Extracellular Vesicle–Mediated Transfer

Genes & Cancer 4(7-8) 261 –272© The Author(s) 2013Reprints and permissions: sagepub.com/journalsPermissions.navDOI: 10.1177/1947601913499020ganc.sagepub.com

IntroductionCells can use a variety of approaches to communicate with each other such as direct membrane-to-membrane contact, release of soluble mediators, and secretion of small vesi-cles.1 Exosomes are small extracellular vesicles, ~50 to 100 nm in diameter, secreted from multivesicular endosomes by a variety of cell types. Exosomes and other extracellular vesicles can be secreted by tumor cells and can be taken up by adjacent cells with the intercellular transfer of biologi-cally active contents such as proteins and mRNA.2,3 In recent studies, we found that hepatocellular cancer (HCC) cell–derived extracellular vesicles can modulate cell signal-ing and gene expression via the transfer of microRNAs (miRNAs).4 The involvement of other noncoding RNA, such as long noncoding RNA (lncRNA), in cancer is becom-ing increasingly recognized. However, a role for lncRNA as intercellular signaling mediators has not been defined, and the potential of extracellular vesicles to transfer lncRNA is unknown.

We hypothesized that extracellular vesicle–mediated transfer of lncRNAs could be an important mechanism in

the development of HCC. We have recently examined the involvement of ultraconserved RNAs (ucRNAs) in HCC.5 ucRNAs are a group of lncRNAs transcribed from ultracon-served elements (UCEs), genomic sequences greater than 200 bases that are 100% conserved across human, mouse, and rat genomes.6 A total of 481 UCEs have been reported, with both ubiquitous and tissue-specific transcriptional activity identified in normal human tissues for the majority of these.7 These UCEs are frequently located at fragile sites and genomic regions involved with cancers. Moreover, deregulated expression of ucRNA has been reported in sev-eral cancers with differential expression of about 9% of

Supplementary material for this article is available on the Genes & Cancer website at http://ganc.sagepub.com/supplemental.

Mayo Clinic, Jacksonville, FL, USA

Corresponding Author:Tushar Patel, Mayo Clinic, 4500 San Pablo Road, Jacksonville, FL 32224, USA (Email: [email protected]).

Extracellular Vesicle–Mediated Transfer of a Novel Long Noncoding RNA TUC339: A Mechanism of Intercellular Signaling in Human Hepatocellular Cancer

Takayuki Kogure, Irene K. Yan, Wen-Lang Lin, and Tushar Patel

Submitted 1-Jun-2013; accepted 29-Jun-2013

AbstractAlthough the expression of long noncoding RNA (lncRNA) is altered in hepatocellular cancer (HCC), their biological effects are poorly defined. We have identified lncRNA with highly conserved sequences, ultraconserved lncRNA (ucRNA) that are transcribed and altered in expression in HCC. Extracellular vesicles, such as exosomes and microvesicles, are released from tumor cells and can transfer biologically active proteins and RNA across cells. We sought to identify the role of vesicle-mediated transfer of ucRNA as a mechanism by which these novel lncRNA could influence intercellular signaling with potential for environmental modulation of tumor cell behavior. HCC-derived extracellular vesicles could be isolated from cells in culture and taken up by adjacent cells. The expression of several ucRNA was dramatically altered within extracellular vesicles compared to that in donor cells. The most highly significantly expressed ucRNA in HCC cell–derived extracellular vesicles was cloned and identified as a 1,198-bp ucRNA, termed TUC339. TUC339 was functionally implicated in modulating tumor cell growth and adhesion. Suppression of TUC339 by siRNA reduced HCC cell proliferation, clonogenic growth, and growth in soft agar. Thus, intercellular transfer of TUC339 represents a unique signaling mechanism by which tumor cells can promote HCC growth and spread. These findings expand the potential roles of ucRNA in HCC, support the existence of selective mechanisms for lncRNA export from cells, and implicate extracellular vesicle–mediated transfer of lncRNA as a mechanism by which tumor cells can modulate their local cellular environment. Intercellular transfer of functionally active RNA molecules by extracellular vesicles provides a mechanism that enables cells to exert genetic influences on other cells within the microenvironment.

Keywords: liver cancer, extracellular vesicles, gene expression, RNA genes, paracrine signaling

Original Article

262 Genes & Cancer / vol 4 no 7-8 (2013)

ucRNAs in leukemia and colon cancer.7 We identified and cloned the ucRNA TUC338 that is overexpressed in HCC and can modulate cell cycle progression and proliferation.5 Despite this emerging evidence implicating a role of ucRNA in tumor growth and progression, the precise role of these novel RNA genes remains obscure. Thus, our aims were to evaluate the potential role of extracellular vesicles in medi-ating intercellular transfer of ucRNA to effect gene changes and modulate target cell behavior. Our studies identified selective enrichment of ucRNA in HCC-derived extracel-lular vesicles and characterized a candidate ucRNA involved in intercellular signaling that can modulate gene expression and tumor cell behavior.

Results

Morphological analysis of extracellular vesicles released from HCC cells. First we examined the morphological appearance of extracellular vesicles isolated by differential ultracentri-fugation and density gradient centrifugation from culture medium of PLC/PRF/5 cells by performing ultrathin section transmission electron microscopy. The vesicles were homo-geneous in size and morphology. Morphologically, the vesi-cles had a characteristic appearance of exosomes with a membrane-capsulated spherical shape (Fig. 1A, B). The internal content of most of the vesicles had a faint structure–like appearance with dense homogeneous material observed

A B

0

5

10

15

20

25

30

35

40

40 60 80 100 120 140 160 180 200 220 240

Diameter (nm)

Extr

acel

lula

r ves

icle

s, %

C

Figure 1. Transmission electron microscopy (TEM) of extracellular vesicles isolated from HCC cells. Morphology of PLC/PRF/5-derived extracellular vesicles was examined by ultrathin section TEM using an EM208S Electron Microscope (Philips). (A) Low magnification. (B) High magnification; scale bar, 100 nm. (C) The sizes of vesicles were analyzed using NIH Image J software (National Institutes of Health). The histogram shows the distribution of the size of vesicles.

Extracellular vesicle transfer of lncRNA / Kogure et al. 263

A B C

Figure 2. Internalization of Hep3B-derived extracellular vesicles into other cells. HepG2 cells in culture were incubated with Hep3B-derived extracellular vesicles labeled with PKH67 green dye for 24 hours. Cells are fixed with methanol at −20°C and mounted with ProLong Gold Antifade Reagent with DAPI (Molecular Probes). Images were obtained using a fluorescent microscope (Nikon Eclipse 80i, Nikon Instruments Inc.). (A) DAPI (blue), (B) PKH67 (green), and (C) Merge. Hep3B-derived extracellular vesicles are shown to be internalized into the cytoplasm of HepG2 cells.

in a subset. The median size of the vesicles was 105 nm with a range of 62 to 229 nm (Fig. 1C), similar to the reported size of exosomes.8 Nanoparticle tracking analysis identified a yield of 5,563 ± 395 vesicles/cell, when initial plating den-sity was 105 cells/plate. Furthermore, density gradient cen-trifugation identified that the sedimentation characteristics were consistent with those reported for exosomes. Thus, based on their morphology, size, and density, the extracel-lular vesicle used for these studies comprised exosomes. However, because exosomes are a specific population of vesicles with a distinctive biogenesis, we have used the term extracellular vesicles in this report.

Internalization of extracellular vesicles. We evaluated whether tumor cell–derived extracellular vesicles could be taken up by other cell types. Extracellular vesicles were obtained from Hep3B cells and labeled with green fluores-cent dye PKH67. Subsequently, HepG2 cells were incu-bated with labeled vesicles for 24 hours. Fluorescence microscopy identified internalization of vesicles which appeared as endosome-like cytoplasmic vesicles in HepG2 cells (Fig. 2).

Profiling of ultraconserved RNAs in extracellular vesicles. In recent studies, we have identified aberrant expression lncRNA in HCC cells. The potential of lncRNA as a media-tor of intercellular signaling is unknown. Thus, we sought to determine whether lncRNA could be transferred within extracellular vesicles and to evaluate the potential of these RNA to function as mediators of intercellular communica-tion to modulate gene expression and biological behaviors in HCC.

We began by examining ucRNA expression in Hep3B and PLC/PRF/5 HCC cells and in extracellular vesicles derived from these cells. The expression of 474 ucRNAs and selected other RNA control genes (18S ribosomal RNA, 5S ribosomal RNA, and U6) were measured

by qRT-PCR in 4 independent samples for each cell line/extracellular vesicle pair. A total of 290 ucRNAs were iden-tified in extracellular vesicles isolated from Hep3B cells. Of these, 211 ucRNAs were differentially expressed in extracellular vesicles by more than 4-fold compared to expression in their donor cells. Of these, 130 ucRNAs were enriched (up to 3,477-fold) and 81 miRNAs were decreased (up to 205-fold). We identified 16 ucRNAs that were detected exclusively in extracellular vesicles, indicating a very high enrichment in extracellular vesicles compared to donor cells (Fig. 3A). Similar observations were made in PLC/PRF/5-derived extracellular vesicles, with 185 ucRNAs differentially expressed in extracellular vesicles more than 4-fold compared to the donor cells. Of these, 117 ucRNAs were enriched (up to 899-fold), 68 miRNAs were decreased (up to 868-fold), and 24 ucRNAs detected exclu-sively in extracellular vesicles. There was a moderate cor-relation between ucRNA expression levels in extracellular vesicles isolated from the 2 cell lines (Fig. 3B). These data show dramatic differences in ucRNA between extracellular vesicles and the cells from which they originate and support the existence of selective mechanisms to govern the ucRNA content of extracellular vesicles.

Fourteen ucRNAs were significantly enriched with greater than 4-fold change and with t test P < 0.05 in both Hep3B- and PLC/PRF/5-derived extracellular vesicles (Fig. 3C) compared to their cells of origin. Among these, uc.339 was one of the most highly expressed ucRNAs, with expression increased by 51.7-fold in Hep3B-derived and 6.4-fold in PLC/PRF/5-derived extracellular vesicles. Incu-bation of Hep3B cells with 10 µg/mL HepG2-derived extra-cellular vesicles resulted in a 2.4-fold increase in cellular uc.339 expression. Thus, these data support a potential role for this ucRNA as a signaling mediator.

Identification of full-length TUC339. We next focused our efforts on further characterizing the uc.339 transcript to


Donor cellsExosomes

16 275 131

52

Donor cellsExosomes

24 379 45

26

Hep3B cells PLC/PRF/5 cells

-15

-10

-5

0

5

10

15

20

-15

-10

-5

0

5

10

15

20

EV/D

onor

cel

l ucR

NA

expr

essi

on -L

og2(

fold

cha

nge)

Enriched in EV Enriched in EV117 ucRNAs

2

3

4

5

6

7

8

2 3 4 5 6 7 8Log2(fold change), PLC/PRF/5

Log 2

(fold

cha

nge)

, Hep

3B

uc.339

A

B C

*

-8

-4

0

4

8

12

-8 -4 0 4 8 12

Log 2

(fold

cha

nge)

, Hep

3B

Log2(fold change), PLC/PRF/5

130 ucRNAs

81 ucRNAsDecreased in EV

68 ucRNAsDecreased in EV

EV/D

onor

cel

l ucR

NA

expr

essi

on -L

og2(

fold

cha

nge)

Figure 3. ucRNA expression in extracellular vesicles (EV) and their donor cells. Profiling of ucRNAs was performed using quantitative RT-PCR, and the expression level of each ucRNA in extracellular vesicles was normalized using the median threshold cycle (CT) value and expressed relative to their donor cells. (A) The mean values of fold change of expression of ucRNA detected in extracellular vesicles relative to that in donor cells is shown (n = 4) and the numbers of ucRNA that were exclusively detected in either donor cells or extracellular vesicles are depicted. A total of 291 ucRNAs were identified in Hep3B-derived extracellular vesicles, and 403 ucRNAs in PLC/PRF/5-derived extracellular vesicles. (B) Correlation of ucRNA expression in Hep3B-derived extracellular vesicles and in PLC/PRF/5-derived extracellular vesicles are shown. A total of 279 ucRNAs were detected in extracellular vesicles from both Hep3B and PLC/PRF/5. *, coefficient, .434; P < 0.0001. (C) ucRNAs with fold change >4 and P < 0.05 in both Hep3B and PLC/PRF/5 are plotted. uc.339 was identified to be one of highly expressed ucRNAs in extracellular vesicles secreted from both Hep3B and PLC/PRF/5.


understand the relevance of these observations. The full-length transcript was cloned by RACE and designated as TUC339 (Suppl. Figs. 2 and 3). The TUC339 gene has a total of 1,198 bases, which include the 252nt ultraconserved (uc.339) sequence between positions +73 and +325 from the 3′-UTR. The genomic location of TUC339 is shown in Figure 4B. TUC339 does not overlap any confirmed pro-tein-coding gene, and an open reading frame was not identi-fied. The sequence of TUC339 was analyzed using GenScan 1.0 (http://genes.mit.edu/GENSCAN.html)9 to predict the

potential genes or proteins. The analysis showed no poten-tial sequence to produce a protein in TUC339.

TUC339 modulates tumor cell proliferation. We examined the basal expression level of TUC339 in HCC cell lines. RNA was extracted from HCC cell lines in stable condition and qRT-PCR was performed (Fig. 5B). The highest expres-sion of TUC339 was observed in HepG2.ST cells. To inves-tigate the functional involvement of TUC339 in tumor cell biology, we first examined the effect of suppression of

Figure 4. Cloning of TUC339. (A) Schematic representation of TUC339, the ultraconserved RNA transcribed from the region including uc.339. RACE cloning was performed using SMARTer RACE cloning kit (Clontech) to identify the sequence of full-length TUC339. The complete sequence of TUC339 is shown with the uc.339 sequence identified by Bejerano et al.,6 shown in red. (B) Location of uc.339 and TUC339 in human genome in UCSC Genome Browser (http://genome.ucsc.edu/). No confirmed protein coding transcripts overlapping with TUC339 were reported.


6

8

10

12

Transcription start

Chromosome 12 uc.339

Transcription end

BA

0

2

4

TUC

339/

RN

U6

rela

tive

to H

ep3B

TUC339, non-coding RNA transcribed from uc.339

Sequence identical to uc.339

siRNA-1siRNA-2

Primers for qRT-PCR

5’ 3’

400

500

1.0

1.2

DC

100

200

300

400e0 2

0.4

0.6

0.8

TUC

339/

RN

U6

rela

tive

to c

ontr

ol

**

00 24 48 72

100

Cel

l num

ber,

×100

0

(hr)

0.0

0.2

Non-targetingcontrol

siRNA-1 siRNA-2

r

FE

0 6

0.8

1.0

1.2

ativ

e to

con

trol

**

60

80

100

120

es, %

of c

ontr

ol

**

0.0

0.2

0.4

0.6

Fluo

resc

ence

rela *

0

20

40

60

Num

ber o

f col

oni

Non-targetingcontrol

siRNA-1 siRNA-2Non-targetingcontrol

siRNA-1 siRNA-2

Non-targeting controlsiRNA-1siRNA-2

*

*

**

Figure 5. TUC339 knockdown decreases HCC cell proliferation. (A) Schematic representation of uc.339, TUC339, primers, and siRNAs. The location of the primers used for quantitative RT-PCR (qRT-PCR) and siRNAs are shown. (B) Basal expression level of TUC339 in human HCC cell lines. RNA was extracted from HCC cell lines using TRIzol reagent and qRT-PCR with SYBR green was performed. Expression of TUC339 was normalized using the expression of RNU6B and standardized to Hep3B. Bars express mean ± SE. (C) Knockdown efficiency of siRNAs against TUC339. HepG2.ST cells were transfected with siRNAs against TUC339 or nontargeting control (Dharmacon) using Lipofectamine 2000 (Invitrogen). After 48 hours cells were collected for qRT-PCR to detect TUC339 (C), or used for the following experiments (D-F). Bars represent the mean ± SEM. *, P < 0.05. (D) Growth curve assay. Cells were plated on 24-well plates at 1,000 cells per well and the number of viable cells in each well was counted using hemocytometer with trypan blue staining. Each plot represents mean ± SEM of 3 separate determinants. *, P < 0.05. (E) Clonogenic assay. Cells were plated on 6-well plates at 200 cells per well. After 7 days colonies were fixed and stained using neutralized buffered formalin containing 0.5% crystal violet. Images were taken and the number of the colonies were counted using NIH Image J software and expressed as a percentage of control. Data represent mean ± SEM of 3 determinants. *, P < 0.05. (F) Soft agar assay. Cells were plated in a 96-well plate with cell culture medium containing 0.4% agar at 600 cells per well over a base agar layer consisting of culture medium containing 0.6% agar. After incubation of 7 days, the number of colonies was evaluated fluorometrically. Bars represent the mean ± SEM of 6 separate determinations. *, P < 0.05.

endogenous TUC339 in HepG2.ST cells by RNA interference targeting the ultraconserved region of TUC339 (Fig. 5A). Using 2 different siRNAs against TUC339, the expression of TUC339 was reduced by 64.6 ± 4.6% (siRNA-1) and by 53 ± 4.7% (siRNA-2) compared to nontargeting control (Fig. 5C). Anchorage-depen-dent cell growth was significantly reduced by 68.4 ± 1.3% (siRNA-1) and by 60.9 ± 4.0% (siRNA-2) at 48 hours and by 72.7 ± 8.3% (siRNA-1) and 64.9 ± 6.0% (siRNA-2) at 72 hours compared to nontargeting con-trol (Fig. 5D). Clonogenic growth of HepG2.ST cells was also reduced by suppression of TUC339 with aver-age colony number of 38.0 ± 14.4/well (siRNA-1) and 39.3 ± 10.2/well (siRNA-2) compared to nontargeting control (71.7 ± 4.7/well) (Fig. 5E). We also examined anchorage-inde-pendent growth by examining cell growth in soft agar. Compared with nontargeting controls, siRNAs against TUC339 reduced growth in soft agar of HepG2.ST cells by 53.1 ± 4.1% (siRNA-1) and 63.3 ± 4.6% (siRNA-2) (Fig. 7C).

Next we investigated the effect of enforced expression of TUC339 in HCC cells. The full length of TUC339 was cloned into pcDNA3.1(+) expression vector (Invitrogen) downstream of the CMV promoter and upstream of the bovine growth hormone polyadenyl-ation sequence to ensure the vector expresses only the transcript of TUC339 without any lengthy extra-sequence or protein-coding vector sequences.10 Hep3B cells and PLC/PRF/5 cells were transfected with either TUC339 expression vector or empty vector controls. The expres-sion of TUC339 in PLC/PRF/5 cells at 48 hours after transfection was increased by 78.4-fold compared to empty vector control (Fig. 6A). Enforced expression of TUC339 increased cell growth by 30.5% and 48.9% in Hep3B cells and 216.7%


B

C

1.0

78.4

0102030405060708090

100

Empty vector TUC339TU

C33

9/R

NU

6 re

lativ

e to

con

trolA

0 24 48 720

5

10

15

20

25

30

35

40

45

Cel

l num

ber, ×

1000

Empty vectorTUC339

(hr)

Hep3B

*

*

0

20

40

60

80

100

120

140

160

180

0 24 48 72

Cel

l num

ber, ×

1000

Empty vectorTUC339

(hr)

PLC/PRF/5

*

*

Hep3B

0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4

Fluo

resc

ence

rela

tive

to c

ontro

l

Empty vector TUC339

*

0.0

0.5

1.0

1.5

2.0

2.5

Empty vector TUC339Fluo

resc

ence

rela

tive

to c

ontro

l

PLC/PRF/5

*

Figure 6. Enforced expression of TUC339 enhances cell growth. Cells were transfected with plasmids expressing full-length TUC339 or empty vector control using electroporation (Amaxa Nucleofector V kit, Lonza), and after 48 hours cells were used for anchorage-dependent and anchorage-independent growth assays. (A) Quantitative RT-PCR for TUC339. RNA was extracted from PLC/PRF/5 cells at 48 hours after transfection and qRT-PCR was performed. The expression of TUC339 was expressed relative to that with empty vector control. Bars represent mean ± SEM of 3 determinants. (B) Growth curve assay. Cells were plated on 24-well plates at 1,000 cells per well and the number of viable cells in each well was counted using hemocytometer with trypan blue staining. Each plot represents mean ± SEM of 3 separate determinants. *, P < 0.05. (C) Soft agar assay. Cells were plated in a 96-well plate with cell culture medium containing 0.4% agar at 600 cells per well over a base agar layer consist of culture medium containing 0.6% agar. After incubation of 7 days, the number of colonies was evaluated fluorometrically. Bars represent the mean ± SEM of 6 separate determinations. *, P < 0.05.

and 53.3% in PLC/PRF/5 cells at 48 hours and 72 hours, respectively (Fig. 6B). Likewise, transformed cell growth in soft agar was increased by 1.26-fold in Hep3B cells and 1.87-fold in PLC/PRF/5 cells compared to empty vector control (Fig. 6C). In combination, these studies show that suppression of endogenous TUC339 expres-sion reduces, whereas enforced expression increases

proliferation confirm the involve-ment of TUC339 in HCC cell growth.

Genome-wide gene expression anal-ysis. To investigate the involvement of TUC339 in biological functions of HCC we performed genome-wide gene expression analysis using Human 12x 135K Gene Expression Array (Roche NimbleGen). The genome-wide gene expression was compared between HepG2.ST cells transfected with siRNA against TUC339 (siRNA-2) and with nontar-geting control (Dharmacon). By sup-pression of TUC339 expression in HepG2.ST cells, a total of 843 genes were detected to show differential expression with 2-fold change (374 genes increased and 469 genes decreased) as shown in Figure 7A. Full lists of differentially expressed genes are available in the supplemen-tary data. The DAVID gene functional classification tool revealed a signifi-cant enrichment of 9 gene ontologies with false discovery rate corrected P value less than 0.05 (Fig. 7B). Inter-estingly, 4 gene ontologies related with cell adhesion were identified. Specific differentially expressed genes implicated in cell adhesion are listed in the supplementary data.

TUC339 reduces HCC cell adhesion to extracellular matrix. Since the genome-wide gene expression analy-sis implicated the involvement of TUC339 in cell adhesion, we next investigated the effect of TUC339 modulation on cell adhesion in HCC cells. Attachment assay was per-formed to assess the adhesion of Hep3B, PLC/PRF/5, and HepG2.ST cells to extracellular matrix. When 12,500, 25,000, and 50,000 cells/

wells were seeded, the percentage of attached Hep3B cells transfected with TUC339 was 12.3 ± 0.4%, 12.7 ± 0.6%, and 10.2 ± 0.1%, whereas the percentage of attached cells transfected with empty vector control was 8.9 ± 1.1%, 8.5 ± 0.3%, and 6.1 ± 0.1%, respectively (Fig. 8A). Similar results were obtained with PLC/PRF/5 cells (Fig. 8A). Sub-sequently, we evaluated the effect of suppression of


TUC339 using siRNA-2 in HepG2.ST cells. The percent-age of attached cells transfected with siRNA-2 was 11.2 ± 0.3%, 10.1 ± 0.1%, and 10.7 ± 0.5% in HepG2 cells at 12,500, 25,000, and 50,000 cells/well, compared to 13.1 ± 0.1%, 12.3±± 0.2%, and 12.3 ± 0.3% in HepG2.ST cells transfected with control, respectively (Fig. 8B).

DiscussionIn these studies, we demonstrate that HCC cell–derived extracellular vesicles contain ucRNA and that these extra-cellular vesicles can be taken up by other HCC cells

resulting in intercellular transfer of ucRNA with subsequent modulation of cellular function. The expression of several of these lncRNA is dramatically different in extracellular vesicles from that in the cells of origin. TUC339 was identi-fied as one of the most highly selectively enriched ucRNA in tumor cell–derived extracellular vesicles. These observa-tions extend the role of extracellular vesicles in mediating intercellular transfer of cellular constituents by identifying vesicles containing lncRNA as biologically functional active signaling intermediates. These studies also identify a novel lncRNA gene that is capable of functioning as an intercellular signaling mediator and modulating tumor cell behavior.

Active transcription and expression of a large number of nonprotein coding RNAs has been identified by whole genome transcriptome analysis in mammalian cells.11-13 These noncoding RNA subserve several diverse func-tions, which include crucial roles in the regulation of gene expression and biological processes during cancer development. Among these, the microRNAs have been extensively studied, and deregulated expression of miRNA has been implicated in essential biological func-tions involved in tumorigenesis.14,15 It is likely that other noncoding RNA, such as the lncRNAs, may be involved in human cancers although they have been less well stud-ied. LncRNA such as Air, Hotair, and Xist are involved in aberrant epigenetic gene regulation in cancers.16 Deregu-lated expression of some lncRNA occurs in HCC but their contribution to tumor formation or growth is largely unknown. Despite the large numbers of lncRNA, very few lncRNAs such as H19, MEG3 12, MALAT-1, HULC, and the ucRNA TUC338 have been implicated in hepato-carcinogenesis.17-21 Our studies have identified an addi-tional lncRNA, TUC339 involved in HCC, and which has a novel role as an intercellular signaling mediator. Both TUC338 and TUC339 can modulate transformed cell growth in hepatocytes. However, TUC339 is highly enriched within extracellular vesicles whereas TUC338 is not, suggesting that these 2 ucRNA may play different roles.

These findings extend the known biological roles of ucRNA and possibly other lncRNA as well to intercellular signaling and environmental modulation of cellular pro-cesses in hepatocarcinogenesis. A biological role of these novel RNA genes in HCC growth is supported by the exis-tence of specific mechanisms for selective enrichment within extracellular vesicles and their impact on tumor cell growth. Our studies provide one of the first evidences that ucRNA can function as intercellular signaling intermedi-ates. These observations are of critical functional impor-tance because they extend the influence of the regulatory roles played by these and other lncRNA and indicate poten-tial contributions in maintenance of tissue homeostasis as

Figure 7. TUC339 knockdown alters gene expression. (A) A genome-wide expression analysis was performed by comparing the expression of genes in HepG2.ST cells with TUC339 knockdown to that with nontargeting control using NimbleGen gene expression 12 × 135K arrays (Roche NimbleGen). Differential expressions of genes are plotted (axis, intensity). (B) Enriched gene ontologies of genes with altered expression by TUC339 knockdown. Total 843 genes with fold change >2 or <2 were analyzed using DAVID v6.7 program. Enriched gene ontologies with P < 0.05 (false discovery rate corrected) are shown. FDR = false discovery rate.


Hep3B

101214

cells

, %Empty vector

TUC339* *

A

02468

Atta

ched

c

12.5 25 50

*

Plated cell number, ×1000 cells

PLC/PRF/5

141618

ls, %

Empty vector

TUC339

02468

101214

Atta

ched

cel

l

**

*

12.5 25 50Plated cell number, ×1000 cells

Empty vector TUC339

B HepG2 STB HepG2.ST

8101214

d ce

lls, %

non-targeting controluc.339 siRNA-2

* **

0246

12.5 25 50Plated cell number, ×1000 cells

Atta

ched

Figure 8. Enforced TUC339 expression modulates cell attachment. Hep3B and PLC/PRF/5 cells transfected with TUC339 expression vector or empty vector control and HepG2.ST cells transfected with siRNA against TUC339 or nontargeting control cells were labeled with green fluorescent dye (CellTrackerGreen CMFDA, Invitrogen), seeded on a collagen I-coated 96-well plate and incubated at 37°C for 30 minutes. Cells were washed with serum-free medium and fluorescence was measured before and after washing. The number of cells attached to the plate was estimated based on the change in fluorescence before and after the wash. (A) Hep3B and PLC/PRF/5 with representative images of PLC/PRF/5 cells after washing at 50,000 cells per well. Bars express mean ± SEM of 3 studies, *, P < 0.05. (B) HepG2.ST. Bars express mean ± SEM of 3 studies, *, P < 0.05.

well as to the intercellular interactions that may contribute to cancer growth and progression.

Extracellular vesicle–mediated transfer of lncRNA such as TUC339 thus represents a unique mechanism by which tumor cells can modulate their environment and promote HCC growth. While the focus of our studies has been on the potential role of lncRNA as signaling mediators, there is information from several studies that provides additional biological or therapeutic roles for extracellular vesicles in general. These include roles as delivery agents for drugs, vaccines, and gene therapy vectors. Thus, information regarding the RNA content is likely to have broader impor-tance. The ability to detect and isolate extracellular vesicles from the circulation emphasizes the potential for selective extracellular vesicle RNA content as biomarkers of disease. Based on our findings, further studies to evaluate such extracellular vesicle ucRNA as potential markers for HCC are warranted.

Materials and MethodsCell lines and culture. Human HCC cell lines, Hep3B,

HepG2, and PLC/PRF/5, were obtained from the American Type Culture Collection (Manassas, VA). HepG2.ST, which express high levels of the uc.339 transcript, were obtained from HepG2 cells by spontaneous transformation. Com-pared to HepG2 cells, HepG2.ST cells have increased pro-liferation and lower levels of expression of α-fetoprotein and α-1 antitrypsin-1 (Suppl. Fig. S1). All cell lines were authenticated by short tandem repeat analysis using Identi-filer (Applied Biosystems, Carlsbad, CA). Cells were main-tained in Dulbecco’s modified Eagle’s medium (Invitrogen, Carlsbad, CA) containing 10% fetal bovine serum and 1% antibiotic-antimycotic (Invitrogen) at 37°C with 5% CO

2.

For extracellular vesicle studies, vesicle depleted (VD) medium was prepared by centrifuging cell-culture medium at 100,000g overnight to spin down any preexisting vesicu-lar content.

Isolation of HCC cells–derived vesicles. Extracellular vesi-cles released from HCC cells were isolated from culture media by sequential ultracentrifugation and density gradi-ent separation using protocols similar to those described previously.4 Briefly, HCC cells were plated with VD medium on collagen-coated 10-cm dishes for 3 to 4 days prior to collection of extracellular vesicles. The isolated extracellular vesicles were used immediately or resus-pended in phosphate buffered saline (PBS) and stored at −80°C. Isolated vesicles were analyzed using nanoparticle tracking analyses (Nanosight, Worthington, OH) for quanti-tation and size determination.

Transmission electron microscopy. Pellets of vesicles were fixed with 2.5% glutaraldehyde, postfixed with 1% osmium tetroxide, and embedded. Ultrathin sections were stained with uranyl acetate and lead citrate, and images were


obtained using an EM208S transmission electron micro-scope (Philips, Eindhoven, the Netherlands). The size of vesicles was assessed using NIH image J software (National Institutes of Health, Bethesda, MD).

Cellular internalization of Hep3B-derived extracellular vesi-cles. Hep3B-derived extracellular vesicles were labeled with PKH67 (Sigma-Aldrich, St. Louis, MO) as previously reported.4 The labeled extracellular vesicles were added onto HepG2 cells cultured in a 4-chamber slide. After incu-bation for 24 hours, cells were fixed with methanol, mounted with ProLong Gold Antifade Reagents with DAPI (Molecular Probes, Inc., Eugene, OR), and examined by fluorescence microscopy (Nikon Eclipse 80i, Nikon Instru-ments, Inc., Tokyo, Japan).

Ultraconserved RNA profiling in extracellular vesicles. Expression profiling of 474 ultraconserved RNAs (ucRNAs) was performed using an Applied Biosystems 7900HT real-time PCR instrument equipped with a 384-well reaction plate as previously described.4 RNA samples from extracel-lular vesicles or donor cells (n = 4 per each cell line) were treated with DNase I (Qiagen Inc., Valencia, CA). A total of 600 ng of DNase-treated RNA was reverse transcribed using SuperScript II transcriptase and random primers (Invitrogen). Real-time PCT was performed and the cycle number at which the reaction crossed a threshold (CT) was determined for each gene. Raw CT values were normalized using a median CT value (ΔCT = CT

ucRNA − CT

median), and

the relative amount of each ucRNA in extracellular vesicles relative to donor cells (fold change) was described using the equation 2−ΔΔCT where ΔΔCT = ΔCT

extracellular vesicle −

ΔCTdonor cell

. Profiling data are reported in the supplemen-tary data.

Quantitative Reverse-Transcriptase Polymerase Chain Reac-tion (qRT-PCR). cDNA was transcribed from a total of 300 ng of DNase I-treated RNA using the cDNA reverse transcrip-tion kit and random primers (iScript cDNA synthesis kit, BioRad, Hercules, CA). qRT-PCR was performed using a Mx3000p System (Stratagene, La Jolla, CA) to detect uc.339/TUC339 (ucRNA transcribed from uc.339), and U6 small nuclear RNA (RNU6) with SYBR green I (SYBR Advantage qPCR Premix, Clontech, Mountain View, CA). The following PCR primers were used: TUC339 primers, sense: 5′-GATGAGGCCCCGAGTTTAAT-3′, antisense: 5′-AGATGGAGGATCGGTGTGAA-3′, U6, sense: 5′- CTCGCTTCGGCAGCACA-3′, antisense: 5′-AACGCTT CACGAATTTGCGT-3′.

RACE cloning. 3′ and 5′ Rapid amplification of cDNA ends (RACE) was performed using SMARTer RACE cDNA Amplification Kit (Clontech) to characterize 5′ and 3′ sequences of the gene encoding uc.339. Total RNA was

extracted from HepG2.ST cells using TRIzol reagent (Invi-trogen) and polyadenylated using the poly(A) tailing kit (Ambion, Austin, TX). RACE-ready cDNA was generated, and cDNA ends were amplified with Universal primer mix and gene-specific primers. PCR products were then run in a 1.0% agarose gel, and DNA was extracted, cloned into pCR8/GW/TOPO vector (Invitrogen), and sequenced with a sequence analyzer (ABI PRISM 3730xl DNA Analyzer, Applied Biosystems). Gene-specific primers of TUC339 used for RACE were as follows (5′ to 3′): GSP1 (5′ RACE), CCCTCCCTTTCAGGAGCTCAGGGCCATA; GSP2 (3′ RACE), GGAGGAATTTCAATGCGGCCAATCCATC.

Transfection of siRNAs to TUC339. HCC cells were trans-fected with siRNAs using Lipofectamine 2000 reagent (Invitrogen). siRNAs were designed using siDESIGN (Dharmacon, Lafayette, CO) with an input of the complete sequence of uc.339. The 2 highest-ranked target sequences were synthesized as ON TARGET siRNA (5′ to 3′): siRNA-1, GGAAUUUCAAUGCGGCCAA and siRNA-2, UUG-GCCGCAUUGAAAUUCC. Cells were transfected with siRNAs to TUC339 or nontargeting control (ON TARGET Plus siCONTROL Nontargeting pool, Dharmacon) at a concentration of 100 nM. Cells were collected after 48 hours for further study.

Transfection of TUC339 expression vector. Full length of TUC339 was cloned into pcDNA3.1(+) (Invitrogen). Prim-ers that incorporated 5′ BamHI and 3′ XhoI restriction sites were used to amplify the full-length TUC339 transcript. PCR products were digested with BamHI and XhoI (Pro-mega) and cloned into the pcDNA3.1(+) vector. HCC cells were transfected with 2 µg of TUC339 expressing vector or empty vector control using electroporation (Amaxa Nucleo-fector V kit, Lonza, Basel, Switzerland) with T-28 program, and after 48 hours cells were used for further experiments.

Genome-wide gene expression analysis. HepG2.ST cells were transfected with either siRNA against TUC339 or nontargeting control and RNA was extracted. Genome-wide gene expression analysis was performed with the Human 12x 135K Gene Expression Array (Roche Nimble-Gen, Inc., Madison, WI). Data were extracted and analyzed with GeneSpring GX software ver. 11.5.1 (Agilent Tech-nologies, Foster City, CA), and genes that were signifi-cantly differentially expressed were identified. Gene ontology analysis was performed using the Database for Annotation, Visualization, and Integrated Discovery v6.722,23 to identify enriched gene ontologies in genes with altered expression by TUC339 knockdown.

Cell growth assays. For anchorage-dependent growth assay, cells were plated (10,000 cells per well) in collagen-coated 24-well plates and the number of viable cells was


counted using trypan blue staining at each time point. For clonogenic assay, cells were plated on collagen-coated 6-well plates at 200 cells per well. After 1 week cells were fixed and stained with 0.5% of crystal violet in 10% neu-tralized buffered formalin for 15 minutes. Numbers of colo-nies in each well were counted using NIH Image J software (National Institute of Health). For anchorage-independent cell growth assay, cells were plated in a growth medium containing 0.4% agar (600 cells per well) on a bottom layer of medium containing 0.6% agar. After 1 week of incuba-tion, cell growth was assayed fluorometrically using ala-marBlue (Biosource International, Camarillo, CA) and a FLUOstar Omega Microplate Reader (BMG Labtech, Offenburg, WI).

Attachment assay. Cells were harvested by trypsinization, resuspended in a serum-free medium containing 10 µM of green fluorescent dye (CellTrackerGreen CMFDA, Invitro-gen), and incubated at 37°C for 30 minutes. After incubation cells were washed twice with serum-free medium and plated on a 96-well plate coated with rat tail collagen I (BD Biosci-ences, San Jose, CA) and incubated at 37°C for 30 minutes. Cells were gently washed with serum-free medium thrice to remove unattached cells. Cell fluorescence was measured before and after the wash using a FLUOstar Omega Micro-plate Reader (BMG Labtech, Offenburg, WI) with a fixed gain. The attached cell number was calculated using the fluorescence before and after the wash to remove unattached cells. There was a favorable linear correlation between fluo-rescence and seeded cell number (Suppl. Fig. S4).

Statistical analysis. Data were analyzed by ANOVA fol-lowed by Fisher’s PLSD test. Results were considered to be statistically significant when P < 0.05. Data were expressed as the mean and standard error.

Authors’ Note

The TUC339 sequence has been deposited in Genbank, accession number KC508659. Profiling data are reported in the supplemen-tary data, and on publication will also be submitted to Vesiclepedia (www.microvesicles.org), an online compendium of molecular data from extracellular vesicles. The content is solely the respon-sibility of the authors and does not necessarily represent the offi-cial views of the National Institutes of Health (the funding agency).

Declaration of Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial sup-port for the research, authorship, and/or publication of this

article: Research reported in this article was supported by the National Institute of Diabetes and Digestive and Kidney Diseases of the National Institutes of Health under Award Number R01DK069370.

References

1. Hui EE, Bhatia SN. Micromechanical control of cell-cell interactions.

Proc Natl Acad Sci U S A. 2007;104:5722-6.

2. van Niel G, Porto-Carreiro I, Simoes S, Raposo G. Exosomes: a

common pathway for a specialized function. J Biochem. 2006;140:

13-21.

3. Valadi H, Ekstrom K, Bossios A, Sjostrand M, Lee JJ, Lotvall JO.

Exosome-mediated transfer of mRNAs and microRNAs is a novel

mechanism of genetic exchange between cells. Nat Cell Biol.

2007;9:654-9.

4. Kogure T, Lin WL, Yan IK, Braconi C, Patel T. Intercellular nanoves-

icle-mediated microRNA transfer: a mechanism of environmen-

tal modulation of hepatocellular cancer cell growth. Hepatology.

2011;54:1237-48.

5. Braconi C, Valeri N, Kogure T, et al. Expression and functional role of

a transcribed noncoding RNA with an ultraconserved element in hepa-

tocellular carcinoma. Proc Natl Acad Sci U S A. 2011;108:786-91.

6. Bejerano G, Pheasant M, Makunin I, et al. Ultraconserved elements in

the human genome. Science. 2004;304:1321-5.

7. Calin GA, Liu CG, Ferracin M, et al. Ultraconserved regions encod-

ing ncRNAs are altered in human leukemias and carcinomas. Cancer

Cell. 2007;12:215-29.

8. Valenti R, Huber V, Iero M, Filipazzi P, Parmiani G, Rivoltini L.

Tumor-released microvesicles as vehicles of immunosuppression.

Cancer Res. 2007;67:2912-5.

9. Burge C, Karlin S. Prediction of complete gene structures in human

genomic DNA. J Mol Biol. 1997;268:78-94.

10. Mohamed JS, Gaughwin PM, Lim B, Robson P, Lipovich L. Con-

served long noncoding RNAs transcriptionally regulated by Oct4 and

Nanog modulate pluripotency in mouse embryonic stem cells. RNA.

2010;16:324-37.

11. Sharp PA. The centrality of RNA. Cell. 2009;136:577-80.

12. Pan Q, Shai O, Lee LJ, Frey BJ, Blencowe BJ. Deep surveying of

alternative splicing complexity in the human transcriptome by high-

throughput sequencing. Nat Genet. 2008;40:1413-5.

13. Mortazavi A, Williams BA, McCue K, Schaeffer L, Wold B. Mapping

and quantifying mammalian transcriptomes by RNA-Seq. Nat Meth-

ods. 2008;5:621-8.

14. Ryan BM, Robles AI, Harris CC. Genetic variation in microRNA

networks: the implications for cancer research. Nat Rev Cancer.

2010;10:389-402.

15. Croce CM. Causes and consequences of microRNA dysregulation in

cancer. Nat Rev Genet. 2009;10:704-14.

16. Mercer TR, Dinger ME, Mattick JS. Long non-coding RNAs: insights

into functions. Nat Rev Genet. 2009;10:155-9.

17. Matouk IJ, Abbasi I, Hochberg A, Galun E, Dweik H, Akkawi

M. Highly upregulated in liver cancer noncoding RNA is overex-

pressed in hepatic colorectal metastasis. Eur J Gastroenterol Hepatol.

2009;21:688-92.


18. Matouk IJ, DeGroot N, Mezan S, et al. The H19 non-coding RNA is

essential for human tumor growth. PLoS One. 2007;2:e845.

19. Lai MC, Yang Z, Zhou L, et al. Long non-coding RNA MALAT-1

overexpression predicts tumor recurrence of hepatocellular carcinoma

after liver transplantation. Med Oncol. 2012;29:1810-6.

20. Panzitt K, Tschernatsch MM, Guelly C, et al. Characterization

of HULC, a novel gene with striking up-regulation in hepatocel-

lular carcinoma, as noncoding RNA. Gastroenterology. 2007;132:

330-42.

21. Braconi C, Kogure T, Valeri N, et al. microRNA-29 can regulate

expression of the long non-coding RNA gene MEG3 in hepatocellular

cancer. Oncogene. 2011;30:4750-6.

22. Huang da W, Sherman BT, Lempicki RA. Systematic and integrative

analysis of large gene lists using DAVID bioinformatics resources.

Nat Protoc. 2009;4:44-57.

23. Huang da W, Sherman BT, Lempicki RA. Bioinformatics enrichment

tools: paths toward the comprehensive functional analysis of large

gene lists. Nucleic Acids Res. 2009;37:1-13.

Extracellular Vesicle–Mediated Transfer

Documents

Transcript of Extracellular Vesicle–Mediated Transfer