FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world...
-
Upload
beverley-neal -
Category
Documents
-
view
214 -
download
0
Transcript of FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world...
![Page 1: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/1.jpg)
FilmArray: Automated PCR
![Page 2: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/2.jpg)
Genetics In the Real World
How are genetics used in real world applications?
What can an undergrad student do with knowledge gained from Biology?
![Page 3: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/3.jpg)
PCR: A Quick Review
Polymerase Chain reaction:Quiz: what do you know?
![Page 4: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/4.jpg)
Components of PCR
AGGTGTCCGCGATAGACGATAGCGAGTAGCAGAGGTTTAGA
3’ 5’Template DNA
TCCACAGGCGCTATCTGCT AT C
Primer
A
AA
T
T
T
5’ 3’
C
C
C
C
G
G
G
Free nucleotides
C
G
Taq polymerase
Buffers
![Page 5: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/5.jpg)
PCR Process
-Heat denatures template strand
-Forward and reverse primers are annealed to single stranded DNA
-Taq polymerizes dNTP’s to elongate the replicated strand.
![Page 6: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/6.jpg)
PCR Amplification
Original DNA Copy
5 cycles of PCR amplify 1 copy into 32………and so on
![Page 7: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/7.jpg)
Instruments for Viewing PCR Results
•Gel Electrophoresis and Camera image of agarose gel
![Page 8: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/8.jpg)
PCR in the Classroom
How long does PCR take?
![Page 9: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/9.jpg)
Improving the Process: PCR today
New Concepts Biotechnology industry utilizes
many new improvements in conducting and analyzing the PCR process
![Page 10: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/10.jpg)
Fluorescent DNA: DNA Binding Molecules
Fluorescent molecules that bind to double stranded DNA help make it visible. Works like ethidium bromide in gel electrophoresis
CGTTAGCACAGTACAGACGCAATCGTGTCATGTCTG
+
CGTTAGCACAGTACAGACGCAATCGTGTCATGTCTG
=
![Page 11: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/11.jpg)
Visible RealmGreater Than 10 Billion Copies
Camera Records a Fluorescent Image Every Cycle
PCR Cycle 1 5 10 15 20 25 30 40
Num
ber of DN
A C
opies
![Page 12: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/12.jpg)
Real-Time PCR
Uses a camera and
Software to plot
fluorescence during PCR
![Page 13: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/13.jpg)
Nested PCR Nested reaction includes:
1. outer PCR (PCR1)2. dilution3. inner PCR (PCR2)
*allows for more specific amplification of selected organisms
![Page 14: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/14.jpg)
Nested RT-PCR Primer Designs
Outer RT-PCR
Inner PCR
200bp
90bp
Virus Genome
![Page 15: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/15.jpg)
Multiplex Assays
Uses multiple primers in one reaction to amplify several different DNA templates present in a sample
i.e.: clinical sample run on a panel of 20 organisms to determine presence ofinfection
![Page 16: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/16.jpg)
Schematic of Nested Multiplex PCR
Secondary PCR
Dilute 100 fold
1F 1R
2R
3R
5R
6R
3F
2F
6F
4F
5F
4R
Primary RT-PCR
![Page 17: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/17.jpg)
Primer Design
Primer of 17 base pairs has 1 in 10 billion chance of laying down on human genome. Design never goes below 17 bp (usually 18-20bp)
AGGTGTCCGCGATAGACGATAGCGAGTAGCAGAGGTTTAGA
AGGCGCTATCTGCT ATC
5’ 3’
3’ 5
![Page 18: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/18.jpg)
Our Project: FilmArray
![Page 19: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/19.jpg)
Collaboration
Chemists: PCR reactions occurring in the pouch
Engineers: Pouch development and Instrument development
Software: Communication from instrument to computer, analysis of data
Film Array instrument allows for automated PCR with results in approximately 1 hour
![Page 20: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/20.jpg)
FilmArray Pouch Cell
LysisPCR1
PCR2MagBead
Capture
DiluteWash
Pouch substitutes pipettes and tubes for mixing
substitutes chemist on a bench-top
FLASH ANIMATION
![Page 21: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/21.jpg)
FilmArray Beta Prototype
Substitutes mechanical actions of chemist and bench-top instruments (bead whacker=vortex, mag. beads and blisters=filter tubes and centrifuge, peltier=thermo block, array=DNA detection
![Page 22: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/22.jpg)
Run Protocol
1st PCR
DNA Melt
2nd PCR
There are two Peltier Thermocyclers
The software displays the temperature during each PCR and the melt
Green indicates camera acquisitions:
Once per PCR2 cycle 2500 in the 5 min
melt
![Page 23: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/23.jpg)
Example of Results
Software makes call, positive or negative result
2nd PCR Post PCR Melt
PCR1 Control PCR2 Control Sc DNA assay Sc RNA assay
Sp DNA AssaySp RNA Assay
![Page 24: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/24.jpg)
Film Array Utilizes
Faster Process Sample utilization: 120 1uL
reactions = 1/10 price Pre amplification (PCR 1=
enrichment) amplifies enough to cover entire array every well
Some micro-array processes have difficulty having enough sample for every well
![Page 25: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/25.jpg)
Risks of PCR
Contamination is a HUGE risk factor Nesting not to popular because of
how easily you can contaminate your assays
False positives look the same as true positives
The pouch is an all enclosed environment that eliminates the risk of contamination
![Page 26: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/26.jpg)
Reagent Lyophilization
All reagents in the pouch or lyophilized (freeze dried) so all that is needed is water
Freeze Dried reagents can have a shelf life of approximately 1 year
Wet Bench Top reagents have short shelf life
Proteins are protected with “cake” so they don’t die
![Page 27: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/27.jpg)
Film Array Applications: Projects Under Development
Respiratory Panel: Clinical Samples Febrile Infant Risk Stratification Tool
(FIRST): bacterial identification for infant fever
Biothreat Pouch:Department of Defense
Methicillin Resistant Staph. aureus detection:characterizing outbreaks of Staph infection in the hospital and community
Tuberculosis Screening
![Page 28: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/28.jpg)
Respiratory Panel
Resp. Panel screens samples for 16 viruses or bacteria in 1 hour
PIV1 HNPIV2 FGPIV3 FGPIV4 FGFluB HARSV MGFluA MA Pan
HA H3HA H5HA H5NA N1NA N2
Adenovirus HexEnterovirus 3' UTR HRV
Coronavirus Pol 229ENG 229EPol OC43NG OC43Pol HKU1NG HKU1Pol NL63NG NL63NG SARSPL SARS
hMPV NGPol
Bocavirus NP-1NS-1
B. pertutsis ToxinM. pneumoniae gyrBM. pneumoniae ToxinC. pneumoniae gyrBOut control AtD08Dilution cont AtR04PCR2 Control AtR04RNA Process SpR05DNA Process SpD02
![Page 29: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/29.jpg)
Micro-array: Automated Pipetting
![Page 30: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/30.jpg)
Spots Primersin specific layout
Film Array 1 2 3 4 5 6 7 8 9 10
a rpoB1Spne AtR04 FluAN1NA05 RSVMG0 FluBHA01 AtD02
b FluAH3Ha04 AdHex-iF1R1 ScD05 AtD08 AdHex-iF2R1
c PIV3FG01 FluBHA01 AdHex-iF1R2 gyrB3Mpne PIV1HN01 ScD05
d AdHex-iF2R2 rpoB1Spyo FluANaN206 RSVMG0 gyrB3Mpne
e FluAHA1 AdHex-iF2R1 PIV1HN01 PIV2FG02 CoVOC43NG07 FluAHA1 AdHex-iF1R1f ScR03 AtD08 PIV2FG02 AtD08 AtD02 AdHex-iF2R2 AtD08 FluAH3Ha04 rpoB1Spne
g PIV1HN01 FluANaN206 ScD05 FluAN1NA05 rpoB1Spne CoV229EPL01 PIV3FG01
h AdHex-iF1R1 FluAH3Ha04 RSVMG0 FluBHA01 ScR03 FluAHA1 CoV229EPL01 AdHex-iF2R1 PIV2FG02
I CoV229EPL01 ScD05 rpoB1Spne AdHex-iF2R2 AdHex-iF1R2 ScR03 PIV3FG01 AtR04 ScR03
j rpoB1Spyo gyrB3Mpne PIV3FG01 rpoB1Spyo AtR04 PIV2FG02 RSVMG0 FluAN1NA05 FluANaN206
k AdHex-iF2R2CoVOC43NG07 PIV1HN01 AtR04 CoVOC43NG07 FluAN1NA05 gyrB3Mpne CoV229EPL01 AdHex-iF1R2 rpoB1Spyo
l AtD02 AdHex-iF1R2 FluAHA1 AdHex-iF1R1 FluANaN206 AdHex-iF2R1 CoVOC43NG07 FluAH3Ha04 FluBHA01 AtD02
![Page 31: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/31.jpg)
Kody (BioChemistry Intern)
Pouch Production Freeze Dry Reagents Reagent QC Primer Validation and Tracking Assay Optimization Pouch/Protocol Optimization Build and Update Database
![Page 32: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/32.jpg)
Meghan (Research Associate I)
NanoPlotter validation and QC Film Array instrument optimization Assist with pouch production
![Page 33: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/33.jpg)
Idaho Technology Broad range of projects Great experience, resume builder Offers career opportunities,
internships, and benefitsVisit:http://www.idahotech.com/work_with_us/
Join the ITI Team
![Page 34: FilmArray: Automated PCR. Genetics In the Real World How are genetics used in real world applications? What can an undergrad student do with knowledge.](https://reader035.fdocuments.in/reader035/viewer/2022070323/56649dc65503460f94ab9c5d/html5/thumbnails/34.jpg)
Questions?