Figure S1nizetlab.ucsd.edu/Publications/HIF-UPEC-Suppl.pdf · 2015. 4. 30. · Figure S1! Figure...

8
Figure S1

Transcript of Figure S1nizetlab.ucsd.edu/Publications/HIF-UPEC-Suppl.pdf · 2015. 4. 30. · Figure S1! Figure...

Page 1: Figure S1nizetlab.ucsd.edu/Publications/HIF-UPEC-Suppl.pdf · 2015. 4. 30. · Figure S1! Figure S2! Figure S3! Figure S4! Figure S5! Figure S6! Figure S7! 2.0 - 25 0.5 o UT189 Infection

Figure S1!

Page 2: Figure S1nizetlab.ucsd.edu/Publications/HIF-UPEC-Suppl.pdf · 2015. 4. 30. · Figure S1! Figure S2! Figure S3! Figure S4! Figure S5! Figure S6! Figure S7! 2.0 - 25 0.5 o UT189 Infection

Figure S2!

Page 3: Figure S1nizetlab.ucsd.edu/Publications/HIF-UPEC-Suppl.pdf · 2015. 4. 30. · Figure S1! Figure S2! Figure S3! Figure S4! Figure S5! Figure S6! Figure S7! 2.0 - 25 0.5 o UT189 Infection

Figure S3!

Page 4: Figure S1nizetlab.ucsd.edu/Publications/HIF-UPEC-Suppl.pdf · 2015. 4. 30. · Figure S1! Figure S2! Figure S3! Figure S4! Figure S5! Figure S6! Figure S7! 2.0 - 25 0.5 o UT189 Infection

Figure S4!

Page 5: Figure S1nizetlab.ucsd.edu/Publications/HIF-UPEC-Suppl.pdf · 2015. 4. 30. · Figure S1! Figure S2! Figure S3! Figure S4! Figure S5! Figure S6! Figure S7! 2.0 - 25 0.5 o UT189 Infection

Figure S5!

Page 6: Figure S1nizetlab.ucsd.edu/Publications/HIF-UPEC-Suppl.pdf · 2015. 4. 30. · Figure S1! Figure S2! Figure S3! Figure S4! Figure S5! Figure S6! Figure S7! 2.0 - 25 0.5 o UT189 Infection

Figure S6!

Page 7: Figure S1nizetlab.ucsd.edu/Publications/HIF-UPEC-Suppl.pdf · 2015. 4. 30. · Figure S1! Figure S2! Figure S3! Figure S4! Figure S5! Figure S6! Figure S7! 2.0 - 25 0.5 o UT189 Infection

Figure S7!

Page 8: Figure S1nizetlab.ucsd.edu/Publications/HIF-UPEC-Suppl.pdf · 2015. 4. 30. · Figure S1! Figure S2! Figure S3! Figure S4! Figure S5! Figure S6! Figure S7! 2.0 - 25 0.5 o UT189 Infection

Supplementary Information - University of Nottinghameprints.nottingham.ac.uk/32631/2/Jackson Thorax 2016 suppl.pdf · Kalsheker13, Sally Chappell13, Tamar Guetta-Baranes13, Tricia

Supplementary Information - University of Nottinghameprints.nottingham.ac.uk/32631/2/Jackson Thorax 2016 suppl.pdf · Kalsheker13, Sally Chappell13, Tamar Guetta-Baranes13, Tricia

UPEC 2016 – Conference Programme

UPEC 2016 – Conference Programme

UPEC Biofilm Factors

UPEC Biofilm Factors

Supplemental Materials for: Fibrocyte-like cells recruited ...nizetlab.ucsd.edu/Publications/Fibrocytes-JMM-Suppl.pdf · gr-1 gcagtgctacgagtgctatgg actgacgggtctttagtttcctt haptoglobin

Supplemental Materials for: Fibrocyte-like cells recruited ...nizetlab.ucsd.edu/Publications/Fibrocytes-JMM-Suppl.pdf · gr-1 gcagtgctacgagtgctatgg actgacgggtctttagtttcctt haptoglobin

Biopolitics, Governmentality, (security) Dispositifs. · Biopolitics, Governmentality, (security) Dispositifs. ... Frédéric Gros (UPEC) International Conference IRI/PUC-Rio (Brasil)

Biopolitics, Governmentality, (security) Dispositifs. · Biopolitics, Governmentality, (security) Dispositifs. ... Frédéric Gros (UPEC) International Conference IRI/PUC-Rio (Brasil)

Why QB UPEC I CHOOSE QB UPEC! INTERNATIONAL · obtention of the certificate and its publication on the website evaluation.cstb.fr. If a product no longer has the specified characteristics,

Why QB UPEC I CHOOSE QB UPEC! INTERNATIONAL · obtention of the certificate and its publication on the website evaluation.cstb.fr. If a product no longer has the specified characteristics,

UPEC 2020 SessionsEventsupec2020.polito.it/wp-content/uploads/2020/08/UPEC_2020_SessionsEvents.pdf2 Hour (CEST) Monday 31.08.2020 Tuesday 01.09.2020 Wednesday 02.0 9.2020 Thursday

UPEC 2020 SessionsEventsupec2020.polito.it/wp-content/uploads/2020/08/UPEC_2020_SessionsEvents.pdf2 Hour (CEST) Monday 31.08.2020 Tuesday 01.09.2020 Wednesday 02.0 9.2020 Thursday

UPEC 2018 TS 6 - 2 Abdullah PETRONAS Rev 3 FINALicep.com.my/.../uploads/2018/12/UPEC-2018-TS-6-2-AbdullahPETRO… · ,qwurgxfwlrq 2iivkruh6hoi5hjxodwlrq 265 riilfldoo\odxqfkhglq zkhuh

UPEC 2018 TS 6 - 2 Abdullah PETRONAS Rev 3 FINALicep.com.my/.../uploads/2018/12/UPEC-2018-TS-6-2-AbdullahPETRO… · ,qwurgxfwlrq 2iivkruh6hoi5hjxodwlrq 265 riilfldoo\odxqfkhglq zkhuh

Beyond Fixed Grid: Learning Geometric Image Representation with a Deformable Gridjungao/def-grid/files/suppl.pdf · 2020. 8. 21. · Beyond Fixed Grid: Learning Geometric Image Representation

Beyond Fixed Grid: Learning Geometric Image Representation with a Deformable Gridjungao/def-grid/files/suppl.pdf · 2020. 8. 21. · Beyond Fixed Grid: Learning Geometric Image Representation

UPEC 2018 TS 5 - 3 Harit- Katrina McDermott FINAL v3icep.com.my/wp-content/uploads/2018/12/UPEC-2018... · Title: Microsoft PowerPoint - UPEC 2018 TS 5 - 3 Harit- Katrina McDermott

UPEC 2018 TS 5 - 3 Harit- Katrina McDermott FINAL v3icep.com.my/wp-content/uploads/2018/12/UPEC-2018... · Title: Microsoft PowerPoint - UPEC 2018 TS 5 - 3 Harit- Katrina McDermott

Virtual Conference UPEC 2021

Virtual Conference UPEC 2021

Resumen - UPEC

Resumen - UPEC

Metabolic Adaptations of Uropathogenic E. coli in the Urinary Tract · 2020-03-09 · Mann et al. Metabolic Adaptations of UPEC FIGURE 1 | UPEC pathogenesis across multiple microenvironments:

Metabolic Adaptations of Uropathogenic E. coli in the Urinary Tract · 2020-03-09 · Mann et al. Metabolic Adaptations of UPEC FIGURE 1 | UPEC pathogenesis across multiple microenvironments:

ELECTION COLLEGE F - UPEC

ELECTION COLLEGE F - UPEC

E-Table 1. Properties of the investigated catheters ...rc.rcjournal.com/highwire/filestream/11981/field_highwire_adjunct_files/0/suppl.pdf · Comparison of compliance measurements

E-Table 1. Properties of the investigated catheters ...rc.rcjournal.com/highwire/filestream/11981/field_highwire_adjunct_files/0/suppl.pdf · Comparison of compliance measurements

A bacterial gene-drive system efficiently edits and ...nizetlab.ucsd.edu/Publications/Pro-AG-Suppl.pdf · Supplementary Fig. 2 Escherichia coli MG1655 colony counts and cell density

A bacterial gene-drive system efficiently edits and ...nizetlab.ucsd.edu/Publications/Pro-AG-Suppl.pdf · Supplementary Fig. 2 Escherichia coli MG1655 colony counts and cell density

'Universities Power Engineering Conference (UPEC) ; … AVariableSpeedPermanentMagnet,Wind-TurbineGeneratorandits Control ZChen,ESpooner-University ofDurham,UK 431 Experimental Study

'Universities Power Engineering Conference (UPEC) ; … AVariableSpeedPermanentMagnet,Wind-TurbineGeneratorandits Control ZChen,ESpooner-University ofDurham,UK 431 Experimental Study

Upec rapport de_stage_zegowitz

Upec rapport de_stage_zegowitz

Virtual Conference UPEC 2020

Virtual Conference UPEC 2020

Combating Poverty, Promoting Fellowship - Union …uprr/@employee/@upec/documents/up_pdf...Combating Poverty, Promoting Fellowship ... sized toiletries, including soap, shampoo, lotion,

Combating Poverty, Promoting Fellowship - Union …uprr/@employee/@upec/documents/up_pdf...Combating Poverty, Promoting Fellowship ... sized toiletries, including soap, shampoo, lotion,