Finding What you Need in Biological Databases
description
Transcript of Finding What you Need in Biological Databases
![Page 1: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/1.jpg)
Cédric Notredame (21/04/23)
Finding What you Need in Biological
Databases
Cédric Notredame
![Page 2: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/2.jpg)
Cédric Notredame (21/04/23)
Where is my Needle ?
Databases:
![Page 3: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/3.jpg)
Cédric Notredame (21/04/23)
![Page 4: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/4.jpg)
Cédric Notredame (21/04/23)
Our Scope
Give you means to answer simple questions
Databases are UNFRIENDLY INFORMATION DESKS
Give you an idea of what is possible
WHAT can you ask ?
HOW can you ask it ?
![Page 5: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/5.jpg)
Cédric Notredame (21/04/23)
Outline
- An Overall view
- Asking a biological question to a database
- Turning a question into a query
- Bibliographic Databases: Medline, OMIM
- Gene Databases: GenBank, LocusLink, ENSEMBL
- Protein Databases: SwissProt, InterPro, Prodom
- SRS
![Page 6: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/6.jpg)
Cédric Notredame (21/04/23)
Database:
What is a Database ?
![Page 7: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/7.jpg)
Cédric Notredame (21/04/23)
DataBase Entries
1 entry = 1 SequenceAGCTGTCGAGGGATAGGACATATACATAAATTAATATAAT
1 entry = 1 File = Sequence +DocSEQ
DOC
= Flat File
Database = Collection of Flat FilesSEQ
DOCSEQ
DOCSEQ
DOCSEQ
DOCSEQ
DOCSEQ
DOCSEQ
DOC
![Page 8: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/8.jpg)
Cédric Notredame (21/04/23)
DataBase Entries: Flat Files
Accession number: 1
First Name: Amos
Last Name: Bairoch
Course: DEA=oct-nov-dec 2002
http://www.expasy.org/people/amos.html
//
Accession number: 2
First Name: Laurent
Last name: Falquet
Course: EMBnet=sept 2000, sept 2001;DEA=oct-nov-dec 2000;
//
Accession number 3:
First Name: Marie-Claude
Last name: Blatter Garin
Course: EMBnet=sept 2000; sept 2001; DEA=oct-nov-dec 2000;
http://www.expasy.org/people/Marie-Claude.Blatter-Garin.html
//
![Page 9: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/9.jpg)
Cédric Notredame (21/04/23)
DataBase: Relational Databases
TeacherAccession number
Education
Amos 1 Biochemistry
Laurent 2 Biochemistry
M-Claude 3 Biochemistry
CourseDate Involved
teachers
DEA Oct-nov-dec 2000 1,3
EMBnet Sept 2000, Sept 2001 2,3
Relational database (« table file »):
![Page 10: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/10.jpg)
Cédric Notredame (21/04/23)
To Summarize: What’s a database ?
Collection of Data that is:•Structured Data •Searchable (index) -> table of contents
•Updated periodically (release) -> new edition
•Cross-referenced (hyperlinks) -> links with other db
Collection of tools (software) necessary for:
Searching –Updating -Releasing
Data storage managment: flat files, relational databases…
![Page 11: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/11.jpg)
Cédric Notredame (21/04/23)
Database:
What’s on the Menu?
![Page 12: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/12.jpg)
Cédric Notredame (21/04/23)
A large amount of information
More than 1000 different databases
Generally accessible through the webEBI: http://www.ebi.ac.uk/
NCBI: http://www.ncbi.nlm.nih.org
Google: http://www.google.com
Variable size: <100Kb to >10GbDNA: > 10 Gb
Protein: 1 Gb
3D structure: 5 Gb
Other: smaller
Update frequency: daily to annually
![Page 13: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/13.jpg)
Cédric Notredame (21/04/23)
A Non Exhaustive List
AATDB, AceDb, ACUTS, ADB, AFDB, AGIS, AMSdb, ARR, AsDb, BBDB, BCGD, Beanref, Biolmage,BioMagResBank, BIOMDB, BLOCKS, BovGBASE,
BOVMAP, BSORF, BTKbase, CANSITE, CarbBank, CARBHYD, CATH, CAZY, CCDC, CD4OLbase, CGAP, ChickGBASE, Colibri, COPE, CottonDB, CSNDB, CUTG, CyanoBase, dbCFC, dbEST, dbSTS, DDBJ, DGP, DictyDb, Picty_cDB, DIP, DOGS, DOMO, DPD, DPlnteract, ECDC, ECGC, EC02DBASE, EcoCyc, EcoGene, EMBL, EMD db, ENZYME, EPD, EpoDB, ESTHER, FlyBase, FlyView, GCRDB, GDB, GENATLAS, Genbank, GeneCards, Genline, GenLink, GENOTK, GenProtEC, GIFTS, GPCRDB, GRAP, GRBase, gRNAsdb, GRR, GSDB, HAEMB, HAMSTERS, HEART-2DPAGE, HEXAdb, HGMD, HIDB, HIDC, HlVdb, HotMolecBase, HOVERGEN, HPDB, HSC-2DPAGE, ICN, ICTVDB, IL2RGbase, IMGT, Kabat, KDNA, KEGG, Klotho, LGIC, MAD, MaizeDb, MDB, Medline, Mendel, MEROPS, MGDB, MGI, MHCPEP5 Micado, MitoDat, MITOMAP, MJDB, MmtDB, Mol-R-Us, MPDB, MRR, MutBase, MycDB, NDB, NRSub, 0-lycBase, OMIA, OMIM, OPD, ORDB, OWL, PAHdb, PatBase, PDB, PDD, Pfam, PhosphoBase, PigBASE, PIR, PKR, PMD, PPDB, PRESAGE, PRINTS, ProDom, Prolysis, PROSITE, PROTOMAP, RatMAP, RDP, REBASE, RGP, SBASE, SCOP, SeqAnaiRef, SGD, SGP, SheepMap, Soybase, SPAD, SRNA db, SRPDB, STACK, StyGene,Sub2D,SubtiList, SWISS-2DPAGE, SWISS-3DIMAGE, SWISS-MODEL Repository, SWISS-PROT, TelDB, TGN, tmRDB, TOPS, TRANSFAC, TRR, UniGene, URNADB, V BASE, VDRR, VectorDB, WDCM, WIT, WormPep, YEPD, YPD, YPM, etc .................. !!!!
There Exists A Specialized Database on Almost anything you can think of
![Page 14: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/14.jpg)
Cédric Notredame (21/04/23)
A database of databases
![Page 15: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/15.jpg)
Cédric Notredame (21/04/23)
What’s on the Menu:The Art of Eating Well
Always Use Fresh Data: The Latest Update of your DataBase
Make Sure The DataBase is Maintained: Many Databases are poorly maintained
Treat DataBases like Publications: Some Journals are Better than Others
![Page 16: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/16.jpg)
Cédric Notredame (21/04/23)
Bio-Google:
How Can I Search a Database ?
![Page 17: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/17.jpg)
Cédric Notredame (21/04/23)
Searching Databases
There are 2 ways to search databases
Text based queries: Medline, EntrezSEQ
DOCSearch For « Smith AND dUTPase>
Similarity Searches: BLASTAGCTGTCGAGGGATAGGACATATACATAAATTAATATAAT
![Page 18: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/18.jpg)
Cédric Notredame (21/04/23)
Searching Databases
Each database is a little kingdom…
Has its own query system
Has its own information structure
The main databases are well documentedand this documentation is available online
Most databases can be searched using SRSor Entrez
![Page 19: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/19.jpg)
Cédric Notredame (21/04/23)
Databases: Asking the right Question
Databases ARE NOT meant for browsing
When you search a Database you must have an idea of what your Needle-in-a-hay-stack looks like
![Page 20: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/20.jpg)
Cédric Notredame (21/04/23)
Databases: Asking the right Question
Browsing a database is like Using your
phone book in place of a dating agency…
![Page 21: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/21.jpg)
Cédric Notredame (21/04/23)
Databases: Asking the right Question
Finding Data: Database Search
Finding Questions: Data Mining
![Page 22: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/22.jpg)
Cédric Notredame (21/04/23)
The Kind Of Questions We Can Ask:
SEQUENCE Based
InterPro Any Known Domain in my Protein ???
SwissProt Any Protein like mine ???
These ARE Predictions
![Page 23: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/23.jpg)
Cédric Notredame (21/04/23)
The Kind Of Questions We Can Ask:
TEXT Based
Medline Who Worked on my Protein ???
SwissProt Function of My Protein ???
PDB Structure of My Protein ???
These are NOT Predictions
![Page 24: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/24.jpg)
Cédric Notredame (21/04/23)
Just like When You Google up
Specific Queries give Precise Answers
![Page 25: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/25.jpg)
Cédric Notredame (21/04/23)
Medline:
Who worked on my Protein ?
![Page 26: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/26.jpg)
Cédric Notredame (21/04/23)
Medline (PubMed)
![Page 27: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/27.jpg)
Cédric Notredame (21/04/23)
What is in Medline ?
MEDLINE covers the fields of medicine, nursing, dentistry, veterinary medicine, the health care system, and the preclinical sciences
more than 4,000 biomedical journals and More than 10 million citations since 1966 until now
Contains links to biological db and to some journals
nMany papers not dealing with human are not in Medline
nBefore 1970, keeps only the first 10 authors !
![Page 28: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/28.jpg)
Cédric Notredame (21/04/23)
Using Medline: Asking a question
During the last Lab Meeting, I heard the word dUTPase.
What can it be ? What has been published on this ?
![Page 29: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/29.jpg)
Cédric Notredame (21/04/23)
Using Medline: Asking a question
![Page 30: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/30.jpg)
Cédric Notredame (21/04/23)
Using Medline: Asking a question
![Page 31: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/31.jpg)
Cédric Notredame (21/04/23)
Using Medline: Asking a question
![Page 32: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/32.jpg)
Cédric Notredame (21/04/23)
Using Medline: Asking a question
By Default, Medline Assumes you mean:
Abergel AND dUTPase
![Page 33: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/33.jpg)
Cédric Notredame (21/04/23)
Using Medline: Asking a question
I have found the reference I wanted.
Now I want to save it so that I can use it later, For instance to Import it in ENDnote my Reference Manager
Save Your Data in the Proper DataBase format
![Page 34: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/34.jpg)
Cédric Notredame (21/04/23)
Using Medline: Storing your results
![Page 35: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/35.jpg)
Cédric Notredame (21/04/23)
Using Medline: Storing your results
![Page 36: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/36.jpg)
Cédric Notredame (21/04/23)
Retrieving EXACTLY the Information that you need
[AB] [AD]
Restricted fields
![Page 37: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/37.jpg)
Cédric Notredame (21/04/23)
Using Medline: Storing your results
AB
AD
![Page 38: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/38.jpg)
Cédric Notredame (21/04/23)
Using Medline: Looking for a Review
I Want to Find the LATEST REVIEW on the dUTPase.
Use The Limit Option of Medline
![Page 39: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/39.jpg)
Cédric Notredame (21/04/23)
Using Medline: Looking For a Review
LanguageTitle OR Abstract
Article type
1-Limits
![Page 40: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/40.jpg)
Cédric Notredame (21/04/23)
Using Medline: A Few Tips
•Quoted queries (e.g. «down syndrome» ) behave as a single word, and are great to improve the relevance of your search
•Adding initials to names (e.g. “Abergel C” ) (if you can) also reduces your output
•Write down the PubMed Identifier (the number in the PMID field) of that interesting paper you just find. It could be very useful in your subsequent search for related items such as associated gene and protein sequences
![Page 41: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/41.jpg)
Cédric Notredame (21/04/23)
Using Medline: A Few Tips
•Spelling mistakes, wrong field restrictions or Limits setting can occur. These may be the problem.
•Use abstracts to enlarge your vocabulary and look for synonyms: some papers on dUTPase might use dUTP pyrophosphatase instead!
•The “related papers” button (on the extreme right of the PubMed output). Try it from time to time, to enlarge a search that is not giving you enough references
![Page 42: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/42.jpg)
Cédric Notredame (21/04/23)
Using Medline: A Few Tips
•Storing your PDFs,•Memory is cheap, access is sometimes strange…•Storing your favourite PDF is a good idea
•Which name on your disk?
•THE MEDLINE ID NUMBER !!!
•With a reference manager like EndNote
![Page 43: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/43.jpg)
Cédric Notredame (21/04/23)
![Page 44: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/44.jpg)
Cédric Notredame (21/04/23)
GenBank:
What is the Sequence of my
Gene ?
![Page 45: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/45.jpg)
Cédric Notredame (21/04/23)
GenBank: an Overview
![Page 46: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/46.jpg)
Cédric Notredame (21/04/23)
GenBank: an Overview
![Page 47: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/47.jpg)
Cédric Notredame (21/04/23)
GenBank: an Overview
EMBL
DDBJ
GenBank
EMBL, GenBank and DDBJ are the same database. They are synchronized every day.
![Page 48: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/48.jpg)
Cédric Notredame (21/04/23)
GenBank: an Overview
GenBank contains EVERY piece of DNA that has been sequenced and made publicly available.
It contains GOOD and BAD data
There is a Historical Aspect in the GenBank data:
-Complex Genes are spread in many entries:
![Page 49: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/49.jpg)
Cédric Notredame (21/04/23)
GenBank Entries Are Complex because Genes are complex
Prokaryotic Example
GenePromoter RBS
Protein
ORF
mRNASTOPATG
![Page 50: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/50.jpg)
Cédric Notredame (21/04/23)
GenBank Entries Are Complex because Genes are complex
Gene
Promoter
Protein (form2)
Protein (form1)
mRNA (form1)
mRNA (form2)
exonexon exon exon exonexon
![Page 51: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/51.jpg)
Cédric Notredame (21/04/23)
What is the Sequence of the E. Coli dUTPase ?
Using GenBank: Asking a question
![Page 52: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/52.jpg)
Cédric Notredame (21/04/23)
Using GenBank: Asking a questionThe Naive Way
This search reports EVERY GenBank entry that contains these two words.
Most Bacterial Genomes Entries (annotated by similarity) Contain these two words
Escherichia coli dUTPase
![Page 53: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/53.jpg)
Cédric Notredame (21/04/23)
Using GenBank: Asking a questionThe Right Way
Escherichia coli[organism] dUTPase[definition]
![Page 54: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/54.jpg)
Cédric Notredame (21/04/23)
Using GenBank: And There Is Plenty More where It comes from…
If a Gene is published more than once, Each publication gets its own entry
This can mean MANY ENTRIES if you have SNPs or ESTs
GenBank Is Redundant:
![Page 55: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/55.jpg)
Cédric Notredame (21/04/23)
HeaderContains all the practical Information
![Page 56: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/56.jpg)
Cédric Notredame (21/04/23)
FeaturesContains Experimental
Information and Predictions
![Page 57: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/57.jpg)
Cédric Notredame (21/04/23)
Extra GeneThis is common in GenBankentries
![Page 58: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/58.jpg)
Cédric Notredame (21/04/23)
What is the Sequence of the Human dUTPase ?
Using GenBank: Asking a question
What is the Sequence of the E. Coli dUTPase ?
![Page 59: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/59.jpg)
Cédric Notredame (21/04/23)
Using GenBank: Finding the Human dUTPase
2-Check box here to exclude ESTs
1-Request Limits
![Page 60: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/60.jpg)
Cédric Notredame (21/04/23)
Using GenBank: Finding the Human dUTPase
The Gene does NOT appear in a single entry
![Page 61: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/61.jpg)
Cédric Notredame (21/04/23)
Using GenBank: Finding the Human dUTPase
![Page 62: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/62.jpg)
Cédric Notredame (21/04/23)
Using GenBank: Reconstructing your gene
![Page 63: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/63.jpg)
Cédric Notredame (21/04/23)
Some Good News…
-This Information is complicated because it is RAW Information
-It is necessary to keep UNINTERPRETED Experimental Information available
-There are SIMPLER alternatives to using this RAW Information:
-Gene Centric Databases-Protein Databases
![Page 64: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/64.jpg)
Cédric Notredame (21/04/23)
RefSeq/LocusLink:
What Is There To know about This
Gene?
![Page 65: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/65.jpg)
Cédric Notredame (21/04/23)
Using LocuLink
![Page 66: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/66.jpg)
Cédric Notredame (21/04/23)
What Can I find about the DUT Gene ?
Using LocusLink: Asking a question
![Page 67: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/67.jpg)
Cédric Notredame (21/04/23)
EnterGene name
SelectLocusLink
![Page 68: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/68.jpg)
Cédric Notredame (21/04/23)
Using LocusLink: Asking a question about a Gene
![Page 69: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/69.jpg)
Cédric Notredame (21/04/23)
Using LocusLink: Asking a question about a Gene
![Page 70: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/70.jpg)
Cédric Notredame (21/04/23)
OMIM:
Is There A disease Associated to This
Gene?
![Page 71: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/71.jpg)
Cédric Notredame (21/04/23)
OMIM: Finding Out About The Phenotype of a Gene
![Page 72: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/72.jpg)
Cédric Notredame (21/04/23)
OMIM: Finding Out About The Phenotype of a Gene
OMIM™: Online Mendelian Inheritance in Man
A catalog of human genes and genetic disorders
Contains a summary of literature, pictures, and reference information. It also contains numerous links to articles and sequence information.
![Page 73: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/73.jpg)
Cédric Notredame (21/04/23)
OMIM: Finding Out About The Phenotype of a Gene
![Page 74: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/74.jpg)
Cédric Notredame (21/04/23)
NCBI-GENOME:
What is the Context of my Gene In Its
Genome?
![Page 75: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/75.jpg)
Cédric Notredame (21/04/23)
NCBI-GENOME
![Page 76: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/76.jpg)
Cédric Notredame (21/04/23)
NCBI-GENOME: The Virus Section
![Page 77: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/77.jpg)
Cédric Notredame (21/04/23)
NCBI-GENOME: The Virus Section
![Page 78: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/78.jpg)
Cédric Notredame (21/04/23)
NCBI-GENOME: The Bacteria Section
![Page 79: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/79.jpg)
Cédric Notredame (21/04/23)
NCBI-GENOME: The Bacteria Section
![Page 80: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/80.jpg)
Cédric Notredame (21/04/23)
ENSEMBL:
Where is my Gene in the Human
Genome (who are its neighbors) ?
![Page 81: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/81.jpg)
Cédric Notredame (21/04/23)
Using ENSEMBL
![Page 82: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/82.jpg)
Cédric Notredame (21/04/23)
My Gene:
A Summary
![Page 83: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/83.jpg)
Cédric Notredame (21/04/23)
Gathering Everything you need on a gene
GenBank: What is the Sequence ?
LocusLink: What about this Gene?
ENSEMBL: What is the Context?
MEDLINE: Are There Papers?
OMIME: Are There Illnesses?
![Page 84: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/84.jpg)
Cédric Notredame (21/04/23)
SwissProt:
What Do We Know About My Protein ?
![Page 85: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/85.jpg)
Cédric Notredame (21/04/23)
The Protein Databases
GenBank: A Big Bag of DNA
PREDICTION+
EXPERIMENT
Generic Non Redundant Protein
DatabasesNR
trEMBLSpecialized Protein
DatabasesSwissProt
PIR
![Page 86: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/86.jpg)
Cédric Notredame (21/04/23)
What Is SwissProt ?
![Page 87: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/87.jpg)
Cédric Notredame (21/04/23)
What Is SwissProt ?
Fully-annotated (manually), non-redundant, cross-referenced, documented protein sequence database.
~100 ’000 sequences from more than 6’800 different species; 70 ’000 references (publications); 550 ’000 cross-references (databases); ~200 Mb of annotations.
Collaboration between the SIB (CH) and EMBL/EBI (UK)
![Page 88: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/88.jpg)
Cédric Notredame (21/04/23)
Using SwissProt: Asking a question
We hear the word EPO quite often these days, but whatexactly is known about it ?
![Page 89: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/89.jpg)
Cédric Notredame (21/04/23)
Using SwissProt: Asking a question
A Simple SwissProt Text Query
EPO HUMAN
![Page 90: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/90.jpg)
Cédric Notredame (21/04/23)
Using SwissProt: Reading an Entry
![Page 91: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/91.jpg)
Cédric Notredame (21/04/23)
Using SwissProt: Reading an Entry
![Page 92: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/92.jpg)
Cédric Notredame (21/04/23)
Using SwissProt: Reading an Entry
![Page 93: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/93.jpg)
Cédric Notredame (21/04/23)
Using SwissProt: Reading an Entry
![Page 94: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/94.jpg)
Cédric Notredame (21/04/23)
Using SwissProt: Reading an Entry
Structure Information
![Page 95: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/95.jpg)
Cédric Notredame (21/04/23)
Using SwissProt: Reading an Entry
![Page 96: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/96.jpg)
Cédric Notredame (21/04/23)
The Protein Databases
GenBank: A Big Bag of DNA
PREDICTION+
EXPERIMENT
Specialized Protein DatabasesSwissProt
PIRUniProt
Generic Non Redundant Protein
DatabasesNR
trEMBL
![Page 97: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/97.jpg)
Cédric Notredame (21/04/23)
![Page 98: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/98.jpg)
Cédric Notredame (21/04/23)
![Page 99: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/99.jpg)
Cédric Notredame (21/04/23)
![Page 100: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/100.jpg)
Cédric Notredame (21/04/23)
SwissProt
How Good is Good ?
![Page 101: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/101.jpg)
Cédric Notredame (21/04/23)
![Page 102: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/102.jpg)
Cédric Notredame (21/04/23)
![Page 103: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/103.jpg)
Cédric Notredame (21/04/23)
PDB:
What is the Structure of my
Protein ?
![Page 104: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/104.jpg)
Cédric Notredame (21/04/23)
PDB: The Protein Database
![Page 105: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/105.jpg)
Cédric Notredame (21/04/23)
PDB: The Protein Database
Managed by Research Collaboratory for Structural Bioinformatics (RCSB) (USA).
Contains macromolecular structure data on proteins, nucleic acids, protein-nucleic acid complexes, and viruses.
Currently there are ~16’000 structure data for about 4’000 different molecules, but far less protein families (highly redundant) !
![Page 106: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/106.jpg)
Cédric Notredame (21/04/23)
Using PDB: Asking a question
Does tolB have a known Structure? And If the answer is Yes, How can I look at it ?
![Page 107: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/107.jpg)
Cédric Notredame (21/04/23)
Using PDB: Asking a question
Query: TolB
![Page 108: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/108.jpg)
Cédric Notredame (21/04/23)
Using PDB: Viewing a Structure
View Structure
![Page 109: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/109.jpg)
Cédric Notredame (21/04/23)
Using PDB: Viewing a Structure
![Page 110: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/110.jpg)
Cédric Notredame (21/04/23)
Using PDB: Viewing a Structure
![Page 111: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/111.jpg)
Cédric Notredame (21/04/23)
Using PDB: Viewing a Structure
![Page 112: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/112.jpg)
Cédric Notredame (21/04/23)
Using PDB: Downloading Data
Coordinates
![Page 113: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/113.jpg)
Cédric Notredame (21/04/23)
Interpro:
Are There Domains In my Protein ?
![Page 114: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/114.jpg)
Cédric Notredame (21/04/23)
Interpro: The Idea of Domains
![Page 115: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/115.jpg)
Cédric Notredame (21/04/23)
Interpro: The Idea of Domains
![Page 116: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/116.jpg)
Cédric Notredame (21/04/23)
Interpro: A Federation of Databases
![Page 117: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/117.jpg)
Cédric Notredame (21/04/23)
Using InterPro: Asking a question
Which Domains does the oncogene FosB contain?
![Page 118: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/118.jpg)
Cédric Notredame (21/04/23)
Using InterPro: Asking a question
![Page 119: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/119.jpg)
Cédric Notredame (21/04/23)
Using InterPro: Asking a question
![Page 120: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/120.jpg)
Cédric Notredame (21/04/23)
Using CDsearch: Asking a question
![Page 121: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/121.jpg)
Cédric Notredame (21/04/23)
Using CDsearch: Asking a question
![Page 122: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/122.jpg)
Cédric Notredame (21/04/23)
Using Domains: Some Statistics
• 10 most common protein domains for H. sapiens
Immunoglobulin and major histocompatibility complex domainZinc finger, C2H2 typeEukaryotic protein kinaseRhodopsin-like GPCR superfamilyPleckstrin homology (PH) domainRING fingerSrc homology 3 (SH3) domainRNA-binding region RNP-1 (RNA recognition motif)EF-hand familyHomeobox domain
![Page 123: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/123.jpg)
Cédric Notredame (21/04/23)
My Protein:
A Summary
![Page 124: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/124.jpg)
Cédric Notredame (21/04/23)
Gathering Everything you need on a Protein
trEMBL: What is the Sequence ?
MEDLINE: Are There Papers?
PDB: Which Structure?
INTERPRO: Which Domains?
SwissProt:What about the Function
![Page 125: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/125.jpg)
Cédric Notredame (21/04/23)
SRS:
Can I search Many Databases
Simultaneously ?
![Page 126: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/126.jpg)
Cédric Notredame (21/04/23)
Using SRS
![Page 127: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/127.jpg)
Cédric Notredame (21/04/23)
Using SRS
![Page 128: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/128.jpg)
Cédric Notredame (21/04/23)
A Few Databases in Bulk
![Page 129: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/129.jpg)
Cédric Notredame (21/04/23)
![Page 130: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/130.jpg)
Cédric Notredame (21/04/23)
![Page 131: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/131.jpg)
Cédric Notredame (21/04/23)
![Page 132: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/132.jpg)
Cédric Notredame (21/04/23)
![Page 133: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/133.jpg)
Cédric Notredame (21/04/23)
A Few Addresses
![Page 134: Finding What you Need in Biological Databases](https://reader030.fdocuments.in/reader030/viewer/2022012906/568144d6550346895db1a2ab/html5/thumbnails/134.jpg)
Cédric Notredame (21/04/23)
A few Databases