Free Radical Biology and Medicine 65 (2013) 632–644

Contents lists available at ScienceDirect

Free Radical Biology and Medicine

0891-58http://d

n CorrEducatiRoad, Fu

E-m1 Th

journal homepage: www.elsevier.com/locate/freeradbiomed

Original Contribution

Epigenetic silencing of NAD(P)H:quinone oxidoreductase 1 by hepatitisB virus X protein increases mitochondrial injury and cellularsusceptibility to oxidative stress in hepatoma cells

Yun-li Wu a,1, Dong Wang b,1, Xian-e Peng a, Yan-ling Chen b, Da-li Zheng a,Wan-nan Chen a,c, Xu Lin a,c,n

a Key Laboratory of Ministry of Education for Gastrointestinal Cancer, School of Basic Medical Sciences, Fujian Medical University, Fuzhou 350108, Chinab Department of Hepatobiliary and Pancreatic Surgery, Union Clinical Medical College, Fujian Medical University, Fuzhou 350108, Chinac Key Laboratory of Tumor Microbiology, School of Basic Medical Sciences, Fujian Medical University, Fuzhou 350108, China

a r t i c l e i n f o

Article history:Received 16 November 2012Received in revised form22 July 2013Accepted 24 July 2013Available online 3 August 2013

Keywords:Hepatitis B virus X proteinNAD(P)H:quinone oxidoreductase 1Hepatocellular carcinomaEpigenetic modificationMitochondrial injuryRedox statusFree radicals

49/$ - see front matter & 2013 Elsevier Inc. Ax.doi.org/10.1016/j.freeradbiomed.2013.07.037

espondence to: Fujian Medical University, Kon for Gastrointestinal Cancer, School of Basiczhou 350108, China. Fax: +86 591 83569132.ail address: linxu@mail.fjmu.edu.cn (X. Lin).ese authors contributed equally to this study

a b s t r a c t

NAD(P)H:quinone oxidoreductase 1 (NQO1) is a phase II enzyme that participates in the detoxification ofdopamine-derived quinone molecules and reactive oxygen species. Our prior work using a proteomicapproach found that NQO1 protein levels were significantly decreased in stable hepatitis B virus (HBV)-producing hepatoma cells relative to the empty-vector-transfected controls. However, the mechanismand biological significance of the NQO1 suppression remain elusive. In this study we demonstrate thatHBV X protein (HBx) induces epigenetic silencing of NQO1 in hepatoma cells through promoterhypermethylation via recruitment of DNA methyltransferase DNMT3A to the promoter region of theNQO1 gene. In HBV-related hepatocellular carcinoma (HCC) specimens, HBx expression was correlatednegatively to NQO1 transcripts but positively to NQO1 promoter hypermethylation. Downregulation ofNQO1 by HBx reduced intracellular glutathione levels, impaired mitochondrial function, and increasedsusceptibility of hepatoma cells to oxidative stress-induced cell injury. These results suggest a novelmechanism for HBV-mediated pathogenesis of chronic liver diseases, including HCC.

& 2013 Elsevier Inc. All rights reserved.

Hepatitis B virus (HBV) infection leads to a wide range of liverdiseases, including chronic hepatitis, cirrhosis, and hepatocellularcarcinoma (HCC) [1]. HBV belongs to the hepadnaviridae family andencodes seven proteins including the small surface antigen (HBsAg),the middle surface antigen (MHBs), the large surface antigen (LHBs),the core antigen (HBcAg), the e antigen (HBeAg), the DNA poly-merase (HBpol), and the X protein (HBx). Among these viralproteins, HBx apparently has the most pathogenic potential as itcan act on a wide array of signaling pathways in the cytoplasm thatare associated with apoptosis, cell proliferation, and response toDNA damage [2–4] and can transactivate a number of cellularpromoters by interacting with nuclear transcription factors [5,6].HBx also regulates proteasome function and therefore controlsdegradation of cellular and viral proteins [7,8]. HBx does not binddirectly to the host DNA; however, accumulating evidence hassuggested its important role as an epigenetic regulator in down-regulation of several tumor suppressor genes in HCC by promoter

ll rights reserved.

ey Laboratory of Ministry ofMedical Sciences, 1 Xueyuan

.

hypermethylation [9–11] and in HBV-mediated hepatocarcinogen-esis [12–14]. Despite the multifunctional regulatory capacities HBxpossesses, its mechanisms and key host factors involved in epige-netic modifications are rather poorly understood.

HBV infection can cause oxidative stress resulting in sustainedand elevated generation of reactive oxygen species (ROS) such ashydroxyl radical, superoxide radical anion, and hydrogen peroxide(H2O2) [15,16]. HBx has been shown to increase the ROS level inhuman liver cell lines and consequently oxidative liver injury[17,18]. ROS may lead to repeated cycles of hepatocyte death andregeneration and cause severe genetic damage of liver cells,eventually boosting the development of HCC [19,20]. Cytoprotectivemechanisms against toxic effects of endogenous ROS are providedby a variety of antioxidant and detoxifying enzymes [21], of whichNAD(P)H:quinone oxidoreductase 1 (NQO1) is of particular interestwith respect to its critical role in cancer prevention, having longserved as an index of chemoprotective efficacy for anticarcinogenicagents [22–24]. NQO1 is mainly a cytosolic protein that catalyzestwo-electron reduction and detoxification of quinones and theirderivatives and directly competes with cellular cytochrome P450reductase (CYP), thus preventing or decreasing the formation of freeradicals and toxic reactive oxygen intermediates generated fromone-electron reductions catalyzed by CYP [25]. Disruption of NQO1

Y. Wu et al. / Free Radical Biology and Medicine 65 (2013) 632–644 633

has been shown to alter intracellular redox status and result inexcessive ROS production leading to toxicity, mutations, and ulti-mately development of cancer in various human tissues [19,20,26].Recently, using fluorescent two-dimensional difference gel electro-phoresis and MALDI-TOF/TOF MS analysis we found that NQO1protein level in HBV-producing cells was significantly decreasedcompared to that in control cells [8]. Transcriptional regulation ofNQO1 is mainly through the nuclear factor erythroid 2-relatedfactor 2 (Nrf2)/antioxidant response element (ARE) pathway, inwhich Nrf2, a transcription factor responsive to oxidative stress,binds to the ARE within the NQO1 promoter region [27]. In additionto the above genetic model of regulation, epigenetic modificationsof NQO1 via CpG island hypermethylation have also been impli-cated in the pathogenesis of HCC [28]. However, the detailedmechanisms of the CpG island hypermethylation and its biologicalconsequences have not been elucidated.

In this study, we demonstrate that HBx, interacting with DNAmethyltransferase 3 A (DNMT3A), induces NQO1 promoter hyper-methylation, thus epigenetically silencing NQO1 expression. Tran-scriptional downregulation of NQO1 by HBx impairs mitochondrialfunction and induces a decrease in cellular redox status withconsequent increases in oxidative stress-induced cell death.

Materials and methods

Cells and tumor tissues

HepG2 (HB-8065, ATCC, Manassas, VA, USA), Huh7 (JCRB0403,Japan), and Hep3B (HB-8064, ATCC) cells were maintained inDulbecco's modified Eagle medium (DMEM; Invitrogen, Carlsbad,CA, USA) supplemented with 10% (v/v) fetal bovine serum (FBS;Invitrogen). HepG2.2.15 cells (CRL-11997, ATCC) harboring four copiesof HBV DNA were cultured in modified Eagle's medium (Invitrogen)with 380 μg/ml G418 (Invitrogen). The HepG2-HBV3 cell line harbor-ing 1.2� unit-length of HBV genome and the control HepG2-RepSal1cell line [8] were maintained in DMEM supplemented with 10% FBSand 250 μg/ml hygromycin B (Roche Diagnostics, Mannheim,Germany). Surgically resected HBV-associated HCC tissues wereobtained from 20 patients who underwent surgical resection. Thestudy protocol had all the appropriate approvals by the institutionalreview board and regulatory authorities. All patients had giveninformed and written consent.

Construction of expression vectors and production of recombinantadenoviruses

Details on the construction of various expression vectors andgeneration of the recombinant adenoviruses are given in thesupplementary material.

RNA interference assay

DNMT3A-specific small interfering RNA (siRNA) mix (siRNA-3 A,No. sc-37757) and NQO1 siRNA mix (siRNA-NQO1, No. sc-37139)were obtained from Santa Cruz Biotechnology, and NC-siRNA, anontargeting siRNA, was used as a negative control. Forty-eighthours after transfection the cells were harvested for quantitativereverse-transcription PCR (qPCR), Western blot analysis, or cellviability assay.

Bisulfite DNA sequencing

Genomic DNA was isolated using a DNeasy Tissue Kit (Qiagen,Hilden, Germany), and 2 μg of genomic DNA was treated withsodium bisulfate (EpiTect Bisulfite kit, Qiagen) to convert all

nonmethylated cytosine bases to uracil. The resultant bisulfite-modified DNA (40 ng) was amplified by PCR with Hotstart Taq(Qiagen) and NQO1 promoter/exon 1-specific primers (Supple-mentary Table S1 for sequences). The amplified products wereseparated on 1.5% agarose gels and purified for subcloning into thepMD18-T vector (Takara, Japan). To determine the CpG methyla-tion status of the 5′ CpG island of the NQO1 gene, 10 randomlyselected clones from each cell line were sequenced.

Methylation-specific PCR (MSP)

Bisulfite-modified DNA was amplified using primers (Supple-mentary Table S1 for sequences) specific for both the methylatedand the unmethylated NQO1 promoter/exon 1. The amplified PCRproducts were run on a 1.5% agarose gel stained with ethidiumbromide.

Chromatin immunoprecipitation (ChIP) assay

ChIP assay was performed according to Abcam's X-ChIP protocol(http://www.abcam.com/ps/pdf/.protocols/x_chip_protocol.pdf).For immunoprecipitation, anti-DNMT3A or anti-Flag M2 (sameamount of normal rabbit IgG as control) antibodies were added.Bound target DNA fractions were analyzed by PCR with the pairedprimers (Supplementary Table S1) targeting nucleotides �73 to+135 (region 1, R1) or nucleotides �4824 to �4638 (region 2, R2).

NQO1 activity assay

An indirect, coupled assay was used to measure NQO1 activityas described previously [29]. Forty-eight hours postinfection withHBx-expressing adenoviruses (Ad-HBx) and control adenoviruses(Ad-GFP), cells were harvested and frozen at �80 1C for 24 h. Thefrozen cells were suspended in 0.45 ml of phosphate-bufferedsaline plus 50 μl of a 10% solution of aprotinin (Sigma) andsonicated at 4 1C for 5 min with a Branson Model 350 Sonifier(Branson Sonic Power Co., Danbury, CT, USA) at 10% duty cycle.After centrifugation at 12,000g for 20 min at 4 1C, supernatantwas collected and the protein concentration was measured usingthe BCA protein assay (Pierce, Rockford, IL, USA). NQO1 activitywas assayed spectrophotometrically by measuring cytochrome creduction at 550 nm in 20 μg of cell proteins in the presence ofNADH. Standard reaction mixtures (1 ml) contained 77 μM cyto-chrome c, 200 μM NADH, 10 μM menadione, 0.14% bovine serumalbumin, and Tris–HCl buffer (50 mM; pH 7.5). The activityattributable to NQO1 activity in the cell extracts was that whichwas inhibited by the NQO1 inhibitor dicumarol (10 μM). All of thereactions were carried out at 37 1C and rates of reduction ofcytochrome c were calculated from the initial linear part of thereaction curves. NQO1 activity was expressed as nanomoles ofcytochrome c reduced per minute per milligram of protein. Anextinction coefficient for cytochrome c of 21.1 mM/cm was used inthe calculations.

Determination of reduced glutathione content

The intracellular reduced glutathione (GSH) levels were measuredusing a glutathione assay kit (Sigma). GSH and glutathione disulfide(GSSG) in the presence of glutathione reductase catalyze the reductionof 5,5′-dithiobis(2-nitrobenzoic acid) (DTNB) by NADPH. The rate ofDTNB reduction is proportional to the total glutathione concentration(GSH+GSSG) in the cell lysate. Briefly, 1�108 cells were harvested andresuspended in 3 volumes of 5% 5-sulfosalicylic acid. The suspensionwas then snap-frozen in liquid nitrogen and thawed at 37 1C twice.All samples were centrifuged at 10,000g for 10 min and 10 μl ofeach supernatant was assayed spectrophotometrically following the

Y. Wu et al. / Free Radical Biology and Medicine 65 (2013) 632–644634

manufacturer's instructions using a plate reader (Bio-Tek, Winooski,VT, USA) set to 412 nmwith kinetic read at 1-min intervals for 10 min.

Apoptosis analysis

Apoptosis was detected using an FITC Annexin V apoptosisdetection kit (BD Pharmingen, San Diego, CA, USA) according tothe manufacturer's instructions. Briefly, Hep3B cells were har-vested and resuspended in 1� binding buffer (1�106 cells/ml).Aliquots of 105 cells (100 μl) were mixed with 5 μl of annexin Vand 5 μl of propidium iodide (PI). After 15-min incubation atroom temperature in the dark, fluorescence was analyzed by flowcytometry (FACSVerse, BD Biosciences) using FACSuite software(BD Biosciences).

Assessment of mitochondrial membrane potential (Δψm)

Changes in Δψm were assessed in a fluorescence microscopewith the mitochondrial-specific dual-fluorescence probe JC-1 atthe concentration of 10 mg/ml (Molecular Probes) according to themanufacturer's instructions. JC-1 is a ratiometric dye that isinternalized as a monomer dye (green fluorescence, excitation/emission 485/530 nm) and is concentrated by respiring mitochon-dria with negative inner membrane potential into the J-aggregatedye (red fluorescence, excitation/emission 535/590 nm). Conse-quently, mitochondrial depolarization (i.e., loss of Δψm) is indi-cated by a decrease in the red/green fluorescence ratio.

Measurement of cellular ATP levels

Intracellular ATP levels were determined by a bioluminescentsomatic cell ATP assay kit (Sigma–Aldrich, St. Louis, MO, USA)according to the manufacturer's instructions. The assay is based onfirefly luciferase's requirement for ATP to produce light. The lightintensity is a direct measure of intracellular ATP concentration.Briefly, cells were mixed with Somatic Cell ATP Releasing Reagentand ATP assay mix. The amount of light emitted from each reactionwas measured immediately by a luminometer (Orion II MicroplateLuminometer, Berthold Detection Systems, Bad Wildbad, Germany)and the ATP amount in each sample was calculated from ATPstandard curves. Data were expressed as nanomoles of ATP permilligram of protein.

Results

HBV suppresses NQO1 expression

The effect of HBV on NQO1 expression was first evaluated byqPCR and Western blot analysis in the stable HBV-producinghepatoma cell lines HepG2.2.15 and HepG2-HBV3, which had beenproven to constitutively produce infectious HBV particles [8,30].Both NQO1 mRNA (Fig. 1A) and protein (Fig. 1B) levels weresignificantly reduced in HepG2.2.15 and HepG2-HBV3 cells com-pared to their respective controls, HepG2 and HepG2-RepSal.A similar result was obtained with Hep3B, Huh7, and HepG2 cellstransiently transfected with 1.2� unit-length of the HBV genome(pRep-HBV), showing the decreased NQO1 mRNA (Fig. 1C) andprotein (Fig. 1D) levels in the HBV-DNA-transfected cells. Theseresults imply that suppression of NQO1 by HBV might be mediatedprimarily at the transcriptional level.

HBx downregulates NQO1 gene expression

To further delineate and distinguish individual effects byvarious HBV proteins on NQO1 gene expression, recombinant

adenoviruses expressing various viral proteins were generatedand used for infection of HepG2 cells. Successful expression ofthe individual proteins in infected cells was confirmed by fluor-escence microscopy and Western blot analysis (SupplementaryFig. S1A–C). Fig. 2A–C show that expression of HBx, but not anyother viral protein, significantly decreased the NQO1 protein andmRNA levels in HepG2 cells compared to Ad-GFP control.To confirm and extend this finding into other hepatoma cell lines,we infected Huh7 and Hep3B cells with HBx-expressing adeno-viruses. Likewise, a marked reduction in NQO1 protein and mRNAlevels was observed in the HBx-overexpressing Huh7 and Hep3Bcells (Fig. 2D–F). NQO1 enzyme activity was also determined inHepG2, Huh7, and Hep3B cells infected with HBx-expressingadenoviruses (Ad-HBx) or control adenoviruses (Ad-GFP). Asshown in Fig. 2G, HBx expression significantly reduced NQO1enzyme activity, indicating a good correlation between NQO1expression and its functional activity. The fact that HBx constitu-tively downregulates NQO1 gene expression raised the question asto whether HBx would behave differently in the presence of SUL, afunctional NQO1 inducer [21]. As expected, SUL increased NQO1expression in the control Ad-GFP cells in a concentration-dependent manner, whereas SUL-mediated induction of NQO1 inthe HBx-expressing Hep3B cells was less profound compared tothe control (Fig. 2H–J). This observation implies that a mechanismby which HBx downregulates NQO1 in this cell system is pre-dominant over Nrf2/ARE transactivation activity because SULexerts its NQO1-inducing effect mainly through this signalingpathway [31].

HBx represses NQO1 expression by inducing hypermethylation of theNQO1 promoter via recruitment of DNMT3A

Owing to the transcriptional downregulation of NQO1 in HBx-expressing cells, we reasoned that HBx may induce DNA methyla-tion that enables silencing of NQO1. Indeed, as shown in Fig. 3A–C,treatment of HBx-expressing hepatoma HepG2, Huh7, or Hep3Bcells with a demethylating agent, DAC, effectively restored NQO1mRNA and protein levels, whereas the magnitude of this effectwas relatively smaller in the Ad-GFP control cells. However, thehistone deacetylase inhibitor TSA had no effect on restoring NQO1expression in either Ad-HBx or control Ad-GFP cells. HBx has beenshown to repress the expression of tumor suppressor genep16INK4a via promoter hypermethylation [32]. Consistent with thisprior observation, p16INK4a expression was indeed downregulatedin the HBx-expressing HepG2 cells but was restored to its fullextent after treatment with DAC (Fig. 3D), thus providing furtherassurance of DAC's effectiveness.

The fact that NQO1 mRNA expression can be restored upon DACtreatment prompted us to explore potential mechanisms by whichHBx regulates NQO1 promoter hypermethylation. Using EMBOSSCpGplot software, we identified a CpG island spanning nucleotides�106 to +341 (Fig. 4A and B) after depositing 2200 bp (nucleo-tides �1550 to +650) of NQO1 gene promoter sequence that alsocontained the known ARE located between �469 and �446(AGTCACAGTGACTCAGCAGAATCT, Fig. 4A); 22 CpG dinucleotideswere present in the NQO1 CpG island. Through extensive bisulfitesequencing analysis, we found that the CpG island methylationwas significantly increased in HBx-expressing HepG2, Huh7,or Hep3B cells relative to that in their respective control cells(Fig. 4C). Interestingly, the basal levels of CpG methylation varyconsiderably between Hep3B and HepG2 or Huh7 cell lines. Tadaet al. [28] have previously reported that, for unknown reasons, the5′ CpG island of NQO1 was densely methylated in Hep3B cells,whereas few CpG dinucleotides were methylated in HepG2 andHuh7 cells. This is consistent with our observation in that thepercentage of methylated CpG dinucleotides was 45.45, 4.09, and

Fig. 1. Effects of HBV on NQO1 mRNA and protein levels. (A, B) mRNA and protein levels of NQO1 in HBV-producing cell lines. HepG2.2.15 and HepG2-HBV3 cells were HBV-producing cell lines. (C, D) mRNA and protein levels of NQO1 in HBV-DNA-transfected cells. HepG2, Huh7, and Hep3B cells were transfected with pRepHBV and controlplasmid pRep-Sal. Results are means7SD of three separate experiments performed in duplicate. β-Actin served as a loading control for Western blot. GAPDH served as aninternal control for qPCR. *po0.05 versus control.

Y. Wu et al. / Free Radical Biology and Medicine 65 (2013) 632–644 635

3.18%, respectively, for Hep3B, HepG2, and Huh7. These dataindicate that the mRNA expression of NQO1 is inversely correlatedwith the status of NQO1 promoter methylation induced by HBx.

HBx was recently reported to physically interact with DNAmethyltransferase DNMT3A in vitro and in vivo to facilitate cellularepigenetic modification at distinct genomic loci [14]. Intrigued by thisobservation and taking into account the significant hypermethylationof the NQO1 promoter, we were tempted to speculate that HBx mayrecruit DNMT3A to the regulatory promoter of NQO1 and subse-quently abrogate NQO1 transcription via de novo DNA methylation.To test the hypothesis, we performed a ChIP assay in Ad-HBx Hep3Bcells with specific antibodies and PCR using the primers (Supplemen-tary Table S1) designed against the CpG island region (�73 to +135,R1) or distant upstream 5′ untranslated region (�4824 to �4638, R2)of the NQO1 gene (Fig. 4D). The results revealed that the antibody toDNMT3A or the antibody to Flag, which binds the Flag-tagged HBx,efficiently immunoprecipitated the CpG-rich R1 (Fig. 4E, upper row),whereas these two antibodies did not immunoprecipitate the distant

upstream R2 (Fig. 4E, lower row). To further confirm contribution ofDNMT3A to HBx-mediated NQO1 gene repression, DNMT3A wasknocked down in Ad-HBx-infected Hep3B cells using an siRNA mix(Fig. 4F). As shown in Fig. 4G, knockdown of DNMT3A in the HBx-overexpressing Hep3B cells effectively restored transcription ofHBx-repressed NQO1. Collectively, these data demonstrate that HBxrepresses NQO1 expression by inducing hypermethylation of theNQO1 promoter via recruitment of DNMT3A to the NQO1 promoter.

Correlation between NQO1 and HBx levels in HBV-related HCCspecimens

Currently, there is no information available regarding the rela-tionship between HBx and NQO1 expression in human HBV-associated tissues. To evaluate their clinicopathological implicationand correlation, NQO1 and HBx transcript levels were first assessedin 20 primary HBV-related HCC tumors by qPCR. Fig. 5A shows thatNQO1 transcript level was negatively correlated with HBx level

Fig. 2. HBx represses NQO1 expression. (A–C) Protein and mRNA levels of NQO1 in HepG2 cells infected with HBV-expressing recombinant adenoviruses or Ad-GFP (control).*po0.05 versus Ad-GFP. (D–F) Protein and mRNA levels of NQO1 in Huh7, HepG2, and Hep3B cells infected with Ad-HBx or Ad-GFP. npo0.05 versus Ad-GFP. (G) HBxexpression impairs NQO1 enzyme activity. NQO1 enzymatic activity was assayed spectrophotometrically by measuring cytochrome c reduction in the presence of NADH.(H–J) The effects of HBx on SUL induction of NQO1 at the protein (H, I) or mRNA level (J) in Hep3B cells. Hep3B cells were infected with Ad-HBx or Ad-GFP in the presence ofincreasing concentrations (0 to 20 μM) of SUL for 20 h. npo0.05 versus Ad-GFP.

Y. Wu et al. / Free Radical Biology and Medicine 65 (2013) 632–644636

(Pearson r¼�0.4639, po0.05). Semiquantitative RT-PCR alsorevealed that, in most cases, the NQO1 transcript was repressed inHBx-positive samples and vice versa (Fig. 5B). In line with the qPCR

results, immunohistochemistry (cases 3 and 12 were representativeof negative and positive HBx-expressing samples, respectively)demonstrated a similar pattern of correlation (Fig. 5C and Table 1).

Fig. 3. NQO1 expression in HepG2, Huh7, and Hep3B cells after DAC or TSA treatment. Cells were treated with 5 mM DAC for 72 h or 0.67 mM TSA for 24 h. NQO1 expressionwas then analyzed by (A) qPCR and (B, C) Western blot. Results are shown as means7SD of three independent experiments performed in duplicate. npo0.05 versus Ad-GFP.#po0.05 versus Ad-HBx. (D) p16INK4a expression in HepG2 cells analyzed by Western blot served as a positive control for DAC effectiveness.

Y. Wu et al. / Free Radical Biology and Medicine 65 (2013) 632–644 637

Furthermore, using methylation-specific PCR we consistentlyfound that the NQO1 promoter was hypermethylated in NQO1-low-expressing specimens and conversely hypomethylated inNQO1-high-expressing tumors (Fig. 5D). Bisulfite sequencing oftwo randomly selected samples each from HBx-negative and-positive HCC specimens demonstrated that the percentage ofmethylated CpG's within the NQO1 promoter was strikingly lowerin the HBx-negative tumor tissues (5.45% for case 3 and 5.91% forcase 5) compared to the HBx-positive tumor tissues (82.73% forcase 11 and 85.45% for case 12; po0.01; Fig. 5E). Collectively,these results clearly indicate that HBx is transcriptionally innegative correlation with NQO1 through modulation of NQO1promoter methylation in HBV-related specimens, which is in goodagreement with the in vitro results obtained in HBx-expressingcells.

HBx reduces glutathione levels and sensitizes hepatoma cells toH2O2-induced cytotoxicity

Expression of HBx has been shown to elevate the ROS level inhuman liver cell lines, which disrupts the mitochondrial membranepotential, causing oxidative liver injury and cell death [17,18]. Wesought to further investigate how ectopic expression of HBx inhepatoma cells induces cell death and attempted to explore protectivemechanisms for this induced oxidative stress. Given that persistent,high levels of ROS could exhaust cellular antioxidant enzymes, weexamined and compared the intracellular levels of total glutathione, amajor intracellular antioxidant and indicator of ROS accumulation, inthe control and HBx-expressing cells without or with treatment withNQO1 overexpression, RNA interference by DNMT3A, DAC, or SUL.As expected, HBx expression resulted in a significant drop in GSH

Fig. 4. HBx represses NQO1 expression by inducing hypermethylation of NQO1 promoter via recruitment of DNMT3A to the NQO1 promoter. (A) Schematic representation ofthe positions of the ARE and the putative CpG island in the 5′ flanking region of the NQO1 gene promoter. (B) A putative CpG island containing 22 CpG dinucleotides relativeto the transcription start site (TSS). (C) Methylation status of the CpG's in cells. Bisulfite DNA sequencing was performed to determine the methylation status of the 5′ CpGisland of the NQO1 promoter in cells infected with Ad-HBx or Ad-GFP control. (D) Schematic representation of PCR-amplified fragments of the NQO1 regulatory region.(E) ChIP assay using lysates of Hep3B cells infected with Ad-HBx. PCR was conducted using primer pairs described in (D) and precipitated DNA was used as the template.(F, G) Knockdown of DNMT3A in Hep3B cells restored the transcription of NQO1. (F) Cellular proteins of Hep3B cells were subjected to Western blot analysis with anti-DNMT3A and (G) mRNA level of NQO1 was determined by qPCR. The relative NQO1 mRNA level was obtained by comparison with the negative control (NC), which was set to1. *po0.05 versus Ad-GFP+NC. #po0.05 versus Ad-GFP+siRNA_3 A.

Y. Wu et al. / Free Radical Biology and Medicine 65 (2013) 632–644638

levels compared with the Ad-GFP control, and treatment of the HBx-expressing cells with DAC or SUL markedly elevated the GSH levels,whereas there was little effect from NQO1 overexpression or DNMT3ARNA interference (Fig. 6A). To evaluate whether the changes in GSHlevels resulted from differences in NQO1 expression, the protein levelsof NQO1 were determined byWestern blot analysis after the indicated

treatments. As shown in Fig. 6B, the relative expression of NQO1largely mirrored intracellular glutathione levels. Densitometric mea-surements revealed the level of NQO1 protein was 0.58-, 1.04-, 1.94-,1.86-, and 0.92-fold, respectively, in the Ad-HBx, Ad-HBx+NQO1,Ad-HBx+DAC, Ad-HBx+SUL, Ad-HBx+siRNA-DNMT3A cells comparedwith control Ad-GFP cells. These results indicated that after HBx

-20 -15 -10 -5 0 5-12

-10

-8

-6

-4

-2

0

-ΔCT (HBx)

-ΔC

T (N

QO

1)

Fig. 5. Expression and DNA methylation status of NQO1 in HCC specimens with and without HBx. (A) NQO1 and HBx transcript levels were negatively correlated in 20 HBV-related HCC specimens. NQO1 and HBx mRNA levels were measured by qPCR, and respective ΔCt values were subjected to Pearson correlation analysis. The dotted linesrepresent the 95% confidence band of the regression line. (B) Semiquantitative RT-PCR of NQO1. β-Actin and water served as internal and negative control, respectively.(C) The protein levels of NQO1 and HBx in two representative specimens by immunohistochemistry. Case 3: low expression of HBx (left) with high expression of NQO1(right). Case 12: high expression of HBx (left) with low expression of NQO1. The protein expression levels of NQO1 and HBx in a total of 20 HBV-related HCC specimens areshown in detail in Table 1. (D) MSP analysis of the CpG islands of NQO1. Not treated indicates samples not subjected to bisulfite treatment. (E) Bisulfite DNA sequencing of theNQO1 promoter region in HCC tissues. Cases 3 and 5 were HBx-negative-expression samples, and cases 11 and 12 were HBx-positive-expression samples. The sequencedregion was nucleotides �106 to +341 relative to the transcription start site.

Y. Wu et al. / Free Radical Biology and Medicine 65 (2013) 632–644 639

treatment, recovery of NQO1 to the control level (NQO1 overexpres-sion and DNMT3A knockdown) is not sufficient to restore the GSHlevel, and NQO1 needs to be significantly higher than that in thecontrol samples (DAC and SUL treatment) to restore the GSH level. Toinvestigate whether a reduction in the intracellular GSH pools inducedby HBx-mediated NQO1 suppression could predispose the cells toapoptosis, annexin V/PI dual staining for flow cytometric analysis was

used to measure an early event of apoptosis. As shown in Fig. 6C, adramatic increase in the percentage of annexin V–FITC+/PI� cells(46.48%, lower right quadrant) was observed in the HBx-transfectedcells, indicating that HBx expression increased apoptotic susceptibilityof the cells. Treatment with NQO1 overexpression, DAC, SUL, orDNMT3A knockdown moderately reduced the percentage of the earlyapoptotic cells. To address directly whether HBx impairs cellular

Table 1The expression of NQO1 in HCC tissues with high or low HBx expression.

Group Cases (n) The expression of NQO1 (IHC scorea)

1 2 3 4

HBx high expression 10 2 6 1 1HBx low expression 10 0 2 5 3

a Staining was assessed on a four-tiered scale: negative, no staining; 1+, weakstaining; 2+, moderate staining; and 3+, strong staining. The immunohistochemical(IHC) scores were graded as follows: 0, no staining or 1+ staining regardless of thepercentage of positive cells; 1, 2+ staining in r30% of cells; 2, 2+ staining in >30%of cells; 3, 3+ staining in r50% of cells; and 4, 3+ staining in >50% of cells. Mann–Whitney U¼16.00, po0.01.

Y. Wu et al. / Free Radical Biology and Medicine 65 (2013) 632–644640

defenses against exogenous pro-oxidant stimuli, cells were exposed toincreasing concentrations of H2O2 and cell viability was measured. Asshown in the H2O2 concentration survival curve (Fig. 6D), althoughH2O2 produced a concentration-dependent killing of cells undervarious conditions, it caused much more cell death inHBx-expressing Ad-HBx cells than in the control Ad-GFP cells.Knockdown of NQO1 in Ad-HBx cells (Ad-HBx+siRNA-NQO1)further sensitized the cells to the cytotoxic effects of H2O2. Incontrast, overexpression of NQO1 or pretreatment with DAC or SULprotected the cells from the oxidative stress-induced death. Therewas no discernible difference in response to H2O2 stress betweenthe Ad-GFP control and the Ad-HBc cells, which express the coreantigen, a non-HBx HBV protein. Taken together, these resultsindicate that although restoration of NQO1 levels is not sufficientto protect the cells from apoptosis, augmentation of NQO1 expres-sion clearly improves cellular protection against H2O2 insult.

HBx-induced Δψm loss and ATP depletion are reversible by NQO1overexpression or DAC treatment

It has been reported that HBx itself can target and bind tomitochondria, leading to loss of mitochondrial membrane poten-tial and increased endogenous ROS level [17,18,33]. To examinewhether NQO1 is involved in the Δψm pathway downregulated byHBx, the molecular probe JC-1 was used to assess mitochondrialmembrane depolarization in Hep3B cells under various experi-mental conditions. As shown in Fig. 7A, control cells exhibitedbrightly stained mitochondria that emit red fluorescence. HBx-transfected cells displayed a green diffused fluorescence in thecytoplasm indicating dissipation of the Δψm. Overexpression ofNOQ1 or treatment with DAC showed a substantial increase in redfluorescence, implicating recovery of Δψm loss in the HBx-transfected cells. Likewise, the ATP levels in HBx-transfected cellswere markedly decreased, whereas NQO1 overexpression or DACtreatment resulted in significant ATP increase (Fig. 7B). Thesefindings suggest that HBx-induced mitochondrial dysfunction andGSH depletion occurred, at least in part, through the downregula-tion of NQO1 and inhibition of its oxidoreductase activity.

Discussion

Epigenetic modifications of cellular genes by way of hypo-methylation, hypermethylation, chromatin remodeling, or RNA-associated silencing have proved to play crucial roles in thepathogenesis of many diseases. An increasing body of evidencehas also indicated that viral genes are key players in the regulationof DNA methylation, contributing to viral pathogenesis and tumor-igenesis [34]. HBx is associated with oxidative stress, which candamage cellular molecules leading to mutations or cell death

[35,36]. The results reported here provide evidence that HBx-induced mitochondrial injury and susceptibility to oxidative stressin hepatoma cells is related to its transcriptional downregulationof NQO1 via hypermethylation of NQO1 promoter. The epigeneticmodifications of NQO1 by HBx were supported by a string ofevidence. First, HBx was able to transcriptionally and constitu-tively downregulate NQO1 expression, and the demethylatingagent but not histone deacetylase inhibitor restored the expres-sion levels of NQO1. Second, bisulfite DNA sequencing revealedthat the CpG island of the NQO1 promoter was hypermethylated ata greater frequency in HBx-infected Hep3B, Huh7, and HepG2 cellscompared to their respective controls. Of more clinical importance,HBx was found to be negatively correlated with NQO1 transcriptsbut positively to NQO1 promoter hypermethylation in HBV-relatedHCC specimens. All these observations are in concert with thenotion that HBx downregulates NQO1 expression through hyper-methylation of its promoter region.

Methylation modification is primarily mediated by the DNMTfamily members through various mechanistic pathways ultimatelyleading to methylation-based gene silencing or downregulation.The DNMT family consists of DNMT1, DNMT3A, and DNMT3B.DNMT1 functions mainly as a maintenance methyltransferase forreestablishment of the DNA methylation patterns during DNAreplication, whereas DNMT3A and DNMT3B are the de novomethyltransferases [37]. A few recent studies have reported thatin hepatoma cell models HBx can upregulate the expression of denovo methyltransferase DNMT3A, interact directly with and evenrecruit DNMT3A to the regulatory promoters of target genes, andsubsequently silence their transcription via de novo DNA methyla-tion [9,12,14]. Given the clear evidence that HBx downregulatedNQO1 transcripts by promoter hypermethylation, and demethylat-ing treatment restored NQO1 expression, it is reasonable topostulate that HBx function may also involve DNMT3A to epigen-etically silence NQO1. Indeed, our current study demonstrated thatHBx recruited DNMT3A to the promoter region of NQO1, asobserved with ChIP assay, and probably induced de novo methyla-tion of the NQO1 promoter to silence NQO1 expression, becauseknockdown of DNMT3A restored the expression. It is noteworthythat HBx did not change the expression of DNMT1, DNMT3A,or DNMT3B and could interact only with DNMT3A in vivo, asobserved with immunoprecipitation assay [14].

Oxidative stress and the generation of ROS can induce celldamage, thus contributing to dysfunction, mutation, and develop-ment of diseases [38,39]. It is generally accepted that HBV caninduce oxidative stress, which leads to chronic hepatitis and mayresult in the initiation and progression of HCC [36]. Mitochondriaare the major source of cellular ROS, which are formed throughelectron leakage from the mitochondrial respiratory chain [40].HBx is often found to target and be localized at the mitochondria,causing loss of mitochondrial membrane potential and overge-neration of ROS that have been associated with cell death andoxidative liver injury [17,18,33,41–43]. In addition, HBx expressionalso induces oxidative stress through calcium signaling andactivation of cellular kinases and transcriptional factors, as wellas stimulating translocation of mitogen-activated protein kinaseRaf-1 to mitochondria and increasing TNF-α expression [36]. Themechanism of ROS generation induced by HBx in mitochondria isquite diversified and controversial. Our observation that a sig-nificant decrease in GSH level, an indicator of ROS accumulation, inHBx-transfected cells is accompanied by a decrease in Δψm andATP and an increase in sensitivity to H2O2 cytotoxic effects favors apositive feedback model as proposed by Cai and Jones [44], inwhich ROS overproduction as a direct result of HBx expressionfurther impairs mitochondrial electron transport, thus amplifyingthe deleterious effect of HBx on the mitochondria and sensitizingcells to other oxidative insults.

Fig. 6. HBx-mediated NQO1 repression reduced cellular glutathione levels and increased susceptibility of Hep3B cells to apoptosis and H2O2-induced cell death. (A) HBxdecreases GSH levels. GSH content was measured in Hep3B cell lysates with indicated treatments using a glutathione assay kit as described under Materials and methods.Results are the means of three separate experiments. npo0.05 versus Ad-GFP. #po0.05 versus Ad-HBx. (B) Western blot analysis of the effects of indicated treatments onNQO1 protein levels. The ratio of NQO1 protein levels in the treated cells relative to that in the control Ad-GFP cells was calculated densitometrically after normalization tothe level of β-actin. Values are means7SD, n¼3. npo0.05 versus Ad-GFP. #po0.05 versus Ad-HBx. (C) Induction of apoptosis in Hep3B cells. Cells were exposed to theindicated treatments and stained with annexin V–FITC and PI for flow cytometric analysis. Cells in lower right quadrant (annexin V–FITC+/PI�) represent early apoptoticpopulation. Hep3B cells transfected with the empty vector p3� FLAG-CMV-10 and scrambled siRNA were used as the negative control. (D) Cell viability in Hep3B cells aftertreatment with H2O2. Hep3B cells were infected with Ad-HBx or Ad-GFP followed by exposure to H2O2 for 24 h. For the pretreatment experiments, cells were pretreated with5 mM DAC or 10 mM SUL or transfected with pFLAG-NQO1 or siRNA-NQO1 before the addition of H2O2. Cells infected with Ad-HBc served as a negative control for HBxspecificity. Cell viability was detected using the CCK-8 assay. Values represent means7SD of three separate experiments performed in duplicate. npo0.05 versus Ad-GFP.#po0.05 versus Ad-HBx.

Y. Wu et al. / Free Radical Biology and Medicine 65 (2013) 632–644 641

Another notable observation of this study was the coordinatedlevels of endogenous GSH and NQO1, two crucial cellular defensesagainst oxidative and electrophilic stress. GSH, a nonprotein thiol, isthe major endogenous antioxidant and plays a vital role in main-taining the balance between oxidation and antioxidation. Its deple-tion has been shown to increase cellular susceptibility to apoptosis,whereas high intracellular GSH levels have been related to apoptosisresistance [45–47]. NQO1 is a phase II detoxification enzyme and alsohelps maintain endogenous antioxidants in their reduced and there-fore active form. It has been firmly established that NQO1 providesmajor antioxidant functions by virtue of its obligatory two-electron

reduction mechanism, thereby minimizing opportunities for genera-tion of reactive oxygen intermediates and for depletion of intracel-lular thiol pools [48]. In this report, we found that transcriptionaldownregulation of NQO1 expression by HBx did impair cellularantioxidant defense capacity as evidenced by a significant decreasein GSH levels in HBx-expressing cells. Although the exact mechanismcontributing to the coordinate regulation of NQO1 and GSH remainsto be defined, at least part of the observed decrease in GSH contentcan be accounted for by a reduction in NQO1 expression. It should benoted that the GSH-restoring effect of DAC or SUL treatment wasrelatively stronger than that of NQO1 overexpression or DNMT3A

Fig. 7. Effects of HBx-mediated NQO1 repression on Δψm loss and ATP depletion. (A) Δψm assessed by JC-1 dye using fluorescence microscopy. Hep3B cells from the variousexperimental groups were stained with JC-1. Red fluorescence (JC-1 aggregates) indicates functional mitochondria, whereas green fluorescence (JC-1 monomer) indicatesdysfunctional mitochondria. (B) Intracellular ATP levels measured by a bioluminescence somatic cell assay. Hep3B cells from the various experimental groups were harvestedfor ATP assay, and ATP levels were expressed as nmol ATP/mg protein. Values represent means7SD of three separate experiments performed in duplicate. npo0.05 versuscontrol.

Y. Wu et al. / Free Radical Biology and Medicine 65 (2013) 632–644642

knockdown, indicating that a mechanism other than NQO1 mayalso participate in the regulation of GSH homeostasis. Indeed,DAC treatment has been shown to alter DNA methylation of genesrelated to GSH biosynthesis and metabolism [11,49,50]. In addition totranscriptional upregulation of NQO1, SUL is known to be capable ofinducing the expression of other phase II enzymes, such as glu-tathione S-transferase and γ-glutamylcysteine synthase, through theactivation of the Nrf2/ARE pathway [51,52].

GSH content and its depletion have been widely reported toregulate a variety of apoptotic signaling pathways; however, theprecise molecular mechanisms are still far from clear. It is generallybelieved that GSH depletion due to excessive oxidative stressinduces apoptosis primarily through the intrinsic pathways invol-ving the mitochondria [53]. Its depletion can directly trigger celldeath or predispose cells to apoptosis by modulation of both themitochondrial permeability transition pore formation and theactivation of execution caspases [54,55]. Depletion of GSH may alsocause the release of cytochrome c and it has been postulated thatreleased cytochrome c from the mitochondria needs to be oxidizedfor the formation of apoptosome and caspase activation, whichwould require cytosolic GSH levels to be depleted [56,57]. Ourobservation that a decrease in cellular GSH levels is paralleled byboth loss of mitochondrial membrane potential and increased cellapoptotic susceptibility provides further confirmation of the con-cept that the intracellular thiol redox state controlled by GSH is oneof the endogenous effectors for the mitochondrion-based cell death

mechanism in the context of HBx-mediated NQO1 repression. It isrecognized that a single treatment with NQO1 overexpression, DAC,SUL, or knockdown of DNMT3A did not significantly abrogate HBx-induced apoptotic susceptibility (Fig. 6C), indicating that NQO1 maynot be the exclusive pathway that mediates the proapoptoticactivity of HBx. Future study would be warranted to determinethe possible involvement of other apoptotic signaling in thescenario of HBx-triggered epigenetic silencing of NQO1. Never-theless, our findings in this study suggest that NQO1 operates in away to offset the oxidative stress posed by HBx and lend support tothe notion that antioxidant therapy may be a rational approach toprotect against oxidative liver injury and reduce the risk ofprogressive chronic liver disease due to HBV infection.

In summary, this is to the best of our knowledge the firstreport demonstrating that HBx transcriptionally downregulatesNQO1 expression by promoter hypermethylation via interaction withDNMT3A, and such epigenetic downregulation of NQO1 exacerbatesthe effects of HBx-induced mitochondrial injury and imbalance inthe cellular redox state on the pathogenesis of chronic liver diseaseand HCC.

Acknowledgments

This work was supported by grants from the National NaturalScience Foundation of China (Grants 81271822 and 81001279), the

Y. Wu et al. / Free Radical Biology and Medicine 65 (2013) 632–644 643

Fujian Science and Technology Innovation Foundation for YoungScientists (Grant 2010J05067), the Key Program for ScientificResearch of Fujian Medical University (Grant 09ZD004), andthe Fujian Educational Committee Foundation (Grants JA10138and JK2009014). We are grateful to Dr. Ren Lin (Fujian MedicalUniversity, Fuzhou, China) for his excellent technical assistance.

Appendix A. Supporting information

Supplementary data associated with this article can be found inthe online version at http://dx.doi.org/10.1016/j.freeradbiomed.2013.07.037.

References

[1] Lok, A. S.; Heathcote, E. J.; Hoofnagle, J. H. Management of hepatitis B: 2000—summary of a workshop. Gastroenterology 120:1828–1853; 2001.

[2] Bouchard, M. J.; Schneider, R. J. The enigmatic X gene of hepatitis B virus. J.Virol. 78:12725–12734; 2004.

[3] Bouchard, M. J.; Wang, L.; Schneider, R. J. Activation of focal adhesion kinaseby hepatitis B virus HBx protein: multiple functions in viral replication. J. Virol.80:4406–4414; 2006.

[4] Ueda, H.; Ullrich, S. J.; Gangemi, J. D.; Kappel, C. A.; Ngo, L.; Feitelson, M. A.;Jay, G. Functional inactivation but not structural mutation of p53 causes livercancer. Nat. Genet. 9:41–47; 1995.

[5] Caselmann, W. H. Trans-activation of cellular genes by hepatitis B virusproteins: a possible mechanism of hepatocarcinogenesis. Adv. Virus Res47:253–302; 1996.

[6] Haviv, I.; Shamay, M.; Doitsh, G.; Shaul, Y. Hepatitis B virus pX targets TFIIB intranscription coactivation. Mol. Cell. Biol. 18:1562–1569; 1998.

[7] Brechot, C. Pathogenesis of hepatitis B virus-related hepatocellular carcinoma:old and new paradigms. Gastroenterology 127:S56–61; 2004.

[8] Huang, Q.; Wang, L.; Bai, S.; Lin, W.; Chen, W.; Lin, J.; Lin, X. Global proteomeanalysis of hepatitis B virus expressing human hepatoblastoma cell lineHepG2. J. Med. Virol. 81:1539–1550; 2009.

[9] Zhu, Y. Z.; Zhu, R.; Shi, L. G.; Mao, Y.; Zheng, G. J.; Chen, Q.; Zhu, H. G. HepatitisB virus X protein promotes hypermethylation of p16(INK4A) promoterthrough upregulation of DNA methyltransferases in hepatocarcinogenesis.Exp. Mol. Pathol. 89:268–275; 2010.

[10] Shim, Y. H.; Yoon, G. S.; Choi, H. J.; Chung, Y. H.; Yu, E. p16 hypermethylation inthe early stage of hepatitis B virus-associated hepatocarcinogenesis. CancerLett. 190:213–219; 2003.

[11] Zhong, S.; Tang, M. W.; Yeo, W.; Liu, C.; Lo, Y. M.; Johnson, P. J. Silencing ofGSTP1 gene by CpG island DNA hypermethylation in HBV-associated hepato-cellular carcinomas. Clin. Cancer Res. 8:1087–1092; 2002.

[12] Park, I. Y.; Sohn, B. H.; Yu, E.; Suh, D. J.; Chung, Y. H.; Lee, J. H.; Surzycki, S. J.;Lee, Y. I. Aberrant epigenetic modifications in hepatocarcinogenesis inducedby hepatitis B virus X protein. Gastroenterology 132:1476–1494; 2007.

[13] Shon, J. K.; Shon, B. H.; Park, I. Y.; Lee, S. U.; Fa, L.; Chang, K. Y.; Shin, J. H.; Lee, Y. I.Hepatitis B virus-X protein recruits histone deacetylase 1 to repress insulin-likegrowth factor binding protein 3 transcription. Virus Res. 139:14–21; 2009.

[14] Zheng, D. L.; Zhang, L.; Cheng, N.; Xu, X.; Deng, Q.; Teng, X. M.; Wang, K. S.;Zhang, X.; Huang, J.; Han, Z. G. Epigenetic modification induced by hepatitis Bvirus X protein via interaction with de novo DNA methyltransferase DNMT3A.J. Hepatol. 50:377–387; 2009.

[15] Hagen, T. M.; Huang, S.; Curnutte, J.; Fowler, P.; Martinez, V.; Wehr, C. M.;Ames, B. N.; Chisari, F. V. Extensive oxidative DNA damage in hepatocytes oftransgenic mice with chronic active hepatitis destined to develop hepatocel-lular carcinoma. Proc. Natl. Acad. Sci. USA 91:12808–12812; 1994.

[16] Rehermann, B.; Nascimbeni, M. Immunology of hepatitis B virus and hepatitisC virus infection. Nat. Rev. Immunol. 5:215–229; 2005.

[17] Shirakata, Y.; Koike, K. Hepatitis B virus X protein induces cell death by causingloss of mitochondrial membrane potential. J. Biol. Chem. 278:22071–22078;2003.

[18] Lee, Y. I.; Hwang, J. M.; Im, J. H.; Kim, N. S.; Kim, D. G.; Yu, D. Y.; Moon, H. B.;Park, S. K. Human hepatitis B virus-X protein alters mitochondrial functionand physiology in human liver cells. J. Biol. Chem. 279:15460–15471; 2004.

[19] Seidman, M. D.; Quirk, W. S.; Shirwany, N. A. Reactive oxygen metabolites,antioxidants and head and neck cancer. Head Neck 21:467–479; 1999.

[20] Royack, G. A.; Nguyen, M. P.; Tong, D. C.; Poot, M.; Oda, D. Response of humanoral epithelial cells to oxidative damage and the effect of vitamin E. Oral Oncol.36:37–41; 2000.

[21] Kensler, T. W.; Wakabayashi, N.; Biswal, S. Cell survival responses to environ-mental stresses via the Keap1–Nrf2–ARE pathway. Annu. Rev. Pharmacol.Toxicol. 47:89–116; 2007.

[22] Prochaska, H. J.; Santamaria, A. B. Direct measurement of NAD(P)H:quinonereductase from cells cultured in microtiter wells: a screening assay foranticarcinogenic enzyme inducers. Anal. Biochem. 169:328–336; 1988.

[23] Siegel, D.; Yan, C.; Ross, D. NAD(P)H:quinone oxidoreductase 1 (NQO1) in thesensitivity and resistance to antitumor quinones. Biochem. Pharmacol. 83:1033–1040; 2012.

[24] Yan, C.; Siegel, D.; Newsome, J.; Chilloux, A.; Moody, C. J.; Ross, D. Antitumorindolequinones induced apoptosis in human pancreatic cancer cells viainhibition of thioredoxin reductase and activation of redox signaling. Mol.Pharmacol. 81:401–410; 2012.

[25] Joseph, P.; Jaiswal, A. K. NAD(P)H:quinone oxidoreductase1 (DT diaphorase)specifically prevents the formation of benzo[a]pyrene quinone–DNA adductsgenerated by cytochrome P4501A1 and P450 reductase. Proc. Natl. Acad. Sci.USA 91:8413–8417; 1994.

[26] Jaiswal, A. K. Nrf2 signaling in coordinated activation of antioxidant geneexpression. Free Radic. Biol. Med. 36:1199–1207; 2004.

[27] Jaiswal, A. K. Regulation of genes encoding NAD(P)H:quinone oxidoreductases.Free Radic. Biol. Med. 29:254–262; 2000.

[28] Tada, M.; Yokosuka, O.; Fukai, K.; Chiba, T.; Imazeki, F.; Tokuhisa, T.; Saisho, H.Hypermethylation of NAD(P)H:quinone oxidoreductase 1 (NQO1) gene inhuman hepatocellular carcinoma. J. Hepatol. 42:511–519; 2005.

[29] Fitzsimmons, S. A.; Workman, P.; Grever, M.; Paull, K.; Camalier, R.; Lewis, A. D.Reductase enzyme expression across the National Cancer Institute tumor cellline panel: correlation with sensitivity to mitomycin C and EO9. J. Natl. CancerInst. 88:259–269; 1996.

[30] Sells, M. A.; Chen, M. L.; Acs, G. Production of hepatitis B virus particles in HepG2 cells transfected with cloned hepatitis B virus DNA. Proc. Natl. Acad. Sci.USA 84:1005–1009; 1987.

[31] Itoh, K.; Chiba, T.; Takahashi, S.; Ishii, T.; Igarashi, K.; Katoh, Y.; Oyake, T.;Hayashi, N.; Satoh, K.; Hatayama, I.; Yamamoto, M.; Nabeshima, Y. An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzymegenes through antioxidant response elements. Biochem. Biophys. Res. Commun.236:313–322; 1997.

[32] Jung, J. K.; Kwun, H. J.; Lee, J. O.; Arora, P.; Jang, K. L. Hepatitis B virus X proteindifferentially affects the ubiquitin-mediated proteasomal degradation of beta-catenin depending on the status of cellular p53. J. Gen. Virol. 88:2144–2154; 2007.

[33] Lim, W.; Kwon, S. H.; Cho, H.; Kim, S.; Lee, S.; Ryu, W. S. HBx targeting tomitochondria and ROS generation are necessary but insufficient for HBV-induced cyclooxygenase-2 expression. J. Mol. Med. (Berlin) 88:359–369; 2010.

[34] Li, H. P.; Leu, Y. W.; Chang, Y. S. Epigenetic changes in virus-associated humancancers. Cell Res. 15:262–271; 2005.

[35] Shimoda, R.; Nagashima, M.; Sakamoto, M.; Yamaguchi, N.; Hirohashi, S.;Yokota, J.; Kasai, H. Increased formation of oxidative DNA damage, 8-hydro-xydeoxyguanosine, in human livers with chronic hepatitis. Cancer Res. 54:3171–3172; 1994.

[36] Ha, H. L.; Shin, H. J.; Feitelson, M. A.; Yu, D. Y. Oxidative stress and antioxidantsin hepatic pathogenesis. World J. Gastroenterol. 16:6035–6043; 2010.

[37] Chen, T.; Li, E. Structure and function of eukaryotic DNA methyltransferases.Curr. Top. Dev. Biol. 60:55–89; 2004.

[38] Schwarz, K. B. Oxidative stress during viral infection: a review. Free Radic. Biol.Med. 21:641–649; 1996.

[39] Shih, P. H.; Yeh, C. T.; Yen, G. C. Anthocyanins induce the activation of phase IIenzymes through the antioxidant response element pathway against oxida-tive stress-induced apoptosis. J. Agric. Food Chem 55:9427–9435; 2007.

[40] Adam-Vizi, V.; Chinopoulos, C. Bioenergetics and the formation of mitochon-drial reactive oxygen species. Trends Pharmacol. Sci. 27:639–645; 2006.

[41] Takada, S.; Shirakata, Y.; Kaneniwa, N.; Koike, K. Association of hepatitis Bvirus X protein with mitochondria causes mitochondrial aggregation at thenuclear periphery, leading to cell death. Oncogene 18:6965–6973; 1999.

[42] Rahmani, Z.; Huh, K. W.; Lasher, R.; Siddiqui, A. Hepatitis B virus X proteincolocalizes to mitochondria with a human voltage-dependent anion channel,HVDAC3, and alters its transmembrane potential. J. Virol. 74:2840–2846; 2000.

[43] Waris, G.; Huh, K. W.; Siddiqui, A. Mitochondrially associated hepatitis B virusX protein constitutively activates transcription factors STAT-3 and NF-kappa Bvia oxidative stress. Mol. Cell. Biol 21:7721–7730; 2001.

[44] Cai, J.; Jones, D. P. Mitochondrial redox signaling during apoptosis. J. Bioenerg.Biomembr. 31:327–334; 1999.

[45] Morales, A.; Miranda, M.; Sanchez-Reyes, A.; Biete, A.; Fernandez-Checa, J. C.Oxidative damage of mitochondrial and nuclear DNA induced by ionizingradiation in human hepatoblastoma cells. Int. J. Radiat. Oncol. Biol. Phys.42:191–203; 1998.

[46] Friesen, C.; Kiess, Y.; Debatin, K. M. A critical role of glutathione in determiningapoptosis sensitivity and resistance in leukemia cells. Cell Death Differ. 11(Suppl. 1):S73–85; 2004.

[47] Cazanave, S.; Berson, A.; Haouzi, D.; Vadrot, N.; Fau, D.; Grodet, A.; Letteron, P.;Feldmann, G.; El-Benna, J.; Fromenty, B.; Robin, M. A.; Pessayre, D. Highhepatic glutathione stores alleviate Fas-induced apoptosis in mice. J. Hepatol.46:858–868; 2007.

[48] Dinkova-Kostova, A. T.; Talalay, P. NAD(P)H:quinone acceptor oxidoreductase 1(NQO1), a multifunctional antioxidant enzyme and exceptionally versatilecytoprotector. Arch. Biochem. Biophys. 501:116–123; 2010.

[49] Campos, A. C.; Molognoni, F.; Melo, F. H.; Galdieri, L. C.; Carneiro, C. R.;D'Almeida, V.; Correa, M.; Jasiulionis, M. G. Oxidative stress modulates DNAmethylation during melanocyte anchorage blockade associated with malig-nant transformation. Neoplasia 9:1111–1121; 2007.

[50] Niu, D.; Zhang, J.; Ren, Y.; Feng, H.; Chen, W. N. HBx genotype D repressesGSTP1 expression and increases the oxidative level and apoptosis in HepG2cells. Mol. Oncol. 3:67–76; 2009.

Y. Wu et al. / Free Radical Biology and Medicine 65 (2013) 632–644644

[51] Brooks, J. D.; Paton, V. G.; Vidanes, G. Potent induction of phase 2 enzymes inhuman prostate cells by sulforaphane. Cancer Epidemiol. Biomarkers Prev.10:949–954; 2001.

[52] Shinkai, Y.; Sumi, D.; Fukami, I.; Ishii, T.; Kumagai, Y. Sulforaphane, an activatorof Nrf2, suppresses cellular accumulation of arsenic and its cytotoxicity inprimary mouse hepatocytes. FEBS Lett. 580:1771–1774; 2006.

[53] Franco, R.; Cidlowski, J. A. Apoptosis and glutathione: beyond an antioxidant.Cell Death Differ. 16:1303–1314; 2009.

[54] Armstrong, J. S.; Jones, D. P. Glutathione depletion enforces the mitochondrialpermeability transition and causes cell death in Bcl-2 overexpressing HL60cells. FASEB J 16:1263–1265; 2002.

[55] Varghese, J.; Khandre, N. S.; Sarin, A. Caspase-3 activation is an early event andinitiates apoptotic damage in a human leukemia cell line. Apoptosis 8:363–-370; 2003.

[56] Gogvadze, V.; Orrenius, S.; Zhivotovsky, B. Multiple pathways of cytochrome crelease from mitochondria in apoptosis. Biochim. Biophys. Acta 1757:639–647;2006.

[57] Brown, G. C.; Borutaite, V. Regulation of apoptosis by the redox state ofcytochrome c. Biochim. Biophys. Acta 1777:877–881; 2008.