Figure S1 Figure S1. Infection with fluorescently tagged S. marcescens establish an infection in the flys intestine. To show that oral infection by feeding was efficient, we used the S. marcescens Db11-GFP strain (gift from D. Ferrandon, IBMC, Strasbourg, France) to show ingestion and localization of the bacteria in the intestinal lumen. (A) A dissected midgut after 24 hours of oral infection with Db11-GFP. (B) Enlargement of the anterior region. The white lined area corresponds to the luminal space of the intestinal canal. The white narrows mark the ingested fluorescent bacteria. Figure S2 Figure S2. To evaluate the concentration-dependency of Serratia-induced transcription factor translocation, standardized experiments employing different bacterial concentration were used for infection. Transcription factor reporter lines were used and different bacterial concentrations were used. From top to bottom the different infection conditions are represented, ranging from OD 600 =0.5 [D, E, F] up to OD 600 =50 [S, T, U], all compared to control conditions by ingestion of 5% sucrose only [A, B, C]. The left column [A, D, G, J, M, P, S] shows Dorsal (NP1-Gal4>pUAST-EGFP-dorsal). In the middle column the Imd-dependent transcription factor Relish (NP1-Gal4>pUAST-EYFP-relish) is shown [B, E, H, K, N, Q, T]. Here, in E the copper cell region is shown. There was no translocation in the enterocytes at all, but we first recognized the translocation to the copper cells by an infection with OD 600 =1. Right figures [C, F, I, L, O, R, U] show translocation of TF dfoxO (NP1-Gal4>pUAST-foxO-GFP). Translocation of FoxO starts at low concentrations (OD = 1). Scale bar is 20 m. Fly strains pUAST-EYFP-relish (Tony Ip, Massachusetts) pUAST-EGFP-dorsal (Tony Ip, Massachusetts) pUAST foxo GFP (selfmade, Tina) NP1-GAL4 (D. Ferrandon, Straburg) Figure S2 Figure S3 2 h -Relish-dFoxO DAPI 4 h 6 h 8 h DAPI C BBBB D D D C C C D E E EE G AAAA 0 h 8 h F F FF Figure S3 Figure S3. Time-course of the Infection-dependent translocation of dFoxO and Relish in enterocytes (ECs). To show that the translocation of FoxO in response to an infection (and the lack of translocation of Relish) is no artifact of the indicator lines used, we performed time-course experiments employing immunohistochemistry. In these time course experiment flies from the wild type strain w 1118 were infected with pathogenic bacteria (S. marcescens Db11) for 2 h [B], 4 h [C], 6 h [D], and 8 h [E]. Controls were only fed with 5% sucrose [A]. The images are representative for enterocytes of the anterior midgut. Nuclei were stained with Hoechst (blue) [A-G]. Antibody-staining was like followed: -Relish (red) [A-G] and -dFoxO (green) [A-G]. The co-localization of all staining is represented in [A-G]. Relish is not detectable in the nuclei of the enterocyte at any time point of the experiment. dFoxO instead shows nuclear translocation after a 8 h infection period [E]. At higher magnification, this becomes more obvious [G]. Scalebar is 20 m. Figure S4. Relative expression levels of FoxO target genes. To compare the gene expression after oral infection in wildtype w 1118 and foxo-impaired foxo 21/21 depicted in figure 1, we here investigated the inducible expression of the same target genes by constitutive overexpression of foxo in enterocytes (NP1-Gal4 X UAS-foxo, grey bars; control, black bars). n = 5 for both conditions, statistical analysis was performed with the Mann-Whitney test. Asteriks label statistically significant differences to matching controls (p50) Median life span (d) Decrease in Median life span (% of control) Chi- Square (2) p-value w w dFoxO-KO < dFoxO-KO +11 IMD-KO < IMD-KO +16 w < w dFoxO-KO < dFoxO-KO +12 IMD-KO < IMD-KO +2.5 Data derived from log rank analysis of the survival curves shown in Fig. 4. Log rank test was performed using GraphPad Prism Experiments shown are representatives of four independent experiments., each with 10 flies per vial. Supplemental materials Infection by feeding For the concentration-dependent infection experiments (Figure S3), Serratia marcescens culture we serially diluted to the initial concentration of OD 600 =50 with a sterile sucrose solution (5 %) and to the final concentrations with the following ODs: OD 600 =50, OD 600 =25, OD 600 =10, OD 600 =5, OD 600 =5, OD 600 =1, OD 600 =0.5. The bacterial/sucrose solution contained 1 % E133 brilliant blue food coloring dye. One absorbent filter (37mm; Millipore) was placed into a fly culture tubes and soaked with 350 l of the S. marcescens sucrose solution. The flies were then transferred to these infectious vials for 24 hours at 29C in a bench incubator with 12/12 h day-night-rhythm. The intestines were dissected in PBS buffer and then mounted in Roti-Mount FluorCare DAPI (Carl Roth GmbH & Co. KG, Karlsruhe, Germany). Images were captured with the Imager.Z1 equipped with an Apotome (Zeiss, Gttingen, Germany). Immunohistochemistry Immunohistochemistry for Relish and FoxO was performed using standard protocols and anti-Relish (21F3, DSHB, Iowa, USA) as well as anti-FoxO (Cosmo Bio, Cologne, Germany) antibodies. DyLight 549 Goat anti mouse and DyLight 488 donkey anti rabbit antibodies (Jackson Immuno Research, Hamburg, Germany) were used as secondary antibodies. Oligonucleotide sequences rpL32 sense CCGCTTCAAGGGACAGTATC antisense GACAATCTCCTTGCGCTTCT pgrp-Sc2 sense AACTACCTGAGCTACGCCGTG. antisense AGCAGAGGTGAGGGTGTTGGT thor sense CTCCTGGAGGCACCAAACTT. antisense GAGTTCCCCTCAGCAAGCAA upd3 sense GAGAACACCTGCAATCTGAA antisense AGAGTCTTGGTGCTCACTGT attB sense ACAATCTGGATGCCAAGGTC antisense TGTCCGTTGATGTGGGAGTA attD sense AGTGGGGGTCACTAGGGTTC antisense AGGTGATGATTGGCACTTCC lip4 sense TTCTGATGCAGGGATTGGCA antisense GGGGTAACTTACGCTCACCG attacin A sense CAATCTGGATGCCAAGGTCT - antisense TCCCGTGAGATCCAAGGTAG defensin sense GCTATCGCTTTTGCTCTGCT - antisense GCCGCCTTTGAACCCCTTGG diptericin sense GCAATCGCTTCTACTTTGGC - antisense TAGGTGCTTCCCACTTTCCA drosomycin sense ACCAAGCTCCGTGAGAACCTT -antisense TTGTATCTTCCGGACAGGCAG cecropin C sense AAGATCTTCGTTTTCGTCGC - antisense GTTGCGCAATTCCCAGTC metchnikowin sense CCACCGAGCTAAGATGCAA - antisense AATAAATTGGACCCGGTCTTG drosocin sense GTTCACCATCGTTTTCCTGC - antisense GGCAGCTTGAGTCAGGTGAT PGRP-LE sense ACGAGCCACTGCCCTTGCAAC - antisense AGTCTTACGTTGATCGCCCGC foxo sense GCATGCACAATGCAAGAGAT - antisense GCCTCGTTATTGAGCACCTC