1

Finch, AJ et al., Supplemental Material

Includes 7 Supplemental Figures, 7 Supplemental Tables, (Tables 1 and 2 are

provided as Excel files), Supplemental Materials and Methods, Supplemental

References.

Supplemental Figures

Figure S1. Targeted disruption of the mouse Sbds gene, related to Fig. 1

a. Genomic organization of the mouse Sbds locus (Sbds+); b. targeting vector; c. the

product of homologous recombination (Sbdsfl); d. structure of the Sbds locus

following Cre recombination (Sbds-). Red boxes represent Sbds exons I-V, yellow

triangles represent loxP sites. The 5' external probe used for genotyping by filter

hybridization is shown as a gray box. B, BamH1.

Figure S2. Sbds deletion does not alter the ratio of 60S to 40S ribosomal subunits,

related to Fig. 2. The ratios of 60S to 40S subunits are compared between Sbdsfl/- mice

treated with 6 x 250 µg poly(I:C) over 2 weeks in the absence (-Cre) or presence

(+Cre) of the pMx1-cre transgene.

Figure S3. A negative genetic interaction network for EFL1 and SDO1, related to

Fig. 3. Genes are represented as nodes, and negative genetic interactions (e.g.

synthetic lethal/sick interactions) are represented as edges that connect the nodes.

Synthetic lethal/sick interactions confirmed by random spore and/or tetrad analysis

are shown as black edges. Network edges representing unconfirmed quantitative

negative interactions that satisfied a stringent confidence threshold (e <-0.12, p <0.05)

2

are shown in grey. Nodes are colored based on a general biological process annotation

described previously (Costanzo et al. 2010).

Figure S4. EFL1 catalytic residues are required for genetic complementation of efl1Δ

cells in vivo, related to Fig. 3.

a. Schematic of the domain structure of yeast EFL1 showing the position of critical

loss of function missense mutations.

b. Sequence alignment of the consensus GTP-binding domain (G domain) for H.

sapiens EFL1 (HsEFL1, NP_078856), S. cerevisiae EFL1 (ScEfl1p, NP_014236) and

S. cerevisiae EF-2 (ScEF-2). The amino sequences were aligned using MacVector

11.1 (http://www.macvector.com). The conserved motifs G1, G2, G3, G4 and G5 of

the G domain are boxed in red. Residues mutated in (c) are shown in red.

c. EFL1 catalytic residues are required for function in vivo. The ability of a yeast

EFL1-expressing plasmid to complement the growth defect of efl1Δ cells is impaired

by mutations in the G1 P-loop that spans the α and β phosphates of the bound GTP

cofactor (T33A), the G3 switch II region involved in Mg2+ coordination and γ-

phosphate binding (D102A, H106A, H106I), the G4 motif involved in binding the

guanine nucleobase of GTP (D159A) or mutation of a residue predicted to contact the

SRL (W240A).

Figure S5. The SBDS protein is highly conserved from archaea to human, related to

Fig. 4.

a. Structure-based sequence alignment of representative SBDS protein orthologs.

Numbering corresponds to the amino acid sequence for human SBDS. Shading

intensity indicates the degree of amino acid identity. GenBankTM accession numbers:

3

H. sapiens (NP_057122), M. musculus (P70122), S. cerevisiae (NP_013122), D.

melanogaster (NP_648057), D. discoideum (AAO50830), A. fulgidus (NP_069327),

M. thermautotrophicus (NP_275828). Secondary structure elements for the A.

fulgidus and H. sapiens SBDS orthologs are shown above the alignment with domain

I colored in red, domain II in yellow, domain III in green. The alignment was

generated with MacVector 11.1 (http://www.macvector.com).

b-d. The fold of the human and archaeal SBDS proteins is conserved. Superposition

of the structures of human SBDS (pdb code 2L9N) domain I (red) (b), domain II

(yellow) (c) and domain III (green) (d) with the respective domains of A. fulgidus

SBDS (pdb code 1T95) (gray). Rms deviation for domain I (residues A16-T89) is

1.27 Å; domain II (residues D97-K164) is 1.48 Å and domain III (residues H171-

L237) is 1.13 Å. Figures were generated using PyMOL (http://www.pymol.org).

Figure S6. Chemical shift perturbations caused by SDS-associated disease mutants,

related to Fig. 4. Overlays of the 1H,15N HSQC spectra for SBDS WT (blue) and 25

SDS-associated mutants (red). a. (I) P6L, (II) N8K, (III) R19Q, (IV) F27L, (V) A30S,

(VI) Y32C, (VII) K33E, (VIII) N34I. b. (IX) E44G, (X) F57L, (XI) K67E, (XII)

K118N, (XIII) C119R, (XIV) C119Y, (XV) N121T, (XVI) T129A. c. (XVII) S143L,

(XVIII) S143W, (XIX) K148R, (XX) K148T, (XXI) Q153R, (XXII) R169C, (XXIII)

R169L, (XXIV) R175W. d. (XXV) R218Q.

Figure S7. The SDS-associated SBDS variants R126T and K151N bind to 60S

subunits in vitro, related to Fig. 6. Recombinant WT SBDS and variants (R126T,

K151N) were bound together with EFL1 to RRL 60S subunits over the indicated

4

range of KCl concentrations and pelleted through 30% (w/v) sucrose cushions. Bound

SBDS, EFL1 and Rpl28 were visualized by immunoblotting.

Supplemental Tables.

Table S1. Quantitative scoring of EFL1 positive and negative genetic interactions

(Excel file).

Table S2. MS/MS analysis of murine eIF6 tryptic peptides. Observed

phosphopeptides are shaded in yellow. The peptide containing S235

(LNEAKPSTIATS235MR) is shaded in blue. Lower case amino acids indicate

modifications (Excel file).

5

Table S3. Summary of experimental restraints and structural statistics for the 20

accepted lowest energy structures of the human SBDS protein

Structuralconstraints Intra‐residueSequentialMedium‐range(2≤|i‐j|≤4)Long‐range(|i‐j|>4)DihedralTALOSconstraintsHydrogenbondconstraintsTotal

149011195968222961164439

StatisticsforacceptedstructuresStatisticsparameter R.m.sdeviationfordistanceconstraints(űSD)R.m.sdeviationfordihedralconstraints(o±SD)

0.0052±0.00100.0727±0.0486

MeanCNSenergyterm(kcal.mol‐1±SD)E(overall)E(vanderWaals)E(NOEandhydrogenbondconstraints)E(chi‐1dihedralandTALOSconstraints)

157.7±26.940.5±13.18.8±3.70.5±1.0

R.m.sdeviationsfromtheidealgeometryBondlengths(űSD)Bondangles(o±SD)Improperangles(o±SD)

0.0012±0.00020.29±0.01

0.15±0.02

Averageatomicr.m.sdeviationfromthemeanstructure(űSD)DomainIResiduesA16‐T89(N,Cα,Catoms)aSecondarystructure(N,Cα,Catoms)ResiduesA16‐T89(allheavyatoms)DomainIIResiduesD97‐K164(N,Cα,Catoms)bSecondarystructure(N,Cα,Catoms)ResiduesD97‐K164(allheavyatoms)DomainIIIResiduesH171‐L237(N,Cα,Catoms)cSecondarystructure(N,Cα,Catoms)ResiduesH171‐L237(allheavyatoms)

0.44±0.120.37±0.090.99±0.12

0.78±0.25

0.55±0.141.42±0.270.66±0.110.63±0.101.30±0.10

Ramachandran Quality parameters (%) Molprobity Residues in favored region of Ramachandran Plot ResiduesinallowedregionofRamachandranPlotPROCHECKMostfavoredregionsAdditionallyallowedregionsGenerouslyallowedregionsDisallowedregions

92.899.1

90.49.50.00.1

6

aresidues A16-R22, K25-C31, K33-S41, L47-V50, F57-N59, Q64-V65, K68-F75,

Q80-T89. bresidues D97-D117, V130-D139, T150-K164. cresidues H171-L178, E182-

L193, K195-D201, E207-P214, R218-K229, L234-L237.

7

Table S4. Summary of SBDS missense mutations associated with Shwachman-

Diamond syndrome

Mutation Reference N8K (Boocock et al. 2003) E44G K67E I87S R126T R169C I167M (Nakashima et al. 2004) R19Q (Shammas et al. 2005) C31W K33E N34I L71P K118N S143L + K148R Q153R R169L I87T (Makitie et al. 2004) Y32C (Nicolis et al. 2005) C84R (Kuijpers et al. 2005) R175W (Erdos et al. 2006) N121T P6L C. Bellanné-Chantelot and J. Donadieu,

personal communication F57L C119Y, C119R T129A K151N R169L R218Q A154V A30S M. Schwarz, personal communication

8

Table S5. Impact of SDS-associated mutations

Chemical shift

SBDS mutants perturbationa Classb I II III

Domain I P6L + – – B N8K + – – B R19Q + – – B F27L * – – A A30S + – – B Y32C * – – A K33E + – – B N34I + – – B E44G + – – A F57L * – – A K67E + – – B C84R * – – A

Domain II

K118N – + + B C119R – * * A C119Y – * * A N121T – * * A R126T – + – B T129A – + – B S143W – + – B S143L – + – B K148R – + – B K148T – + – B K151N – + – B Q153R – + – A R169C – + + A R169L – + + A

Domain III

R175W – – + B R218Q – – + B

9

a. (–) indicates no chemical shift perturbation compared to WT SBDS; (+), local or

global chemical shift perturbation; (*), stability of the domain was compromised

leading to unfolding and/or aggregation.

b. (A) stability mutants, (B) surface mutants.

10

Table S6. Yeast strainsName Genotype Source

SE1 S288c;MATa/α,lyp1Δ/+,mfα1Δ::MFα1pr­LEU2/+;can1Δ::MFA1pr­HIS3/+,his3Δ1/his3Δ1,leu2Δ0/leu2Δ0,ura3Δ0/ura3Δ0,met15Δ0/met15Δ0,sdo1Δ::NatMX4/SDO1,efl1Δ::KanMX4/EFL1

AJW

C375

S288c,MATα,can1Δ::MFA1pr­HIS3,mfα1Δ::MFα1pr­LEU2,lyp1Δ,his3Δ1,leu2Δ0,ura3Δ0,met15Δ0,sdo1Δ::NatMX4,TIF6­I58T

AJW

NS0 S288c,MATα,can1Δ::MFA1pr­HIS3,lyp1Δ,his3Δ1,leu2Δ0,ura3Δ0,met15Δ0,efl1Δ::NatMX4,TIF6­R61G

Thisstudy

Y5538 S288c,MATa/α,lyp1Δ/+,mfα1Δ::MFα1pr­LEU2/+;can1Δ::MFA1pr­HIS3/+,his3Δ1/his3Δ1,leu2Δ0/leu2Δ0,ura3Δ0/ura3Δ0,met15Δ0/met15Δ0

C.Boone

BCY123 MATa, CAN1, ade2, trp1, ura3-52, his3, leu2-3, 112, pep4::his+, prb1::leu2+, bar1::HisG+, lys2::pGAL1/10-GAL4+

A. Newman,LMB

11

Table S7. Primers

Primer Sequence

Hs eIF61-225 5'

Hs eIF61-225 3'

Hs EFL1 5'

Hs EFL1 3'

Hs SBDS 5'

Hs SBDS 3'

Sbdsfl/+ geno 5'

Sbdsfl/+ geno 3'

Sbds- geno 5'

Sbds- geno 3'

GGAATTCCATATGGCGGTCCGAGCTTCG

CGGAATTCTCAATTCAGCTTGAAGACACTCTC

GCGGATCCATGGTGCTCAACAGTTTG

GCCTCGAGTTAATGGTGATGGTGGTGATGCTTATTTTTGCTGAGTGT

GGGGGATCCATGTCGATCTTCACCCCCACCAACCAGATCCGCC

GCGGATCTGGTTGGTGAGGGTGAAGATCGAC

TGAGTAATCCTGTGCCCAGAGTTC

TGGAAATCGCAGCAATCCTC

AAAACAAGGTCGTCGGCTGG

CCCCTCAAACAGGACAACCAAC

12

Supplemental Materials and Methods

Mouse gene targeting

The mouse genomic Sbds locus was PCR-amplified from mouse 129 DNA. Targeting

vector pMCTV1 was generated by inserting the positive selection FRT/Neo/FRT

cassette into intron 2 of Sbds, with one loxP site placed in intron 1 and a second in

intron 2, 3’ to the selection cassette. Exposure to Cre recombinase results in deletion

of exon 2 and the selection cassette. G418-resistant ES cell clones were screened by

filter hydridization using two distinct mouse genomic probes 5’ and 3’ to the targeting

vector. Targeted clones were verified as having a single integration using a neomycin

resistance gene fragment. Male chimeras were generated by injection of an ES cell

clone into C57BL/6J blastocysts and germline transmission verified by filter

hybridization.

Activation of the pMx1-cre transgene was achieved by intraperitoneal injection of 250

µg poly(I:C) (Invivogen) in saline three times per week. Following euthanasia, livers

were dissected, frozen on dry ice and stored at -80°C. Samples of liver were fixed in

10% neutral buffered formalin, embedded in paraffin, sectioned and stained with

haematoxylin and eosin. Images were acquired with a Leica DMR microscope and

JVC 3CCD KY-F75U digital camera.

Protein expression and purification

The coding sequence for human eIF6 (NP_852133), residues 1-225, was PCR-

amplified (from clone IMAGE:2823211) and cloned into pET-28a (Novagen) to

generate plasmid peIF6. N-terminal 6xHis-tagged eIF6 was purified by Ni-NTA (GE

Healthcare) affinity chromatography. The coding sequence for human EFL1

(NP_078856) was PCR-amplified (from clone IMAGE:100016131) and cloned into

13

pYES2 to generate plasmid pEFL1.1 that encodes a C-terminal 6xHis-tagged EFL1.

Plasmid pEFL1.1 was transformed into yeast strain BCY123 (provided by A.

Newman) and EFL1 protein expression induced with 2% (w/v) galactose. EFL1

protein was purified using Ni-NTA (GE Healthcare) affinity chromatography and a

Hiload 26/60 Superdex 200 column (GE Healthcare). The coding sequence for human

SBDS (NP_057122) was amplified by RT-PCR from human skeletal muscle RNA

(Clontech) and cloned into a modified pRSETA vector (Invitrogen) to generate

plasmid pSBDS that encodes SBDS fused at the N-terminus to a 6xHis/lipoamyl

domain/thrombin cleavage sequence. SBDS mutants were generated using the

QuickChange kit (Stratagene). pSBDS was transformed into E. coli C41(DE3) cells

and SBDS protein purified by Ni-NTA affinity (GE Healthcare) and a Hiload 26/60

Superdex 75 column (GE Healthcare). For all protein preparations, purity was

assessed by SDS-PAGE and the identity of each sample confirmed by mass

spectrometry.

NMR sample preparation

Isotopically labeled (15N,13C) samples were grown in M9 minimal medium

supplemented with vitamin mix, trace elements and the appropriate nitrogen

(15NH4Cl) and carbon (13C-glucose, U-13C6, 99%) sources and purified as described

above. The production of perdeurated samples followed a similar protocol using

2H2O-based M9 medium and deuterated 13C-glucose (U-13C6, 99%; 1,2,3,4,5,6,6-D7,

98%). NMR samples at a concentration of 500 µM were prepared in 25 mM

phosphate buffer, pH 6.5, 150 mM NaCl, 10% 2H2O, 1 mM deuterated DTT (d11),

0.05% (w/v) NaN3 and 0.1 mg/ml Pefabloc (Roche). Analytical ultracentrifugation

analysis confirmed the monomeric state of the protein under NMR conditions.

14

Spectroscopic measurements

Spectra were recorded at 25°C on Bruker Avance or DRX spectrometers equipped

with 5 mm triple resonance inverse cryoprobes. Backbone resonance assignments

were obtained with TROSY-based three-dimensional experiments (HNCA, HNCO,

HN(CO)CA, HBHA(CO)NH, HNCACB, HNCACO) (Wüthrich 1986; Bax 1994) on

[13C,15N,2H]-labeled samples at 700 MHz 1H frequency for the human SBDS protein

and at 750 MHz (European NMR Large-Scale Facility, Utrecht, Holland) for the yeast

SBDS protein. Backbone resonance assignments were confirmed by a HN(CAN)NH

spectra (Weisemann et al. 1993). Side-chain resonance assignments were completed

using two-dimensional 1H,13C-HSQC in 1H2O-based buffer and 100% 2H2O and three-

dimensional HCCH-TOCSY, HCCH-COSY, (H)CC(CO)NH and H(CCCO)NH.

NOESY experiments (two-dimensional 1H, 1H-NOESY, three-dimensional 1H, 1H,15N-

NOESY in 1H2O-based buffer and three-dimensional 1H,1H,13C- and 1H,13C,13C-

NOESY in 100% 2H2O) were recorded at 900 MHz (European NMR Large-Scale

Facility, Utrecht, Holland). The mixing time in all NOESY spectra was 90 ms. 14%

of the Hβ resonances were assigned stereospecifically using an HNHB spectrum. 95%

of valine Hγ and 84% of leucine Hδ resonances were assigned stereospecifically using

a 10% fractionally 13C-labeled sample of human SBDS protein. Spectra were

internally referenced to the 1H2O signal at 4.70 ppm, processed with TopSpin version

2.1 (Bruker), and analyzed with SPARKY (Goddard TD & Kneller DG, SPARKY 3,

University of California, San Francisco).

15

Structure calculation

Structures were calculated using a standard torsion angle dynamics simulated

annealing protocol with the program CNS (Brunger et al. 1998). Intensities of cross-

peaks from within regions of known secondary structures were used for calibration

purposes. Backbone φ and ϕ angular constraints were determined from the HN, Hα,

13Cα, 13Cβ, 13CO and 15N chemical shifts using the program TALOS (Cornilescu et al.

1999). A total of 36 structures out of 50 were accepted where no distance violation

was > 0.3 Å and no angle violations were > 5º. The quality of the structure was

analyzed with Molprobity (Lovell et al. 2003) and PROCHECK (Laskowski et al.

1996).

Backbone relaxation measurements

All relaxation measurements were performed on [2H,15N]-labeled human and yeast

SBDS at 700 MHz and 25°C, using standard Bruker pulse programs. Ten experiments

were recorded to measure 15N R1, with delays of 32, 56, 88, 136, 248, 376, 488, 776,

1384 and 2000 ms. The time courses were acquired in randomized order, and

decaying peak intensities were fit using CurveFit (Arthur G. Palmer, III, 1998). For

{1H}15N-heteronuclear NOE measurements, two pairs of interleaved spectra were

recorded with and without 1H saturation, achieved by applying 120˚ pulse every 5 ms

for 7 s. Back-calculated values for 15N R1 were obtained at 700 MHz and 25°C using

the program HYDRONMR (Garcia de la Torre et al. 2000) and the human SBDS

coordinate file.

Antibodies

16

Rabbit polyclonal antibodies were raised against human SBDS (amino acids 236-250)

and human EFL1 (residues 1106-1120) and affinity purified. Other antibodies used

for immunoblotting were anti-Rps14 (Aviva Systems Biology, #ARP40321), anti-

Rpl28 (ProteinTech Group, #16649), anti-eIF6 (Sigma, #GW22375), anti-Nmd3

(ProteinTech Group, #16060), anti-Ebp1 (ProteinTech Group, #ab33613), anti-Nog1

(ProteinTech Group, #13897), anti-Npm (Abcam, #ab15440), anti-Gapdh (Sigma,

#G9545), anti-Histone H3 (Abcam, #ab1791). Antibody to human Lsg1 was a kind

gift from Emmanuel Reynaud, University College Dublin, Ireland. Antibody to

human P0 was a kind gift of Marek Tchórzewski, Maria Curie-Skodowska University,

Lublin, Poland. Secondary HRP-conjugated antibodies were obtained from Sigma.

Peptide separation, mass spectrometry and database analysis

Digested peptide mixtures were subjected to LC-MS/MS using an LTQ Velos-

Orbitrap MS (Thermo) coupled to a Ultimate RSLCnano-LC system (Dionex) fitted

with an Acclaim PepMap 100 column (C18, 3 µm, 100 Å) (Dionex) with an internal

diameter of 75 µm and capillary length of 25 cm. A flow rate of 350 nL/min was used

with a solvent gradient of 5% B to 50% B in 57 min. Solvent A was 0.1% (v/v)

formic acid and aqueous 80% (v/v) acetonitrile in 0.1% (v/v) formic acid was used as

solvent B. The mass spectrometer was operated using an Nth order double play

method to automatically switch between Orbitrap-MS and LTQ Velos-MS/MS

acquisition. Survey full scan MS spectra (from m/z 400 to 1600) were acquired in the

Orbitrap with resolution R= 60,000 at m/z 400 (after accumulation to a target of

1,000,000 charges in the LTQ). The method used allowed sequential isolation of the

20 most intense ions for fragmentation in the linear ion trap, depending on signal

intensity, using CID at a target value of 5,000 charges. For accurate mass

17

measurements the lock mass option was enabled in MS mode and the

polydimethylcyclosiloxane (PCM) ions generated in the electrospray process from

ambient air were used for internal recalibration during the analysis. Target ions

already selected for MS/MS were dynamically excluded for 60 s. General mass

spectrometry conditions were: electrospray voltage, 1.76 kV with no sheath or

auxiliary gas flow, an ion selection threshold of 1000 counts for MS/MS, an

activation Q-value of 0.25, activation time of 30 ms, capillary temperature of 250°C

and an S-Lens RF level of 60% were also applied for MS/MS. Raw files were

processed using Proteome Discoverer v.1.1 (Thermo). Processed files were searched

against the SwissProt mouse database using the Mascot search engine version 2.3.0.

Possible structure modifications allowed were carbamidomethyl cysteine as a fixed

modification. Oxidized methionine, deamidation of asparagine and glutamine,

phosphorylated serine, threonine and tyrosine were searched as variable

modifications. Searches were done with tryptic specificity allowing up to 2 mis-

cleavages and a tolerance on mass measurement of 7 ppm in MS mode and 0.6 Da for

MS/MS ions. Phosphorylation sites assigned by Mascot were cross-checked against

the fragmentation data in Proteome Discoverer.

18

Supplemental References

Bax, A. 1994. Multidimensional Nuclear-Magnetic-Resonance Methods For Protein

Studies. Current Opinion in Structural Biology 4: 738-744.

Boocock, G.R., Morrison, J.A., Popovic, M., Richards, N., Ellis, L., Durie, P.R., and

Rommens, J.M. 2003. Mutations in SBDS are associated with Shwachman-

Diamond syndrome. Nat Genet 33(1): 97-101.

Brunger, A.T., Adams, P.D., Clore, G.M., DeLano, W.L., Gros, P., Grosse-Kunstleve,

R.W., Jiang, J.S., Kuszewski, J., Nilges, M., Pannu, N.S. et al. 1998.

Crystallography & NMR system: A new software suite for macromolecular

structure determination. Acta Crystallogr D Biol Crystallogr 54(Pt 5): 905-

921.

Cornilescu, G., Delaglio, F., and Bax, A. 1999. Protein backbone angle restraints from

searching a database for chemical shift and sequence homology. J Biomol

NMR 13(3): 289-302.

Costanzo, M., Baryshnikova, A., Bellay, J., Kim, Y., Spear, E.D., Sevier, C.S., Ding,

H., Koh, J.L., Toufighi, K., Mostafavi, S. et al. 2010. The genetic landscape of

a cell. Science 327(5964): 425-431.

Erdos, M., Alapi, K., Balogh, I., Oroszlan, G., Rakoczi, E., Sumegi, J., and Marodi, L.

2006. Severe Shwachman-Diamond syndrome phenotype caused by

compound heterozygous missense mutations in the SBDS gene. Exp Hematol

34(11): 1517-1521.

Garcia de la Torre, J., Huertas, M.L., and Carrasco, B. 2000. HYDRONMR:

prediction of NMR relaxation of globular proteins from atomic-level

structures and hydrodynamic calculations. J Magn Reson 147(1): 138-146.

19

Kuijpers, T.W., Alders, M., Tool, A.T., Mellink, C., Roos, D., and Hennekam, R.C.

2005. Hematologic abnormalities in Shwachman Diamond syndrome: lack of

genotype-phenotype relationship. Blood 106(1): 356-361.

Laskowski, R.A., Rullmannn, J.A., MacArthur, M.W., Kaptein, R., and Thornton,

J.M. 1996. AQUA and PROCHECK-NMR: programs for checking the quality

of protein structures solved by NMR. J Biomol NMR 8(4): 477-486.

Lovell, S.C., Davis, I.W., Arendall, W.B., 3rd, de Bakker, P.I., Word, J.M., Prisant,

M.G., Richardson, J.S., and Richardson, D.C. 2003. Structure validation by

Calpha geometry: phi,psi and Cbeta deviation. Proteins 50(3): 437-450.

Makitie, O., Ellis, L., Durie, P.R., Morrison, J.A., Sochett, E.B., Rommens, J.M., and

Cole, W.G. 2004. Skeletal phenotype in patients with Shwachman-Diamond

syndrome and mutations in SBDS. Clin Genet 65(2): 101-112.

Nakashima, E., Mabuchi, A., Makita, Y., Masuno, M., Ohashi, H., Nishimura, G., and

Ikegawa, S. 2004. Novel SBDS mutations caused by gene conversion in

Japanese patients with Shwachman-Diamond syndrome. Hum Genet 114(4):

345-348.

Nicolis, E., Bonizzato, A., Assael, B.M., and Cipolli, M. 2005. Identification of novel

mutations in patients with Shwachman-Diamond syndrome. Hum Mutat 25(4):

410.

Shammas, C., Menne, T.F., Hilcenko, C., Michell, S.R., Goyenechea, B., Boocock,

G.R., Durie, P.R., Rommens, J.M., and Warren, A.J. 2005. Structural and

mutational analysis of the SBDS protein family. Insight into the leukemia-

associated Shwachman-Diamond Syndrome. J Biol Chem 280(19): 19221-

19229.

20

Weisemann, R., Ruterjans, H., and Bermel, W. 1993. 3D triple-resonance NMR

techniques for the sequential assignment of NH and 15N resonances in 15N-

and 13C-labelled proteins. J Biomol NMR 3(1): 113-120.

Wüthrich, K. 1986. NMR of Proteins and Nucleic Acid. Wiley, J., New York.