Ghent University

Faculty of Science

Department Biology

Academic year 2013 – 2015

Functional analysis of effectors secreted by the root-knot

nematode Meloidogyne graminicola.

Firehiwot Birhane Eshetu

Promoter: Prof. Dr. Godelieve Gheysen

Supervisor: Diana Naalden (PhD student)

Thesis submitted to obtain the degree of

Master of Science in Nematology

1 |

Functional analysis of effectors secreted by the root-knot

nematode Meloidogyne graminicola

Firehiwot Birhane Eshetu

Ghent University, Department of Biology, K.L. Ledeganckstraat 35, B-9000 Ghent, Belgium

Summary- The root-knot nematode Meloidogyne graminicola is considered the most damaging

Meloidogyne species on rice (Oryza sativa L.) and management towards this nematode is needed.

Understanding the molecular interaction between M. graminicola and its host plant may lead to new

control strategies. In previous studies, candidate effectors of M. graminicola were identified from

pre-parasitic second stage juvenile using 454 sequencing technology. Effectors were selected for

study that have no homology with already known parasitism genes from other nematode species and

for which the function is not known. In this study, we focused on Mg-UK52. To analyse the

subcellular localization of Mg-UK52, it was fused to eGFP on its carboxyl (C)-terminus) and it was

observed in the cytoplasm and nucleus, while addition of a signal peptide (Mg-UK52+SP) targeted

the fusion protein to the outer cell surface. As many effectors suppress plant defense, it was tested

if Mg-UK52 could suppress reactive oxygen species (ROS) production induced by perception of the

bacterial peptide flg22. ROS production was enhanced by Mg-UK52 and Mg-UK52 fused to eGFP

at the C-terminus, whereas suppression was shown with Mg-UK52 +SP eGFP fused at the C-

terminus. We demonstrated that the programmed cell-death in tobacco leaves mediated by

recognition of Avr2 by R2, was suppressed by Mg-UK52 fused to eGFP on its C-terminus but not

by Mg-UK52 fused to eGFP from its amino (N)-terminus. We, therefore, conclude that M.

graminicola most likely employs Mg-UK52 to suppress effector triggered plants defense by

pursuing cytoplasm and nucleus as site of action. In this study, some preliminary study trails were

performed on three effectors of M. graminicola Mg-UK67, Mg-UK50 and Mg-UK8+SP using

RNAi, yeast-two hybrid, and transformation, respectively.

Keywords: - Meloidogyne graminicola, effectors, subcellular localization, AVR2/R2, flg22, ROS,

Y2H, Hypersensitive response

2 |

The rice root-knot nematode Meloidogyne graminicola is a sedentary endoparasitic nematode with

a wide host range. It parasitizes mainly rice, wheat, oats, bush bean, sorghum, pearl millet and

grasses (Panka et al., 2010; Dutta et al., 2012; Upadhyay et al., 2014). Recently M. graminicola is

becoming an important threat to rice production system both in tropics and sub-tropics especially

where dry aerobic rice cultivation system is adapted (Soriano & Reversat, 2003; De Waele & Elsen,

2007; Dutta et al., 2012). Shifting in rice production system from irrigation to upland system occurs

because of decreasing fresh-water availability. The aerobic soil conditions create a suitable

environment for rapid buildup of nematode populations (Soriano et al., 2000; De Waele & Elsen,

2007; Haegeman et al., 2013). The life cycle of M. graminicola is completed in 19 days under 22-

29°C which is the optimal temperature range (Jones & Goto, 2011 ; Dutta et al., 2012; Ji et al.,

2013). The second stage juveniles (J2) penetrate the root closely behind the root tip puncturing the

cells by their stylet. They migrate intercellularly towards the root apex, where they immediately

form a U-turn and move upwards to the vascular cylinder where they settle to initiate a feeding site

“giant cell” (Kyndt et al., 2013). Successively, their life cycle continues by moulting from J2 to J3

and J4 until they become adult females. The female lays her egg mass inside the root. Newly hatched

juveniles can either reinfect the same root or migrate to adjacent roots (Ji et al., 2013). Hook-like

galling of the root tip, stunting, chlorosis and distorted and crinkled appearance of newly emerged

leaves are the characteristic symptoms observed on infected rice plants. Economically, M.

graminicola together with M. incognita are estimated to cause up to 70% rice yield losses at field

level (Kyndt et al., 2014).

Meloidogyne graminicola is a biotrophic pathogen that build up an intimate relationship with host

plants to accomplish successfully its life cycle (Hewezi & Baum, 2013). Induction of giant cells

inside the host’s tissue is a means to establish a close cellular relationship with the host and a key

3 |

factor for the sedentary life style. The giant cells are physiologically active, multinucleated

hypertrophied cells formed by repeated acytokinetic mitosis and contain as many as 100 nuclei

(Caillaud et al., 2008; de Almeida engler et al., 2011; Jones & Goto, 2011 ). Subsequently, the giant

cells function permanently as nutrient sink for the nematode. Principal suppression or avoiding the

plants defense throughout the lifetime of the feeding structure is therefore crucial (Haegeman et al.,

2012). Additional to giant cell formation, these nematodes change the cells surrounding the feeding

site which results visible morphological changes; a gall-like organ (Ji et al., 2013; Bartlem et al.,

2014).

All these changes to host tissues are modulated by parasitism proteins secreted by the nematode that

are called effectors. They are secreted into host tissue via a need-like stylet and are synthesized in

two sub-ventral glands, the dorsal gland, and the amphids and from the hypodermis which deposits

secretions on the cuticular surface (Davis et al., 2004; Baum et al., 2007 ; Rosso & Grenie, 2011;

Haegeman et al., 2012). The principal sources of effector proteins are the two sub-ventral glands

activated during early parasitism and the dorsal gland which is activated in later developmental

stages of the nematode (Davis et al., 2004; Haegeman et al., 2012). Although they are commonly

known as effectors, their role in parasitism is quite variable. Softening and or degrading of plants

cell wall, suppression of hosts defense responses, regulation of host cell cycle and cytoskeleton

rearrangements, manipulating signalling pathway in order to generate complex feeding structures

and host compatibility are the pivot utilities of nematode effector proteins (Davis et al., 2008;

Gheysen & Mitchum, 2011; Haegeman et al., 2012). Host plant cell penetration and migration of

the nematode inside the plants tissue facilitated by secreted cell-wall degrading enzymes. Cellulases,

pectate-lyases, arabinogalactan-Endo-1,4-β-galactosidase, xylanase, polygalacturonase, arabinase

are capable of degrading cell-wall through their hydrolysis activity and α-expansin which is involved

4 |

in loosening of cell-wall are among the first identified group effectors of plant parasitic nematodes

(Smant et al., 1998; Gao et al., 2002; Vanholme et al., 2007; Haegeman et al., 2008). At the same

time, other effectors might be involved in induction or maintenance of the feeding site. For example,

it has been suggested chorismate mutase (CM) could be involved in the early development of the

feeding site, by modulating auxin levels and salicylic acid mediated plant defense pathways. The

19C07 effector protein secreted by the cyst nematodes Heterodera glycines and Hetrodera schachtii

interacts with the Arabidopsis auxin influx transporter LAX3 to control feeding site development

(Doyle & Lambert, 2003; Lee et al., 2011; Haegeman et al., 2012).

To overcome pathogen attack, plants have evolved sophisticated multiple layers of defense

responses. This continued co-evolutionary struggle of plants to be able to secure themselves has

been shown in the “zig-zag model” of (Jones & Dangl, 2006). Microbe or pathogen associated

molecular pattern (MAMP/PAMP) for example, bacterial flagellin (flg22), elongation factor-Tu

(EF-Tu), lipopolysaccharides and chitin from fungi are recognized by transmembrane pattern

recognition receptors (PPRs) and this results in the first line of plants basal immunity; the PAMP

triggered immunity (PTI) (Bent & Mackey, 2007; Smant & Jones, 2011; Jaouannet et al., 2013;

Goverse & Smant, 2014). Effectors secreted by the pathogen interfering with PTI results in effector

triggered susceptibility (ETS), after which the plant evolves to specifically recognize this effector

by a NB-LRR protein resulting in effector triggered immunity (ETI). However, natural selection

drives pathogens to avoid ETI by shedding or diversifying the recognized effector or by further

acquiring additional effectors that can suppress ETI. In case the plants is resistant to a certain

pathogen, ETI frequently mediates a hypersensitive response (HR) followed by a local programmed

cell-death. This event inhibits further proliferation of the pathogen (Gheysen & Jones, 2006; Jones

& Dangl, 2006).

5 |

Several examples of nematode effectors suppressing plant defense have already been characterized.

Mi-CRT secreted by the root-knot nematode M. incognita, 10A06 secreted by the cyst nematode H.

schachtii, apoplastic venom-allergen (VAP) like protein of G. rostochiensis have shown to suppress

the plant innate immunity mediated by cell surface receptors (Hewezi et al., 2010; Jaouannet et al.,

2013; Lozano-Torres et al., 2014). Modulating host signaling pathway altering transports and

hormonal signaling by self-mimicry with host plant hormones is an alternative strategy. For

example, the peptide encoded by the gene 16D10 of M. incognita overexpressed in transformed

plant stimulates root proliferation with normal differentiation; CLAVATA-like peptide (CLV3)

participates in manipulation of the host cells, HG-SYV46 of H. glycines encodes a protein that

contains a CLE motif that has been shown to mimic At-CLE3 (Wang et al., 2005; Gheysen & Jones,

2006; Huang et al., 2006b; Guo et al., 2011). Nevertheless a large number of nematode effector

proteins is still not functionally characterized. Besides analysis of possible suppression activity,

effectors can also be studied by looking at their subcellular localisation, by RNAi and by identifying

the plant proteins they interact with.

Knowing the particular cellular compartments where the nematode effectors act in the host cell gives

more insight in the possible function and site of action. In previous studies, the subcellular

localization of different nematode putative effectors has been verified in planta. The apoplasm has

been demonstrated as a target compartment for some nematode effector proteins during migration

and invasion (Vieira et al., 2011; Jaouannet & Rosso, 2013 ). For example, the apoplastic venom-

allergen like proteins (Gr-VAP) of G. rostochiensis have an apoplastic target and they are involved

in selective suppression of the plants basal immunity mediated by surface localized immune

receptors (Lozano-Torres et al., 2014). Some studies have functionally analysed the possible role of

effectors after addition of their signal peptide to mimic in apoplasm and shown to suppress plants

6 |

basal immunity (PTI), overexpressing Mi-CRT+SP in Arabidobsis as apoplastic target suppressed

callose deposition (Wang et al., 2001; Jaouannet et al., 2013; Jaouannet & Rosso, 2013 ). On the

other hand some nematode effectors are targeted to the host plants cytoplasm, to modulate the plants

cell defense responses and maintenance of feeding site by interacting with cytoplasmic plant proteins

including transmembrane. The H. schachtii Hs10A06 was shown to interact with spermidine

synthase in the cytoplasm in order to modulate salicylic acid signaling and the antioxidant machinery

which is related with defense (Patel et al., 2010; Jaouannet & Rosso, 2013). Alternatively, nematode

effectors can also move to the nucleus in order to change cell regulation by interacting with host

plant transcription factors. The nuclear localized M. incognita effector 7H08, is involved in the

activation of gene expression as revealed by reporter gene analysis both in yeast and plants (Zhang

et al., 2015).

Identifying the interacting plant protein to the particular nematode protein gives an indication about

the possible functions of the effector protein. The yeast two-hybrid system, used to detect protein-

protein interaction has been adapted to gain insight into nematode secreted effector protein-host

plant protein interaction. Accordingly, the Y2H based interactor studies have demonstrated that

nematode secreted effector proteins, e.g. 10A06 of H. schachtii, 16D10 of M. incognita, and 30C02

of cyst nematode H. glycine and H. schachtii to interact with Arabidopsis thaliana Spermidine

Synthase2, A. thaliana (AT4G16260) host plant β-1, 3-endoglucanases and SCARECROW-like

(SCL) transcription factors of GRAS protein family respectively (Huang et al., 2006b; Hewezi et

al., 2010; Hamamouch et al., 2012). RNA interference (RNAi) based gene silencing developed in

model nematode Caenorhabditis elegans (Fire et al., 1998), has been extensively adapted in plant

parasitic nematodes to functionally characterize parasitism proteins and shown to reduce and or

silence expression of a range of parasitism genes (Rosso et al., 2005; Huang et al., 2006a; Gheysen

7 |

& Vanholme, 2007; Rosso et al., 2009). RNAi-mediated gene silencing that is essential for

nematode development, survival, and parasitism is becoming an interesting control strategy.

Putative candidate effectors of the root-knot nematode M. graminicola have been previously

annotated and described (Haegeman et al., 2013). In this work four putative effectors of M.

graminicola, Mg-UK67, Mg-UK52, Mg-UK50 and Mg-UK8 were functionally characterized. The

two putative effectors of M. graminicola, Mg-UK52 and Mg-UK50 are synthesized in the dorsal

glands of preparasitic J2 and assumed to be secreted via the stylet. In contrast, the Mg-UK8 is

expressed in the amphids of the nematodes. We focused on the study of Mg-UK52 of M. graminicola

with detailed localization studies of eGFP-fusions. Several methods were used to test a possible

suppression effect of Mg-UK52 on plant defense, and a search for interacting plant proteins was

performed. In addition, preliminary analyses were performed on the other selected effector proteins.

Materials and methods

Growth conditions and plants

This research was fully conducted at the laboratory of Applied Molecular Genetics of Gent

University. Plants of Nicotiana benthamiana were grown in a controlled tobacco room set at 27°C

light/dark cycles of 16 h/8 h growing conditions. The seedlings were grown in separate pots for 4-5

weeks until they had 4-5 big leaves and they were preferably used for infiltration before flowering.

The rice (Oryza sativa) Nipponbare seedlings were grown in rice room at 27°C light/dark cycles of

16 h/8 h growing conditions.

Cloning effector Mg-UK67 from cDNA library

To pick up the effector Mg-UK67 from cDNA library bank of M. graminicola, PCR amplification

was carried out in 30µl total reaction mixture containing 1µl cDNA library, 3µl 10x PCR buffer,

8 |

1µl 5mM dNTP, 0.1µl Taq polymerase, 23.9µl bidest, 0.5µl 10mM UK67-FL Forwad (5'-

CCGggggTCAATTAAATTATTC–3') and 0.5µl 10mM UK67-FL-Reverse (5'-

TCTCTTTTTGGAAAAACATCCTT–3') to obtain a product of 908 bp. The amplification program was

1 minute preheating at 94°C, 30 cycles of denaturation at 95°C for 35 seconds, 35 seconds annealing

at 58°C and 90 seconds extension at 72°C. The amplification products were separated by

electrophoresis using 1.5% agarose prepared by 1XTAE buffer and 10µl of amplification products

with 2µl (1x) loading dye was loaded on gel and the PCR fragment matching 908 bp was selected.

Cloning PCR fragment in vector pGEM-T (Promega)

The purified fragment was ligated in the vector pGEM-T (Promega) in 10µl reaction mix containing

3µl of PCR product, 1µl of vector pGEM-T (Promega) 1µl of ligase, 5µl of ligation buffer. The

mixture was incubated at 4°C overnight. The plasmids were transformed in E. coli strain DH5-α.

3µl of ligation mix was added to 50µl DH-α competent cells and incubated for 30 minute on ice.

The heat-shock was performed for 45 seconds at 42°C on heating block followed by 2 minutes

incubation directly on ice. To recover the cells 1ml SOC-medium was added to the heat-shocked

cells and incubated for 90 minutes at 37°C, 200 rpm. 150µl of the recovered transformant cells were

plated together with 50µl X-Gal stock solution (20 mg/ml in dimethylformamide) on LB-medium

supplemented with carbencillin (100µg/ml). The plates were incubated upside down overnight at

37°C for blue/white screening. White colonies were used for further screening by colony PCR. The

colony PCR amplification was carried out in 30µl reaction containing 3µl 10x PCR buffer, 1µl 5mM

dNTP’s, 0.5µl10µM SP6 (5'–ATTTAGGTGACACTATAGAATACTCAAGC-3') primer, 0.5µl 10µM

T7 (5'–TAATACGACTCACTATAGGGCGAATTGG–3') primer, 0.1µl Taq DNA polymerase, 14.9µl

bidest and 10µl of cell solution. A PCR tube containing 10µl of water and 20µl PCR mix was used

as negative control. The PCR products were loaded on 1.5% agarose gel to determine colonies

9 |

holding the right insert. Positive colonies were used for plasmid extraction and cells were grown

overnight in 5ml LB-medium supplemented with 100µg/ml carbencillin at 37°C on shaker

(200rpm). The cell solution was pelleted by centrifugation at 3000rpm for 10 minutes. Fermentas

plasmid extraction kit supported with its extraction manual was used to extract the plasmid. The

plasmid miniprep was sent for sequencing. The sequence was assessed by using FinchTV version

1.4.0 software and compared with previously annotated Mg-Uk67 sequence to check the similarity.

Cloning of Mg-UK67 in pDONR221 (Gateway® pDONRTM221)

The Mg-UK67pGEM-T plasmid (75.5 ng/µl) with desired fragment were used to ligate in Gateway®

pDONRTM221 vector. The attb sites were added to the effector by gate way cloning procedure

subsequently by two PCR programs procedures. Six constructs of Mg-UK67 were made by using

gene specific forward and reverse primers with part of attb site. The gate way cloning PCR1 to add

the attb site was carried out in 30µl total reaction containing 1µl of Mg-UK67pGEM-T plasmid

(75.5 ng/µl) plasmid, 1µl 5mM dNTP’s, 3µl 10x PCR buffer, 0.5µl Taq DNA polymerase, 22.5µl

of bidest, and 1µl 10µM gene specific forward and reverse primers. The forward primer UK67-

attb1+start (5'–aaaaagcaggcttaATGGGTGTgCAGaTTGTCC–3') with reverse primer UK67-attb2 (5'–

agaaagctgggtgGACTTCAGTATAGTAACTGCA–3'), the forward primer UK67-attb1 (5'–

aaaaagcaggcttaGGTGTgCAGaTTGTCC–3') with reverse primer UK67-attb2+stop (5'–

gaaagctgggtgTCAGACTTCAGTATAGTAACTGCA–3'), the forward primer UK67-attb1+start (5'–

aaaaagcaggcttaATGGGTGTgCAGaTTGTCC–3') with reverse primer UK67-attb2+stop (5'–

gaaagctgggtgTCAGACTTCAGTATAGTAACTGCA–3') were used to add the attb site to Mg-UK67 and

form constructs of with start codon, stop codon and both stop and start codons respectively. To

include the signal peptide we used the primers labeled signal peptide (SP) only for the forward

primers. Here too, three constructs with SP, forward primer SPUK67-attb1+start (5'–

10 |

aaaaagcaggcttaATGCTTtCTCTTAAACTCCac–3') with reverse primer UK67-attb2 (5'–

agaaagctgggtgGACTTCAGTATAGTAACTGCA–3'), forward primer SPUK67-attb1 (5'–

aaaaagcaggcttaCTTtCTCTTAAACTCCacTATG–3') with reverse primer UK67-attb2+stop (5'–

gaaagctgggtgTCAGACTTCAGTATAGTAACTGCA–3') and forward primer SPUK67-attb1+start (5'–

aaaaagcaggcttaATGCTTtCTCTTAAACTCCac–3') with reverse primer UK67-attb2+stop (5'–

gaaagctgggtgTCAGACTTCAGTATAGTAACTGCA–3') were used to form Mg-UK67+SP constructs

with start, stop and with both start and stop codons respectively. Subsequently gate way cloning

PCR2 was performed for each constructs in 30µl total reaction containing 3µl of amplification

product from PCR1, 1µl 5mM dNTP’s, 1µl attB1 primer (5'-ACAAGTTTGTACAAAAAAGCA–3'),

1µl attB2 primer (5'-ACCACTTTGTACAAGAAAGCT–3'), 3µl 10x PCR buffer, 0.5µl Taq DNA

polymerase, and 20.5µl of bidest. The PCR2 product was checked on 1.5% agarose gel to determine

the fragment size.

To ligate above mentioned constructs in pDONR221 vector, BP reaction was performed by using

Gateway® BP Clonase® II Enzyme mix. To ligate the attB-PCR products with pDONR 221, the

ligation mixes were prepared for all constructs in 6µl reaction mix separately containing 3µl of attB-

PCR product and 2µl of pDONR221 vector (75ng/µl) and 1µl of BP Clonase® II Enzyme mix. The

ligation mix was incubated at 25 °C overnight. The heat-shock was performed as described above

in TOP10 E.coli strain. The cells were then grown on LB-medium supplemented with kanamycin

(50µg/ml). The colony PCR amplification was performed in 30µl total reaction as mentioned above

using M13-forward (5'-GTAAAACGACGGCCAG–3') and M13-reverse (5'-

CAGGAAACAGCTATGAC–3') primers. The PCR products were loaded on 1.5% agarose gel to

determine colonies holding the right insert. Positive colonies were used for plasmid extraction, cells

were grown overnight in 5ml LB-medium supplemented with 50µg/ml kanamycin at 37°C on shaker

11 |

(200rpm). The cell solutions were pelleted by centrifugation at 3000 rpm for 10 minutes. Fermentas

plasmid extraction kit supported with its extraction manual was used to extract the plasmid. The

plasmid miniprep was sent for sequencing. The sequence was assessed by using FinchTV version

1.4.0 software and compared with previously annotated Mg-Uk67pGEM-T sequence to check the

similarity.

Silencing of Mg-UK67 expression by RNA interference

Synthesis of dsRNA

dsRNA was synthesized using MEGAscript RNAi kit (Life Technology Corporation). Mg-UK67

RNAi primers, UK67-F (5'–GGTGTgCAGaTTGTCCC–3'); UK67-R (5'–

GGATGGGAGTTCTTTTATAG–3’) together with forward and reverse primers tagged with opposing

T7 RNA Polymerase promoters at the 5' end of each strand T7UK67-F (5'–

TAATACGACTCACTATAGGGAGGGTGTgCAGaTTGTCCC–3'); T7UK67-R (5'-

TAATACGACTCACTATAGGGAGGGATGGGAGTTCTTTTATAG–3'), were designed from 200 bp

to the beginning of the gene to amplify a PCR product of 150 bp of Mg-Uk67 coding sequences. As

a negative control dsRNA targeting GFP was included. The GFP primers GFP-F(5'–

GTGAGCAAGGGCGAGGAG–3'), GFP-R-401(5'–CCGTCCTCCTTGAAGTCG–3') together with

forward and reverse primers tagged with opposing T7 RNA Polymerase promoters GFP-F-T7(5'–

TAATACGACTCACTATAGGGAGAGTGAGCAAGGGCGAGGAG–3'), T7GFPRNAi-R (5'-

TAATACGACTCACTATAGGGAGACCGGTGGTGCAGATGAAC–3') were designed to produce

150bp amplification, with opposing T7 RNA Polymerase promoters (underlined) at the 5' end of

each strand.

The DNA template for both UK67 and GFP, in sense and antisense T7 promoter was amplified

separately. For each product 8 PCR tubes were used with 98.4µl PCR reaction containing 1µl

12 |

plasmid, 1µl 10mM forward primer, 1µl 10mM reverse primer, 2.5µl 5mM dNTP’s, 15µl 10X PCR

buffer, 0.4µl Taq DNA Polymerase and 76.5µl of bidest. The amplification program was performed

at 3 minute pre-heating and initial denaturation, 35 cycles of 30 second at 95°C, 45 seconds at 58°C,

60 seconds at 72 °C and 5 minutes at 72°C. The size of amplification products were checked on gel

(1.5%) agarose. The PCR products of the same product were combined in 2ml tubes and purified

using QIAquick PCR Purification Kit and Nano dropped to measure the concentration of purified

products. The purified templates from both T7UK67-forward, T7UK67-reverse and T7GFP-

forward, T7GFP-reverse were consequently used as template for in-vitro dsRNA synthesis. dsRNA

synthesis was carried out in the same 1.5ml Eppendorf tube for both forward and reverse templates

using MEGAscript RNAi kit (Ambion, US patent, Massachusetts Institute of Technology).

Silencing of gene expression

Sucrose purified 2nd stage juveniles extracted from infected roots by 100% sucrose purification

method was used for RNA interference. 11ml of 100% sucrose and 3ml of extracted nematodes were

placed in two 15ml tubes and mixed very well by hand shaking. To form separation layer at the top

1ml of water was added very slowly and carefully. Centrifugation was then performed at 1500rpm

for 3 minute to have clear nematode layer between the sucrose and water layer. Nematodes were

sucked up with a glass pipet and transferred to a new 15ml tube. The sucrose was washed away by

adding up to 14ml fresh water and re-centrifugation with the same program. The water was carefully

discarded without disturbing the pellets at the bottom of the tube. 3x50µl nematode droplets were

taken from the carefully mixed pellet to determine the nematode count. The appropriate number of

nematodes were taken per 2ml Eppendorf tube for soaking and pelleted again by centrifugation with

the same program.

13 |

Soaking solution was prepared in 200µl final volume containing 200µg dsRNA, 4µl preheated

150mM spermidine phosphate salt hexahydrate (SPSH, SIGMA Alderich, so381), 4µl 2.5% gelatin

and nuclease free water. Around 5000 juveniles were incubated in the soaking solution for 24h on a

rotator in the dark at 27°C. From this solution, 1500 nematode were snap frozen directly after

soaking and used for RNA extraction and RT-PCR analysis, 2000 nematodes were used for

inoculation on plants and 1500 nematodes were used for RNA extraction after 24h of recovery and

RT-PCR analysis. The same procedure was followed both for GFP control and buffer control

treatments. To check the role of gene silencing on the infectivity of the nematodes, 2 weeks old

seedlings of Nipponbare rice variety grown in the SAP (Superabsorbent Polymers, mixture of 2kg

sand, 3g polymer and 300ml bidest) tubes at 28°C and light/dark cycles of 16 h/8 h were used. For

each treatment a total of 8 plants were inoculated by 250 dsRNA treated nematodes per seedling.

The inoculated seedlings were removed from SAP tubes 24h post inoculation and the SAP was

carefully washed away and the plant was transferred to a new glass tube filled with 10ml of

Hoagland solution. Fresh Hoagland solution was given three times a week and the synchronized

seedlings were treated the same way for three weeks at 28°C and light/dark cycles of 16 h/8h

growing conditions. Three weeks post inoculation the shoot length and root length of the plants were

measured. The roots were also stained with acid fuchsin (0.1g acid fuchsin, 750ml water, 250ml

acetic acid) and de-stained with acidified glycerol (glycerol with 300µl HCL per 100ml) for

microscopic visualization of the nematode development inside the root. The means of number of

nematodes per plant were statistically analysed by one-way ANOVA.

To examine Mg-Uk67 expression after dsRNA treatment, RNA was extracted from dsRNA treated

nematodes using RNeasy Mini Kits (QIAGEN) and twice sonication of the lysate for 10 seconds.

After DNAse treatment of extracted RNA first strand cDNA synthesis was conducted following the

14 |

Superscript reverse Transcriptase II protocol. RT-PCR was conducted following the protocol of

MyTaq DNA polymerase using primer UK67-FL-F (5'–CCGggggTCAATTAAATTATTC–3’)

designed outside the targeted region by dsRNA and UK67-reverse (5'–

GGATGGGAGTTCTTTTATAG–3’). To normalize the expression of Mg-UK67, the expression of

the reference gene Tubulin was visualized using the primers MgTub-F (5'–

ATTTTCTGAGGCTCGTGAGG-3’) and MgTub-R (5'–AATATTCATCGGCTTCTTCTCC–3’). The

amplification program was carried out in 5 minute at 95°C, 40 cycles of 1 minute in 94 °C, 30

seconds at 58°C and 30 seconds of 72°C, final extension for 5 minute at 72°C and 16°C on hold.

The amplification products were equally loaded on a 1.5% agarose gel to check the expression level

of targeted gene.

Reactive oxygen species (ROS) suppression assay

To investigate whether Mg-UK52 is able to suppress ROS production triggered by perception of an

elicitor synthetic bacterial flagellin (flg22), Mg-UK52 fused to eGFP at C-terminus site (Mg-UK52-

pK7FWG2), Mg-UK52 (pK7WG2) and Mg-UK52 together with its signal peptide fused to eGFP at

C-terminus site (Mg-UK52+SP-pK7FWG2) were analysed. As a control free eGFP and MP10

effector of Aphid species Myzus persicae was included. Agrobacterium tumefaciens strain GV3101

carrying the desired constructs were incubated in LB-medium supplemented with the proper

antibiotics at 28°C on 200rpm shaker in dark conditions one day prior to infiltration. The construct

of interests, the GFP control and the MP10 effector were transiently expressed in N. benthamiana

leaves using Agrobacterium at OD600 nm= 0.3. About 30h post inoculation, 16mm2 leaf disks were

sampled using a Cork borer (size 2# diameter of 4.5mm) and floated on 190µl filter sterilized MilliQ

water overnight in 96-well plates. For each construct 16 replicates were sampled from 8 different

plants. Reactive oxygen species (ROS) production was then concomitantly elicited with the bacterial

15 |

PAMP flg22 (synthetic peptide QRLSSGLRINSAKDDAAGLAIS) and was measured by Luminol-

dependent assay 48h post inoculation. Water used for overnight floating was removed gently without

damaging the leaf disks and replaced by 100µl of the reaction mix containing 2µl of flg22 (100nM),

2µl of horseradish peroxidases (HRP SIGMA P6782; 20µg/ml) and 25µl of Luminol (Waco

chemicals; 0.5mM). Luminescence was measured using a plate-reader luminometer over time (40

minutes kinetic with measures taken every 46 seconds with integration at 750ms) and data was

selected at maximum intensity of the responses. The experiment was repeated twice to check the

validity of the results and one-way ANOVA was performed for statistical validity of the mean of

ROS production.

Plant defense suppression (ETI) assay

To examine whether Mg-UK52 is able to suppress R-mediated hypersensitive responses we used

the Mg-UK52 fused to eGFP at C-terminus and N-terminus sites. Free eGFP and empty vector in

VirGplasmid were comprised as a control treatments. A. tumefaciens strain GV3101 carrying the

gene of interests were grown from glycerol stock on LB plates supplemented with proper antibiotics

for two to three days in dark condition at 28°C. The A. tumefaciens grown on LB plates were

suspended in liquid LB-medium with proper antibiotics and incubated for two days in a dark

condition at 28°C on the shaker of 200rpm. Pellets were collected by centrifugation at 3000rpm for

10 minutes and re-suspended after removing the supernatant in sterile freshly made 10ml

Agrobacterium infiltration buffer (1ml 1M MgCl2, 2ml 0.5M MES (2-[N-Morpholino] ethane

sulfonic acid) and 200µl 0.1M acetosyringone prepared in 100ml of bidest) followed by

centrifugation. The collected pellets were diluted in 5ml infiltration buffer and the optical density

measured at OD600. Bacteria were then incubated for at least 3h in the dark at room temperature

prior to further dilution in infiltration buffer. Infiltration was done in one-month-old N. benthamiana

16 |

on the abaxial side of the leaves using a 1ml needleless syringe. Agrobacterium clones carrying

either Mg-UK52 constructs or eGFP and Empty vector controls were infiltrated at a final OD600 of

0.6 in combination with OD600 of 0.3 for Avr2/R2 constructs and 1:1:1 ratio at a final OD600 of

0.5 were used for other combinations. The R/Avr gene combinations tested in this study were

R2/Avr2 (Saunders et al., 2012), Gpa2/RBP-1 (Sacco et al., 2009), Cf-4/Avr4 (Thomas et al., 2000).

In addition the assay was conducted for the P. infestans PAMP elicitor INF1 (OD600 = 0.5;

(Kamoun et al., 2003). For each combination of effector and cell-death inducer assayed, up to 10

plants used which were infiltrated on 4 leafs per plant with 2 spots for effectors, 2 spots for the eGFP

and empty vector control on the same leaf. The hypersensitive response (HR) was recorded and

photographed for each individual spot of infiltration at 4dpi and evaluated as 1 if more than 50% of

the infiltrated area shows a HR, or 0 if less than 50% shows a HR followed by the protocol of (Gilroy

et al., 2011). The experiment was repeated at least twice to validate the results. The mean percentage

of total inoculations developing the response per plant was statistically evaluated for significance

with one-way ANOVA.

Subcellular localization of proteins

The subcellular localization of M. graminicola effector protein Mg-UK52 and together with its

native signal peptide UK52 + SP fused with GFP to their C-terminal were performed with free eGFP

expressed as control. The A. tumenfacien strain (GV310) containing the desired constructs were

grown in 5ml LB-medium with Spectinomycin and Gentamycin selection (50 µg/ml and 25 µg/ml

respectively) at 28°C in dark condition on 200rpm shaker from two to three days. The bacteria were

pelleted by centrifugation for 10 minute at 3000rpm. The supernant was discarded and the pelleted

cells were re-suspended in 10ml of freshly made infiltration buffer (1ml 1M MgCl2, 2ml 0.5M MES

(2-[N-Morpholino] ethane sulfonic acid) and 200µl 0.1M acetosyringone prepared in 100ml of

17 |

bidest) followed by centrifugation with the same program. The pelleted cells were re-suspended in

5ml infiltration buffer and left at room temperature for 3h in the dark. The OD600 was subsequently

adjusted to 0.04 by dilution with infiltration buffer. Infiltration of about one month old N.

benthamiana leaves was carried out by puncturing a hole on the abaxial side of the leaf with a needle

between two veins and using 1ml syringe containing re-suspended solution in infiltration buffer. A

total of 8 plants, and 2 leafs per plants were used. After 48h the infiltrated spot were used for

microscopic visualization with a Confocal Laser-Scanning Microscope (Nikon Instruments Inc.,

Tokyo, Japan) with excitation at 488nm and emission at 509nm. Samples were imaged with 40X

objective and the experiment was repeated three times.

Yeast two-hybrid (Y2H), library screening

Yeast strain MaV203 containing the M. graminicola gene for effector Mg-UK50 ligated to bait

plasmid pDEST32 was grown from glycerol stock on –leu medium (yeast nitrogen base without

Amino acid, –leu supplement, filter sterilized 40% glucose, agar, and pH-5.6) and incubated for

three days upside down at 30°C. A single colony was selected from the plate for library screening

and inoculated in 15ml liquid –leu medium followed by overnight incubation at 30°C on 200rpm

shaker. 150ml of liquid–leu medium was simultaneously incubated at 30°C on shaker to check for

contamination and initiation of culture the next day. Overnight grown yeast culture was measured

at OD600 and the yeast culture was diluted to the OD = 0.1 by adding the appropriate amount of

yeast culture to the overnight incubated 150ml –leu medium. The cells were incubated for about 6h

at 30°C at 200rpm until the OD600 reached a density of approximately 0.5. The cells were pelleted

by centrifugation for 5 minutes at 1100g and re-suspended in 15ml of sterile water by mild shaking

and pelleted by centrifugation at 1100g for 5 minutes. The pellet was re-suspended in freshly made

750µl 1X TE/1XLiAc and mixed carefully by mild shaking mixes of pre-heated 10µl salmon sperm

18 |

DNA (5 µg/µl), 1µl rice cDNA library (1µg/µl) (Invitrogen) (cDNA from root material infected

with M. gramnicola and Hirshmanella oryzae at different time points of infection (3d, 7d, 14d and

21d), galls, normal root tissues and rice roots infected by fungi and rice leaf material) were prepared

in 14 sterile 1.5ml Eppendorf tubes and incubated on ice. Subsequently, 50µl of re-suspended yeast

cells were added to each of the 14 tubes containing the mix and one extra tube with only 50µl re-

suspended yeast cells taken as control treatment. Gently, 300µl 1x LiAc/40%PEG/1xTE was added

to each tube and mixed by slowly pipetting up and down and incubated for 30 minutes at 30°C in

the dark. Afterward, 36µl DMSO was added to each tube followed by mixing of the cells by gently

pipetting up and down. The heat-shock was performed carefully for 10 minutes at 42°C in a heating

block. To check the transformation efficiency two tubes were randomly selected and diluted 100x

in sterile water and 100µl (10µl from 100x dilution and 90µl sterile water) was plated on a

(140x21mm) TL plate (yeast nitrogen base without amino acids, TL dropout supplement, sterilized

40% glucose, agar and pH-5.6). The remaining cells were plated onto (140x21mm)TLH10 plates

(yeast nitrogen base without amino acids, TLH dropout supplement, sterilized 40% glucose, 10 mM

3-aminotriazole, agar, and pH-5.6) and incubated upside down at 30°C for three days in the dark.

The transformation efficiency was calculated as (1000000 independent transformant/total cell

solutions (14*397)*100xdilution) and the expected colonies were 18 on control TL plate.

Further selection of yeast colonies that grew on TLH10 plates was carried out by picking colonies

using yellow tips and re-suspending them either in 50 or 100µl sterile water, depending on the size

of the colonies. Gently, 3µl of re-suspended cell solution were spotted on a TL plate as control for

growth, a TLH10 plate, a (140x21mm) TLU plate (yeast nitrogen base without amino acids, TLH

dropout supplement, sterilized 40% glucose, agar, and pH-5.6) and a TL plate with a Hybond N+

membrane on top. On each plate, spots with strong interactor, weak interactor and no interactor were

19 |

included as control treatments. The plates were incubated upside down overnight at 30°C. After 24h

the cells grown on the Hybond N+ membrane were frozen twice in liquid nitrogen for 30 seconds

and transferred to a big Petridish with Whatman paper supplemented with X-gal reaction mixture

(12.5mg X-gal, 100µl DMF, 60µl beta-mercapto-ethanol and 10ml Z-buffer) followed by 24h

incubation at 37°C in the dark. The colonies that appeared positive -based on blue color- were

selected and used for prey plasmid isolation. The selected yeast colony was grown overnight in 4ml

liquid TL medium at 30°C at 200rpm shaker. The overnight grown culture was pelleted by

centrifugation at 3000rpm for 5 minutes and the supernatant was discarded. Thermo Scientific Gene

JET Plasmid Mini Prep Kit combined with zymolase (Sigma®) lytic enzyme was used for plasmid

isolation. 2µl of zymolase (Sigma®) and 150µl of resuspension buffer (Scientific Gene JET Plasmid

Mini Prep) was added to the pelleted cells and incubated at 37°C for 90 minutes. Then, the rest of

plasmid isolation protocol was followed from the kit manual. The isolated plasmid was heat-shocked

in TOP10 competent cells and grown overnight at 37°C on LB-plates with carbencillin (100µg/ml)

or gentamycin (25µg/ml) to recover the prey and bait respectively. The PCR colony was performed

as mentioned earlier to select the colonies with DNA fragment. The positive colonies from both

recovered prey and bait with DNA fragment were used for plasmid extraction. Fermentas plasmid

extraction kit supported with its extraction manual was used to extract the plasmid. The plasmid

miniprep was sent for sequencing. The sequence was assessed by using FinchTV version 4.1.0

software. BLAST search was performed to check the homologous hit sequences with prey sequence

from NCBI data bases. The protein sequence was aligned with amino acid sequence of identical rice

protein//http://multalin.toulouse.inra.fr/multalin/.

20 |

Plant transformation

Wild type rice Nipponbare seeds (IRTP23787) were used for transformation using A. tumefaciens

strain GV3101 with vector pMBb7Fm21GW-UBIL containing the genes for the effectors Mg-UK52

and Mg-UK8 + SP of M. graminicola. The de-husked seeds were surface sterilized by soaking for

5 minutes in 70% ethanol and then incubated in 4% NaHypochlorite for 30 minutes on rotator. Seeds

were washed with sterile bidest until the foam of the bleach was completely gone and dried on the

lid of a Petridish. Ten to twenty seeds were sown per single callus induction (CIM) medium (Chu

N6 Salts including vitamins (Duchefa), Casein Hydrolysate (= N-Z Amine A) (Duchefa), Proline

(Sigma), 2,4-D1ml 2mg/ml(Sigma), Sucrose (Fisher), Agarose SPI (Duchefa) and pH 5.8). Plates

were sealed with two layers of micropore tape and incubated in dark conditions at 30°C for three

weeks until good embryonic callus was observed. The embryogenic calli that were small (1-2mm),

round and compact, slightly yellow in colour, non-hairy, growing on the media away from the seed

were transferred to fresh CIMs using sterile scalpel. The plates were then sealed with leucopore tape

and placed in the dark at 30°C for 4 days. The embryonic rice tissue was inoculated with A.

tumefaciens strain GV3101 carrying the desired gene (effectors). Healthy embryonic calli were

transferred to R2COMAS co-cultivation medium (Mogen R2 ½ Macro salts = Devgen R2 salts (MS

Salts) (Duchefa), Gamborgs B5 Vitamins (Fisher), Sucrose (Sigma), Glucose (Duchefa), Casein

Hydrolysate (Duchefa), 2,4-D 1ml 2mg/ml (Sigma), Acetosyringone (AS) (Sigma), Micro-agar

(Duchefa)) and pH 5.2. The Agrobacterium dilution buffer AA-1 (Devgen modified Gamborg salts

(G23, MS Frigo) (Fisher), Casein Hydrolysate (= N-Z Amine A) (doos) (Duchefa), Glucose

(Duchefa), Sucrose (Fisher), AA Amino Acids (20X Stock) and pH 5.2) and 0.1M Acetosyringone

a stimulant of wounding response in Agrobacterium mediated transformation were used.

Filtersterilezed 0.1M (AS) was added to 100µM final concentration AA-1 and mixed by mild

21 |

shaking. 21ml of AA-1+AS was pipetted into a sterile 50ml falcon tube and inoculated with 2 loops

of Agrobacterium. The Agrobacterium was re-suspended by shaking and vortexing. The re-

suspended cells were measured at OD600nm and diluted to the OD600 of 1.0 - 1.2. The calli were

inoculated in 10ml Agrobacterium solution and incubated for 8 minutes by shaking at least once

during that time. The Agro-incubated calli were tipped out onto R2COMAS media and spread

evenly. The excess bacterial suspension was removed with a Gilson pipette, and the plates were air

dried in flow hood before wrapping. The plates were labelled and sealed with leucopore tape and

placed in the dark at 30°C for 4 days. To select the transformant calli, 4 day co-cultivated embryonic

calli were washed in 10ml timentin water (500µl timentin in sterile water 500ml). The timentin water

was replaced with fresh timentin water as many times as it took for the liquid to go clear and 20-30

calli ware transferred to 1 plate of N6 selection medium (Chu N6 Salts including vitamins (Duchefa),

Casein Hydrolysate (= N-Z Amine A) (Duchefa), Proline (Sigma), 2mg/1L 2,4-D 2mg/ml(Sigma),

Sucrose (Fisher), Agarose SPI (Duchefa), Basta, Timentin (Ticarcillin and pH 5.8)). The plates were

labelled and sealed with leucopore tape and incubated under light condition at 30°C for 3 weeks.

After three weeks the calli were assessed and actively grown putative transgenic calli (PTC) were

transferred to N6 pre-regeneration media ((Chu N6 Salts including vitamins (Duchefa), Casein

Hydrolysate (= N-Z Amine A) (Duchefa), Proline (Sigma), 1mg/1L 2,4-D 2mg/ml(stock)(Sigma),

Sucrose (Fisher), Agarose SPI (Duchefa), Basta, Timentin (Ticarcillin) and pH 5.8). Up to 20

putative transgenic calli of independent events were transferred per plate and the plates were sealed

with leucopore tape and placed in the growth room at 30°C, light condition for 2 weeks. Two weeks

old actively dividing transgenic calli were transferred from the Pre-Regeneration medium to the

Regeneration medium (AA Amino Acids, Chu N6 Salts including vitamins (Duchefa), Casein

Hydrolysate (= N-Z Amine A) (Duchefa), CuSO4 (Sigma), Sucrose (Fisher), Agarose (Duchefa),

22 |

Basta, Timentin (Ticarcillin), Zeatin (10mg/ml) and pH 5.8)) ensuring that only small pieces (~1-3

mm) were transferred. Numbers of putative transgenic calli actively dividing were also recorded for

future transformation frequency calculations. The plates were then sealed with leucopore tape and

placed in the growth room at 30°C, on the light for three weeks. After three weeks none of the

putative transgenic calli were regenerated and hence the transformation procedure couldn’t be

completed.

Results

Cloning of the gene for effector Mg-UK67

Putative candidate effectors of M. graminicola have been previously annotated and described

(Haegeman et al., 2013). To analyze these putative effectors in more detail, isolation and cloning is

necessary. Therefore, PCR amplification was performed using UK67 specific primers and cDNA of

2nd stage M. graminicola juveniles as template. This resulted in a PCR fragment matching the

expected 908 bp shown in Fig.1 (A). The fragment was successfully ligated in pGEM-T and

transformed into E. coli strain DH5-α. The extracted plasmid was sent for sequencing. When the

sequencing result compared with the previously annotated amino acid sequence, the amino acid

sequences encoding the proteins was shown in frame. But, two amino acid differences was observed

in signal peptide region Fig.1 (B). This change could be due mutational events, as the size of the

gene appears relatively larger. We also assume probably due 2nd stage juveniles used to synthesis

the cDNA are sampled at difference time point.

23 |

Fig.1. Gel electrophoresis of PCR amplification products to pick up the Mg-UK67 fragment from a cDNA library

and UK67-pGEM-T amino acid sequence alignment compared with the previously annotated sequence. A) The

amplification result performed to pick up effector Mg-UK67 from the cDNA library using gene specific primers. M-

DNA marker, *_a positive Mg-UK67 amplified product given (908 bp) B) The sequencing result obtained from the

pGEM-T vector insert of Mg-UK67 and the amino acid sequence alignment together with previously annotated gene.

Silencing of Mg-UK67 expression by RNA interference

To perform RNAi on the expression of UK67, dsRNA was synthesized matching 150 base pairs of

the Mg-UK67 transcript sequence. Infective juveniles of M. graminicola were soaked in this dsRNA

and the expression of UK67 was measured. Reverse transcription PCR on nematodes soaked in Mg-

UK67 specific dsRNA did not show a significant reduction in the mRNA level compared to the

control treatments Fig. 2 (A). We infected the rice seedlings with approximately 250 infective

juveniles treated by dsRNA. The total number of nematodes infecting plants didn’t resulted in

significant difference between treatments as illustrated in Fig. 2 (B).

24 |

Fig. 2. RNA interface to silence UK67 at infective stage of M. graminicola. A) Amplification products of RT-PCR

on nematodes soaked in dsRNA; M-DNA marker, Ref-reference gene amplified product with Mg-Tub-primer, UK67-

amplification product with gene specific primer; Lane1-3 nematodes taken at recovery 1-Buffer, 2-GFP & 3-UK67;

Lane 4-6 nematodes used after soaking 4-buffer, 5-GFP & 6-UK67. B) The total mean number of nematodes infecting

rice plantlets inoculated after 24h dsRNA treatment. One-way analysis of variance was performed for statistical analysis

and the error bars indicates the standard error. No significant differences were observed between different treatments

(P≥ 0.05), means of the same letters represented non-significant.

Subcellular localization of Mg-UK52 in planta

To observe the subcellular location of the nematode effectors, they were fused with eGFP and

transiently expressed in tobacco leaves mediated by agro-infiltration. With Confocal Laser-

Scanning Microscopy (Nikon Instruments Inc., Tokyo, Japan) the effector Mg-UK52 and the same

effector with it native signal peptide was followed in the plant cells. Mg-UK52+SP expression was

used to mimic the effector secretion in the apoplasm. For both the GFP was fused to the C terminal

end. Free GFP used as control was localized in cytoplasm and nucleus Fig. 3 (A). Mg-UK52 was

observed to be localized both cytoplasmic and nuclear Fig. 3 (C&D), meanwhile Mg-UK52 with its

signal peptide was detected as weak signal and we therefore expect that it is transported outside Fig.

3 (B).

25 |

Fig. 3. Subcellular localization of M. graminicola effectors 48h post inoculation in N. benthamiana leaves. (A) Free

eGFP control, B) localization of Mg-UK52+SP fused to eGFP at C-terminus; (C&D) Cytoplasmic and nuclear

localization of Mg-UK5 fused to eGFP at C-terminus. Scale bars A&B- 50µM, C&D- 20µM.

Can the Meloidogyne graminicola effector Mg-UK52 suppress ROS production

triggered by elicitor?

To analyze weather Mg-UK52 can suppress apoplastic oxidative burst generated during plants basal

response in the peroxidase dependent pathway, we treated Agro-infiltrated leaf disks expressing

desired effector construct with the 22-amino acid bacterial flagellin peptide (flg22) in Horse radish

peroxidase (HRP) and luminol-based assay measured over 40 minutes by Luminometer. Mg-UK52

constructs Mg-UK52 fused to eGFP at C-terminus, Mg-UK52 fused to eGFP at C-terminus, free

eGFP as negative control treatment and MP10 as positive control treatments were analysed to check

their role in suppression of plants basal immunity, ROS production. Mp10 is an effector of Myzus

persica (green peach Aphid) known to suppress ROS production induced by flg22 (Bos et al., 2010).

Mg-UK52 fused to eGFP at C-terminus and Mg-UK52 showed an enhanced oxidative burst rather

than suppression compared to our control treatments as illustrated Fig. 4. The ROS production for

all three treatments was initiated at the same level, but at about 10-25 minutes post induction the

Mg-UK52 fused to eGFP at C-terminus treatment resulted in significant enhancement of the

oxidative burst, compared to eGFP control treatments while MP10 suppressed the oxidative burst.

26 |

The mean comparison of each treatment over 60 minutes of ROS production resulted in a significant

difference.

Fig. 4. ROS assay for Mg-UK52-eGFP suppression, production of active oxygen species by an elicitor flg22 at 48h

post agro-infiltration. (A) ROS production pattern of Mg-UK52 fused to eGFP at C-terminus and an enhanced

oxidative burst during the time of 10–25 minutes post ROS induction, (B) graphical representation of overall ROS

production by mean comparison the treatments. One-way analysis of variance was performed for statistical analysis of

mean comparisons and the error bars indicates standard error. ROS induction was significantly different between

treatments (P ≤ 0.001), means with different letters represent significant difference. This result is representative of two

independent experiments.

Likewise, the Mg-UK52 not tagged with GFP also resulted an enhanced apoplastic oxidative burst

compared to both free GFP and MP10 treatments illustrated in Fig. 5 (A). However the statistical

analysis between treatments did not result in significant difference during total ROS production Fig.

5 (B), rather the initial 26 minutes was observed as statistically significant on enhanced burst with

Mg-UK2 Fig. 5 (C). Both Mg-UK52 and Mg-UK52-CT have shown the same effect on oxidative

burst which is suggested, GFP fusion at C-terminus doesn’t alter the effectors functioning.

27 |

Fig. 5. ROS assay for Mg-UK52 suppression, production of active oxygen species by an elicitor flg22 treatment

at 48 h post agro-infiltration. ROS production pattern of Mg-UK52 and an enhanced oxidative burst during the time

of 10–25 minutes post ROS induction, meanwhile the MP10 positive control treatment have shown dramatic suppression

and the free GFP lies in between (A), graphical representation of overall ROS production that shows total mean of ROS

production between each treatment (B). Comparisons of ROS production during the initial 26 minutes at the peak of

ROS production (C). One-way analysis of variance was performed for statistical analysis of mean comparisons and the

error bars indicates standard error. ROS induction was significantly different during the initial 26 minutes each between

treatments at (P ≤ 0.007), means with different letters represent significant difference. This result is representative of

two independent experiments.

It was also tested whether the effector Mg-UK52 together with its native signal peptide which is

probably secreted in the apoplasm would suppress ROS production. The Mg-UK52 construct

together with its native signal peptide (Mg-UK52+SP) fused to eGFP at C-terminus resulted in

suppression of the oxidative burst peak compared to the free eGFP control treatment Fig. 6 (A).

Nevertheless the total ROS production appears statistically not significant between two controls

treatments as illustrated in Fig. 6 (B), whereas the initial 27 minutes post ROS induction resulted

statistically significant difference Fig. 6 (C).

28 |

Fig. 6. ROS assay for Mg-UK52+SP-eGFP suppression, production of active oxygen species by elicitor flg22

treatment at 48h post agro-infiltration. (A) Mg-UK52+SP fused to eGFP at C-terminus suppressed ROS, the MP10

positive control treatment have shown dramatic suppression and remains enhanced in negative free GFP control

treatment. B) Graphical representation of overall ROS production by mean comparison in between treatments ROS

induction and analysis during the initial 27 minutes post induction. C) One-way analysis of variance was performed for

statistical analysis of mean comparisons and the error bars indicates standard error. ROS production was significantly

different between each treatment (P ≤ 0.001), means with different letters represent significant difference. This result is

representative of two independent experiments.

The effector Mg-UK52 of Meloidogyne graminicola might be involved in

suppression of effector triggered plant defense

To investigate if the Mg-UK52 effector protein is able to suppress effector triggered cell defense,

we transiently expressed a two-component activator of the hypersensitive response with Mg-UK52

in leaves of N. benthamiana as illustrated in Fig.7. Both Mg-UK52 fused to eGFP at C-terminus and

Mg-UK52 fused to eGFP at N-terminus were analyzed. Mg-UK52 fused to eGFP at C-terminus

showed suppression of the hypersensitive response mediated by recognition of Avr2 of P. infestans

by cytoplasmic immune receptor protein R2 from potato as illustrated Fig.7 (A). By contrast, Mg-

UK52 fused to eGFP at N-terminus was not able to suppress the HR mediated by the same immune

29 |

receptor and avirulence gene Fig.7 (A). On the other hand, neither constructs was able to suppress

the programmed cell death induced by P. infestans elicitin INF1. Additionally, these constructs also

were not able to suppress the hypersensitive response mediated by recognition of Avr4 of

Cladosporium fulvum by extracellular receptor protein Cf-4 from tomato.

Fig.7. Suppression of plants defense related programmed cell-death induced by cytoplasmic receptor protein R2.

(A) Transient expression of Avr2/ R2 an inducer of effector triggered plant defense in N. benthamiana together with

Mg-UK52 effector protein fused to GFP. UK52-CT, Mg-UK52 fused to eGFP at C-terminus, UK52-NT- Mg-UK52

fused to eGFP at N-terminus, EV-Empty vector. B) One-way analysis of variance was performed for statistical analysis

of mean comparison of the percentage of necrotic area spot and the error bar indicates standard error. Suppression of

effector triggered plant defense by Mg-UK52 fused to eGFP at C-terminus compared to control treatments is statistically

different (P≤ 0.05), means with different letters represent significant difference.

Can ETI change the subcellular localization of Mg-UK52?

We hypothesized the Avr2/R2 induced ETI response may change the subcellular localization of Mg-

UK52. We demonstrated this effector has a cytoplasmic and nuclear localization. ETI-triggering

Avr2/R2 was transiently expressed in N. benthamiana leaves by agro-infiltration together with Mg-

UK52 eGFP fused both to its N-terminus and C-terminus. However, both fused proteins were

localized cytoplasmic and nuclear. This is similar to leaves without Avr2/R2 expressed and as the

eGFP control treatment as illustrated in Fig. 8. Also, there was no difference in localization due to

fusion either from C-terminus or N-terminus Fig. 8 (B, C&D)

30 |

Fig. 8. ETI-localization by co-expression of Avr2/R2 together with Mg-UK52 in N. benthamiana leaves. A)

Enhanced green fluorescent (eGFP) control treatment localized cytoplasmic and nucleus. B) Cytoplasmic and nuclear

localization of Mg-UK52 eGFP fused at C-terminus. C &D) Cytoplasmic and nuclear localization of Mg-UK52 eGFP

fused at N-terminus. Scale bars, C -20µM, ((A, B& D)-50µM).

Transformation of Mg-UK52 and Mg-UK8+SP into rice

To produce transgenic rice line expressing the effector Mg-UK52 and Mg-UK8+SP under the

control of UBIL maize promoter, Agrobacterium mediated rice transformation was performed. To

be able to transform the effectors putative transgenic callus was produced from actively diving

embryonic callus isolated from rice seed. Well established, fresh and healthy calli were used for

shoot regeneration and the media used from callus induction to pre-regeneration was also working

well. Apparently, no shoot was obtained from developed transgenic calli on regeneration media in

two separate experimental trails for Mg-UK52 and Mg-UK8+SP as shown in Fig. 9.

Fig. 9. Agrobacterium mediated transformation to express Mg-UK52 and Mg-UK8+SP in rice. Healthy putative

transgenic calli grown on co-cultivation media were transferred to selection and regeneration media used for shoot

regeneration.

31 |

Y2H Library screening to identify a target rice protein of Mg-UK50

To investigate if there is a possible interactor protein of the Mg-UK50 effector protein in rice, a

Y2H screening was performed with the effector protein to a rice cDNA library. The X-gal assay

resulted in one blue colony out of 63 tested colonies, which shows deep blue comparable to the

strong interactor control treatment as illustrated in Fig. 10 (D). The yeast colonies were recovered on

TLH10 media as same as TL, but the growth rate was slightly slower.

Fig. 10. Yeast two-hybrid library screening of M. graminicola UK50 bait plasmid with cDNA library of rice. A)

The yeast colonies grown on TL media as control treatment, circled colony the colony gave positive result B) The yeast

colonies on TLH10 media to test if the yeast colonies can recovered again on same medium and circled colony the

colony gave positive result. C) The yeast colonies on TLU media to check for strong interactor D) X-gal assay performed

to select blue colonies with effector protein, WI-weak interactor control treatment, SI-strong interactor control treatment

and NI-non interactor control treatment.

The yeast transformation was resulted about 111111.11 independent transformant cells, which is

about 9x lower than expected 1000000 transformant cells. Hence, the transformation efficiency was

comparatively quite low. We, isolated the prey and bait plasmid from the corresponding positive

strong interactor yeast colony grown on TL plate. To recover the prey and bait plasmid antibiotics

based selection was performed from heat-shocked cells. The gene fragment from the colony PCR

amplification product on the prey was shown to be about 2800 bp Fig.11 (A) while the gene fragment

from the bait plasmid was 800bp Fig.11 (B). The extracted plasmid from both prey and bait was sent

32 |

for sequencing. The sequence result was assessed and the nucleotide BLAST search was performed

to check identical hits with found prey sequence. The isolated prey has a 99-100% with Oryza sativa

Japonica Group Os05g0515700 (Os05g0515700) mRNA, complete cds clone but the protein was

not in frame when aligned with amino acid sequence of obtained Oryza sativa protein as shown

Fig.11 (C). We therefore suggested the interactor protein observed on X-gal assay might be a false

positive.

Fig.11. Gel electrophoresis of colony PCR amplification product on heat-shocked cells recovered from the bait

and prey plasmid. A) Gel electrophoresis of the PCR amplification product from colonies recovered on prey recovery

plate (LB+ carbencillin(100µg/ml) resulted at about 2800bp. B) Gel electrophoresis of the PCR amplification product

on colonies recovered from bait recovery plate (LB+ gentamycin (25µg/ml). C) The amino acid sequence alignments

of the prey protein with the amino acid sequence taken from Oryza sativa Japonica Group Os05g0515700

(Os05g0515700) mRNA, complete cds gene.

Discussions

Lots of efforts have been made to identify and functionally characterize plant-parasitic nematode

candidate effectors since the first parasitism gene, the cell-wall degrading enzyme was identified

from the cyst nematodes Globodera rostochiensis and Heterodera glycines (Smant et al., 1998).

Since then, the most studied are the nematode putative candidate effectors secreted from the two

sub-ventral and the dorsal glands (Davis et al., 2000; Gao et al., 2002; Huang et al., 2003). Here

33 |

too, we have studied further some unknown effectors secreted from the glands of M. graminicola as

a proceeding work from (Haegeman et al., 2013).

First, we cloned M. graminicola effector Mg-UK67 by PCR amplification from a cDNA library of

pre-parasitic 2nd stage juveniles using gene specific primers. Sequencing confirmed 908 bp of the

expected clone. Unfortunately cloning with the Gateway® pDONRTM221 vector was not successful

for unknown reasons so far. Several ways were performed to optimize the Gateway BP reaction,

without result. The function of the Mg-UK67 gene of M. graminicola was tested by RNAi. 2nd stage

juveniles were treated with dsRNA targeting Mg-UK67 to test if this alters the nematode infectivity.

However, the RT-PCR performed on the cDNA from dsRNA treated nematode revealed the gene

was not silenced. Therefore, there was no difference in infectivity potential of nematodes treated by

dsRNA of Mg-UK67 solution and the control dsGFP treatment. In future works, optimization will

be needed on soaking procedure, as it was shown that the success of gene silencing is highly

dependent on the uptake of dsRNA by non-feeding J2 (Rosso et al., 2005). Indeed in plant parasitic

nematodes the mode of delivery is a bottleneck since the infective stage (J2) of plant parasitic

nematodes are small in size and the well-formed cuticle makes microinjection difficult. Delivery by

in-vivo ingestion is also problematic because endoparasitic nematodes normally feed only from their

feeding site. Soaking of J2 in dsRNA molecule stimulated by Octopamine offers a possibility (Urwin

et al., 2002) but in root-knot nematodes Octopamine induced uptake was weak through the pharynx

and no visible uptake was detected through the extractor/secretory system (Rosso et al., 2005). A

few year later, in-vitro gene silencing was adapted in RKNs with the aid of uptake stimulants. For

example, the parasitism gene 16D10 encoding a conserved RKN secretory peptide was successfully

silenced by soaking J2 of M. incognita in dsRNA solution containing gelatin, spermidine and

resorcinol an uptake stimulant, which led about to 95% reduction of 16D10 transcripts (Huang et

34 |

al., 2006a). In our study we treated the infective 2nd stage juvenile in dsRNA solution combined

with spermidine phosphate and gelatin, which might be improved by addition of an uptake stimulant

resorcinol.

Mg-UK52 fused to eGFP with and without signal peptide were expressed in N. benthamiana leaves

to observe the subcellular localization. Some optimization was performed on the concentration of

Agrobacterium OD600 to detect a good signal for both constructs. The Mg-UK52 construct without

signal was localized both in the cytoplasmic and nuclear region similar to that observed for eGFP

of the control treatment. Passive diffusion to the nucleus might happen due to the lower molecular

weight of the effector fused to eGFP, given a signal at the nucleus and cytoplasm (Haasen et al.,

1999; Jaouannet et al., 2012). Translational fusions of effector protein with reporter genes eGFP-

GUS (enhanced green fluorescent protein-β-glucuronidase) could possibly inhibit cytoplasm-

nucleus passive diffusion (Elling et al., 2007; Hewezi et al., 2008; Hewezi et al., 2010; Zhang et al.,

2015). In fact, most nematode effectors studied so far are shown to be localized in the cytoplasm.

For instance, in single study out of 13 localized M. incognita effectors only one effector was shown

to have a nuclear localization whilst the remaining 12 effectors were found to be cytoplasmic (Zhang

et al., 2015). Some findings point out those effectors targeted to the cytoplasm are related to plant

defense, for example Hs10A06 effector of H. schachtii interacts with spermidine synthases in the

cytoplasm in order to modulate salicylic acid and antioxidant machinery (Jaouannet & Rosso, 2013).

Whereas, effectors accumulating in the plant nucleus may play a role in altering gene expression

(for example M. incognita 7H08 (Zhang et al., 2015)) or in regulating changes in the cell cycle that

induce the development of their feeding site (Elling et al., 2007; Jaouannet et al., 2012; Quentin et

al., 2013; Jaouannet & Rosso, 2013 ). We suggest that if the nucleus is the target of Mg-UK52, it is

probably secreted in order to manipulate gene expression. The localization of Mg-UK52 with its

35 |

signal peptide fused to eGFP was detected in the surrounding cell surface which might be due to the

signal peptide of the nematode effector directing the protein to the secretory pathway (Mitchum et

al., 2013). This could be correlated with our investigation observed in suppression of ROS

production by Mg-UK52+SP fused to eGFP, whereas this was not a case with Mg-UK52 and Mg-

UK52 fused to eGFP at C-terminus. It was shown that the Mi-CRT+SP localized in the cell

periphery, whereas the Mi-CRT was localized in the cytoplasm and nucleus. This confirmed that the

nematode secretion signal peptide was functional in directing the effector to the plants cells and that

Mi-CRT+SP was secreted to the apoplasm via the plants secretory pathway (Jaouannet et al., 2013).

Apparently, it is uncertain if the nematode could secretes UK52 in apoplasm or cytoplasm of the

plant cell. Therefore, we conclude that the Mg-UK52 could be functional in the apoplasm for further

investigation in this study.

We demonstrated that Mg-UK52 with eGFP fused to the C-terminus suppressed the HR response

mediated by Avr2/R2, whilst the N-terminus eGFP fusion gave similar results as the empty vector

and the free eGFP control treatments. This could probably when eGFP fused at the effectors N-

terminus site, it might interfere with the active site of the effector which is essential for its

recognition. As eGFP fusion is advantageous in improving the stability of effectors during

expression in the plant cells, here we found C-terminus fusion to Mg-UK52 works more likely as

same as non-fused Mg-UK52 can do. This has shown by the experiment trail performed with

Avr2/R2 combination for Mg-UK52 which then also led to suppression of effector triggered plant

defense (Diana Naalden, unpublished). This observation could give, a supportive evidence that

fusion eGFP at N-terminus site is interfering with active site of the effector. Besides Avr2/R2 also

Avr4/Cf4 mediated effector triggered plant defense was used to test if Mg-UK52 might influence

the defense response, however no suppression was observed with this effector/resistance

36 |

combination. Which, shows the recognition to this effector is very specific and these two HR inducer

perhaps follow different cellular signaling pathways. Furthermore, neither the C-terminal nor the N-

terminal Mg-UK52 eGFP fusion could suppress HR mediated by INF1, which is also linked with

our investigation shown in ROS assay. Hence, it is possible to suggest that Mg-UK52 plays a role

in suppress of ETI.

Localization studies were performed to examine if induction of the Avr2/R2 HR could change the

subcellular localization of Mg-UK52. The Mg-UK52 fused to eGFP either to its N-terminus and C-

terminus together with Avr2 and R2 were expressed in N. benthamiana leaves by Agro-infiltration

to follow the subcellular localization. However, no difference in subcellular localization could be

observed although in the ETI assay Mg-UK52 fused to its C-terminus gave a significant suppression

of effector triggered plant defense while the N-terminal fusion did not. As mentioned before, this

would be explained by passive diffusion of the effector in the cellular compartments.

Suppression of reactive oxygen species (ROS) production is one of the earliest plant defense

response against pathogen infection. ROS assays were performed to test if Mg-UK52 could be

involved in suppression of the plants apoplastic oxidative burst. Three constructs, Mg-UK52, and a

C-terminal Mg-UK52-eGFP fusion with or without signal peptide were transiently expressed in N.

benthamiana leaves. ROS production was induced by the bacterial PAMP flg22. Surprisingly, we

found that both UK52 and UK52 with eGFP fused to its C-terminus showed a significantly higher

ROS production than the free eGFP control treatment. On other hand, Mg-UK52+SP was

suppressing ROS production compared to the free eGFP control. Previously our localization

experiment demonstrated Mg-UK52 as the cytoplasm and nucleus target, hence an enhanced ROS

production probably due the effector may not have any effect in the apoplasm. It also seems this

effector is recognized by specific receptors, most likely intracellular receptors to suppress R-

37 |

mediated plants defense responses in the cytoplasm. At the same time mimicking the effector in the

apoplasm by expressing with its signal peptide suppress ROS production. In previous studies

mimicking nematode effector in the apoplasm led to suppression of PTI, provoked by perception of

general elicitor elf8, which then shows the nematode probably secrete effectors in the apoplasm to

create compatible interaction (Jaouannet et al., 2013). Some of the secreted effectors by

endoparasitic nematodes during the onset of parasitism are targeted to the apoplastic compartment

to be able to suppress plants basal immunity. For instance Mi-CRT from M. incognita and venom

allergen like protein Gr-VAP of G. rostochiensis were revealed to be targeted in the apoplastic

cellular compartment to suppress plants basal immunity (Jaouannet et al., 2013; Lozano-Torres et

al., 2014). We, therefore, postulate Mg-Uk52 would have no direct role in the apoplasm during

interaction.

The yeast two-hybrid (Y2H) technique is an important tool for identification of the targeted host

protein of the nematode without previous knowledge. We used the Y2H screening in order to find

out a target protein of the effector Mg-UK50 in a rice cDNA library. The X-gal assay revealed one

yeast colony with a strong blue color, the same as the strong interactor control. The BLAST search

on the sequence of the isolated prey showed up to be 100% identical to an Oryza sativa clone.

However, the sequence showed the protein not to be in framed, meaning the found interactor protein

was a false positive. A false positive result, have been pointed out as a disadvantage to this

techniques. In our understanding, we suggest a false positive result might be due inappropriate

insertion of the cDNA in yeast cells. Furthermore, the cDNA library used for screening was not very

specific hence it could be possible to interact with all kind of proteins at list partly those with similar

property in their protein domains. In addition to that, our transformation efficiency was comparably

very low from expected individual trasformant cells, maybe one of the cause for limited success.

38 |

In this study, rice transformation was also performed to produce transgenic lines expressing the

nematode genes Mg-UK52 and Mg-UK8 with signal peptide. The putative transgenic calli derived

from embryonic callus grown on selection media appeared healthy indicating the transformation

was efficient. However, shoot regeneration from transgenic calli remains challenging. In perennial

rhizomatous turmeric (Curcuma longa L.), it has been shown successive selection events during

agrobacterium mediated transformation affects the regeneration of shoot from embryonic calli. In

the same study it has been demonstrated the calli showed stress symptoms with slow growth and

greatly reduced shoot regeneration when placed on selective regeneration media and none of the

calli generated shoots (Enríquez-Obregón et al., 1999). This is normally not a problem in rice

transformation. We therefore suspect that these effectors by themselves might interfere with

meristemoids, a meristematic cells which give rise to leaf primordia and the apical meristem.

Probably the effectors are toxic or interfering with the regulators of auxin/cytokinin signalling

pathway which is very important for in-vitro shoot formations. Therefore, shoot regeneration

efficiency may be rescued by using an inducible gene expression which is important for the rapid

and specific activation of gene expression in response to external stimuli. Apparently, our

knowledge here is limited to exactly give clue why shoot regeneration remains recalcitrant.

In conclusion, the subcellular localization of M. graminicola effector Mg-UK52 fused to eGFP was

both cytoplasmic and nuclear. Both Mg-UK52 on its own or fused to eGFP have revealed rather

enhanced ROS production. However, further studies will be needed to confirm the results more

precisely. Rather, the Mg-UK52 fused to eGFP from its C-terminus suppresses the HR mediated by

recognition of Avr2 by R2 tomato receptor protein. But, the Mg-UK52 fused to eGFP from its N-

terminus expressed at the same time did not show any suppression. We therefore conclude that eGFP

is interfering with functioning of Mg-UK52. The ETI-localization of Mg-UK52 fused to eGFP both

39 |

from its C-terminus and N-terminus could not change the subcellular localization of Mg-UK52

observed before as cytoplasmic and nuclear, which indicates the defense suppression response

targeted either in cytoplasmic or nuclear.

Acknowledgements

First and foremost, I would like to express my sincere gratitude to my promoter Prof. Godelieve

Gheysen, for accepting me as her student and allowing me to work in such a wonderful laboratory

which was one of my dreams. Your guidance, critical reading and supportive comments helped me

writing this thesis. I also owe a special debt of my gratitude to Diana Naalden for her comprehensive

support, responsive attention, exciting enthusiasm, encouragements and respect for new ideas from

the very beginning of my thesis work. Your supervision was quit friendly and in a respectful way,

you are such inspiration to me. I would like to express my respect to Geert Meesen for giving me a

brief advice on lab equipment’s, all the rules and regulations of the lab so I could properly use all

the materials in the lab. I am thankful for the whole molecular genetics research groups at Ghent

University for such positive and inventive atmosphere in the lab during the whole period of my

work. I always enjoy lunch break and it was a wonderful time all I had with you. I am greatly

indebted to my fellow colleagues Md.Sikder Maniruzzaman, Romnick Latina and Adelahu

Mekonene for sharing ideas throughout my work. I am truly thankful for all the people involved in

founding Nematology program at University and especially for Nic Smol, Inge Dehnin and Prof.

Wilfrida Decramer for making it a familywise atmosphere. It would have been very difficult if not

impossible for me to join this program without the support of Vliruos scholarship which covered all

the expenses needed by the program. I would like to give my deepest appreciation to my friends and

classmates, with whom I studied these unforgettable two years and for always showing friendly

gestures and tolerating our cultural and social differences. I am eternally obligated to Dr. Beira Hailu

40 |

a former nematology student at Ghent University who encouraged me to attend this program. I also

thank my friends in Ghent without whom my stay in Ghent would not have been as enjoyable. I

finally would like to thank my family for their dedication in supporting me and most importantly,

none of this would have been possible without your love and your spiritual presence with me no

matter the distance.

References

Bartlem, D. G., Jones, M. G. K. & Hammes, U. Z. (2014). Vascularization and nutrient delivery at

root-knot nematode feeding sites in host roots. Journal of Experimental Botany 65, 1789-

1798.

Baum, T. J., Hussey, R. S. & Davis, E. L. (2007 ). Root-knot and cyst nematode parasitism genes:

The molecular basis of plant parasitism. In: SETLOW, J. K. (Ed.) Genetic Engineering:

Principle and Methods New York, Plenum Press, Springer, pp. 17-27.

Bent, A. F. & Mackey, D. (2007). Elicitors, effectors, and R genes: The new paradigm and a lifetime

supply of questions. Annual Review of Phytopathology 45, 399-436.

Bos, J. I. B., Prince, D., Pitino, M., Maffei, M. E., Win, J. & Hogenhout, S. A. (2010). A functional

genomics approach identifies candidate effectors from the Aphid Species Myzus persicae

(Green Peach Aphid). Plos Genetics 6.

Caillaud, M. C., Dubreuil, G., Quentin, M., Perfus-Barbeoch, L., Lecornte, P., Engler, J. D., Abad,

P., Rosso, M. N. & Favery, B. (2008). Root-knot nematodes manipulate plant cell functions

during a compatible interaction. Journal of Plant Physiology 165, 104-113.

Davis, E. L., Hussey, R. S. & Baum, T. J. (2004). Getting to the roots of parasitism by nematodes.

Trends in Parasitology 20, 134-141.

Davis, E. L., Hussey, R. S., Baum, T. J., Bakker, J. & Schots, A. (2000). Nematode parasitism genes.

Annual Review of Phytopathology 38, 365-396.

Davis, E. L., Hussey, R. S., Mitchum, M. G. & Baum, T. J. (2008). Parasitism proteins in nematode-

plant interactions. Current Opinion in Plant Biology 11, 360-366.

41 |

De Almeida Engler, J., Engler, G. & Gheysen, G. (2011). Unravelling the plant cell cycle in

nematode induced feeding sites. In: JONES, J., GHEYSEN, G. & FENOLL, C. (Eds). Genomics

and MolecularGenetics of Plant-Nematode Interactions. Dordrecht Heidelberg London New

York, Springer, pp. 349-368.

De Waele, D. & Elsen, A. (2007). Challenges in tropical plant nematology. Annual Review of

Phytopathology. pp. 457-485.

Doyle, E. A. & Lambert, K. N. (2003). Meloidogyne javanica chorismate mutase 1 alters plant cell

development. Molecular Plant-Microbe Interactions 16, 123-131.

Dutta, T. K., Ganguly, A. K. & Gaur, H. S. (2012). Global status of rice root-knot nematode,

Meloidogyne graminicola. African Journal of Microbiology Research 6, 6016-6021.

Elling, A. A., Davis, E. L., Hussey, R. S. & Baum, T. J. (2007). Active uptake of cyst nematode

parasitism proteins into the plant cell nucleus. Int J Parasitol 37, 1269-79.

Enríquez-Obregón, G., Prieto-Samsónov, D., De La Riva, G., Pérez, M., Selman-Housein, G. &

Vázquez-Padrón, R. (1999). Agrobacterium-mediated Japonica rice transformation: a

procedure assisted by an antinecrotic treatment. Plant Cell, Tissue and Organ Culture 59,

159-168.

Fire, A., Xu, S. Q., Montgomery, M. K., Kostas, S. A., Driver, S. E. & Mello, C. C. (1998). Potent

and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.

Nature 391, 806-811.

Gao, B., Allen, R., Maier, T., Davis, E. L., Baum, T. J. & Hussey, R. S. (2002). Identification of a

New beta-1,4-Endoglucanase Gene Expressed in the Esophageal Subventral Gland Cells of

Heterodera glycines. Journal of Nematology 34, 12-15.

Gheysen, G. & Jones, J. T. (2006). Molecular aspects of plant–nematode interactions. In: PERRY, R.

N. & MOENS, M. (Eds). Plant Nematology 2ed. Wallingford, UK, CAB International, pp.

274-298

Gheysen, G. & Mitchum, M. G. (2011). How nematodes manipulate plant development pathways

for infection. Current Opinion in Plant Biology 14, 415-421.

Gheysen, G. & Vanholme, B. (2007). RNAi from plants to nematodes. Trends in Biotechnology 25,

89-92.

42 |

Gilroy, E. M., Taylor, R. M., Hein, I., Boevink, P., Sadanandom, A. & Birch, P. R. (2011). CMPG1-

dependent cell death follows perception of diverse pathogen elicitors at the host plasma

membrane and is suppressed by Phytophthora infestans RXLR effector AVR3a. New Phytol

190, 653-66.

Goverse, A. & Smant, G. (2014). The activation and suppression of plant innate immunity by

parasitic nematodes. Annu. Rev. Phytopathol 52, 243–65.

Guo, Y. F., Ni, J., Denver, R., Wang, X. H. & Clark, S. E. (2011). Mechanisms of molecular mimicry

of plant CLE peptide ligands by the parasitic nematode Globodera rostochiensis. Plant

Physiology 157, 476-484.

Haasen, D., Köhler, C., Neuhaus, G. & Merkle, T. (1999). Nuclear export of proteins in plants:

AtXPO1 is the export receptor for leucine-rich nuclear export signals in Arabidopsis

thaliana. The Plant Journal 20, 695-705.

Haegeman, A., Bauters, L., Kyndt, T., Rahman, M. M. & Gheysen, G. (2013). Identification of

candidate effector genes in the transcriptome of the rice root knot nematode Meloidogyne

graminicola. Molecular Plant Pathology 14, 379-390.

Haegeman, A., Jacob, J., Vanholme, B., Kyndt, T. & Gheysen, G. (2008). A family of GHF5 endo-

1,4-beta-glucanases in the migratory plant-parasitic nematode Radopholus similis. Plant

Pathology 57, 581-590.

Haegeman, A., Mantelin, S., Jones, J. T. & Gheysen, G. (2012). Functional roles of effectors of

plant-parasitic nematodes. Gene 492, 19-31.

Hamamouch, N., Li, C. Y., Hewezi, T., Baum, T. J., Mitchum, M. G., Hussey, R. S., Vodkin, L. O.

& Davis, E. L. (2012). The interaction of the novel 30C02 cyst nematode effector protein

with a plant beta-1,3-endoglucanase may suppress host defence to promote parasitism.

Journal of Experimental Botany 63, 3683-3695.

Hewezi, T. & Baum, T. J. (2013). Manipulation of Plant Cells by Cyst and Root-Knot Nematode

Effectors. Molecular Plant-Microbe Interactions 26, 9-16.

Hewezi, T., Howe, P., Maier, T. R., Hussey, R. S., Mitchum, M. G., Davis, E. L. & Baum, T. J.

(2008). Cellulose Binding Protein from the Parasitic Nematode Heterodera schachtii

Interacts with Arabidopsis Pectin Methylesterase: Cooperative Cell Wall Modification

during Parasitism. The Plant Cell 20, 3080-3093.

43 |

Hewezi, T., Howe, P. J., Maier, T. R., Hussey, R. S., Mitchum, M. G., Davis, E. L. & Baum, T. J.

(2010). Arabidopsis Spermidine Synthase Is Targeted by an Effector Protein of the Cyst

Nematode Heterodera schachtii. Plant Physiology 152, 968-984.

Huang, G., Allen, R., Davis, E. L., Baum, T. J. & Hussey, R. S. (2006a). Engineering broad root-

knot resistance in transgenic plants by RNAi silencing of a conserved and essential root-knot

nematode parasitism gene. Proceedings of the National Academy of Sciences 103, 14302-

14306.

Huang, G. Z., Dong, R. H., Allen, R., Davis, E. L., Baum, T. J. & Hussey, R. S. (2006b). A root-

knot nematode secretory peptide functions as a ligand for a plant transcription factor.

Molecular Plant-Microbe Interactions 19, 463-470.

Huang, G. Z., Gao, B. L., Maier, T., Allen, R., Davis, E. L., Baum, T. J. & Hussey, R. S. (2003). A

profile of putative parasitism genes expressed in the esophageal gland cells of the root-knot

nematode Meloidogyne incognita. Molecular Plant-Microbe Interactions 16, 376-381.

Jaouannet, M., Magliano, M., Arguel, M. J., Gourgues, M., Evangelisti, E., Abad, P. & Rosso, M.

N. (2013). The Root-Knot Nematode Calreticulin Mi-CRT Is a Key Effector in Plant Defense

Suppression. Molecular Plant-Microbe Interactions 26, 97-105.

Jaouannet, M., Perfus‐ Barbeoch, L., Deleury, E., Magliano, M., Engler, G., Vieira, P., Danchin, E.

G., Rocha, M. D., Coquillard, P. & Abad, P. (2012). A root-knot nematode-secreted protein

is injected into giant cells and targeted to the nuclei. New Phytologist 194, 924-931.

Jaouannet, M. & Rosso, M.-N. (2013 ). Effectors of root sedentary nematodes target diverse plant

cell compartments to manipulate plant functions and promote infection Plant Signaling &

Behavior 8, 1-5.

Ji, H. L., Gheysen, G., Denil, S., Lindsey, K., Topping, J. F., Nahar, K., Haegeman, A., De Vos, W.

H., Trooskens, G., Van Criekinge, W., De Meyer, T. & Kyndt, T. (2013). Transcriptional

analysis through RNA sequencing of giant cells induced by Meloidogyne graminicola in rice

roots. Journal of Experimental Botany 64, 3885-3898.

Jones, J. D. G. & Dangl, J. L. (2006). The plant immune system. Nature 444, 323-329.

Jones, M. G. K. & Goto, D. B. (2011 ). Root-knot Nematodes and Giant Cells In: JONES, J.,

GHEYSEN, G. & FENOLL, C. (Eds). Genomics and Molecular Genetics of Plant-Nematode

Interactions. Dordrecht Heidelberg, London New York, Springer pp. 83-100

44 |

Kamoun, S., Hamada, W. & Huitema, E. (2003). Agrosuppression: A Bioassay for the

Hypersensitive Response Suited to High-Throughput Screening. Molecular Plant-Microbe

Interactions 16, 7-13.

Kyndt, T., Fernandez, D. & Gheyse, G. (2014). Plant-Parasitic Nematode Infections in Rice:

Molecular and Cellular Insights. Molecular Plant Pathology 52, 135–153.

Kyndt, T., Vieira, P., Gheysen, G. & De Almeida-Engler, J. (2013). Nematode feeding sites: unique

organs in plant roots. Planta 238, 807-818.

Lee, C., Chronis, D., Kenning, C., Peret, B., Hewezi, T., Davis, E. L., Baum, T. J., Hussey, R.,

Bennett, M. & Mitchum, M. G. (2011). The Novel Cyst Nematode Effector Protein 19C07

Interacts with the Arabidopsis Auxin Influx Transporter LAX3 to Control Feeding Site

Development. Plant Physiology 155, 866-880.

Lozano-Torres, J. L., Wilbers, R. H., Warmerdam, S., Finkers-Tomczak, A., Diaz-Granados, A.,

Van Schaik, C. C., Helder, J., Bakker, J., Goverse, A., Schots, A. & Smant, G. (2014).

Apoplastic venom allergen-like proteins of cyst nematodes modulate the activation of basal

plant innate immunity by cell surface receptors. PLoS Pathog 10, e1004569.

Mitchum, M. G., Hussey, R. S., Baum, T. J., Wang, X. H., Elling, A. A., Wubben, M. & Davis, E.

L. (2013). Nematode effector proteins: an emerging paradigm of parasitism. New Phytologist

199, 879-894.

Panka, J., Sharma, H. K. & Prasad, J. S. (2010). The rice root-Knot nematode, Meloidogyne

graminicola: An emerging problem in rice-wheat cropping system. Indian Journal of

Nematology 40, 1-11.

Patel, N., Hamamouch, N., Li, C. Y., Hewezi, T., Hussey, R. S., Baum, T. J., Mitchum, M. G. &

Davis, E. L. (2010). A nematode effector protein similar to annexins in host plants. Journal

of Experimental Botany 61, 235-248.

Quentin, M., Abad, P. & Favery, B. (2013). Plant parasitic nematode effectors target host defense

and nuclear functions to establish feeding cells. Frontiers in Plant Science 4, 53.

Rosso, M.-N. & Grenie, E. (2011). Other Nematode Effectors and Evolutionary Constraints. In:

JONES, J., GHEYSEN, G. & FENOLL, C. (Eds). Genomics and Molecular Genetics of Plant-

Nematode Interactions. Dordrecht, Heidelberg, London, New York, Springer, pp. 287-307.

45 |

Rosso, M. N., Dubrana, M. P., Cimbolini, N., Jaubert, S. & Abad, P. (2005). Application of RNA

interference to root-knot nematode genes encoding esophageal gland proteins. Mol Plant

Microbe Interact 18, 615-20.

Rosso, M. N., Jones, J. T. & Abad, P. (2009). RNAi and Functional Genomics in Plant Parasitic

Nematodes. Annual Review of Phytopathology. pp. 207-232.

Sacco, M. A., Koropacka, K., Grenier, E., Jaubert, M. J., Blanchard, A., Goverse, A., Smant, G. &

Moffett, P. (2009). The Cyst Nematode SPRYSEC Protein RBP-1 Elicits Gpa2-and

RanGAP2-Dependent Plant Cell Death. Plos Pathogens 5.

Saunders, D. G. O., Breen, S., Win, J., Schornack, S., Hein, I., Bozkurt, T. O., Champouret, N.,

Vleeshouwers, V. G. a. A., Birch, P. R. J., Gilroy, E. M. & Kamoun, S. (2012). Host Protein

BSL1 Associates with Phytophthora infestans RXLR Effector AVR2 and the Solanum

demissum Immune Receptor R2 to Mediate Disease Resistance. The Plant Cell 24, 3420-

3434.

Smant, G. & Jones, J. (2011). Suppression of Plant Defences by Nematodes Genomics and

Molecular Genetics of Plant-Nematode Interactions. Dordrecht Heidelberg London New

York, Springer, pp. 273-286).

Smant, G., Stokkermans, J., Yan, Y. T., De Boer, J. M., Baum, T. J., Wang, X. H., Hussey, R. S.,

Gommers, F. J., Henrissat, B., Davis, E. L., Helder, J., Schots, A. & Bakker, J. (1998).

Endogenous cellulases in animals: Isolation of beta-1,4-endoglucanase genes from two

species of plant-parasitic cyst nematodes. Proceedings of the National Academy of Sciences

of the United States of America 95, 4906-4911.

Soriano, I. R. & Reversat, G. (2003). Management of Meloidogyne graminicola and yield of upland

rice in South-Luzon, Philippines. Nematology 5, 879-884.

Soriano, I. R. S., Prot, J. C. & Matias, D. M. (2000). Expression of tolerance for Meloidogyne

graminicola in rice cultivars as affected by soil type and flooding. Journal of Nematology

32, 309-317.

Thomas, C. M., Tang, S., Hammond-Kosack, K. & Jones, J. D. G. (2000). Comparison of the

Hypersensitive Response Induced by the Tomato Cf-4 and Cf-9 Genes in Nicotiana spp.

Molecular Plant-Microbe Interactions 13, 465-469.

46 |

Upadhyay, V., Bhardwaj, N. R., Neelam & Sajeesh , P. K. (2014). Meloidogyne graminicola

(Golden and Birchfield): Threat to Rice Production. Res. J. Agriculture and Forestry Sci. 2,

31-36.

Urwin, P. E., Lilley, C. J. & Atkinson, H. J. (2002). Ingestion of double-stranded RNA by

preparasitic juvenile cyst nematodes leads to RNA interference. Mol Plant Microbe Interact

15, 747-52.

Vanholme, B., Van Thuyne, W., Vanhouteghem, K., De Meutter, J., Cannoot, B. & Gheysen, G.

(2007). Molecular characterization and functional importance of pectate lyase secreted by

the cyst nematode Heterodera schachtii. Molecular Plant Pathology 8, 267-278.

Vieira, P., Danchin, E. G. J., Neveu, C., Crozat, C., Jaubert, S., Hussey, R. S., Engler, G., Abad, P.,

De Almeida-Engler, J., Castagnone-Sereno, P. & Rosso, M. N. (2011). The plant apoplasm

is an important recipient compartment for nematode secreted proteins. Journal of

Experimental Botany 62, 1241-1253.

Wang, X., Allen, R., Ding, X., Goellner, M., Maier, T., De Boer, J. M., Baum, T. J., Hussey, R. S.

& Davis, E. L. (2001). Signal Peptide-Selection of cDNA Cloned Directly from the

Esophageal Gland Cells of the Soybean Cyst Nematode Heterodera glycines. Molecular

Plant-Microbe Interactions 14, 536-544.

Wang, X. H., Mitchum, M. G., Gao, B. L., Li, C. Y., Diab, H., Baum, T. J., Hussey, R. S. & Davis,

E. L. (2005). A parasitism gene from a plant-parasitic nematode with function similar to

CLAVATA3/ESR (CLE) of Arabidopsis thaliana. Molecular Plant Pathology 6, 187-191.

Zhang, L., Davies, L. J. & Elling, A. A. (2015). A Meloidogyne incognita effector is imported into

the nucleus and exhibits transcriptional activation activity in planta. Molecular Plant

Pathology 16, 48-60.