PHIS Midterm Agreement Food Safety and Inspection Service, USDA
Food Safety and Inspection Service - APHL€¦ · Office of Public Health Science. Food Safety...
Transcript of Food Safety and Inspection Service - APHL€¦ · Office of Public Health Science. Food Safety...
-
Food Safety and Inspection Service:Food Safety and Inspection Service:
1
-
Food Safety and Inspection Service:
Managing the Transition to WGS and Maintaining Multiple Workflows in
USDA FSIS
Glenn E. Tillman, PhD
Chief, Microbiology Characterization BranchEastern Laboratory (Athens, GA)Office of Public Health Science
Food Safety Inspection Service, USDASeptember 26-28, 2018
2
-
Food Safety and Inspection Service:Food Safety and Inspection Service:
3
Why WGS?
• Improved resolution for foodborne illness investigations
• Supports FSIS mission goals– Understand foodborne illness and emerging microbiological trends– Recurrences of pathogens in FSIS-regulated establishments/products
to further support the inspection and verification process
• Alignment of pathogen surveillance with our domestic public health and regulatory partners
PresenterPresentation NotesWhy is FSIS implementing WGS analyses?
Improved discrimination – outbreaks, defining cases
Mission goals – incorporating new technologies to help us understand relationship between food products and illness and to look at other emerging microbiological trends
Aligning with our public health and regulatory partners in the US and abroad
-
Food Safety and Inspection Service:Food Safety and Inspection Service:
• Performs WGS on all isolates from FSIS sampling programs– 12 sequencers in FSIS Field Service Laboratories– In FY18, FSIS has sequenced ~11,000 isolates
• Use WGS analyses in addition to epidemiological and traceback information to further understand the relationship between isolates
• Work with National Antimicrobial Resistance Monitoring System (NARMS) partners (FDA, CDC) to understand the occurrence or introduction of antimicrobial resistance genes in pathogens of interest
4
WGS at FSIS: Current Status
PresenterPresentation NotesFSIS usually has roughly 8000-10000 isolates per year from our various testing programs – the intent is to sequence roughly half of those isolates in a real-time manner.
We are currently using WGS data as part of our outbreak investigations and other harborage related analyses for Lm, particularly in DJE.
-
Food Safety and Inspection Service:Food Safety and Inspection Service:
5
1- FSIS Eastern Lab began WGS on adulterant isolates2- Uploaded first Lm sequences to NCBI
FY2014
1- Visits to NCBI, FDA and CDC2- Procurement of two MiSeq’s3- First Sequences produced for outbreak investigations
FSIS shared Lmwith FDAfor WGS
Food Safety and Inspection Service:
FY2015
FSIS begins WGS on selected cecalSalmonella and Campylobacter
FY2016
1- WGS on all Salmonella and Campylobacter2- FSIS Midwestern Lab begins WGS
FY2017
1- FSIS Western Lab begins WGS2- PFGE no longer performed on Lm3- WGS on NARMS cecal E. coli and Enterococcus4- Use WGS for reporting in Lm
Food Safety and Inspection ServiceWGS at FSIS: Capability and Capacity Building by Year
FY2013 FY2018
FY2019
1- Stop PFGE for Campylobacter2- Stop PFGE for Salmonella & STEC
-
Food Safety and Inspection Service:Food Safety and Inspection Service:
6
WGS Data Sharing – Metadata and Sequence Data
• Description about an isolate that has an experiment assigned • Metadata, such as source type, organism, serotype etc.• BioSample number is specific to a bacterial isolate for FSIS
FSIS Submissions to NCBI Bioprojects• PRJNA242847
– GenomeTrakr Project: USDA-FSIS (Salmonella)
• PRJNA215355– GenomeTrakr Project: FDA (Listeria
monocytogenes)
• PRJNA287430– USDA-FSIS: Campylobacter
• PRJNA268206– GenomeTrakr Project: USDA-FSIS (STEC)
• PRJNA292666– FSIS NARMS Salmonella
• PRJNA292667 – FSIS NARMS E. coli
• PRJNA292668– FSIS NARMS Campylobacter
• PRJNA292669– FSIS NARMS Enterococcus
PresenterPresentation NotesImportant points: we release minimal metadata, including year of isolation and state where the sample was collected in “real-time” – which means that when the sequence is available for upload, so is the metadata. We upload sequences whenever they are run – there is no delay (including during investigations).
-
Food Safety and Inspection Service:Food Safety and Inspection Service:
FSIS: WGS Data Analyses Work Flow Overview
7
Output: FASTA
Input: FASTQ
• MLST Sequence Type• Antibiotic Resistance genes• Virulence Profile• Salmonella and STEC serotype• MASH Tree comparison
@M02848:54:000000000-AJ347:1:1101:14587:1926 1:N:0:4 TCCGTGCTCAGTTACACGGACAAAATACCGGCGAAAAACCTTGGGCCTTCCCTGGCGACATGGGATT + AA>1A1AAD31DF3F3B111A0000B1BB00A/////0AAGG11/BFFGFFFG1/>//E/?10E0FGDGFG1
• wgMLST BioNumerics 7.6• Lyve-SET, SNP Pipeline• NCBI Pathogen Isolate Browser
De novo Assembly
Input: FASTA
QC Pipeline• Coverage• Average Quality• Nucleotide balance
QC Pipeline• File Size• N50 & No.
contigs• Correct organism
-
Food Safety and Inspection Service:Food Safety and Inspection Service:
8
Maintaining Parallel Workflows
• Four main characterization tests currently performed in parallel
0
2000
4000
6000
8000
10000
12000
14000
16000
PFGE AST WGS Serotyping
Bacterial Isolates Characterized by Test
2014 2015 2016 2017
-
Food Safety and Inspection Service:Food Safety and Inspection Service:
Further Characterization of Isolates Using WGS
• Campylobacter speciation • Serotyping/serogrouping
– Salmonella– Adulterant STEC
• Antimicrobial Resistance (Phenotype prediction)
– Salmonella– Campylobacter– E. coli– Enterococcus
• Identify characterized genes of interest– Resistance to environmental factors (heat, acid,
sanitizers, etc)– Virulence factors
• stx/eae sub-types (STEC)• Alternative to PFGE for comparison of
genotypes– wgMLST analyses– SNP analyses
A single workflow for many characterization approaches viainformatics
9
PresenterPresentation NotesIn addition to surveillance and regulatory purposes, WGS has the potential to replace a number of subtyping analyses, leading to a more efficient workflow for characterization of isolates.
In most cases, WGS analyses will take more time than traditional methods performed individually, but all of the information can be obtained from a single characterization technique (WGS with informatics).
-
Food Safety and Inspection Service:Food Safety and Inspection Service:
10
WGS Analyses for Phylogenetic Context: wgMLST and hqSNP Analyses
FSIS uses pipelines developed by public health partnersLyve-SEThttps://github.com/lskatz/lyve-SET/blob/master/
NCBI Pathogen Detection Isolates Browswerhttp://www.ncbi.nlm.nih.gov/pathogens
FDA SNP Pipelinehttps://github.com/CFSAN-Biostatistics/snp-pipeline
wgMLSTBioNumerics 7.6 CDC-PulseNet
https://github.com/lskatz/lyve-SET/blob/master/http://www.ncbi.nlm.nih.gov/pathogens
-
Food Safety and Inspection Service:Food Safety and Inspection Service:
11
Applications of WGS at FSIS: Lm HarborageFood Safety and Inspection ServiceWGS usage: hqSNP analyses and wgMLST with Listeria monocytogenes
Lyve-SETSnp Pipeline
wgMLST
0-13 SNPs
NCBI Pathogen Browser hqSNP
PresenterPresentation NotesWGS and PFGE results are generally in agreementSame PFGE pattern: WGS agreement0-2 SNPs0-7 allele differences
WGS can sometimes exclude isolates from a group within the same PFGE pattern Same PFGE pattern: WGS exclusion 34-45 SNPs 29-33 allele differencesor include isolates in a group with different PFGE patterns (wgs has finer reading capability)Different PFGE: WGS inclusion 0-3 SNPs 0-5 allele differences
In the examples below inclusion or exclusion considered all information including sample metadata (establishment, isolation date, etc.) CDC wgMSLTFDA uses high quality SNPs
-
Food Safety and Inspection Service:Food Safety and Inspection Service:
• High-throughput capacity for WGS – Sequenced ~11,000 isolates in FY18 to date
• FSIS has performed parallel workflows for several years
• FSIS labs will utilize WGS data in outbreak investigations, and as a stream-lined analytical procedure
12
Concluding Remarks
-
Food Safety and Inspection Service:
Acknowledgements
13
• USDA FSIS Offices• USDA ARS• CDC PulseNet and NARMS• FDA CFSAN• FDA CVM• NCBI• State Laboratories
Slide Number 1Managing the Transition to WGS and Maintaining Multiple Workflows in USDA FSISWhy WGS?WGS at FSIS: Current StatusSlide Number 5WGS Data Sharing – Metadata and Sequence DataFSIS: WGS Data Analyses Work Flow OverviewMaintaining Parallel WorkflowsFurther Characterization of Isolates Using WGSWGS Analyses for Phylogenetic Context: wgMLST and hqSNP AnalysesApplications of WGS at FSIS: Lm HarborageConcluding RemarksAcknowledgements