Fibronectin's 111-1 Module Contains a Conformation-dependent ...

T H E JO~TRNAL OF BIOUGICA~ CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 269, No. 29, Issue of July 22, pp. 19183-19191, 1994 Printed in U.S.A.

Fibronectin’s 111-1 Module Contains a Conformation-dependent Binding Site for the Amino-terminal Region of Fibronectin*

(Received for publication, December 10, 1993, and in revised form, May 12, 1994)

Denise C. Hocking, Jane Sottile, and Paula J. McKeown-LongoS From the Department of Physiology and Cell Biology, Albany Medical College, Albany, New York 12208

Cultured fibroblasts express binding sites for the amino-terminal region of fibronectin on their cell surface that mediate the assembly of soluble fibronectin into disulfide-stabilized fibrils. These binding sites have been termed matrix assembly sites and have been stud- ied in binding assays using a ‘261-labeled 70-kDa fragment derived from the amino terminus of fibronectin. In an attempt to isolate the protein(s) responsible for binding the 70-kDa fragment, cell surface proteins were cleaved from fibroblast monolayers by mild trypsinization. Trypsinization of monolayers generated a series of fibronectin fragments that bound the ‘%labeled 70-kDa fragment by ligand blot assay and affinity chromatography. AU of the fibronectin fragments that bound the 70- kDa fragment contained the 111-1 module. In solid phase binding assays, the ‘261-labeled 70-kDa fragment bound preferentially to reduced fibronectin as compared with unreduced fibronectin fragments. Binding of the ‘“I-labeled 70-kDa fragment to reduced fibronectin was inhibited by a monoclonal antibody directed against the 111-1 domain. Isolated III-1, however, did not bind the 1z61- labeled 70-kDa fragment when adsorbed to plastic tissue culture wells. Heat denaturation of 111-1 prior to adsorption conferred 70-kDa fragment binding properties on the isolated module. The laaI-labeled 70-kDa fragment did not bind to heat-denatured 111-2, suggesting that 70- kDa fragment binding was a property of the 111-1 module and not a general characteristic of all type I11 modules. The binding of ‘asI-labeled 70-kDa fragment to 111-1 was of high affinity (K, = 1.8 x M). These results indicate that a binding site for the 70-kDa amino terminus of fibronectin is contained within a cryptic site found in the first type I11 module of fibronectin. Unfolding of the 111-1 module on the cell surface may control matrix assembly site expression and represent an important step in the initiation of cell-dependent fibronectin polymerization.

Fibronectins are a family of high molecular weight multido- main glycoproteins composed of two structurally similar sub- units that are joined at the carboxyl terminus by disulfide bonds (1). The primary structure of each subunit is organized into three types of repeating homologous units, termed types I, 11, and I11 (1, 2). Twelve type I modules are found grouped at

* This work was supported by Grants Pol-GM-40761, HL-21644, T32- GM-07033, and BRSG S07RR05394-31 from the National Institutes of Health and Grant 93-0236B from the American Heart Association. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “adver- tisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

and Cell Biology, Neil Hellman Medical Research Bldg., Albany Medical $ To whom correspondence should be addressed: Dept. of Physiology

College, 47 New Scotland Ave., Albany, New York 12208. %I.: 518-262- 5666; Fax: 518-262-5669.

the amino- and carboxyl-terminal regions, and two type I1 modules are located within the gelatin-binding region. Fifteen to seventeen type I11 modules are contained within the middle of the molecule and comprise 60% of fibronectin’s sequence (1,2). The highly modular nature of fibronectin has lent itself to structure-function studies that utilize limited proteolysis of fibronectin to release functional domains (3). Fibronectin has been shown to contain multiple binding sites, including those for sulfated glycosaminoglycans, gelatin, fibrin, and cell surface integrin receptors (2, 4, 5). These binding activities have been localized to either distinct modules or to groups of modules that together form larger functional domains (6).

Fibronectin is found in two forms, (i) as a soluble, protomeric molecule that circulates at high concentrations in the blood, various body fluids and in the conditioned media of cultured cells and (ii) as an insoluble, multimeric form found in the fibrillar network that exists within the extracellular spaces of connective tissue, basement membranes, and cultured cells (1). The multimeric form of fibronectin functions in a variety of biological events including cell attachment and proliferation, cell migration during embryogenesis, wound repair, and dis- ease pathogenesis (1). Fibrillar fibronectin may be derived from either endogenously synthesized cellular fibronectin or from circulating plasma fibronectin (7-10). The mechanism by which soluble fibronectin is converted to the insoluble form, however, is only partially understood.

Polymerization of soluble fibronectin into fibrils is a multi- step process that occurs at the cell surface of substrate-attached cells (6). Cell surfaces bind the amino-terminal region of fibronectin in a reversible and saturable manner (11, 12). This binding is mediated by the first five type I repeats, which ap- pear to function as a single binding unit (13). Fibronectin fragments and recombinant constructs missing the amino-terminal region are not assembled into fibrillar matrix (11, 13, 14). In addition, the presence of excess amounts of amino-terminal fibronectin fragment blocks the binding of intact fibronectin to cell surfaces and inhibits matrix assembly (11). The site on the cell surface that binds the amino-terminal fragment of fibronectin has been defined operationally by ligand binding assays using either ‘251-labeled 70- or 27-kDa amino-terminal fragments of fibronectin (11,121. These binding sites have been termed matrix assembly sites, and their activity may be regulated by the asp1 integrin receptor for fibronectin (15). A third region of fibronectin, composed of modules 1-9 and 111-1, appears to be involved in fibronectin-fibronectin interactions (16- 18). Antibodies directed against this region inhibit fibronectin matrix assembly (16), and a peptide sequence from within this region binds to fibronectin (18) and promotes fibronectin self- polymerization (17). The complementary site on fibronectin that binds to the 111-1 module has not been identified. Also, the molecule that mediates binding of the amino terminus of fibronectin to the cell surface during matrix assembly has not yet been identified. The present study was undertaken to identify the molecule on the cell surface that binds the amino-terminal

19183

19184 Fibronectin's Amino Terminus Binds to III-1 70-kDa fragment of fibronectin. The results indicate that the 111-1 module of fibronectin contains a cryptic site that binds the amino-terminal 70-kDa fragment of fibronectin. The impor- tance of this cryptic site in the matrix assembly process is discussed.

MATERIALS AND METHODS Reagents-Materials for autoradiography were from Eastman Kodak

Co. Gel electrophoresis supplies were from Bio-Rad. Unless otherwise indicated, chemical reagents were obtained from Sigma.

Cell Culture-Human foreskin fibroblasts (Al-F) were a gift from Dr. Lynn Allen-Hoffmann (University of Wisconsin, Madison, WI). The cells were cultured in Dulbecco's modified Eagle's medium (DMEM)' (Life Technologies, Inc.) supplemented with 10% fetal bovine serum (Sterile Systems, Logan, UT). Fibroblasts were plated in 75-cm2 flasks and 820-cm2 roller bottles (Becton Dickinson Labware, Franklin Lakes, NJ) at 5 x 10' celldflask and 5 x lo6 cells/roller bottle and reached conflu- ence within 5-7 days of seeding.

Preparation of Dypsinized Cell Surface Supernatants-Medium from confluent fibroblast monolayers grown in 820-cm2 roller bottles was removed, and the cells were washed extensively with phosphate- buffered saline (PBS), pH 7.2. 0.25% trypsin (Life Technologies, Inc.) was diluted to 1 pg/ml in DMEM, and 2 ml were added to each roller bottle. Cells were incubated for 6 h at 37 "C, after which time the medium was collected. Trypsin activity was inhibited by the addition of 5-fold excess of soybean trypsin inhibitor. Low speed centrifugation was used to remove cellular debris, and the supernatant was assayed im- mediately. For some experiments, trypsinized supernatant was prepared by adding 5 ml of 100 pg/ml trypsin in DMEM to confluent fibroblasts grown in 75-cm2 flasks.

Gel Electrophoresis and Immunoblotting-SDS-polyacrylamide gel electrophoresis (PAGE) was performed according to Laemmli (19) using a discontinuous buffer system (Bio-Rad). Samples were diluted 1:l in gel buffer containing 4% SDS and 20% glycerin in 0.05 M Tris, pH 6.8. Some samples were reduced with 2% P-mercaptoethanol prior to electrophoresis. To visualize proteins, gels were stained with 0.1% Coo- massie Blue in 50% methanol and 10% acetic acid, destained completely using 50% methanol and 10% acetic acid, and then restained with 0.1% silver nitrate (20). For immunoblotting, electrophoretic transfer of proteins to nitrocellulose paper (Schleicher and Schuell) (21) was performed in a Trans-Blot apparatus (Bio-Rad) according to manufacturer's instructions. Following transfer, the nitrocellulose blot was reversibly stained for protein using Ponceau S (22). Blots were incubated with 3% bovine serum albumin (BSA) in Tris-buffered saline (TBS), pH 7.6, containing 0.1% Tween-20 (Bio-Rad) (TBS-T), washed briefly, and immunoblotted with a 1:lOOO dilution of primary antibody followed by a 1:6000 dilution of either goat anti-rabbit or rabbit anti- mouse peroxidase-linked secondary antibody (Bio-Rad). Immunoblots were developed using enhanced chemiluminescence (Amersham Corp.) according to the manufacturer's protocol. Following detection, the immunoblots were stripped in 62.5 mM Tris-HC1, pH 6.7,2% SDS, 100 m~ 2-mercaptoethanol at 50 "C for 30 min as recommended by the manufacturer. Before reprobing, the immunoblots were re-equilibrated in TBS and reblocked with 3% BSA in TBS-T.

Purification of Fibronectin and Fibronectin Fragments-Human fibronectin was isolated from plasma by gelatin affinity chromatography (Pharmacia Biotech Inc.) as previously described (23). Fig. 1 shows a schematic of the various fibronectin fragments used in this study. The 70-kDa amino-terminal fragment of fibronectin was generated by digestion with cathepsin D followed by gelatin affinity chromatography, as previously described (11). To cleave the 70-kDa fragment into the 27-kDa heparin-binding and 40-kDa gelatin-binding fragments, the 70- kDa fragment was incubated with trypsin as previously described (24). The 40-kDa fragment was separated from the 27-kDa fragment by retention on gelatin affinity columns (24). The 60-kDa gelatin-binding fragment was prepared by limited digestion of fibronectin with human leukocyte elastase (Calbiochem) and purified by retention on gelatin- Sepharose followed by anion exchange on DEAE-Sephacel (Pharmacia), according to the procedure of McDonald and Kelley (25). A 14-kDa fragment that contains the 111-1 module was prepared by digestion of the 60-kDa fragment with cathepsin D at a ratio of 125:l (w/w) for 4 h

'The abbreviations used are: DMEM, Dulbecco's modified Eagle's medium; DTT, dithiothreitol; PBS, phosphate-buffered saline; TBS, Tris-buffered saline; TBS-T, Tris-buffered saline-Tween; BSA, bovine serum albumin; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction.

60K I

27K ' 40K

" 70K 120K

I I 160K

I 180K

FIG. 1. Fibronectin fragments. Schematic representation of fibronectin molecule illustrating relative positions of proteolytically derived fibronectin fragments. Shown are the 27-kDa (cathepsin-trypsin, heparin binding), 40-kDa (cathepsin-trypsin, gelatin binding), 60-kDa (elastase, gelatin binding), 70-kDa (cathepsin, amino-terminal), 120- kDa (chymotrypsin, cell binding), and 160/180-kDa (trypsin, gelatin, and cell binding) fragments. Rectangles, type I modules; ouals, type I1 modules; squares, type I11 modules; shaded square, 111-1.

a t 37 "C. The 14-kDa fragment was separated from the 40-kDa gelatin- binding fragment by gelatin-Sepharose. Amino acid sequencing of the

ITETPSQPNSH. This sequence corresponds to a region beginning 8 14-kDa fragment yielded the following amino-terminal sequence:

amino acids into the 111-1 module, starting at amino acid residue Ile586 of the mature protein (2). The 120-kDa cell-binding fragment was prepared by digestion of fibronectin with chymotrypsin at a ratio of 30:l (w/w) for 60 min at 37 "C and was isolated from the unbound fractions of sequential gelatin- and heparin-Sepharose afflnity columns, as described (26). A preparation containing the 160/180-kDa cell- and gelatin-binding fragments was generated by limited digestion with trypsin and isolation by retention on gelatin-Sepharose, as previously described (11). Purity of all fragments was assessed by SDS-PAGE, and fragments were frozen at -80 "C until use.

Preparation of Recombinant 111-1 and 111-2-Recombinant 111-1 was originally made, expressed, and purified in the laboratory of Dr. Deane Mosher at the University of Wisconsin, Madison, WI. Polymerase chain reaction (PCR) was used to amplify human fibronectin cDNA encoding the first type I11 module (111-1) of fibronectin (bases 1745-2032). This DNA encodes amino acids from Ser5'8 through ThP3. Bases are num- bered from the A in the codon for the first amino acid of the mature protein (EMBL accession number X02761), and amino acids are num- bered from the amino-terminal pyroglutamic acid (2). The sense primer, 5'-CCCGGATCCAGTGGTCCTGTCGAAGTATT, was synthesized with a BamHI site (shown in boldface) a t the 5' end, and the antisense primer, 5'-CCCGAA'M'CmATGTGCTGGTGCTGGTGG, was synthesized with an EcoRI site (shown in boldface) a t the 5' end. For the preparation of the recombinant 111-2, PCR was used to amplify human fibronectin cDNA encoding the second type I11 module (111-2) of fibronectin (bases 2078-2347). This DNAencodes amino acids from Serm8 through Thr'". The sense primer, 5'-CCCGGATCCCCTCTTGTGGC- CAC'ITCTGAATC, was synthesized with a BamHI site (shown in boldface) a t the 5' end, and the antisense primer, 5'-CCCGAATTCrnAT- GTTGTTTGTGAAGTAGACAGG, was synthesized with an EcoRI site (shown in boldface) at the 5' end. Underlined bases introduce a stop codon after the last base in the sequence to be amplified. PCR was performed according to established procedures (27) using human full- length fibronectin cDNA, pFHlOO (a gift of Dr. Jean Thiery, Paris, France), as a template. PCR-amplified DNA was sequenced to confirm that no base changes had been introduced during amplification of the DNA (28). Following digestion with EcoRI and BanHI, the PCR-amplified DNA was cloned into the bacterial expression vector pGEX-2T (Pharmacia). Expression in bacteria results in the production of a fusion protein composed of glutathione 5'-transferase and either 111-1 or 111-2. Cleavage of the fusion protein with trypsin results in the separation of glutathione S-transferase from 111-1 or 111-2. This cleavage gives rise to an additional glycine and serine residue at the amino terminus of 111-1. 111-2 contains no additional amino acids.

DNA was transfected into DH5a bacteria using standard procedures (27). An overnight culture of bacteria was inoculated (1:lO) into fresh LB containing 50 pg/ml ampicillin and allowed to grow for 2 h at 37 "C on an orbital shaker. Isopropyl-1-thio-P-D-galactopyranoside was added to a final concentration of 0.1 mM, and the bacteria were incubated for an additional 6 h. Bacteria were harvested, pelleted at low speed in a centrifuge, and then resuspended in TENS buffer (50 mM Tris, pH 7.5, 10% sucrose, 10 m~ EDTA, 150 mM NaCl, 2 mM phenylmethylsulfonyl

Fibronectin's Amino Terminus Binds to 111-1 19185 fluoride). Lysozyme was added to a final concentration of 0.4 mg/ml and incubated for 60 min on ice. This suspension was frozen and thawed three times to lyse the bacteria and then spun for 30 min at 6000 rpm using a Sorvall GS rotor. Triton X-100 was added to the supernatant to a final concentration of 0.5%, and the supernatant was then mixed with 5 ml of glutathione-agarose for 1.5 h at room temperature. The resin was packed into a column and washed with 20 mM phosphate, pH 8.0, containing 15 m~ NaCl. The fusion protein was eluted from the column with 5 mM reduced glutathione in 15 mM NaCl, 20 m~ Tris, pH 8.0. Fractions containing the fusion protein were pooled and digested with trypsin-acrylic beads (10 pg/ml) for 60 min at room temperature to separate the glutathione-S-transferase from recombinant 111-1 (rIII-1) or recombinant 111-2 (r111-2). The digested material was centrifuged to remove the trypsin-acrylic beads. The rIII-1 digest was then passed over a fast protein liquid chromatography SP-5PW column (Waters, Boston, MA) to separate glutathione S-transferase from rIII-1. rIII-1 was eluted with a salt gradient from 0.015 m~ NaC1,20 mM phosphate, pH 8.0, to 0.25 M NaCl, 20 I" phosphate, pH 8.0. rIII-1 eluted from the column in one sharp peak and was the only protein detected by SDS- PAGE. The rII1-2 digest was passed over a glutathione-agarose column to separate glutathione S-transferase from the rIII-2.

Antibodies-The murine anti-human fibronectin monoclonal antibodies 9D2 and Lab and the polyclonal rabbit anti-fibronectin antibodies were gifts from Dr. Deane Mosher, University of Wisconsin, Madi- son, WI. The epitope recognized by 9D2 is found within the 111-1 module (16). The epitope recognized by Lab is found within the region III-4- 111-8 (16). The polyclonal anti-111-1 antibody was prepared by immuniz- ing rabbits with SDS-PAGE gel slices containing 111-1 proteolytic fragments. Immunoglobulins (IgGs) were isolated by passing immune serum over a protein A-Sepharose CL-4B column (Pharmacia) equilibrated with 100 mM sodium phosphate, pH 7.0. Bound IgG was eluted with 1 M acetic acid, 100 mM glycine, pH 3.0, and the eluate was neu- tralized to pH 7.4 with 1 M Tris, pH 10.0, and dialyzed against PBS. IgG concentration was determined from the absorbance at 280 nM, and aliquots were stored at -80 "C prior to use.

Iodination of Fibronectin and Fibronectin Fragments-For solid phase binding assays and ligand blots, the 70-kDa fragment was iodinated with 1.0 mCi of NalZ61 (DuPont NEN) using chloramine T as previously described (11). Specific activity of the 70-kDa fragment was approximately 1 x lo5 Ci/mol. To assess the binding of fibronectin and fibronectin fragments to tissue culture plastic, fibronectin and fibronectin fragments were iodinated with 0.5 mCi of NalZ51. The iodination reaction was stopped with sodium metabisulfite (Fisher), and free io- dine was removed by chromatography on either gelatin-Sepharose or Sephadex G-25M (Pharmacia). Fibronectin was eluted from the gelatin- Sepharose column with 1 M sodium bromide, pH 5, whereas the gelatin- binding fibronectin fragments were eluted with 4 M urea. Iodinated proteins were dialyzed against PBS and frozen at -80 "C until use. Integrity of the labeled proteins was assessed by gel electrophoresis and autoradiography. Specific activities of fibronectin and other fibronectin fragments ranged from 0.3 x lo4 Ci/mol to 12.0 x lo4 Ci/mol.

'251-Labeled 70-kDa Ligand Blots-The 70-kDa fragment binding to isolated fibronectin and to trypsinized cell supernatants was analyzed by immunoblotting using lZ5I-1abeled 70-kDa fragment. Aliquots of the trypsinized monolayer supernatants were precipitated with 10% trichloroacetic acid for 60 min on ice. Samples were centrifuged at 10,000 r.p.m. at 4 "C for 20 min, and precipitates were washed 3 times with ethanol and dried in a Speed-Vac (Savant Instruments, Farmingdale, NY). Trichloroacetic acid precipitates were dissolved in gel sample buffer, electrophoresed into polyacrylamide gels, and transferred to nitrocellulose paper. Duplicate blots were soaked in 3% BSA in TBS-T for 60 min at 20 "C and incubated overnight with 10 ml of TBS-T containing 1% BSAand 5 x lo5 cpm/ml'251-labeled 70-kDa fragment. To control for nonspecific binding, one blot received excess unlabeled 70-kDa fragment (100 pg/ml). Blots were washed for 48 h with several changes of TBS-T. Blots were air dried, and bound 9-labeled 70-kDa fragment was identified by autoradiography.

70-kDa Fragment Affinity Chromatography-70-kDa fragment and BSA were coupled to cyanogen bromide-activated Sepharose-4B (Phar- macia) according to manufacturer's instructions. Coupling was performed with protein concentrations of 2 mg/ml. Supernatant collected from trypsinized cell surfaces was split into two aliquots of equal volume and applied to either a 2-ml BSA-Sepharose column or to a 2-ml 70-kDa fragment-Sepharose column, both of which had been pre-equilibrated with PBS. m e r application, the columns were washed to base line with PBS at a flow rate of 1 ml/min. Columns were eluted with 4 M

urea in PBS, and 1-ml fractions were collected. Fractions were precipitated with trichloroacetic acid, dissolved in gel sample buffer, and ana-

lyzed by SDS-PAGE and immunoblotting. Solid Phase Binding Assay-70 kDa binding sites in fibronectin were

detected in solid phase binding assays, using '251-labeled 70-kDa fragment as the ligand (11). For studies involving dithiothreitol (DTT), intact fibronectin and fibronectin fragments were incubated with and without 10 mM DTT for 18 h at 20 "C. Reduced proteins were diluted in PBS to 10 pg/ml, and 200 pVwell were added to 24-well multiwell plates (Beckton Dickinson Labware). Following a 90-min incubation at 37 "C, the proteins were removed, and unreacted sites were blocked with 1% BSA in PBS by incubating an additional 90 min at 37 "C. The amount of protein adsorbed to the plastic was determined in separate wells using iodinated protein mixtures of known specific activities. The wells were washed 3 times with PBS containing 0.2% BSA, and the 70-kDa binding assay was conducted at 37 "C for 60 min using 500,000 cpm/ml 1251-labeled 70-kDa fragment in PBS with 0.2% BSA. Nonspecific binding was determined by the addition of 50 pg/ml unlabeled 70-kDa fragment to the binding medium. Specific binding was calculated by sub- tracting nonspecific binding from total binding. Nonspecific binding was typically 30% of the total binding.

For studies involving heat denaturation of proteins, proteins were first diluted to their final concentrations in PBS and then incubated at 90 "C for 10 min. The proteins were then added to multiwell plates and incubated for an additional 60 min a t 80 "C. Plates were allowed to cool at 37 "C for 30 min, after which time unbound protein was removed, and unreacted sites were blocked as indicated above.

The concentration-dependent binding of heat-denatured 111-1 and rIII-1 to tissue culture plastic was assessed by a direct binding assay using a polyclonal antibody directed against 111-1. Proteins were coated onto 96-well enzyme-linked immunosorbent assay plates (Corning Inc., Corning, N Y ) at 80 "C as indicated above. Plates were washed and incubated for 2 h with a 1:lOOO dilution of a polyclonal anti-111-1 antibody followed by a 2-h incubation with a 1:6000 dilution of horseradish peroxidase-conjugated goat-anti-rabbit IgG (Bio-Rad). The assay was developed using the chromogenic substrate, 2,2'-azino-bis(3-ethylbenz- thiazolinesulfonic acid), and the adsorbance a t 410 nm was measured using an enzyme-linked immunosorbent assay microplate biokinetics reader (Bio-tek Instruments, Winooski, VT).

RESULTS

Fibronectin Fragments Derived from the Surface of Fibro- blast Monolayers Bind 70-kDa Fragment-The polymerization of fibronectin matrices is a cell-dependent process regulated by specific sites on the surface of substrate-attached cells (6). Cell surface matrix assembly sites have been identified by radioli- gand binding assays using either 1251-labeled 70-kDa or lZ5I- labeled 27-kDa fragments derived from the amino terminus of fibronectin (11, 12). In an attempt to isolate the cell surface protein(s) responsible for binding of the 70-kDa portion of fibronectin, proteins were cleaved from the surface of human foreskin fibroblast monolayers by mild trypsinization. Proteins derived from trypsinization of monolayer surfaces were separated by SDS-PAGE and analyzed without reduction by immunoblotting. Exposure of fibroblasts to 1 pg/ml trypsin for 6 h generated a number of protein fragments of various sizes (Fig. 24 1. lZ5I-Labeled 70-kDa ligand blotting of these protein fragments revealed several proteins that specifically bound lZ5I- labeled 70-kDa fragment. The smallest protein with 70 kDa binding activity was 36-kDa (Fig. 2 B ) . Identification of the 36-kDa protein as a fibronectin fragment was made by immunoblotting the fragments with a polyclonal anti-fibronectin antibody (Fig. 2C). To localize the 36-kDa fragment within the fibronectin molecule, specific monoclonal antibodies against known regions of fibronectin were used in duplicate blots. The 9D2 monoclonal antibody, which binds to the 111-1 module of fibronectin, recognized the 36-kDa protein in this assay. In contrast, a monoclonal antibody that maps within the 111-4 to 111-8 region (16) did not recognize the 36-kDa protein (Fig. 2C). In addition, a polyclonal antibody that recognizes the 40-kDa gelatin-binding domain of fibronectin did not recognize the 36- kDa protein (data not shown), suggesting that the 36-kDa protein does not contain the gelatin-binding domain. Based on the molecular mass, it seems likely that the 36-kDa protein con-

Fibronectin's Amino Terminus Binds to 111-1 19186

A

200-

97-

68-

B C A. B. C. S U B S U B S U B " T -

43.

70 kDa

43-

BSA

R NR - + al -. 2 h;

Q

29

S U B

U

FIG. 2. '%Labeled 70-kDa fragment binding to supernatants from trypsinized cell surfaces. Confluent fibroblast monolayers were treated with 1 pg/ml trypsin in DMEM for 6 h. Aliquots of the material trypsinized from the cell surface were clarified by centrifugation, and the supernatant was analyzed under reducing (R) and non- reducing (NR) conditions by SDS-PAGE and either stained with silver nitrate (A) or transferred to nitrocellulose and used for ligand blots (B) or immunoblots ( C ) . For ligand blotting, '251-labeled 70-kDa fragment was incubated in the absence (-) and presence (+) of excess nonradio- labeled 70-kDa fragment. Duplicate blots were immunoblotted with polyclonal rabbit anti-fibronectin (anti-Fn) antibodies, the mouse monoclonal antibody that recognizes 111-1 (9D2), or another monoclonal antibody that recognizes 111-4 to 111-8 (Lab d b ) . Samples shown in B and C were not reduced prior to electrophoresis. Molecular mass standards, shown by dashes, are myosin (200 kDa), phosphorylase B (97.4 kDa), BSA (68 kDa), ovalbumin (43 m a ) , and carbonic anhydrase (29 kDa).

tains 111-1 and 111-2 and continues into 111-3. In addition to the 36-kDa fibronectin fragment, two other fi-

bronectin fragments with apparent molecular masses of 150 and 170 kDa bound 1251-labeled 70-kDa fragment by ligand blotting (Fig. 2B ). Both of these fragments were also recognized by the 9D2 antibody. Larger fragments of fibronectin as well as intact fibronectin did not bind lZ5I-labeled 70-kDa fragment, even though they contained the 111-1 module (Fig. 2, B and C ) . A number of trypsin-sensitive cleavage sites are present in fibronectin, and, as a result, the 70 kDa binding site may be generated in cell surface fibronectin fragments only upon cleavage at specific sites. Cleavage of these sites presumably generates certain fibronectin fragments in which the 70 kDa binding site is exposed, while in other fragments the site remains buried.

Cell Surface-derived Fibronectin Fragments Bind 70-kDa Fragment by Affinity Chromatography-To characterize 70-kDa binding proteins by affinity chromatography, confluent

S U B S U B T9" "

FIG. 3. 70-kDa fragment affinity chromatography of trypsinized cell supernatant. Confluent AlF fibroblast monolayers were treated with 100 pg/ml trypsin in DMEM for 5 h. The material trypsinized from the cell surface was clarified by centrifugation, and the supernatant was applied to either a 70-kDa fragment affinity column (upper panels) or a BSA affinity column (lower panels). The starting material (S), unbound fraction (U), and bound fraction (B) were analyzed by SDS-PAGE and visualized by silver staining (A) or immunoblotted with a polyclonal anti-fibronectin antibody (B) and polyclonal rabbit anti-111-1 antibody ( C ) . Samples were trichloroacetic acid-precipitated and resuspended in reduced sample buffer prior to electrophoresis. Molecular mass standards, indicated by dashes, are the same as those in Fig. 2.

fibroblast monolayers were exposed to 100 pg/ml of trypsin for 5 h. The conditioned medium from trypsinized monolayers was split into 2 fractions of equal volume and applied to either a 70-kDa fragment or BSA affinity column. Fig. 2A shows a silver-stained SDS-PAGE gel of the trypsinized supernatant (starting material) and the unbound and bound fractions from both affinity columns. A number of proteins of various molecular weights bound preferentially to the 70-kDa column (Fig. 3A). When subjected to immunoblotting, the larger molecular mass proteins reacted with antibodies against fibronectin, indicating that they were fibronectin fragments (Fig. 3B). The most prominent of these proteins was a 68-kDa fragment, which was also recognized by a polyclonal anti-111-1 antibody (Fig. 3C, arrow).

Reduced Fibronectin Binds 70-kDa Fragment-Our studies using trypsinized cell supernatants indicated that certain fibronectin fragments derived from cell monolayer surfaces bind the 70-kDa amino terminus of fibronectin. Previous studies

Fibronectin's Amino Terminus Binds to III-1 19187

1500 1 T /t

0 5 10 15 20

FN (vglml)

FIG. 4. '"I-Labeled 70-kDa fragment binding to reduced fibronectin (FN). Fibronectin was incubated with PBS (0) or PBS containing 10 mM DTT (A) for 18 h at 20 "C. Multiwell plates were coated with fibronectin at the indicated concentration as described under "Ma- terials and Methods." Previous studies have shown that a fibronectin concentration of 20 pgiml is sufficient to saturate the plastic with fibronectin (29). Fibronectin-coated plates were then incubated for 60 min at 37 "C with 500,000 cpdml 1261-labeled 70-kDa fragment in the presence and absence of 50 pg/ml unlabeled 70-kDa fragment. Nonspe- cific binding, defined as the binding that occurred in the presence of unlabeled 70-kDa fragment, was subtracted from total binding to cal- culate specific binding. Nonspecific binding was approximately 30% of total binding. The data are expressed as the mean f S.E. of triplicate samples.

have shown that '251-labeled 70-kDa fragment does not bind significantly to purified fibronectin in solid phase binding assays in the absence of cells (18,291, suggesting that adsorption of fibronectin onto tissue culture plastic does not expose 70 kDa binding sites within the fibronectin molecule. Therefore, fibronectin was pretreated with the reducing agent, DTT, prior to adsorption onto tissue culture plastic to determine whether reduction of intrachain disulfide bonds would expose 70-kDa fragment binding sites within the molecule. Whereas some specific binding of '251-labeled 70-kDa fragment to nonreduced fibronectin occurred, increasing the concentration of fibronectin on the substrate did not result in a parallel increase in 1251- labeled 70-kDa fragment binding to the fibronectin (Fig. 4). Reduction of fibronectin by DTT, prior to its adsorption onto the plastic, resulted in an increase in '251-labeled 70-kDa fragment binding to fibronectin, and, in addition, '251-labeled 70-kDa fragment binding to reduced fibronectin increased as the concentration of fibronectin on the plate increased. Treatment of fibronectin with 10 mM DTT increased 1251-labeled 70-kDa fragment binding approximately 2.5-fold compared with nonreduced fibronectin (Fig. 4). This increase in 1251-labeled 70-kDa fragment binding was not due to an increase in the amount of fibronectin adsorbed onto the multiwell plates, as DTT treatment did not increase fibronectin binding to tissue culture plastic (data not shown). These results suggest that a cryptic 70 kDa binding site is contained within fibronectin and is exposed upon reduction by DTT.

Binding of 70-KDa Amino Terminus ofFibronectin to Reduced Fibronectin Fragments-To localize the binding site for '251-labeled 70-kDa fragment within the fibronectin molecule, purified fibronectin fragments were coated onto plastic with and without prior reduction by DTT. In the absence of DTT, some specific binding of 1251-labeled 70-kDa fragment to both fibronectin and the 160/180-kDa fragments was observed. In contrast, only minimal binding of 1251-labeled 70-kDa fragment to the 40-, 60-, 70-, and 120-kDa fragments was detected (Fig. 5). Treatment of the fragments with DTT markedly increased the binding of '"I- labeled 70-kDa fragment to the 160/180-kDa fragments as well as to intact fibronectin. Ligand binding assays of the 160/180- kDa fragments electrophoresed and blotted onto nitrocellulose

IOoo 1

FIG. 5. Binding of 1251-labeled 70-kDa fragment to fibronectin (FN) fragments. Fibronectin fragments were incubated in PBS with (closed bars) or without (open bars) 10 mM DTT and coated onto multiwell plates at a concentration of 10 pg/ml, as indicated under "Mate- rials and Methods." The 1251-labeled 70-kDa fragment binding assay was performed as indicated in the legend to Fig. 4. Quantitation of proteins adsorbed to the plastic indicated that similar molar quantities of each fragment adsorbed to the plastic. DTT treatment resulted in a 50% decrease in overall protein binding to plastic (data not shown).

formed in duplicate. Data are expressed as mean S.E. of three separate experiments per-

showed that '251-labeled 70-kDa fragment bound to both the 160- and 180-kDa fragments (data not shown).

Znhibition of 70-kDa Fragment Binding to Reduced Fibronec- tin by Anti-IZI-1-Fig. 2 indicated that a 36-kDa protein, which bound the 70-kDa fragment, was recognized by the 9D2 antibody, indicating that 111-1 may be an important component of the 70 kDa binding site. Therefore, the monoclonal antibody that recognizes 111-1 (9D2) was tested for its ability to inhibit 70-kDa fragment binding to reduced fibronectin in a solid phase binding assay. Plates coated with reduced fibronectin were incubated with various concentrations of either the monoclonal antibody 9D2 or a control monoclonal antibody (Lab), which recognizes a site in fibronectin between modules 111-4 and 111-8. As shown in Fig. 6, following preincubation of reduced fibronectin with 9D2, a concentration-dependent inhibition of '251-labeled 70-kDa fragment binding to reduced fibronectin was observed. Approximately 75% of '251-labeled 70- kDa fragment binding was blocked by preincubation of reduced fibronectin with 50 pg/ml of 9D2 (Fig. 6). In contrast, Lab did not inhibit 70-kDa fragment binding to reduced fibronectin (Fig. 6).

Heat-denatured ZZZ-1 But Not Native IZZ-1 Binds the 70-kDa Amino Terminus of Fibronectin-To determine whether isolated 111-1 binds to 70-kDa fragment, recombinant 111-1 (rIII-1) was tested for its ability to bind 70-kDa fragment in a solid phase binding assay. As shown in Fig. 7, rIII-1 did not bind 70-kDa fragment when adsorbed onto tissue culture plastic. In addition, rIII-1 did not bind 70-kDa fragment by ligand blotting or affinity chromatography (data not shown). Earlier studies have shown that 111-1 reversibly unfolds when denatured either by heat or chemical denaturants (30). Therefore, to test whether 111-1 contains a cryptic 70 kDa binding site, rIII-1 was heat denatured prior to testing for its ability to bind 1251-labeled 70-kDa fragment. Heat denaturation of rIII-1 resulted in a significant increase in binding of 1251-labeled 70-kDa fragment when compared with nonheat-denatured rIII-1 (Fig. 7). The binding of 70-kDa fragment to heat-denatured rIII-1 was specific as lZ5I-labeled 70-kDa fragment did not bind to heat-denatured BSA (Fig. 7). In addition, 1251-labeled 70-kDa fragment binding to heat-denatured rIII-1 was specific to the first type I11 module as '251-labeled 70-kDa fragment did not bind to heat-denatured rIII-2 (Fig. 7), suggesting that 70-kDa fragment binding is not a general property of all type I11 modules.

19188 Fibronectin's Amino Terminus Binds to 111-1

0 ' 0 10 20 30 40 50

Antibody (pglml)

FIG. 6. Inhibition of '2SI-labeled 70-kDa fragment binding to reduced fibronectin by 9D2. DTT-treated fibronectin was coated onto multiwell plates as indicated under "Materials and Methods." Plates were then incubated with either 12.5,25, or 50 pg/ml of either Lab mAb (0) or 9D2 (0) for 60 min at 37 "C. The '251-labeled 70-kDa fragment binding assay was performed in the presence of the antibody as indicated in the legend to Fig. 4.

rlll-1 rlll-2 BSA

FIG. 7. '=I-Labeled 70-kDa fragment binding to heat-denatured type I11 modules. Nonheat-denatured (open bars) and heat- denatured rIII-1, r111-2, and BSA (closed bars) were coated at 10 pg/ml onto multiwell plates as indicated under "Materials and Methods." At these coating concentrations, 8 ng of 111-1 and 24 ng of 111-2 were adsorbed onto the substrate. Binding of 111-1 and 111-2 to the plastic was

activities. The '251-labeled 70-kDa fragment binding assay was per- determined in separate wells using iodinated proteins of known specific

formed as indicated in the legend to Fig. 4. Data are presented as mean f range of triplicate samples.

The increase in 1251-labeled 70-kDa fragment binding to heat- denatured rIII-1 did not result from an increase in the amount of rIII-1 bound to the multiwell plates, as less '251-rIII-l bound to multiwell plates at 80 than at 37 "C (data not shown). 1251- Labeled 70-kDa fragment binding to rIII-1 increased in parallel with the amount of rIII-1 adsorbed to the plate (Fig. 8).

Results shown in Fig. 5 indicated that neither the reduced nor unreduced BO-kDa fragment, which contains the gelatin- binding domain and the 111-1 module, bound '251-labeled 70- kDa fragment phase assays. Heat denaturation of the BO-kDa fragment also did not result in '251-labeled 70-kDa fragment binding (Fig. 9). However, cathepsin cleavage of the BO-kDa into the 40-kDa gelatin-binding domain and the 111-1 module resulted in a 111-1 preparation that bound 1251-labeled 70-kDa fragment following heat denaturation. No binding of '251-labeled 70-kDa fragment to the gelatin-binding domain was detected (Fig. 9). Taken together, these data indicate that the 70 kDa binding site in 111-1 is cryptic and can be exposed upon unfolding of 111-1 by heat denaturation.

Inhibition of 70-kDa Binding to Heat-denatured ZIZ-1 by the

1 .oo

1250

- 0.60

a r d

0.40

0.20

0 - 0.00 0 2 4 6 8 1 0 1 2

rlll-1 ( p g f m l )

FIG. 8. '=I-Labeled 70-kDa fragment binding to heat-denatured rIII-1. Heat-denatured rIII-1 was coated onto 24- and 96-well plates by incubating rIII-1 in the wells at the concentrations indicated. Coating conditions are described under "Materials and Methods." The lz5I-labeled 70-kDa fragment (0) assay was performed on the 24-well plates as indicated in the legend to Fig. 4. Data are presented as mean & range of duplicate samples. The 96-well plate was incubated with the polyclonal anti-111-1 antibody followed by a peroxidase-conjugated secondary antibody. The assay was developed using a chromogenic substrate, and results are expressed as absorbance at 410 nm (A4IO) (0). The data are presented as mean f S.E. of triplicate wells.

1500 1

60kD 40kD 111-1 rill-1 BSA

FIG. 9. '2aI-Labeled 70-kDa fragment binding to heat-denatured fibronectin fragments. Nonheat-denatured (open bars) and heat-denatured fibronectin fragments, 60- and 40-kDa, 111-1, and rIII-1 (closed bars) were coated onto multiwell plates at 10 pg/ml, as indicated under "Materials and Methods." The '251-labeled 70-kDa fragment binding assay was performed as indicated in the legend to Fig. 3. Data are presented as mean 2 range of duplicate samples.

27-kDa Fibronectin Fragment-Previous studies have localized the cell binding activity of the amino-terminal 70-kDa fibronectin fragment to the first 5 type I repeats (11-13). To determine if this region mediates the binding of 70-kDa fragment to heat- denatured III-1,70-kDa fragment was cleaved with trypsin into two fragments of molecular masses of 27 and 40 kDa (11, 12). These fragments were then tested for their ability to inhibit the binding of '251-labeled 70-kDa fragment to heat-denatured 111-1. As shown in Fig. 10, the 27-kDa heparin-binding fragment was as effective at inhibiting the binding of '251-labeled 70-kDa fragment to heat-denatured 111-1 as was the 70-kDa fragment. In contrast, the 40-kDa gelatin-binding fragment had little effect on 70-kDa fragment binding to heat-denatured 111-1 (Fig. 10). Half-maximal inhibition of lZ5I-labeled 70-kDa fragment binding (Ki) was obtained at concentrations of 1.1 x and 1.0 x

M for the 70- and 27-kDa fragments, respectively. These studies indicate that the amino-terminal 27-kDa region of 70- kDa fragment mediates the binding of the 70-kDa fragment to heat-denatured 111-1. Data were also analyzed by Scatchard plot (data not shown) and fitted with a straight line ( r = 0.97) by linear regression. Scatchard analysis indicated that heat-denatured 111-1 had a dissociation constant (K,) for the 70-kDa fragment of 1.8 x lo-* M.

Fibronectin's Amino Terminus Binds to 111-1 19189

3000 r

0 ' 0 5 10 15 20 25

Unlabeled Protein (M x 7)

FIG. 10. Inhibition of '=I-labeled 70-kDa fragment binding to heat-denatured III-1 by 27-kDa fragment. 24-well plates were

Methods" and incubated for 60 min at 37 "C with 0.2 ml of binding coated with heat-denatured 111-1 as indicated under "Materials and

medium containing lZ5I-labeled 70-kDa fragment (1 x lo5 cpm, 228 ng), 0.2% BSA, and increasing concentrations of unlabeled 70-kDa (O), 27- kDa (O), or 40-kDa (m) fragments. Plates were then rinsed, bound protein was solubilized with 1 N NaOH, and radioactivity was determined.

DISCUSSION Our results indicate that a cryptic binding site for the amino-

terminal region of fibronectin is contained within the first type I11 module of fibronectin. This binding site can be detected by ligand blotting using fragments generated by trypsinization of fibronectin fibrils from fibroblast monolayers. Fibronectin fragments generated by trypsinization of purified soluble plasma fibronectin do not bind ''51-labeled 70-kDa fragment in ligand blots' suggesting that SDS treatment is not sufficient to un- mask the 70 kDa binding site within 111-1. It appears likely that the conformation of polymerized fibronectin fibrils is suf- ficiently distinct from that of soluble fibronectin such that trypsinization generates sites in cell surface fibronectin that are not exposed when fibronectin is degraded in solution. Trypsinization of fibroblast monolayers yielded fibronectin fragments that could bind the 70-kDa fragment by affinity chromatography. The smallest fragment that bound the 70-kDa fragment by affinity chromatography was 68 kDa. Smaller fragments, as well as isolated 111-1, did not bind to the 70-kDa column (data not shown). In contrast, the ligand binding assays could detect 70-kDa fragment binding activity in a 36-kDa fragment bound to nitrocellulose. This 36-kDa fragment did not bind to the 70-kDa column, suggesting that in solution the smaller fibronectin fragments are not in the required conformation for 70-kDa fragment binding.

70 kDa binding sites within fibronectin could be detected in solid phase binding assays on tissue culture plastic but only after the fibronectin was treated with DTT. Untreated fibronectin bound only a small amount of 70-kDa fragment, in agree- ment with prior studies that failed to show a significant interaction between the amino terminus of fibronectin and intact fibronectin (18,29). Binding of '251-labeled 70-kDa fragment to reduced fibronectin was inhibited by the monoclonal antibody, 9D2, which specifically binds within the 111-1 module of fibronectin. The mechanism by which DTT treatment unmasks the 70 kDa binding site within 111-1 is not clear. Since the 111-1 module does not contain disulfide bonds, reduction of disulfides in adjacent modules may affect fibronectin's conformation and its adsorption to the plastic in such a way as to expose the 70 kDa binding site within 111-1. Alternatively, incorrect reoxida- tion of disulfides following DTT treatment may result in a

D. C. Hocking, J. Sottile, and P. J. McKeown-Longo, unpublished observation.

distinct orientation of adsorbed fibronectin that exposes the 70 kDa binding site. The 70 kDa binding site within the 111-1 module is available following reduction of intact fibronectin or large fragments of fibronectin (160/180 kDa). DTT treatment did not affect 70-kDa fragment binding to the 60-kDa fragment, even though this fragment contains the 111-1 module. I t is pos- sible that in smaller fragments, like the 60-kDa one, the 111-1 module may be bound to the plastic and, therefore, blocked from interacting with the 70-kDa fragment. Alternatively, the absence of neighboring domains on the carboxyl-terminal side of the 111-1 module may affect the conformation of the 111-1 domain within the 60-kDa fragment. Interactions between the type I11 modules have previously been shown to effect conformation-sensitive epitopes, as well as the adhesive properties of fibronectin (31, 32).

Fibronectin-fibronectin interactions have been shown in several previous studies (14, 15, 17,33). Recombinant fibronectins bind to fibronectin affinity columns only when the first five type I modules are present in the construct, suggesting that fibronectin-fibronectin binding requires the presence of the amino terminus (14). A chymotryptic 60-kDa gelatin-binding fibronectin fragment has been shown to bind to immobilized fibronectin (33). A similar, thermolysin-derived, 56-kDa gelatin-binding fibronectin fragment inhibits fibronectin binding to cell layers but does not bind to cells, suggesting that this 56-kDa fragment binds to protomeric fibronectin (15). Both the chymotrypsin-derived 60-kDa fragment (33) and the thermolysin-derived 56-kDa (15) fragment contain the 111-1 module and, therefore, their ability to bind fibronectin may represent interactions between the amino terminus and 111-1. In the present study, the elastase- generated 60-kDa fibronectin fragment did not bind significantly to the 70-kDa fragment when immobilized onto tissue culture plastic. Subsequent cleavage of 60-kDa fragment to produce 111-1, followed by heat denaturation, resulted in exposure of the 70 kDa binding site in 111-1. Hence, in our elastase- generated 60-kDa fragment, the 70 kDa binding site remains cryptic until 111-1 is separated from the gelatin-binding site and subsequently heat denatured. 70-kDa fragment binding appears to be a specific property of the first type I11 module, as 70-kDa fragment did not bind to heat-denatured 111-2.

Thermal denaturation studies of 111-1 previously demonstrated that the 111-1 module exhibits a sharp unfolding tran- sition with a midpoint at 78 "C (30). Studies utilizing fluores- cence spectroscopy and differential scanning calorimetry suggest that 111-1 is folded into a structure containing a stable compact core surrounded by less compact regions (30). In addition, a nuclear magnetic resonance structure of the 10th type I11 module of fibronectin (34) and a type I11 module in tenasin (35) showed that these type I11 modules consist of seven /3 strands that fold to form two antiparallel /3 sheets enclosing a hydrophobic core. I t is, therefore, likely that in our experiments heat treatment of the 111-1 module results in the exposure of 70 kDa binding sites that are normally buried within the three- dimensional structure.

A 14-kDa fibronectin fragment generated by chymotrypsin, beginning 20 amino acid residues into the 111-1 module and extending partially into the 111-2 module, has been shown to bind to both cell layers and to intact fibronectin (18). This fragment binds to cells and blocks matrix assembly but does not block 70-kDa fragment binding to cells (181, consistent with our findings that isolated 111-1 domain does not bind to 70-kDa fragment unless it is heat denatured. It is unclear whether the inability of the chymotryptic fragment to bind to the 70-kDa fragment is because it does not contain the 70 kDa binding site or because the binding site is present but inaccessible. The 14-kDa fragment used in the present study begins 8 amino

19190 Fibronectin’s Amino Terminus Binds to 111-1

acids into 111-1 and, therefore, includes both the A and B strands of the 111-1 module (2, 34). The 14-kDa chymotryptic fragment starts 20 amino acids into 111-1 and, hence, is missing both the A and B strands of the module. The ability of the 14-kDa chymotryptic fragment to block matrix assembly at a step subsequent to amino-terminal binding suggests that either the carboxyl-terminal region of 111-1 or the amino-terminal region of 111-2 contains a second self-interactive site important in matrix assembly.

The amino-terminal region of fibronectin is essential for the polymerization of fibronectin into a fibrillar matrix (11, 12). Equilibrium binding of ‘T-labeled 70-kDa fragments of fibronectin occurs at specific, saturable sites on the surface of substrate-attached cells, leading to the earlier hypothesis that these 70 kDa binding sites represented specific cell surface receptors involved in the cell-dependent polymerization of fibronectin (11). The data presented here are consistent with a model where the previously described matrix assembly receptor may be the 111-1 module of fibronectin. Opening of the 111-1 domain on cell surfaces may arise from a complex interaction of events initiated by cell adhesion to fibronectin and modulated by interactions occurring between the cytoskeleton and the extracellular matrix (6).

The adherence of fibroblast cells to fibronectin is generally mediated by a5p1 integrins that function as a link between the fibronectin and the cytoskeleton (36-38). Cellular adhesion is necessary for the elaboration of a fibronectin matrix, as cells in suspension do not express binding sites for fibronectin’s amino te rminu~.~ In addition, matrix assembly sites are lost when actin fibers are disrupted with cytochalasins (39) or when cells are incubated with antibodies against the p1 integrin that also disrupt fibronectin-dependent adhesion (15). A requirement for fibronectin-dependent adhesion in matrix assembly has been demonstrated in studies showing that cells adherent to vitronectin exhibit decreased levels of matrix assembly sites, as compared with cells adherent to fibronectin (29). The impor- tance of the asp1 integrin receptor for fibronectin in the assembly of a fibronectin matrix has been demonstrated in several studies showing that fibronectin fibrillogenesis is dependent on functional a5p1 receptors (15, 40-42). On the other hand, di- meric fibronectin constructs lacking the RGD sequence are still incorporated into the extracellular matrix (14). Therefore, in- corporation of incoming fibronectin into the matrix does not depend on direct binding to integrin molecules. The requirement for integrins in matrix assembly may be to provide adhesion sites in which fibronectin, bound to the integrin, undergoes a conformational change, resulting in the exposure of the 70 kDa binding site within the 111-1 module. This site can then serve as a template for the binding and alignment of incoming fibronectin molecules. Following addition of incoming fibronectin to the growing fiber, this template may be regenerated, since recombinant fibronectins lacking 111-1 are still incorporated into the extracellular matrix when added exogenously to substrate-attached cells (14).

In order for the 111-1 module to function in matrix assembly, the cryptic amino-terminal binding site in 111-1 must become exposed. In addition, any model of matrix assembly site expression must provide for the observation that these sites can be rapidly up- and down-regulated (43,441. Unfolding of the 111-1 module may occur during cell spreading as a result of tension generated between the cytoskeleton and extracellular fibronectin. Forces generated by the cytoskeleton and subsequently transmitted through the integrin may result in a reversible conformational change within 111-1 in fibronectin molecules present in cell adhesion sites. Changes in the cytoskeletal gen-

P. J. McKeown-Longo, unpublished observation.

erated tension could potentially regulate unfolding and folding of the 111-1 module, thereby up- and down-regulating matrix assembly. Recent studies have shown that integrins are able to transmit mechanical forces across the cell surface (45). An association between tissue tension and matrix formation has also been suggested in studies showing that stretching of glomerular mesangial cells by glomerular hypertension results in increased production of extracellular matrix molecules (46). A role for changes in cytoarchitecture in regulating the expression of matrix assembly sites has been shown using effectors of protein kinase C, which have shown a positive correlation between actin stress fiber formation and matrix assembly site expression (47,481. The present study indicates that 111-1 contains a cryptic binding site for the amino terminus of fibronectin. Our study does not, however, specifically address whether this cryptic binding site functions as the matrix assembly site on cell surfaces. In matrix assembly assays done on fibroblast monolayers, the 9D2 antibody blocked the polymerization of fibronectin by fibroblast monolayers but at a step after the amino-terminal binding to the cells (16). In fact, 9D2 increased the binding of lZ5I-labeled 70-kDa fragment to the cell by 50%, consistent with the hypothesis that regulation of the conformation of 111-1 regulates matrix assembly site expression. In the present study, preincubation of reduced fibronectin with 9D2 blocked lZ5I-labeled 70-kDa fragment binding to fibronectin in solid phase assays (Fig. 7). This discrepancy is not readily explained but may reflect differences in the orientation of the 70 kDa binding site within the 111-1 domain when the domain is unfolded by the cell as opposed to unfolding by chemical denaturants. The present study demonstrates that a 70 kDa binding site in fibronectin is conformationally constrained within the 111-1 module. The 27-kDa region of the 70-kDa fragment mediates binding to heat-denatured 111-1, consistent with previously published data localizing the cell binding activity of the 70-kDa fragment to this same region (11-13). Scatchard analysis indicates that heat-denatured 111-1 has a dissociation constant (K,) for the 70-kDa fragment of 1.8 x M, which is within the range of the previously published values of 1.5 x 10-8-4 x lo-@ M for the binding of lZ5I-labeled 70-kDa fragment to cell surfaces (49, 50). Whether this site can function as the proposed matrix assembly site during fibronectin polymerization, however, remains to be determined.

The studies presented here provide evidence that the previously proposed matrix assembly receptor (11) may be the 111-1 domain of fibronectin, but they do not rule out the possibility that other proteins may be involved in the binding of the amino terminus of fibronectin to cell surfaces. A 67-kDa protein found on the surfaces of monocytes recognizes the amino terminus of fibronectin (51), and, more recently, a 66-kDa protein has been isolated from chick myoblasts that also exhibits binding activity toward the amino terminus of fibronectin (52). In addition, Limper et al. (53) demonstrated that radiolabeled amino-terminal fibronectin fragments could be cross-linked to an as yet unidentified 120-kDa protein. We propose that regulation of matrix assembly site expression occurs by an integrin-dependent folding and unfolding of the 111-1 domain and that this unfolding is regulated through forces generated by the cytoskeleton. Further studies will be needed to define in more detail the function of the interaction between fibronectin’s amino-terminal and 111-1 domains during matrix assembly.

Acknowledgments-We are grateful to Lynn Farzam, Renotta Smith, and Carol Horzempa for providing technical assistance and to Wendy Ward and Maureen Davis for their secretarial assistance.

REFERENCES 1. Hynes, R. 0. (1990) Fibronectins, Springer-Verlag New York Inc., New York 2. Petersen, T. E., Skorstengaard, K., andV1be-Pedersen, K. (1989) inFibronectin

Fibronectin’s Amino Terminus Binds to 111-1 19191

3. Hynes, R. O., and Yamada, K. M. (1982) J. Cell Biol. 96,369-377 (Mosher, D. F., ed) pp. 1-24, Academic Press, New York

4. Mosher, D. F. (1984) Annu. Rev. Med. 36,561-575 5. Yamada, K. (1989) in Fibronectin (Mosher, D. F., ed) pp. 47-121, Academic

6. Mosher, D. F., Sottile, J., Wu, C., and McDonald, J. A. (1992) Curr: Opin. Cell

7. Allio, A. E., and McKeown-Longo, P. J. (1988) J. Cell. Physiol. 136, 459466 8. Oh, E., Pierschhacher, M., and Ruoslahti, E. (1981) Proc. Natl. Acad. Sci.

9. McKeown-Longo, P. J., and Mosher, D. F. (1983) J. Cell Biol. 97, 466472 10. Hayman, E. G., and Ruoslahti, E. (1979) J. Cell Biol. 83, 255-259 11. McKeown-Longo, P. J., and Mosher, D. E (1985) J. Cell Biol. 100, 364-374 12. Quade, B. J., and McDonald, J. A. (1988) J. Biol. Chem. 263, 19602-19609 13. Sottile, J., Schwarzbauer, J., Selegue, J., and Mosher, D. F. (1991) J. Biol.

14. Schwarzbauer, J. E. (1991) J. Cell Biol. 113, 1463-1473 15. Fogerty, F. J., Akiyama, S. K., Yamada, K. M., and Mosher, D. F. (1990) J. Cell

16. Chernousov, M. A., Fogerty, F. J. , Koteliansky, V. E., and Mosher, D. F. (1991)

17. Morla, A., Zhang, Z., and Ruoslahti, E. (1994) Nature 367, 193-196 18. Morla, A,, and Ruoslahti, E. (1992) J. Cell Biol. 118, 421-429 19. Laemmli, U. K. (1970) Nature 227, 680-685 20. Wray, W., Boulikas, R., Wray, V. P., and Hancock, R. (1981)Anal Biochem. 118,

Press, New York

Biol. 4, 81M18

U. S . A. 78, 32183221

Chem. 266, 12840-12843

Biol. 111,699-708

J. Biol. Chem. 266, 10851-10858

197-203 21. Towbin, H. T., Staehelin, T., and Grodon, J . (1979) Proc. Natl. Acad. Sci.

~~ ~~.

U. S. A. 76. 4350-4354 22. Harlow, E., &d Lane, D. (1988)Antibodies:A Laboratory Manual, Cold Spring

23. Engvall, E., and Ruoslahti, E. (1977) Int. J. Cancer 20, 1-5 24. Balian, G., Click, E. M., and Bornstein, P. (1980) J. Biol. Chem. 266, 3234-

25. McDonald, J. A., and Kelley, D. G. (1980) J. Biol. Chem. 266, 8848-8858 26. Pierschbacher, M. D., Hayman, E. G., and Ruoslahti, E. (1981) Cell 26, 259-

Harbor Laboratory, Cold Spring Harbor, NY

3236

267 27. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A

Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

28. Sanger, E , Niklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74,5463-5467

29. Kowalczyk,A., and McKeown-Longo, P. J. (1992)J. Cell. Physiol. 162,126-134 30. Litvinovich, S. V, Novokhatny, V. V., Brew, S. A,, and Ingham, K. C. (1992)

31. Carnemolla, B., Leprini, A,, Allemanni, G., Saginati, M., and Zardi, L. (1992) Biochim. Bwphys. Acta 1119, 57-62

32. Kimizuka, F., Ohdate, Y., Kawase, Y., Shimojo, T., Taguchi, Y., Hashino, K., J. Biol. Chem. 267,24689-24692

Goto, S., Hashi, H., Kato, I., Sekiguchi, K., and Titani, K. (1991) J. Biol. Chem. 266,30453051

33. Ehrismann, R., Chiquet, M., and Turner, D. C. (1981) J. Biol. Chem. 266, 40564062

34. Main, A. L., Harvey, T. S., Baron, M., Boyd, J., and Campbell, I. D. (1992) Cell 71,671478

35. Leahy, D. J., Hendrickson, W. A,, Ankhil, I., and Erickson, H. P. (1992) Science 268,987-991

36. Burridge, K., Fath, K., Kelly, T., Nuckolis, B., and Turner, C. (1988)Annu. Rev. Cell Biol. 4, 487-525

37. Honvitz, A,, Duggan, K., Buck, C., Berkerle, M. C., and Burridge, K. (1986) Nature 320, 531-533

38. Otey, C. A,, Pavalko, F. M., and Burridge, K. (1990) J. Cell Biol. 111,721-729 39. Barry, E. L. R., and Mosher, D. F. (1989) J. Biol. Chem. 264,4179-4185 40. McDonald, J. A,, Quade, B. J., Broekelmann, T. J., Lachance, R., Forsman, K.,

Hasegawa, E., and Akiyama, S. (1987) J. Biol. Chem. 262,2957-2967 41. Giancotti, E G., and Ruoslahti, E. (1990) Cell 60,849459 42. Wu, C., Bauer, J. S., Juliano, R. L., and McDonald, J. A. (1993) J. Biol. Chem.

43. Allen-Hoffman, B. L., and Mosher, D. F. (1987) J. Biol. Chem. 262, 14361- 268, 21883-21888

44. Allen-Hofiann, B. L., Crankshaw, C. L., and Mosher, D. E (1988) Mol. Cell.

45. Wang, N., Butler, J. P., and Ingher, D. E. (1993) Science 260, 1124-1127 46. Riser, B. L., Cortes, P., Berstein, J., Dumler, F., and Narins, R. G. (1992) J.

47. Checovich, W., and Mosher, D. (1993)Arterioscler: Thromb. 13, 1662-1667 48. Somers, C., and Mosher, D. F. (1993) J. Biol. Chem. 268, 22277-22280 49. McKeown-Longo, P. J., and Etzler, C. A. (1987) J. Cell Biol. 104,601410 50. McKeown-Longo, P. J. (1987) Reu. Infect. Dis. 9, 322334 51. Blystone, S., and Kaplan, J. (1991) J. Biol. Chem. 267, 3968-3975 52. Moon, K-Y., Shin, K. S., Song, W. K , Chung, C. H., Ha, D. B., and Kang, M.3.

53. Limper, A. H., Quade, B. J., LaChance, R. M., Birkenmeier, T. M., Rangwala,

14365

Biol. 8, 42344242

Clin. Invest. 90, 1932-1943

(1994) J. Biol. Chem. 269, 7651-7657

R. S., and McDonald, J. A. (1991) J. Biol. Chem. 266, 9697-9702

Fibronectin's 111-1 Module Contains a Conformation-dependent ...

Documents

Transcript of Fibronectin's 111-1 Module Contains a Conformation-dependent ...