaerobic steroid-38

degrading bacteria. Recent studies provided evidence that in Stl. denitrificans the cholest-4-en-3-one 39

intermediate is oxygen-independently oxidized to 4-dafachronic acid (C26-oic acid), which is 40

subsequently activated by a substrate-specific acyl-coenzyme A (CoA) synthetase (ACS). Further 41

degradation was suggested to proceed via unconventional -oxidation where aldolases, aldehyde 42

dehydrogenases and additional ACS substitute for classical -hydroxyacyl-CoA dehydrogenases and 43

thiolases. Here, we heterologously expressed three cholesterol-induced genes that putatively code for 44

AMP-forming ACS, and characterized two of the products as specific 3-hydroxy-5-cholenoyl-CoA (C24-45

oic acid) and pregn-4-en-3-one-22-oyl-CoA (C22-oic acid) forming ACS, respectively. A third 46

heterologously produced ATP-dependent ACS was inactive with 26-, 24-, or 22-oic-acids but activated 47

3a-H-4-(3'propanoate)-7a-methylhexahydro-1,5-indanedione (HIP) to HIP-CoA, a rather late 48

intermediate of aerobic cholesterol degradation that still contains the CD-rings of the sterane skeleton. 49

This work provides experimental evidence that anaerobic steroid degradation proceeds via numerous 50

alternate CoA-ester-dependent or -independent enzymatic reaction sequences as a result of aldolytic 51

side-chain and hydrolytic sterane ring C–C-bond cleavages. The aldolytic side-chain degradation pathway 52

comprising highly exergonic ACS and aldehyde dehydrogenases is considered to be essential for driving 53

the unfavorable oxygen-independent C26 hydroxylation forward. 54

55

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

Importance 56

57

The biological degradation of ubiquitously abundant steroids is hampered by their low solubility and the 58

presence of two quaternary carbon atoms. The degradation of cholesterol by aerobic Actinobacteria has 59

been studied in detail since more than thirty years and involves a number of oxygenase-dependent 60

reactions. In contrast, much less is known about oxygen-independent degradation of steroids in 61

denitrifying bacteria. In the cholesterol-degrading anaerobic model organism Sterolibacterium 62

denitrificans Chol1S initial evidence has been obtained that steroid degradation proceeds via numerous 63

alternate CoA-ester dependent/independent reaction sequences. Here we describe the heterologous 64

expression of three highly specific and characteristic acyl-CoA synthetases, two of which play a key role 65

in the degradation of the side-chain whereas a third one is specifically involved in the B-ring 66

degradation. The results obtained shed light into oxygen-independent steroid degradation comprising 67

more than 40 enzymatic reactions. 68

69

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

Introduction 70

71

Steroids constitute a highly abundant class of natural compounds with a common sterane ring system. 72

They play essential roles as components of biological membranes and signaling molecules (1). Steroids 73

serve as growth substrate for certain Actinobacteria and Proteobacteria that use them as carbon and 74

together with an electron acceptor as energy source. Bacterial degradation represents the major means 75

of eliminating steroids from the environment (2, 3, 4). Research on microbial steroid degradation has 76

also a biotechnological impact as enzymes transforming steroids may be used for the synthesis of value-77

added products, e.g. the specific conversion of cholecalciferol to 25-hydroxyvitamin D3 by 78

monooxygenases (5) or oxygen- and electron donor-independent hydroxylases (6). Finally, steroid 79

degradation is medically relevant, because Mycobacterium tuberculosis is known to use cholesterol from 80

macrophages as growth substrate during intracellular survival (7, 8). 81

82

Aerobic steroid degradation has mainly been studied in several cholesterol degrading Actinobacteria 83

such as the model organisms Rhodococcus jostii RHA1 and Mycobacterium tuberculosis H37Rv (9), while 84

aerobic degradation of steroidal core ring has mainly been studied in Commamonas testosterone (10). 85

Bile salts degradation has originally been studied in Pseudomonas species but recently also in R. jostii 86

(11, 12, 13, 14). 87

88

During both, aerobic and anaerobic cholesterol degradation, catabolism is initiated by the oxidation of 89

ring A by 3-hydroxysteroid dehydrogenases or cholesterol oxidases and 3-ketosteroid-∆1-90

dehydrogenases yielding cholest-4-en-3-one and cholesta-1,4-diene-3-one, respectively (15, 16, 17). The 91

further degradation involves the oxidation of C26 primary carbon atom to 4-dafachronic acid (26-oic 92

acid; Fig. 1). The enzymes involved in this reaction sequence fundamentally differ in aerobic and 93

anaerobic bacteria. In aerobic Actinobacteria, the cytochrome p450 oxygenases Cyp125 or Cyp142 94

catalyze C26 hydroxylation and further oxidation to the C26-oic acid (18, 19). In contrast the denitrifying 95

Sterolibacterium denitrificans first hydroxylates the tertiary C25 with water by a Mo-dependent steroid 96

C25 dehydrogenase (C25DH) (20) followed by an apparent hydroxyl shift from tertiary C25 to primary 97

C26 by an unknown enzyme (21). The subsequent oxidation of the primary alcohol to the C26-oic acid is 98

then achieved by the action of putative cholesterol-induced alcohol and aldehyde dehydrogenases (22). 99

In both, aerobic and anaerobic cholesterol-degrading bacteria, an ATP-dependent acyl-coenzmye A 100

(CoA) synthetase (ACS) specific for C26-oic acid was identified and characterized (22, 23), (Fig. 1). 101

102

In all cholesterol degrading bacteria -oxidation of the C26-oyl-CoA intermediate yields androsta-1,4-103

diene-3,17-dione (ADD), two propionyl-CoA and one acetyl-CoA (Fig. 1). In Actinobacteria classical acyl-104

CoA dehydrogenases, enoyl-CoA hydratases, 3-hydroxyacyl-CoA dehydrogenases and thiolases are 105

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

involved (8). The only exception is the last C–C bond cleavage at a tertiary carbon atom, which is 106

catalyzed by an aldolase at the level of a -hydroxyacyl-CoA intermediate (24). In contrast, a recent 107

integrated multi omics study suggested that cholesterol side-chain degradation in Stl. denitrificans 108

proceeds via aldolytic cleavage of all 3-hydroxacyl-CoA intermediates to propionyl-CoA/acetyl-CoA and 109

the corresponding C24-/C22-aldehydes. The latter were proposed to be oxidized and activated to the 110

corresponding C24-/C22-oyl-CoAs (22). Consequently, the conventional 3-hydroxyacyl-CoA 111

dehydrogenase and thiolases would be replaced by aldolases, aldehyde dehydrogenases and ACS (Fig. 112

1). However, besides the C26-oic acid activating ACS, none of the proposed enzymes involved in anoxic 113

cholesterol side-chain degradation has been isolated and characterized, yet. Notably, the aldolytic 114

pathway proposed for cholesterol degradation in Stl. denitrificans for steroid side-chain degradation 115

resembles to that reported for aerobic cholate degradation (4, 14), demonstrating the composite 116

character of the anaerobic cholesterol degradation pathway. 117

118

After side-chain removal, degradation of the ADD formed again greatly differs in aerobic and anaerobic 119

steroid degrading bacteria. In the aerobic pathway, a series of oxygenase-dependent reactions results in 120

ring A and B cleavage via a name giving 9,10-seco intermediate, finally yielding the CD-rings containing 121

3a-H-4(3’propanoate)-7a-methylhexahydro-1,5-indanedione (HIP) and its CoA ester HIP-CoA (8). In 122

contrast, denitrifying bacteria degrade ring A by hydrolysis to 17-hydroxy-1-oxo-2,3-seco-androstan-3-123

oic acid via the 2,3-seco pathway (25). Nothing is known about ring B cleavage in anaerobic cholesterol 124

degrading denitrifying bacteria. But the identification of high-resolution masses fitting to HIP-CoA 125

suggested that this compound results from ring B cleavage in Stl. denitrificans and represents an 126

intermediate in both, aerobic and anaerobic cholesterol degradation (22) (Fig. 1). Very recently, 127

degradation of HIP-CoA to central intermediates was revealed in Actinobacteria, which involves two 128

distinct ring-cleaving hydrolases (26). Genomic analyses suggested that HIP-CoA is similarly degraded in 129

Stl. denitrificans and possibly other denitrifying bacteria (22). 130

131

In this work, we heterologously produced and characterized three ACS from Stl. denitrificans and 132

demonstrate that two of them are involved in side-chain degradation (specific for C24-, C22-oic acids 133

respectively), whereas the third ACS is involved in B-ring degradation (specific for HIP). The work 134

provides enzymatic evidence for the omics-based proposal for side-chain degradation and CD-rings 135

cleavage in an anaerobic, cholesterol-degrading model organism; it sheds light into the in large parts still 136

obscure anaerobic steroid degradation pathway. 137

138

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

Results 139

140

ACS genes involved in anaerobic cholesterol degradation. Recent MS-based analyses of metabolites in 141

Stl. denitrificans cells grown with cholesterol suggested a -oxidation-like side-chain degradation 142

pathway (21, 22, 27). With the cholesterol-induced gene product SDENChol_v1_11189, that specifically 143

catalyzed the ATP- and CoA-dependent formation of C26-oyl-CoA, the first enzyme of the proposed -144

oxidation sequence was isolated and characterized (22). Analyses of further metabolites suggested 145

aldolytic cleavage of C–C bonds during side-chain degradation, which would involve two additional C24- 146

and C22-oic acid converting ACS. Finally, a CoA-ester fitting to authentic HIP-CoA standard was identified 147

in whole cells during UPLC-coupled HRMS; its formation may be catalyzed by a further ACS (22). 148

149

Previous proteome analyses identified next to C26-oyl-CoA forming SDEN_v1_11189 three cholesterol-150

induced, ACS-like gene products (Table S1). Two of them, SDENChol_v1_10299 and SDENChol_v1_10305 151

were induced 1.45 and 2.35 (log2 ratios) in cells grown with cholesterol than with testosterone 152

respectively, which contains the sterane skeleton but which lacks the side-chain (22). This finding 153

suggests that the two ACS are involved in side-chain degradation. In contrast, a third ACS candidate 154

(SDENChol_v1_10766) was higher abundant in cells grown with cholesterol vs propionate but was not 155

induced in cells grown with cholesterol vs testosterone. Consequently, the latter is assumed to be 156

involved in sterane ring system degradation. 157

158

Heterologous production, purification and characterization of three ACS involved in anaerobic 159

cholesterol degradation. The genes encoding three putative ACS involved in anaerobic cholesterol 160

degradation, SDENChol_v1_10299, SDENChol_v1_10305, and SDENChol_v1_10766, were heterologously 161

expressed in a soluble form in E. coli BL21 with a N-terminal Strep-tag. The products were purified via 162

StrepTactin® affinity chromatography (see Material and Methods). SDS-PAGE analysis of the three highly 163

enriched enzymes revealed three soluble proteins at molecular masses of 65, 70 and 55 kDa fitting to 164

the theoretical masses of 65.1, 71.3 and 58.6 kDa with enrichment factors of 43.4, 18.4 and 33, 165

respectively (Fig. S2). 166

167

Kinetic properties of SDENChol_v1_10299, SDENChol_v1_10305, and SDENChol_v1_10766. The 168

heterologously produced ACS were tested for their substrate preference using numerous carboxylic 169

acids including 4-dafachronic acid (C26), 3-hydroxy-5-cholenic acid (C24), cholic acid and its 170

analogues desoxy- and lithocholic acid (C24 each), pregn-4-en-3-one-22-oic acid (C22), HIP (C13), 171

palmitic acid (C18), decanoic acid (C10), hexanoic acid (C6) and propionate (C3) as potential substrates. 172

Concentrations of all carboxylic acids tested were 0.3 mM in the presence of 7.8% (w/v) 2-173

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

hydroxypropyl--cyclodextrin as solubilizing agent. Addition of the latter largely increased the solubility 174

of the carboxylic acid substrates and in turn the activity of the individual ACS. The time-dependent 175

formation of CoA ester products was followed by UPLC-analysis in the presence of MgATP, CoA and the 176

individual, heterologously produced ACS. The identity of the reaction products were confirmed by co-177

elution during UPLC-analyses with standards, characteristic UV/vis spectra and LC-ESI/MS analyses (Fig. 178

S1, Fig. S3 and Table S2). No conversion was observed in any case when MgATP was omitted from the 179

assay. 180

181

SDENChol_v1_10299 showed the highest activity with the 3-hydroxy-5-cholenic acid (C24-oic acid), 182

whereas virtually no conversion of the C26-, C22-oic acids and shorter carboxylic acids was observed 183

(Table 1). These results strongly indicate that cholesterol-induced SDENChol_v1_10299 is specifically 184

involved in the activation of the side-chain degradation product 3-hydroxy-5-cholenic acid to its CoA 185

ester. It also activated the C24 bile acids litocholic acid, cholic acid and deoxycholic acids to their 186

respective CoA thioester at lower rates, suggesting that the chain-length rather than modifications at 187

the sterane ring system governs the substrate preference. In contrast SDENChol_v1_10305 only 188

converted pregn-4-en-3-one-22-oic acid to its CoA ester, whereas it was apparently inactive (<0.1%) 189

with all other carboxylic acids tested (Table 1). In conclusion, the gene product is now assigned to as a 190

specific pregn-4-en-3-one-22-oyl-CoA synthetase. Notably, the 4-dafachronic acid (C26-oic acid), the 191

preferred substrate of the recently characterized SDENChol_v1_11189 was not converted by 192

SDENChol_v1_10299 or SDENChol_v1_10305. These results suggest that all three ACS are involved in 193

side-chain degradation with a strong preference for the chain-length of the individual substrates. 194

SDENChol_v1_10766 neither converted any of the C26-/C24- /C22-oic acid substrates nor any of the 195

aliphatic fatty acids. Instead, it showed a high activity with HIP, indicating that it plays a role in the 196

activation of the CD rings containing carboxylic acid (Table 1). 197

198

Using the coupled spectrophotometric assay, the initial rates of all three ACS strongly depended on the 199

substrate concentration. A fit to Michaelis-Menten curves revealed Km-values of SDENChol_v1_10299, 200

SDENChol_v1_10305, and SDENChol_v1_10766 for their individual preferred carboxylic acid substrates 201

(74-156 µM) as well as kcat-values (1.8-10.8 s-1); the results are summarized in Table 2. 202

203

ACS activities in extracts from cells grown with different substrates. The substrate preference of the 204

three ACS for side-chain-containing C24- and C22-oic acids or for HIP suggested a specific role in steroid 205

degradation, whereas they should not be required during growth with propionate. This finding is in full 206

agreement with the differential induction of the individual genes during growth on different carbon 207

sources (22). To further analyze the differential induction of ACS activities, we tested extracts grown 208

with cholesterol and propionate using different carboxylic acid substrates. The activities with the 209

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

individual carboxylic substrates of all three ACS were induced by a factor of 6 to 9 in cells grown with 210

cholesterol vs propionate strongly confirming their specific role in anaerobic cholesterol degradation 211

(Table 3). 212

213

Phylogenetic analyses of ACS involved in steroid degradation. Using BLAST a total of 14 putative genes 214

encoding ACS were identified in the genome of Stl. denitrificans (Expect value threshold = e–14). A 215

multiple sequence alignment with the clustalW program revealed that the experimentally verified ACS 216

from Stl. denitrificans specific for C26-oic acid and HIP cluster with the corresponding FadD19 and FadD3 217

enzymes involved in cholesterol degradation in M. tuberculosis H37v, R. jostii RHA1, respectively (Fig. 2). 218

In contrast, the closest related enzymes to the Stl. denitrificans ACS specific for C24-, C22-oic acids are 219

those involved in bile acid degradation in R. jostii RHA1 and Pseudomonas sp. DOC21. According to the 220

relationship to corresponding enzymes from E. coli, two further putative ACS of Stl. denitrificans most 221

likely function as acetate and propionate activating enzymes, whereas the function of the remaining five 222

putative ACS remains elusive. 223

224

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

Discussion 225

226

The three heterologously produced and characterized ACS from Stl. denitrificans Chol1S in this work, 227

together with a recently identified C26-oyl-CoA forming ACS show all remarkable specificities for their 228

individual C26-, C24-, C22-oic acid and HIP substrates, respectively. Two of which show similarities to 229

enzymes involved in aerobic cholesterol degradation (C26-oyl-CoA and HIP-CoA forming), whereas the 230

other two are rather related to enzymes involved in bile acid degradation and are absent in aerobic 231

cholesterol degradation (C24-, and C22-oyl-CoA forming). This finding corroborates the composite 232

anaerobic steroid degradation pathway involving numerous CoA-ester dependent/independent reaction 233

sequences known from aerobic cholesterol or bile acid degradation. 234

235

The three ACS involved in side-chain degradation strictly discriminate between the structurally related 236

C26-, C24-, C22-oic acids that strongly supports their assignment to individual carboxylic acid substrates 237

of cholesterol side-chain degradation. The assignment of SDENChol_v1_10766 to a highly specific HIP-238

CoA synthetase appears to be less clear as no structurally related substrate analogues that could serve 239

as potential intermediates in anaerobic steroid degradation were available. However, the kcat of the 240

enzyme from Stl. denitrificans is in a similar range (3.7 s-1) as the one reported for HIP-CoA synthetase 241

from R. jostii RHA1 (kcat 7.1 s-1) (28). Thus, the steady-state kinetic properties of SDENChol_v1_10766 242

support that HIP or a structurally closely related analogue act as an intermediate of anaerobic 243

cholesterol degradation. Moreover, previous studies identified clustered, cholesterol-induced genes in 244

Stl. denitrificans (22), that are highly similar to those involved in -oxidation of HIP-CoA to 4-methyl-5-245

oxooctanedioyl-CoA in other organisms (26). In conclusion, both findings together suggest that CD-ring 246

degradation proceeds via identical or highly similar pathways in aerobic and anaerobic cholesterol 247

degrading bacteria. 248

249

The identification of ACS specific for C24-oic and C22-oic acids in Stl. denitrificans is in full agreement 250

with the recently proposed aldolytic C–C-bond cleavage during isoprenoid side-chain -oxidation (22). 251

The classical thiolytic C–C cleavage of -oxidation yields two CoA-esters from a -ketoacyl-CoA 252

intermediate, whereas the aldolytic C–C cleaving mechanism yields an aldehyde plus acetyl-CoA or 253

propionyl-CoA. As a result the aldehyde has to be oxidized to a carboxylic acid, followed by an ACS 254

(AMP-forming) dependent thioesterification to initiate a new round of -oxidation. On the first view, 255

this strategy appears to be energetically less efficient than thiolytic cleavage as two additional 256

phosphoanhydride bonds are hydrolyzed for each -oxidation reaction sequence, assuming that the 257

pyrophosphate formed by AMP-forming ACS is readily hydrolyzed by a pyrophosphatase. Consequently, 258

anaerobic cholesterol degradation via two aldolytic side-chain cleavages yields four ATP less than via the 259

thiolytic pathway. However, the insights into the anaerobic cholesterol degradation pathway obtained 260

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

so far suggest that in total around ten acetyl-CoA/propionyl-CoA units plus one succinyl-CoA are formed 261

from cholesterol, that are fully oxidized in the tricarboxylic acid cycle. Taken into account that NADH 262

oxidation coupled to denitrification yields more than one ATP per NADH oxidized (29), the four 263

additional ATP consumed during aldolytic side-chain degradation will only slightly effect the overall ATP 264

yield. Thus, energetic considerations appear to be rather marginal when comparing the employment of 265

the aldolytic vs the thiolytic side-chain degradation pathway. A possible much more important point is 266

that the aldolytic pathway comprises with the NAD+-dependent aldehyde oxidation to a carboxylic acid 267

(G°’ ≈ –45 kJ mol-1) (30) and the CoA-ester formation by AMP-forming ACS/pyrophosphatase (G°’ ≈ –268

20 kJ mol-1) two highly exergonic steps that are missing in the thiolytic pathway. In contrast, the latter 269

involves an unfavorable reaction that is missing in the aldolytic pathway: the oxidation of -hydroxyacyl-270

CoA to -ketoacyl-CoA with NAD+ as electron acceptor (G°’ ≈ +25 kJ mol-1), that almost compensates 271

for the subsequent exergonic -ketothiolase reaction G = –25.1 kJ mol-1 (31). In conclusion, the 272

equilibrium of the aldolytic pathway is clearly more shifted in the oxidative direction in comparison to 273

the thiolytic one, which will strongly promote the unidirectionality of the overall catabolic pathway. 274

275

The question rises why denitrifying steroid degrading bacteria employ an aldolytic pathway? The most 276

probably rate limiting step in anaerobic cholesterol degradation is the formation of the C26-hydroxy 277

species via a tertiary C25-hydroxy intermediate. This conversion of a tertiary to a primary alcohol is 278

unprecedented in biology and probably highly unfavorable; it might be only possible if highly exergonic 279

downstream -oxidation reactions pull the reaction forward. This assumption is in accordance with 25-280

OH-cholest-4-en-3-one (and its ring A 1,4-diene analogue) representing the highest abundant 281

metabolites in MS-based analyses (22), indicating that its conversion is rate-limiting in the overall 282

degradation pathway. Thus, the rational of using the energetically less efficient aldolytic instead of the 283

thiolytic pathway may be to provide a virtually irreversible reaction sequence to drive an unfavorable, 284

rate-limiting reaction forward. 285

286

It is obvious, that in bacteria specialized for using fatty acids and steroids as growth substrates the 287

number of ACS is usually high (>>10). Indeed, phylogenetic analyses with Stl. denitrificans identified next 288

to the experimentally verified four ACS, ten further genes encoding putative ACS. Among them, the 289

SDENCholv1_20262 and SDENCholv1_20218 most possibly code for propionyl-CoA and acetyl-CoA 290

synthetases, respectively, according to their similarities to experimentally verified enzymes (Fig. 2). The 291

function of the remaining seven putative ACS cannot be easily predicted. Likely functions are the 292

activation of aliphatic fatty acids with chain-length longer than C3, e.g. palmitic acid, a known growth 293

substrate of Stl. denitrificans (32), or the activation of C26-oic acid analogues during growth with -294

sitosterol, stigmasterol or ergosterol (6). Finally, hydrolytic cleavage of ring A yields in denitrifying 295

steroid degraders 1,17-dioxo-2,3-seco-androstan-3-oic acid (DSAO) (25), that needs to be activated to a 296

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

CoA thioester to initiate a new round of -oxidation (22). Taken together, Stl. denitrificans contains a 297

highly versatile inventory of ACS as a result of its specialization for steroid and fatty acid growth 298

substrates. 299

300

Material and Methods 301

302

Materials. Cholest-4-en-3-one-26-oic acid (analytical standard), pregn-4-en-3-one-22-oic acid, 3β-303

hydroxycholenic acid, lithocholic acid, cholic acid, deoxycholic acid, palmitic acid, decanoic acid, 304

hexanoic acid and propionic acid and CoA were purchased from Sigma-Aldrich (Darmstadt, Germany), 305

Cayman Chemicals (Ann Arbor, Michigan, USA) or Santa Cruz Biotechnology (Heidelberg, Germany). In 306

addition to the HIP synthesized by the authors (see below), it was kindly provided by Prof. L. Eltis (Dept. 307

Microbiology & Immunology, University of British Columbia, Vancouver, Canada). Other chemicals and 308

reagents were of analytical or HPLC grade. Sterolibacterium denitrificans Chol1S (DSM = 13999) was 309

obtained from the Deutsche Sammlung für Mikroorganismen und Zellkulturen (DSMZ; Braunschweig, 310

Germany). 311

312

Cloning of acs genes. Cholesterol-grown cells were used as template for extraction of genomic DNA 313

using the Illustra bacteria genomicPrep (GE Healthcare). The genes encoding putative ACS were 314

amplified with specific primers (Table 4); a N-terminal Strep-tag was fused to each subunit. After 315

restriction and ligation into the vector pASK-IBA15plus (IBA Lifesciences) the construct was transformed 316

into Escherichia coli BL21(DE3) (New England Biolabs). 317

318

Heterologous expression of genes and protein purification. E. coli cells expressing the individual genes 319

encoding ACS were grown in LB-media at 30 °C. At an OD600 of 0.6, gene expression was induced with 320

250 µM isopropyl β-D-1-thiogalactopyranoside. Growth temperature was subsequently set to 16°C and 321

cells were harvested after 18 h. 5 g cells were suspended in buffer A (50 mM HEPES/HCl pH 7.5, 150 mM 322

potassium chloride) with 0.1 mg ml-1 DNAse I and lysed using a French pressure cell. The cell lysate was 323

ultracentrifuged and applied to a Strep-Tactin® affinity column (GE Healthcare) using an FPLC System 324

(ÄKTA purifier, GE Healthcare). Removal of non-specifically bound proteins and elution of the 325

heterologously expressed proteins was conducted using buffer A and buffer A containing 5 mM 326

desthiobiothin, respectively. The eluted protein was concentrated using a centrifugal concentrator 327

(Sartorius). Protein concentration was determined with the Bradford method (33) and protein purity 328

was determined by SDS-PAGE. 329

330

Spectrophotometric enzyme assays. For determination of specific ACS activities in cell extracts the 331

time-dependent formation of CoA esters was followed using a discontinuous, ultra performance liquid 332

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

chromatography (UPLC®)-based assay (see below). Specific activities of heterologously produced ACS 333

were conducted using a spectrophotometric assay that coupled AMP formation to NADH oxidation as 334

described (28) with slight modifications. Reactions were performed in a total volume of 0.1 mL with 0.1 335

M HEPES buffer (pH 8), containing 1 mM CoA, 1.5 mM ATP, 1 mM PEP, 4 units pyruvate kinase, 4 units 336

adenylate kinase, 4 units lactate dehydrogenase, 500 µM of NADH, 2.5 mM MgCl2, 2 mM DTE, 7.8% 337

(w/v) 2-hydroxypropyl--cyclodextrin and 787 nM SDENchol_10299, 328 nM SDENchol_10305 or 820 338

nM SDENchol_10766. The mixture was incubated 5 min at 30°C and the reaction was initiated by adding 339

300 µM of the respective carboxylic acid substrate (from 5-10 mM stock, dissolved in 70% isopropanol). 340

All measurements were recorded on a Varian Cary 100 BIO UV/Vis spectrophotometer with the standard 341

software CaryWinUV Kinetics (Version 3.00). 342

343

Synthesis of HIP. A mixture of 5α-OH-HIP and 7β-OH-HIP was purified from cultures of P. stutzeri Chol1 344

Δscd3A with 12 mM succinate and 1 mM deoxycholate as described (34). After complete transformation 345

of deoxycholate to HIPs, the supernatant was acidified to pH 2-3 with HCl and extracted with 346

ethylacetate. HIPs were resolved in MilliQ-H2O. Complete transformation of deoxycholate and purity of 347

HIPs was determined by LC-MS analysis as described for other steroid compounds (35). 348

349

Ultra performance liquid chromatography (UPLC®) analysis of CoA esters. The products formed by 350

purified ACS or cell extracts were analyzed by an UPLC-based assay using a Waters Acquity H-class UPLC 351

system equipped with diode array detector (Waters, Eschborn, Germany) and a Knauer Bluespher 100-2 352

C18 column (2 mm x 100 mm, 2 µm particle size, Knauer, Berlin, Germany). Samples (50 µL) were 353

precipitated by addition of 25 µL 50% (v/v) 1 M HCl or 100 µL MeOH and the supernatant was applied 354

onto the column. If necessary (low concentrations) CoA-esters were enriched by solid phase extraction 355

as described elsewhere (36). For UPLC analyses, a gradient of 15-90 % acetonitrile in 10 mM ammonium 356

acetate buffer and a flow rate of 0.3 mL min-1 were used for separation. Identification of the individual 357

CoA esters was accomplished by their retention times, their UV/vis spectra and by high resolution mass 358

spectrometry (HRMS, see below), (Table S2). 359

360

Liquid chromatography-mass spectrometry (LC-MS). CoA-esters were analyzed using a Waters Acquity 361

I-class UPLC system with a Knauer Bluespher 100-2 C18 column (2 mm x 100 mm, 2 µm particle size, 362

Knauer, Berlin, Germany) coupled to a Waters Synapt G2-Si HDMS electrospray ionization 363

(ESI)/quadrupole time-of-flight (Q-TOF) system (Waters, Eschborn, Germany). A gradient of 15-90 % 364

acetonitrile in 10 mM ammonium acetate buffer and a flow rate of 0.3 mL/min were used for 365

separation. Any compounds were measured in MS positive mode with a capillary voltage of 3 kV, 150 °C 366

source temperature, 450°C desolvation temperature, 1000 L min–1 N2 desolvation gas flow and 100 L 367

min–1 N2 cone gas flow. Collision induced dissociation of precursor ions was performed using a collision 368

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

energy of 20 V. LC/UV-vis analyses were conducted on a Waters Acquity H-class UPLC with a Knauer 369

Eurospher C18 column and the same gradient as described above. Evaluation of LC/MS metabolite data 370

was performed using MassLynx (Waters); for evaluation of LC/UV-vis data MassLynx or Empower 371

(Waters) was used. CoA esters were verified by detection of their characteristic fragment ion at m/z = 372

428.0367 (35). 373

374

Phylogenetic analyses. The protein sequences of ACS detected in the genome of Stl. denitrificans were 375

aligned with a set of published sequences (identification numbers are given in brackets). Phylogenetic 376

analyses were done at the server of www.phylogeny.fr (37) by using the MUSCLE algorithm (default 377

parameters), Gblocks was used for data curation (default parameters) and PhyML for phylogenetic 378

tree construction by maximum-likelihood method, built with 3000 bootstrap replicates. The resulting 379

tree was exported as newick format and visualized in MEGA 7 (38). 380

381

382

ACKNOWLEDGEMENTS 383

This work was funded by the German research council (DFG, BO 1565, 10-2, 14-1). We thank Mario 384

Mergelsberg, University of Freiburg for the help with MS measurements and data handling. We thank 385

Dr. Lindsay D. Eltis, University of British Columbia for providing substrates for enzymatic assays. 386

387 on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

References 388

1. Nes WD. 2011. Biosynthesis of cholesterol and other sterols. Chem Rev 111:6423-51. 389

2. Khanal SK, Xie B, Thompson ML, Sung S, Ong SK, Van Leeuwent J. 2006. Fate, transport, and 390

biodegradation of natural estrogens in the environment and engineered systems. Environ Sci 391

Technol 40:6537-46. 392

3. Barbosa MO, Moreira NF, Ribeiro AR, Pereira MF, Silva AM. 2016. Occurrence and removal of 393

organic micropollutants: An overview of the watch list of EU Decision 2015/495. Water Res 394

94:257-79. 395

4. Holert J, Kulić Ž, Yücel O, Suvekbala V, Suter MJ, Möller HM, Philipp B. 2013. Degradation of the 396

acyl side chain of the steroid compound cholate in Pseudomonas sp. strain Chol1 proceeds via 397

an aldehyde intermediate. J Bacteriol 195:585-95. 398

5. Wikvall K. 2001. Cytochrome P450 enzymes in the bioactivation of vitamin D to its hormonal 399

form (review). Int J Mol Med 7:201-9. 400

6. Warnke M, Jung T, DermerJ, Hipp K, Jehmlich N, Bergen M, Ferlaino S, Fries S, Müller M, Boll M. 401

2016. 25-Hydroxyvitamin D3 Synthesis by Enzymatic Steroid Side-Chain Hydroxylation with 402

Water. Angewandte Chemie (International ed. in English) 55 (5):1881–1884. 403

7. García JL, Uhía I, Galán B. 2012. Catabolism and biotechnological applications of cholesterol 404

degrading bacteria. Microb Biotechnol 5:679-99. 405

8. Wipperman MF, Sampson NS, Thomas ST. 2014. Pathogen roid rage: cholesterol utilization by 406

Mycobacterium tuberculosis. Crit Rev Biochem Mol Biol 49:269-93. 407

9. Van der Geize R, Yam K, Heuser T, Wilbrink MH, Hara H, Anderton MC, Sim E, Dijkhuizen L, 408

Davies JE, Mohn WW, Eltis LD. 2007. A gene cluster encoding cholesterol catabolism in a soil 409

actinomycete provides insight into Mycobacterium tuberculosis survival in macrophages. Proc 410

Natl Acad Sci USA 104:1947-52. 411

10. Horinouchi M, Hayashi T, Kudo T. 2012: Steroid degradation in Comamonas testosteroni. J 412

Steroid Biochem Mol Biol 129:4–14. 413

11. Mohn WW, Wilbrink MH, Casabon I, Stewart GR, Liu J, van der Geize R, Eltis LD. 2012. Gene 414

cluster encoding cholate catabolism in Rhodococcus spp. J Bacteriol 194:6712-9. 415

12. Holert J, Alam I, Larsen M, Antunes A, Bajic VB, Stingl U, Philipp B. 2013. Genome Sequence of 416

Pseudomonas sp. Strain Chol1, a Model Organism for the Degradation of Bile Salts and Other 417

Steroid Compounds. Genome Announc 1(1):e00014-12. 418

13. Holert J, Jagmann N, Philipp B. 2013. The essential function of genes for a hydratase and an 419

aldehyde dehydrogenase for growth of Pseudomonas sp. strain Chol1 with the steroid 420

compound cholate indicates an aldolytic reaction step for deacetylation of the side chain. J 421

Bacteriol 195:3371-80. 422

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

14. Barrientos Á, Merino E, Casabon I, Rodríguez J, Crowe AM, Holert J, Philipp B, Eltis LD, Olivera 423

ER, Luengo JM. 2015. Functional analyses of three acyl-CoA synthetases involved in bile acid 424

degradation in Pseudomonas putida DOC21. Environ Microbiol 17:47-63. 425

15. Simard J, Ricketts ML, Gingras S, Soucy P, Feltus FA, Melner MH. 2005. Molecular biology of the 426

3beta-hydroxysteroid dehydrogenase/delta5-delta4 isomerase gene family. Endocr Rev 26:525-427

82. 428

16. Vrielink A, Ghisla S. 2009. Cholesterol oxidase: biochemistry and structural features. FEBS J 429

276:6826-43. 430

17. Chiang YR, Ismail W, Heintz D, Schaeffer C, Van Dorsselaer A, Fuchs G. 2008. Study of anoxic and 431

oxic cholesterol metabolism by Sterolibacterium denitrificans. J Bacteriol 190:905-14. 432

18. Rosłoniec KZ, Wilbrink MH, Capyk JK, Mohn WW, Ostendorf M, van der Geize R, Dijkhuizen L, 433

Eltis LD. 2009. Cytochrome P450 125 (CYP125) catalyses C26-hydroxylation to initiate sterol 434

side-chain degradation in Rhodococcus jostii RHA1. Mol Microbiol 74:1031-43. 435

19. Driscoll MD, McLean KJ, Levy C, Mast N, Pikuleva IA, Lafite P, Rigby SE, Leys D, Munro AW. 2010. 436

Structural and biochemical characterization of Mycobacterium tuberculosis CYP142: evidence 437

for multiple cholesterol 27-hydroxylase activities in a human pathogen. J Biol Chem 285:38270-438

82. 439

20. Dermer J, Fuchs G. 2012. Molybdoenzyme that catalyzes the anaerobic hydroxylation of a 440

tertiary carbon atom in the side chain of cholesterol. J Biol Chem 287:36905-16. 441

21. Wang PH, Lee TH, Ismail W, Tsai CY, Lin CW, Tsai YW, Chiang YR. 2013. An oxygenase-442

independent cholesterol catabolic pathway operates under oxic conditions. PLoS One 8:e66675. 443

22. Warnke M, Jacoby C, Jung T, Agne M, Mergelsberg M, Starke R, Jehmlich N, von Bergen M, 444

Richnow HH, Brüls T, Boll M. 2017. A patchwork pathway for oxygenase-independent 445

degradation of side chain containing steroids. Environ Microbiol 19: 4668-4699. 446

23. Casabon I, Swain K, Crowe AM, Eltis LD, Mohn WW. 2014. Actinobacterial acyl coenzyme A 447

synthetases involved in steroid side-chain catabolism. J Bacteriol 196:579-87. 448

24. Gilbert S, Hood L, Seah SYK. 2017. Characterization of an aldolase involved in cholesterol side 449

chain degradation in Mycobacterium tuberculosis. J Bacteriol. doi:10.1128/JB.00512-17. 450

25. Wang PH, Leu YL, Ismail W, Tang SL, Tsai CY, Chen HJ. 2013. Anaerobic and aerobic cleavage of 451

the steroid core ring structure by Steroidobacter denitrificans. J Lipid Res 54: 452

1493-504. 453

26. Crowe AM, Casabon I, Brown KL, Liu J, Lian J, Rogalski JC, Hurst TE, Snieckus V, Foster LJ, Eltis LD. 454

2017. Catabolism of the last two steroid rings in Mycobacterium tuberculosis and other bacteria. 455

MBio 8(2): e00321-17. 456

27. Lin CW, Wang PH, Ismail W, Tsai YW, El Nayal A, Yang CY, Yang FC, Wang CH, Chiang YR. 2015. 457

Substrate uptake and subcellular compartmentation of anoxic cholesterol catabolism in 458

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

Sterolibacterium denitrificans. J Biol Chem 290:1155-69. 459

28. Casabon I, Crowe AM, Liu J, Eltis LD. 2013. FadD3 is an acyl-CoA synthetase that initiates 460

catabolism of cholesterol rings C and D in actinobacteria. Mol Microbiol 87:269-83. 461

29. Strohm TO, Griffin B, Zumft WG, Schink B. 2007. Growth yields in bacterial denitrification and 462

nitrate ammonification. Appl Environ Microbiol 73:1420-4. 463

30. Simon H, White H, Lebertz H, Thanos I. 1987. Reduktion von 2-Enoaten und Alkanoaten mit 464

Kohlenmonoxid oder Formiat, Viologenen und Clostridium thermoaceticum zu gesättigten 465

Säuren und ungesättigten bzw. gesättigten Alkoholen. Angewandte Chemie 99:785-787. 466

31. Thauer RK, Jungermann K, Decker K. 1977. Energy conservation in chemotrophic anaerobic 467

bacteria. Bacteriol Rev 41:100-80. 468

32. Tarlera S, Denner EB. 2003. Sterolibacterium denitrificans gen. nov., sp. nov., a novel 469

cholesterol-oxidizing, denitrifying member of the beta-Proteobacteria. Int J Syst Evol Microbiol 470

53:1085-91. 471

33. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities 472

of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248-54. 473

34. Holert J, Yücel O, Jagmann N, Prestel A, Möller HM, Philipp B. 2016. Identification of bypass 474

reactions leading to the formation of one central steroid degradation intermediate in 475

metabolism of different bile salts in Pseudomonas sp. strain Chol1. Environ Microbiol 18: 3373–476

89. 477

35. Yücel O, Drees S, Jagmann N, Patschkowski T, Philipp B. 2016. An unexplored pathway for 478

degradation of cholate requires a 7α-hydroxysteroid dehydratase and contributes to a broad 479

metabolic repertoire for the utilization of bile salts in Novosphingobium sp. strain Chol11. 480

Environ Microbiol 18: 5187–203. 481

36. Gan-Schreier H, Okun JG, Kohlmueller D, Langhans CD, Peters V, Ten Brink HJ, Verhoeven NM, 482

Jakobs C, Voelkl A, Hoffmann GF. 2005. Measurement of bile acid CoA esters by high-483

performance liquid chromatography-electrospray ionisation tandem mass spectrometry (HPLC-484

ESI-MS/MS). J Mass Spectrom 40:882-9. 485

37. Dereeper A, Guignon V, Blanc G, Audic S, Buffet S, Chevenet F, Dufayard JF, Guindon S, Lefort V, 486

Lescot M, Claverie JM, Gascuel O. 2008. Phylogeny.fr: robust phylogenetic analysis for the non-487

specialist. Nucleic Acids Res 36:W465-9. 488

38. Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular Evolutionary Genetics Analysis Version 489

7.0 for Bigger Datasets. Mol Biol Evol 33:1870-4. 490

491

492

493

494

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

Table 1: Substrate preference of the of heterologously produced SDENChol_v1_10299, 495 SDENChol_v1_10305 and SDENChol_v1_10766. 496

497

Substrate SDENChol

v1_10299

SDENChol

v1_10305

SDENChol

v1_10766

4-dafachronic acid

(C26)

0.1% < 0.1% < 0.1%

3-hydroxy-5-

cholenic acid (C24)

100% < 0.1% < 0.1%

lithocholic acid (C24)

39.8% < 0.1% < 0.1%

cholic acid (C24)

14.4% < 0.1% < 0.1%

deoxycholic acid (C24)

11.8% < 0.1% < 0.1%

pregn-4-en-3-one-22-

oic acid (C22)

0.1% 100% < 0.1%

palmitic acid

< 0.1% < 0.1% < 0.1%

decanoic acid

< 0.1% < 0.1% < 0.1%

hexanoic acid < 0.1% < 0.1% < 0.1%

propionate

< 0.1% < 0.1% < 0.1%

3α-4α-3-propanoate-

7α,β-metylhexahydro-

1,5-indanedione (C13)

< 0.1% < 0.1% 100%

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

Table 2: Apparent steady-state kinetic parameters for ACS involved in cholesterol degradation of Stl. denitrificans. 498

Mean values of three biological replicates are shown with the respective standard error. 499

Enzyme Substrate

Km-value

[µM] kcat [s-1]

Kcat/Km

[105 M-1 s-1] Reference

SDENChol_v1_11189 C26-4-dafachronic acid 310 ± 50

1.1 ± 0.19 0.035 (5)

SDENChol_v1_10299 C24-3β-hydroxy-Δ5-cholenic

acid

73 ± 14 10.78 ± 0.53 1.5 This work

SDENChol_v1_10305 C22-pregn-4-en-3-one-22-oic

acid

172 ± 20 1.83 ± 0.08 0.11 This work

SDENChol_v1_10766 C13-3aα-H-4α(3′-propanoate)-

7aβ- methylhexahydro-1,5-

indanedione (HIP)

156 ± 25 3.76 ± 0.24 0.24 This work

500

501

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

Table 3: Kinetic parameters of ACS activities in extracts from cells grown with cholesterol and propionate. The 502

mean values of three biological replicates with respective standard deviations are shown. 503

504

ACS substrates

Cholesterol

Vmax [nmol min-1 mg-1]

Propionate

Vmax [nmol min-1 mg-1]

C24-3β-hydroxy-Δ5-cholenic acid 244 ± 11.2 31 ± 3.8

C22-Pregn-4-en-3-one-22-oic acid 98 ± 6.5 11 ± 2.1

C13-3aα-H-4α(3′-propanoate)-7aβ-

methylhexahydro-1,5-indanedione (HIP) 112 ± 6.9 12 ± 1.4

505

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

Table 4. Primers used for heterologous expression of ACS genes. 506

507

508

509

510

511

512

513

514

515

516

517

518

519

520

521

522

523

Figure legends 524

525

Figure 1. Aerobic (A) and anaerobic (B) cholesterol degradation pathway. The involvement of ATP-526

dependent acyl-CoA synthetases (ACS) is indicated; in the anaerobic pathway only the first ACS acting on 527

C26-oic acid has been isolated and characterized at the beginning of this work. ACDH, acyl-CoA 528

dehydrogenase; ECH, enoyl-CoA hydratase; HADH, 3-hydroxyacyl-CoA dehydrogenase; THL, thioloase; 529

ALD, aldolase; ALDH, aldehyde dehydrogenase. 530

531

Figure 2. Phylogenetic analysis of ACS from Stl. denitrificans (bold) and other steroid-degrading 532

organisms. The clustering of ACS specific for individual substrates is shown with the four experimentally 533

verified ACS being highlighted in red: C26ACS, 4-dafachronic acid; C24ACS, 3-hydroxy-5-cholenic 534

acid; C22ACS, pregn-4-en-3-one-22-oic acid; HIPACS, HIP. The accession numbers are given. The scale 535

bar represents the number of substitutions per site. 536

Primer Sequence (5´-3´) Ta (°C) Restriction site

SDENv1_10299 forw (C24-ACS)

GGAGGCGGTACCACGGAAGCGCTGAAAC

56 KpnI

SDENv1_10299 rev (C24-ACS)

GGTGGAAAGCTTCTCAGTCGCGTTCAAAATC

55 HindIII

SDENv1_10305 forw (C22-ACS)

GGAGGCGGTACCGCAATTCCCCGCGAAG

56 KpnI

SDENv1_10305 rev (C22-ACS)

GGTGGAAAGCTTATCGGTAGTTTAGACGCC

54 HindIII

SDENv1_10766 forw (HIP-ACS)

GGAGGCGAATTCTCGCCGTTGCCGCAAAC

60 EcoRI

SDENv1_10766 rev (HIP-ACS)

GCCTCCAAGCTTGGAGTACGAATCAGCGCAACTGATAC

61 HindIII

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from

on August 11, 2019 by guest

http://aem.asm

.org/D

ownloaded from