For Review Only - University of Toronto T-Space · 2018-09-25 · For Review Only 1 Development of...

For Review Only

Development of race-specific molecular marker for

Xanthomonas campestris pv. campestris race 3, the causal agent of black rot of crucifers

Journal: Canadian Journal of Plant Science

Manuscript ID CJPS-2018-0035.R2

Manuscript Type: Article

Date Submitted by the Author: 08-Apr-2018

Complete List of Authors: Afrin, Khandker Shazia; Sunchon National University, Department of

Horticulture Rahim, Md. Abdur; Sunchon National University, Department of Horticulture; Sher-e-Bangla Agricultural University, Department of Genetics and Plant Breeding Rubel, Mehede Hassan ; Sunchon National University, Department of Horticulture Natarajan, Sathishkumar ; Sunchon National University, Department of Horticulture Song, Jae-Young; National Institute of Biological Resources, 42, Hwangyeong-ro, Seo-gu, Incheon, 22689 Kim, Hoy-Taek ; Sunchon National University, Department of Horticulture Park, Jong-In ; Sunchon National University, Department of Horticulture

Nou, Ill-Sup; Sunchon National University, Department of Horticulture

Keywords: black rot, race-specific marker, Xanthomonas campestris pv. campestris, cabbage

Is the invited manuscript for consideration in a Special

Issue?: Not applicable (regular submission)

https://mc.manuscriptcentral.com/cjps-pubs

Canadian Journal of Plant Science

For Review Only

1

Development of race-specific molecular marker for Xanthomonas campestris pv.

campestris race 3, the causal agent of black rot of crucifers

Khandker Shazia Afrin1, Md Abdur Rahim

1,3, Mehede Hassan Rubel

1, Sathishkumar

Natarajan1, Jae-Young Song

2, Hoy-Taek Kim

1, Jong-In Park

1* and Ill-Sup Nou

1*

1Department of Horticulture, Sunchon National University, Suncheon 57922, Republic of

Korea

2National Institute of Biological Resources, 42, Hwangyeong-ro, Seo-gu, Incheon, 22689,

Republic of Korea

3Department of Genetics and Plant Breeding, Sher-e-Bangla Agricultural University, Dhaka-

1207, Bangladesh

*Correspondence: [email protected] (J.-I.P.); [email protected] (I.-S.N), Tel.: +82-61-

750-3249, Fax: +82-61-750-3208.

Running title: Molecular Marker for Xcc Race 3

Page 1 of 23



For Review Only

2

Abstract: Race-specific molecular markers were established to distinguish Xanthomonas

campestris pv. campestris (Xcc) race 3, the causal agent of black rot disease of crucifers. The

available genome sequences of Xcc races were aligned and identified three DNA fragments

specific to Xcc race 3. The identified race-specific DNA fragments namely XccR3-49,

XccR3-52 and XccR3-55 were used for designing the race-specific primers to detect and

identify the Xcc race 3. The specificity of race-specific primers was tested against the

genomic DNA extracted from Xcc (races 1-7), Xcc strains, Xc pathovars and other bacterial

species. The XccR3-49, a specific sequence characterized amplified region (SCAR) primer

set gave a single band with 867 bp length for Xcc race 3 only. The remaining two markers

such as XccR3-52 and XccR3-55 showed polymorphic amplification with amplicon size of

1889 bp and 2109 bp for Xcc race 3, respectively. Additionally, the SCAR primer set detected

Xcc race 3 rapidly and efficiently in artificially infected cabbage leaves with bio-PCR. This

result showed that the newly developed race-specific markers can successfully and efficiently

detect and identify Xcc race 3 from Xanthomonas campestris pv. campestris races,

Xanthomonas species/pathovars, as well as other plant pathogenic bacteria (Pseudomonas

syringae pv. maculicola and Erwinia carotovora subsp. carotovora). Up to now, this is the

first report describing the race-specific marker for the detection of Xcc race 3.

Key words: black rot, race-specific marker, Xanthomonas campestris pv. campestris,

cabbage

Page 2 of 23



For Review Only

3

Introduction

Xanthomonas campestris pv. campestris (Pam.) Dowson (Xcc), the causal agent of black

rot which is one of the most destructive diseases of the vegetable crops belonging to the

Brassicaceae family worldwide, particularly for the subspecies of Brassica oleracea like

cabbage, cauliflower, broccoli, kohlrabi, Brussels sprouts and kale (Vicente and Holub 2013).

Xcc enters into the plant through the leaf hydathodes, wounded leaves and insects, and

multiply through vascular tissue and develops V-shaped chlorotic lesions (Cook et al. 1952;

Williams 1980; Kifuji et al. 2013; Tonu et al. 2013). The cabbage heads affected by black rot

disease are rapidly rotten after harvest and are not suitable for storage. It reduces crop yield

more than 50% under a favorable environment (Williams 1980; Singh et al. 2014). Moreover,

Massomo et al. (2003) reported up to 100% yield loss in cabbage by the farmers in Tanzania

during El-Niño. Black rot has also been reported in Korean cabbage growing areas since the

1970’s (Kim 1986). It is very difficult to control this pathogen although there are some

agrochemicals available in the market due to resistance against bactericides. Therefore, the

exploitation of resistant cultivars is one of the most effective ways to control the black rot

disease.

There are some black rot resistant Brassica oleracea cultivars/lines reported in different areas

of the world including Korea (Dickson and Hunter 1987; Vicente et al. 2001; Fargier and

Manceau 2007; Cruz et al. 2017; Afrin et al. 2018). However, the problem is the existence of

several races of Xcc and single resistant cultivar/line doesn’t provide resistance to all the Xcc

races. Xcc strains are grouped into nine races based on interactions with differential cultivars

and pathogens (Kamoun et al. 1992; Vicente et al. 2001; Fargier and Manceau 2007).

Recently, two new Xcc races (race 10 and 11) have been identified in Portugal (Cruz et al.

2017). To the best of our knowledge, the numbers and distribution of Xcc races in Korea have

Page 3 of 23



For Review Only

4

not been adequately quantified. Therefore, proper identification of Xcc races at the molecular

level is necessary for black rot resistance breeding as well as the utilization of available

resistant germplasm. The race-specific molecular marker will enable us the rapid, simple and

race-specific detection of Xcc at the molecular level for effective management of black rot

disease. Berg et al. (2006) developed a real-time PCR-based method using hrpF gene for the

detection of Xcc from infected Brassica seeds from other bacteria. Besides, the repetitive

DNA sequence elements based polymerase chain reaction (rep-PCR) have also been used to

classify and differentiate genomic structure of Xanthomonas campestris pv. campestris,

Xanthomonas campestris pv. vesicatoria, (Cruz et al. 1996) Xanthomonas oryzae pv. oryzae

and Xanthomonas campestris pv. musacearum (Louws et al. 1995;Cruz et al. 1996; Aritua et

al. 2007; Singh et al. 2011). But these methods are time consuming and laborious. The PCR

based technique is an alternative and powerful tool for rapid detection and identification of

plant pathogenic bacterial races (Song et al. 2014). Like other cabbage growing countries of

the world, black rot is one of the most serious diseases of cabbage in Korea (Kim 1986). Up

to now, there is no Xcc race information available in the affected cabbage growing areas in

Korea. Therefore, we aimed to determine which Xcc races are pre-dominant in the major

cabbage growing regions in Korean. To detect and identify Xcc races rapidly, we needed PCR

based race-specific molecular markers. Recently, our research group has reported molecular

markers for specific detection of Xcc race 1 and race 4 (Rubel et al. 2017). The development

of molecular markers for remaining Xcc races are in progress. Therefore, the objective of this

research was development of PCR-based race-specific molecular markers for quick detection

and identification of Xcc race 3 from other races and strains.

Materials and Methods

Page 4 of 23



For Review Only

5

Bacterial strains and media

Seven reference Xcc races (races 1-7), eight Xcc strains (races unknown), three Xc

pathovars, three Xanthomonas species and two other plant pathogenic bacteria were used in

this study (Table 1). All the bacterial races/strains were cultured on King’s medium B (KB)

for 48 h at 30℃ (King et al. 1954).

Isolation of genomic DNA

Genomic DNA was isolated from bacterial races/strains using a DNeasy Plant Mini Kit

(Qiagen, Valencia, CA) following the manufacturer’s instructions. The quantity and purity of

the extracted DNA was determined with a NanoDrop spectrophotometer (NanoDrop

Technologies, Wilmington, USA) and stored at -20℃.

Identification of genomic fragments specific to Xcc races 3

The complete genome sequence of Xcc race 1 (AM920689), race 3 (AE008922), race 4

(NZ_CM002673), race 9 (NC_007086), Xci strain CFBP 1606R (NZ_CM002635.1), Xcr

756C (NC_017271.1), Xcv strain 85-10 (NC_007508.1) was retrieved from the NCBI

database (www.ncbi.nlm.nih.gov). Moreover, the genome annotation file (gff3) for race 3

was also downloaded. Subsequently, these genome sequences were aligned with the mauve

genome alignment tool using “progressiveMauve” with default parameters (Darling et al.

2004) and race 1 genome (B100) was used as reference. Thereafter, the variable DNA

fragments among Xcc races were identified of using Geneious free trial version

(www.geneious.com).

Primer designing and PCR conditions

Page 5 of 23



For Review Only

6

The race-specific primers were designed using the DNA fragments specific to the Xcc

race 3 (ATCC 33913) with the GenBank accession number AE008922.1 (Table 2). The race-

specific primers were designed in highly variable regions using OligoCalc (Kibbe 2007) and

specificity of the primers was assessed using the BLAST search

(http://210.110.86.160/lab/home.html). Furthermore, the designed primers were tested using

in silico PCR tool freely available at http://insilico.ehu.es/PCR/index.php?mo=Xanthomonas.

Thereafter, the specificity of each race-specific primer set was tested by PCR using genomic

DNA (gDNA) isolated from the reference Xcc races (races 1-7), Xcc strains, Xc pathovars,

Xanthomonas species and other plant pathogenic bacterial species (Table 1). The PCR was

performed with a 20 µl volume using 2X Prime Taq Premix (GENETBIO, Korea), 30 ng of

genomic DNA as a template and 10 pmol/µl for each primer. Finally, 7 µl of PCR product

was subjected to gel electrophoresis containing 1.2% agarose.

Bio-PCR assay

The bio-PCR assay was performed as described by (Song et al. 2014) with little

modifications. For bio-PCR assay, 35 days old cabbage plants of a black rot susceptible line

(SCNU-C-4320, Department of Horticulture, Sunchon National University, South Korea)

were inoculated by clipping secondary veins of three youngest leaves with sterile forceps

followed by dipping into a bacterial suspension (109 CFU/ml) of Xcc races (race 1-7)

maintaining high humidity (Vicente et al. 2001). Thereafter, about 1 cm infected area of

cabbage leaves were collected when symptoms were visible. The infected leaf samples were

sliced into small pieces and soaked in 250 µl sterile water for 40 min at room temperature.

Finally, 10 µl of the exudates was used as a template for the bio-PCR.

Page 6 of 23



For Review Only

7

Results

Development of Xcc race 3 specific markers

Comparative alignment results showed that all the Xcc strains used fall in the same clade

as compared to other Xanthomonas campetris pathovar (Supplementary Fig. S1). We

identified three DNA fragments such as XccR3-49, XccR3-52 and XccR3-55 that were

unique to Xcc race 3 by sequence alignment (Fig. 1 and Supplementary Fig. S2). The

customized BLAST (Basic Local Alignment Search Tool) search

(http://210.110.86.160/lab/home.html) was performed using these DNA fragments and the

BLAST results also indicated that the identified three DNA fragments were specific to Xcc

race 3 (data not shown). The PCR results showed that the SCAR (XccR3-49) primer set had a

specific amplification with amplicon size 867 bp only for Xcc race 3 while other samples

remained undetected (Fig. 2). On the other hand, the XccR3-52 primers amplified a

specific1889 bp fragment for Xcc race 3 and 404 bp fragment for race 4, 5 and ICMP8 while

other samples didn’t amplified (Fig. 3). Likewise, XccR3-55 also amplified a product size

2109 bp for Xcc race 3 while 597 bp for other Xcc races only (Fig. 4). The SCAR (XccR3-49)

marker located on the same genomic position where a gene (XCC2965) encoding a

‘hypothetical protein’ located while the remaining two markers (XccR3-52 and XccR3-55)

were situated in the intergenic region between genes (Table 3).

Validation of developed markers by Bio-PCR

We further assessed the potentiality of race 3 specific primer sets by bio-PCR assay using

artificially infected cabbage leaves with different Xcc races (race 1-7). The bio-PCR result

revealed that the race-specific SCAR maker detected and distinguished Xcc race 3 directly

from infected cabbage leaves (Fig. 5).

Page 7 of 23



For Review Only

8

Discussion

In this study, the race-specific molecular markers allowed the quick, simple and specific

detection of Xcc race 3. The availability of the genome sequence of Xcc races (race 1, 3, 4

and 9), other pathovars Xci, Xcr and Xev facilitated the finding of highly variable genomic

fragments and development of Xcc race 3 specific markers. We developed three race-specific

markers (one SCAR and two InDels) to distinguish race 3 from other Xcc races. These

primers can efficiently and specifically identified race 3 from other Xcc races as well as other

bacterial strains (Fig. 2-4). These markers detected Xcc race 3 rapidly (within a few hours)

with low-cost and high reliability over differential cultivars based race determination method

which requires extensive field works with high labor cost and at least one cropping season.

The PCR based molecular marker techniques has already been used to detect bacterial and

fungal pathogens. For example, Luongo et al. (2012) developed a PCR-based SCAR marker

which successfully identified Fusarium oxysporum f. sp. melonis race 2, the causal agent of

vascular wilt of melon..

Singh and his coworkers reported a bio-PCR technique with Dhrp primers on hrpF gene,

which detected Xcc from other bacteria but did not distinguish Xcc races (Singh et al. 2014).

Recently, PCR based race-specific primers were described for quick and specific

identification of K3a race of Xanthomonas oryzae pv. oryzae (Xoo) which causes bacterial

blight in rice (Song et al. 2014). The race-specific SCAR primers (XccR3-49) developed in

this study accurately and efficiently detected Xcc race 3 directly from the infected cabbage

leaves using bio-PCR assay without culturing bacteria and isolating gDNA which saved both

time and labor (Fig. 5). All three race-specific primer sets identified Xcc race 3 from gDNA

while the SCAR primer set was more sensitive to bio-PCR which was detected from infected

Page 8 of 23



For Review Only

9

cabbage leaves. A similar PCR assay was shown by Song et al. (2014) for distinguishing Xoo

race 3ka from infected rice leaves. Singh et al. (2014) also found bio-PCR as highly sensitive

for detection of X. campestris pv. campestris and for disease detection. Furthermore, the

newly developed markers were shown to have enhanced sensitivity as they were able to

detect Xcc race 3 at lower concertations of genomic DNA as template by PCR

(Supplementary Fig. S3).

Altogether, the newly established race-specific markers provided a quick, simple and

efficient tool for specific detection and identification of race 3 from other Xcc races. These

molecular markers could be useful for rapid detection of Xcc race 3 in the black rot infected

cabbage filed around the world.

Conclusion

In this study, we compared the available genome sequences of Xcc races, identified

variations, and developed Xcc race 3 specific molecular markers. We developed one SCAR

(XccR3-49) and two InDel (XccR3-52 and XccR3-55) markers which were specific to Xcc

race 3. These newly developed molecular markers detected Xcc race from other Xcc races and

pathovars/species by PCR rapidly with high sensitivity, specificity and reliability.

Furthermore, the SCAR marker has potential to detect Xcc races 3 directly from Xcc infected

cabbage leaves rapidly and efficiently with bio-PCR.

Conflicts of Interest: The authors declare no conflict of interest.

Acknowledgements

Page 9 of 23



For Review Only

10

This research work was supported by the Golden Seed Project (Center for Horticultural Seed

Development) of the Ministry of Agriculture, Food and Rural affairs in the Republic of Korea

(MAFRA) under Grant no. 213007-05-2-CG100. We thank Dr Joana G. Vicente, University

of Warwick, United Kingdom for providing Xanthomonas campestris pv. campestris races.

References

Afrin, K.S., Rahim, M.A., Park, J.I., Natarajan, S., Rubel, M.H., Kim, H.T., Nou, I.S. 2018.

Screening of Cabbage (Brassica oleracea L.) Germplasm for Resistance to Black Rot.

Plant Breed. Biotechnol. 6: 30–43.

Aritua, V., Nanyonjo, A., Kumakech, F., and Tushemereirwe, W. 2007. Rep-PCR reveals a

high genetic homogeneity among Ugandan isolates of Xanthomonas campestris pv.

musacearum. Afr. J. Biotechnol. 6: 179-183.

Berg, T., Tesoriero, L., and Hailstones, D. 2006. A multiplex real‐time PCR assay for

detection of Xanthomonas campestris from brassicas. Lett. Appl. Microbiol. 42: 624-630.

doi:10.1111/j.1472-765X.2006.01887.x. PMID:16706903.

Cook, A., Walker, J., and Larson, R. 1952. Studies on the disease cycle of black rot of

crucifers. Phytopathology 42: 162-167.

Cruz, C.V., Ardales, E., Skinner, D., Talag, J., Nelson, R., Louws, F., Leung, H., Mew, T.,

and Leach, J. 1996. Measurement of haplotypic variation in Xanthomonas oryzae pv.

oryzae within a single field by rep-PCR and RFLP analyses. Phytopathology 86: 1352-

1359. doi:10.1094/Phyto-86-1352.

Cruz, J., Tenreiro, R., and Cruz, L. 2017. Assessment of diversity of Xanthomonas

campestris pathovars affecting cruciferous plants in Portugal and disclosure of two novel

Page 10 of 23



For Review Only

11

X. campestris pv. campestris races. J. Plant Pathol. 99: 403-414.

doi:http://dx.doi.org/10.4454/jpp.v99i2.3890.

Darling, A.C., Mau, B., Blattner, F.R., and Perna, N.T. 2004. Mauve: multiple alignment of

conserved genomic sequence with rearrangements. Genome Res. 14: 1394-1403.

doi:10.1101/gr.2289704. PMID:15231754.

Dickson, M., and Hunter, J. 1987. Inheritance of resistance in cabbage seedlings to black rot.

HortScience 22: 108-109.

Fargier, E., and Manceau, C. 2007. Pathogenicity assays restrict the species Xanthomonas

campestris into three pathovars and reveal nine races within X. campestris pv. campestris.

Plant Pathol. 56: 805-818. doi:10.1111/j.1365-3059.2007.01648.x.

Kamoun, S., Kamdar, H.V., Tola, E., and Kado, C.I. 1992. A . Mol. Plant-Microbe Interact. 5:

22-33.

Kibbe, W.A. 2007. OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids

Res. 35: W43-46. doi:10.1093/nar/gkm234. PMID:17452344.

Kifuji, Y., Hanzawa, H., Terasawa, Y., and Nishio, T. 2013. QTL analysis of black rot

resistance in cabbage using newly developed EST-SNP markers. Euphytica 190: 289-295.

doi:10.1007/s10681-012-0847-1.

Kim, B.S. 1986. Testing for detection of Xanthomonas campestris pv. campestris in crucifer

seeds and seed disinfection. Korean J. of Plant Pathol. 2: 96-101.

King, E.O., Ward, M.K., and Raney, D.E. 1954. Two simple media for the demonstration of

pyocyanin and fluorescin. J. Lab. Clin. Med. 44: 301-307. PMID:13184240.

Louws, F.J., Fulbright, D.W., Stephens, C.T., and De Bruijn, F.J. 1995. Differentiation of

Genomic Structure by rep-PCR Finger-printing to Rapidly Classify Xanthomonas

campestris pv. vesicatoria. Phytopathology 85: 528-536. doi:10.1094/Phyto-85-528.

Page 11 of 23



For Review Only

12

Luongo, L., Vitale, S., Haegi, A., and Belisario, A. 2012. Development of scar markers and

PCR assay for Fusarium oxysporum f. sp. melonis race 2-specific detection. J. Plant Pathol.

94: 193-199. doi: http://dx.doi.org/10.4454/jpp.fa.2012.010.

Massomo, S.M., Nielsen, H., Mabagala, R.B., Mansfeld-Giese, K., Hockenhull, J., and

Mortensen, C.N. 2003. Identification and characterisation of Xanthomonas campestris pv.

campestris strains from Tanzania by pathogenicity tests, biolog, rep-PCR and fatty acid

methyl ester analysis. Eur. J. Plant Pathol. 109: 775-789. doi:10.1023/A:1026194402701.

Rubel, M.H., Robin, A.H.K., Natarajan, S., Vicente, J.G., Kim, H.T., Park, J.I., and Nou, I.S.

2017. Whole-Genome re-alignment facilitates development of specific molecular markers

for races 1 and 4 of Xanthomonas campestris pv. campestris, the cause of black rot disease

in Brassica oleracea. Int. J. Mol Sci. 18: 2523. doi:10.3390/ijms18122523.

PMID:29186799.

Singh, D., Dhar, S., and Yadava, D. 2011. Genetic and pathogenic variability of Indian

strains of Xanthomonas campestris pv. campestris causing black rot disease in crucifers.

Curr. Microbiol. 63: 551-560. doi:10.1007/s00284-011-0024-0. PMID:21956666.

Singh, D., Raghavendra, B., Rathaur, P.S., Singh, H., Raghuwanshi, R., and Singh, R. 2014.

Detection of black rot disease causing pathogen Xanthomonas campestris pv. campestris

by bio-PCR from seeds and plant parts of cole crops. Seed Sci. Technol. 42: 36-46.

doi:https://doi.org/10.15258/sst.2014.42.1.04.

Song, E., Kim, S., Noh, T., Cho, H., Chae, S., and Lee, B. 2014. PCR-based assay for rapid

and specific detection of the new Xanthomonas oryzae pv. oryzae K3a race using an

AFLP-derived marker. J. Microbiol. Biotechnol. 24: 732-739.

http://dx.doi.org/10.4014/jmb.1311.11005. PMID:24572275.

Page 12 of 23



For Review Only

13

Tonu, N.N., Doullah, M. A., Shimizu, M., Karim, M.M., Kawanabe, T., Fujimoto, R., and

Okazaki, K. 2013. Comparison of Positions of QTLs Conferring Resistance to

Xanthomonas campestris pv. campestris in Brassica oleracea. Am. J. Plant Sci. 4: 11-20.

doi:10.4236/ajps.2013.48A002.

Vicente, J.G., and Holub, E.B. 2013. Xanthomonas campestris pv. campestris (cause of black

rot of crucifers) in the genomic era is still a worldwide threat to brassica crops. Mol. Plant

Pathol. 14: 2-18. doi:10.1111/j.1364-3703.2012.00833.x. PMID:23051837.

Vicente, J.G., Conway, J., Roberts, S., and Taylor, J. 2001. Identification and origin of

Xanthomonas campestris pv. campestris races and related pathovars. Phytopathology 91:

492-499. doi:10.1094/PHYTO.2001.91.5.492. PMID:18943594.

Williams, P.H. 1980. Black rot: a continuing threat to world crucifers. Plant Dis. 64: 736-742.

doi:10.1094/PD-64-736.

Page 13 of 23



For Review Only

14

Tables

Table 1. List of bacterial strains used in this study.

Sl. No. Bacterial race/strains Host Country Year Source

1. Xanthomonas campetris pv. campestris (Xcc)

Race 1 (HRIW-3811) Brassica oleracea USA 2017 HRI-W

a

2. Xcc Race 2 (HRIW-3849A) B. oleracea var. botrytis (Cauliflower) USA 2017 HRI-W 3. Xcc Race 3 (HRIW-5212) B. oleracea var. gemmifera (Brussels sprout) UK 2017 HRI-W 4. Xcc Race 4 (HRIW-1279A) B. oleracea var. capitate (Cabbage) UK 2017 HRI-W 5. Xcc Race 5 (HRIW-3880) B. oleracea var. capitate (Cabbage) Australia 2017 HRI-W 6. Xcc Race 6 (HRIW-6181) B. rapa (Chinese cabbage) Portugal (Sardoal) 2017 HRI-W 7. Xcc Race 7 (HRIW-8450A) B. oleracea var. capitate (Cabbage) UK 2017 HRI-W 8. Xcc strain (ICMP 8) B. oleracea var. capitate (Cabbage) New Zealand 2016 ICMP

b

9. Xcc strain (KACC19132) B. rapa (Chinese cabbage) Republic of Korea 2017 KACCc

10. Xcc strain (KACC19133) B. rapa (Chinese cabbage) Republic of Korea 2017 KACC

11. Xcc strain (KACC19134) B. rapa (Chinese cabbage) Republic of Korea 2017 KACC

12. Xcc strain (KACC19135) Host unknown Republic of Korea 2017 KACC



15. Xcc strain (KACC10377) B. oleracea var. capitate (Cabbage) Republic of Korea 2017 KACC

16. X. campestris pv. incane (Xci) (WHRI-6377) Matthiola incana UK 2017 HRI-W 17. X. campestris pv. raphani (Xcr) (WHRI-8305) B. rapa var. perviridis UK 2017 HRI-W 18. X. campestris pv. zinniae (Xcz) (KACC17126) Zinnia elegans Republic of Korea 2017 KACC

19. X. axonopodis pv. dieffenbachiae (Xad)

(KACC17821) Anthurium andraeanum Republic of Korea 2017 KACC

20. X. axonopodis pv. glycines (Xag)

(KACC10491) Glycine max Republic of Korea 2017 KACC

21. X. euvesicatoria (Xev) (KACC 11153) Host unknown Republic of Korea 2017 KACC

22. Pseudomonas syringae pv. maculicola (Psm)

(ICMP13051) B. oleracea var. capitate (Cabbage) New Zealand 2016 ICMP

23. Erwinia carotovora subsp. carotovora (Ecc)

(ICMP12464) B. oleracea var. capitate (Cabbage) New Zealand 2016 ICMP

Note: aHRI-W: Horticulture Research International, Wellesbourne, UK;

bICMP: International Collection of Microorganisms from Plants, New Zealand;

cKACC: Korean Agricultural Culture Collection, Korea.

Page 14 of 23



For Review Only

15

Table 2. List of race-specific primers used in this study.

Primer name Primer sequence (5’ to 3’) Length

(bp) Annealing conditions

XccR3-49 F AAAGAGCCAATGAAGGGCGAACA

867 63℃, 40 s, 25 cycles

R TATGTCAGGCGCATAATCCGCAAT

XccR3-52 F GACAGTGGCGTGTTGGTGGA

1889 63℃, 40 s, 20 cycles

R TTGTGCGCTGATGATCTGTAACCT

XccR3-55 F GTTGCCGCATGCCGACATC

2109 63℃, 40 s, 20 cycles

R TCGTCGCTATCAGGCCAGCAT

Page 15 of 23



For Review Only

16

Table 3. Race-specific primer information for Xcc race 3 from the genome.

Primer

name NCBI ID Start End Location Gene ID Description

XccR3-49 AE008922.1 3526443 3527309 Gene XCC2965 Hypothetical protein

XccR3-52 AE008922.1 3816178 3818066 Intergenic XCC3213/XCC3214 Transcriptional regulator/

IS1478 transposase

XccR3-55 AE008922.1 3977322 3979430 Intergenic XCC3342/XCC3343/XCC3344

Alpha-1,2-mannosidase/

IS1478 transposase/

Hypothetical protein

Page 16 of 23



For Review Only

17

Figure legends

Fig. 1. Alignment of the genome sequence of Xanthomonas campestris pv. campestris (Xcc)

races and other subspecies of Xanthomonas campestris. The GenBank accessions are

AM920689 (Xcc race 1), NZ_CM002673 (Xcc race 4), NC_007086 (Xcc race 9),

NZ_CM002635.1 (Xanthomonas campetris pv. incanae strain CFBP 1606R), NC_017271.1

(Xanthomonas campetris pv. raphani 756C), NC_007508.1 (Xanthomonas campetris pv.

vesicatoria strain 85-10) and AE008922 (Xcc race 3). The syntenic blocks are connected

among the races/strains. Three black bars below the alignment represent the position of three

specific DNA fragments where race-specific primers were designed on Xcc race 3 genome.

Fig. 2. Agarose gel electrophoresis of the Xcc race 3 specific XccR3-49 PCR products

amplified from Xanthomonas campestris pv. campestris (Xcc) races, Xcc strains, Xc

pathovars as well as other bacteria. Lanes 1-7: Xcc races 1-7; lanes 8-15: Xcc strain (ICMP8,

KACC19132, KACC19133, KACC19134, KACC19135, KACC19136, KACC17966,

KACC10377); lanes 16: X. campestris pv. incane (Xci); lane 17: X. campestris pv. raphani

(Xcr); lane 18: X. campestris pv. zinniae (Xcz); lane 19: X. axonopodis pv. dieffenbachiae

(Xad); lane 20: X. axonopodis pv. glycines (Xag); lane 21: X. euvesicatoria (Xev); lane 22:

Pseudomonas syringae pv. maculicola (Psm); lane 23: Erwinia carotovora subsp. carotovora

(Ecc); lane 24: negative control; lane M: 100 bp plus DNA ladder.






Page 17 of 23



For Review Only

18














Fig. 5. Detection of Xcc race 3 by bio-PCR using artificially Xcc (race 1-7) infected cabbage

leaves with race-specific SCAR (XccR3-49) marker. Lanes 1-21: artificially infected leaf

samples with different Xcc races (lanes 1-3: race 1; lanes 4-6: race 2; lanes 7-9: race 3; lanes

10-12: race 4; lanes 13-15: race 5; lanes 16-18: race 6; lanes 19-21: race 7; lane +ve: gDNA

of Xcc race 3 as a positive control; lane M: 100 bp plus DNA ladder.

Page 18 of 23



For Review Only

Fig. 1.

172x128mm (300 x 300 DPI)

Page 19 of 23



For Review Only

Fig. 2.

192x68mm (300 x 300 DPI)

Page 20 of 23



For Review Only

Fig. 3.

193x67mm (300 x 300 DPI)

Page 21 of 23



For Review Only

Fig. 4.

192x76mm (300 x 300 DPI)

Page 22 of 23



For Review Only

Fig. 5.

206x54mm (300 x 300 DPI)

Page 23 of 23



For Review Only - University of Toronto T-Space · 2018-09-25 · For Review Only 1 Development of...

Documents

Transcript of For Review Only - University of Toronto T-Space · 2018-09-25 · For Review Only 1 Development of...