Vol. 171, No. 3JOURNAL OF BACTERIOLOGY, Mar. 1989, p. 1652-16570021-9193/89/031652-06$02.00/0Copyright © 1989, American Society for Microbiology

Extent of the DNA Sequence Required in Integration ofStaphylococcal Bacteriophage L54a

CHIA Y. LEE* AND SARA L. BURANENDepartment of Microbiology, University of Kansas Medical Center, Kansas City, Kansas 66103

Received 23 August 1988/Accepted 11 December 1988

We characterized the minimum length of the DNA sequence of the attachment sites involved in theintegrative recombination of staphylococcal bacteriophage L54a. A DNA fragment carrying the functional viralattachment site (aiP) or the bacterial attachment site (altO) was sequentially trimmed, redoned, and tested forintegrative recombination in vivo. The size of the functional aitd site was at least 228 base pairs (bp) but nomore than 235 bp. The left endpoint of the aIdP site was located to between positions -142 and -140, whereasthe right endpoint was located to between positions +86 and +93 with respect to the center of the coresequence. The atOB site was located to within a 27-bp sequence, from position -15 to + 12, which included the18-bp core sequence.

Staphylococcal bacteriophage L54a is a temperate phagethat was originally discovered as one of the two prophages inStaphylococcus aureus PS54 (4). Its genome size is about 45kilobases (kb), and the genome is circularly permuted (un-published data). During lysogeny, bacteriophage L54a in-serts its genome into the host chromosome. Integrativerecombination occurs between the specific viral attachmentsite (attP) on the bacteriophage genome and the attL54a site(attB) on the host chromosome. As a result of integration,two additional attachment sites, attL and attR, are generatedon the left and the right sides of the prophage genome,respectively. In excision, attL and attR recombine andregenerate attB and attP. The attB site is located at the 3'end of the lipase (geh) structural gene. As a consequence,lysogens of L54a are lipase negative because of insertionalinactivation of the lipase structural ;ene (11, 12). Curing ofthe prophage restores the lipase activity of the host. We havepreviously cloned and sequenced the DNA fragments con-taining the four attachment sites (13). All four att sites sharean identical 18-base-pair (bp) core sequence. Apparently,recombination requires the core sequence. However, thequestion as to how much of the DNA sequence outside thecore sequence is required for the function of the attachmentsites attP and attB remains unanswered. Here we report theminimum sizes of the attB and attP sites.

MATERIALS AND METHODSPhage and bacterial strains. The isolation and propagation

of staphylococcal bacteriophage L54a were done as de-scribed previously (11). S. aureus RN4220 (10), a restriction-deficient variant of S. aureus 8325-4, was used as therecipient in protoplast transformations. Protoplast transfor-mation was performed by the procedure of Chang and Cohen(2). Staphylococcal bacteriophage transductions were per-formed at a multiplicity of infection of 0.1, as describedpreviously (25). Escherichia coli LE392 was used for trans-formation with cloned DNA and for the preparation ofplasmid DNA.

Chenmcals and media. Media used for routine cultivationand detection of lipase activity have been described previ-ously (11). Chemicals were purchased from Sigma ChemicalCo. (St. Louis, Mo.). Restriction enzymes, bacteriophage T4

* Corresponding author.

DNA ligase, nick translation reagents, oligonucleotide link-ers, and nuclease BAL 31 were purchased from BethesdaResearch Laboratories, Inc. (Gaithersburg, Md.), and NewEngland BioLabs, Inc. (Beverly, Mass.). The large fragmentofDNA polymerase (Klenow fragment) was purchased fromBoehringer Mannheim Biochemicals (Indianapolis, Ind.).[a-35S]dATP and [a-32P]dCTP were purchased from Amer-sham Corp. (Arlington Heights, Ill.) and Dupont, NENResearch Products (Boston, Mass.).Recombinant DNA methods. General DNA methods were

carried out as described by Maniatis et al. (15). Rapidsmall-scale DNA purification was done by the method ofHolmes and Quigley (8). The transfer ofDNA to nitrocellu-lose membranes was done by the method of Southern (27).The conditions used for hybridization have been describedpreviously (11). The isolation of bulk chromosomal DNAfrom S. aureus was done by the method of Dyer and landolo(5). Electroelution of DNA bands from agarose gels wascanried out with an electroeluter (International BiologicalInc.) by following the instructions of the manufacturer.DNA sequence analysis. Restriction endonuclease frag-

ments were cloned into the M13 bacteriophage derivativesmpl8 and mpl9 (30) and propagated into E. coli JM103.DNA sequencing was carried out by the dideoxy-chaintermination method of Sanger et al. (24).Trim g of att fragments. Plasmids containing the att

fragment were linearized by endonuclease digestion at suit-able unique sites and were further digested with BAL 31exonuclease to obtain deletions with various lengths extend-ing toward the core sequence of the att sites. The deletedDNA fragments were ligated with a synthetic oligonucleo-tide linker. Conditions and procedures for ligation andnuclease digestion were as described by Maniatis et al. (15).

RESULTSConstruction of pasnid pLI50C. We have reported previ-

ously (13) the construction of plasmid pLI463, which con-tained a 2.1-kb L54a DNA fragment carrying the recombi-nase gene and the functional attP site that is necessary forL54a integration. When strain RN4220 was transformed withpLI463, the plasmid integrated into the attL54a (i.e., attB)site near the 3' end of the lipase structural gene on thechromosome. Strain RN4220(pLI463) therefore is phenotyp-ically lipase negative. Since plasmid pLI463 behaves like

1652

on March 24, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

BACTERIOPHAGE ATTACHMENT SITE 1653

Kpnl Cial

pLI475

iHnd ill

Clol

CIO

ClaljBa3l A360bpEcoRI linker

mde/EcoK1 no Pvul

Kpnl Clal

/ ttP

pLI5O6

EcoRIl

FIG. 1. Construction of plasmid pLI506. Plasmid pLI463 con-tained a 2.1-kb L54a DNA fragment that carried the recombinasegene and the functional attP site. It was digested with the ClaIrestriction enzyme. The linearized DNA was digested with exonu-

clease BAL 31 to remove approximately 360 bp from both ends,including the attP site (ClaI is 229 bp away from the center of thecore sequence of attP). The deleted DNA was end filled with theKlenow fragment and ligated with an EcoRI linker to generatepLI486. The DNA fragment that contained the recombinase genewith deleted attP was digested with EcoRI and HaeIII, end filledwith the Klenow fragment, and ligated to the PvuII site of pLI476 togenerate plasmid pLI506. The 559-bp attP segment of pLI476 wasoriginally from plasmid pLI475, which was constructed by ligating a3.5-kb L54a ClaI fragment containing the functional attP but not therecombinase gene to the ClaI site of shuttle vector pLI50 (13).

phage L54a with respect to integration and excision, is easyto manipulate, and confers antibiotic resistance, we intendedto characterize the size of the attP site that is carried onplasmid pLI463. However, because the recombinase gene inpLI463 is very close to the attP site, it was necessary toseparate the attP site from the recombinase gene in such away that trimming would not affect the expression of therecombinase. To achieve this, plasmids pLI463 and pLI475(a plasmid containing the functional L54a attP site [13]) wereused to generate plasmid pLI506. The details of the con-struction are shown in Fig. 1. The constructed plasmidpLI506 contained an attP site and a recombinase gene thatwere separated by about 2.3 kb on one side and 2.8 kb on theother. To test whether pLI506 carries both the functional

attP site and the intact recombinase gene, the plasmid wastransformed into protoplasts derived from RN4220. StrainRN4220(pLI506) showed a lipase-negative phenotype, indi-cating that both the attP site and the recombinase gene onthe plasmid remained intact. The integration of pLI506 intothe attB site on the chromosome of RN4220 was confirmedby Southern analysis (data not shown).

Size of the attP site. To define the size of the attP site,pLI506 was digested either with ClaI (for defining the limiton the right side) or with KpnI (for defining the limit on theleft side). The linearized plasmid was treated with exonucle-ase BAL 31 to generate deletions with various lengths, andthen a BamHI linker (CGGGATCCCG) was inserted afterthe ends were made flush with the Klenow fragment. Theresultant plasmids were first propagated into E. coli LE392and characterized and then transformed into protoplasts thatwere derived from strain RN4220. The presence of recom-binase activity was tested by assaying the transformants forlipase activity. The presence of lipase-negative transfor-mants indicated that the plasmids in the transformantscontained the functional attP site that was able to integrateinto the chromosomal attB site located on the lipase gene.On the other hand, the presence of lipase-positive transfor-mants indicated that the nonfunctional attP site was carriedby the plasmids as a result of a deletion. Plasmids pCL1623-2and pCL1623-3 defined the right endpoint (P' arm as definedin the lambda system [29]) of attP to be between positions+86 and +93, whereas the left endpoint (P arm) was definedby plasmids pCL1544 and pCL1540 to be between positions-140 and -142 (Fig. 2). The precise endpoint of thesedeletions was determined by DNA sequencing. These resultsindicate that the size of the attP site is in the range of 228 to235 bp (see Fig. 4 for the relevant DNA sequences).

Size of the attB site. We have shown previously (12, 13)that the attB site resides at the 3' end of the lipase structuralgene. A ClaI fragment containing the attB site was clonedinto the M13mpl9 vector. This clone, mpl9gehD, containeda unique AccI site on the left side of the attB site at position-240 and a unique HindIII site on the right side at position+363. To generate deletions toward the core sequence ofattB, mpl9gehD was linearized with either AccI or HindIIIand was then digested with exonuclease BAL 31 to generatedeletions. The deleted DNA fragments were end filled withthe Klenow fragment, and either a BamHI linker (for trim-ming on the left side) or a HindIll linker (CAAGCTTG; fortrimming on the right side) was inserted. The trimmed attBfragments were recloned into E. coli-S. aureus shuttle vectorpLI50, and the resultant plasmids were transformed into theprotoplasts derived from S. aureus RN4220.The strategy to test the functional limit of the attB site was

similar to the in vivo recombination system of coliphagelambda described by Mizuuchi and Mizuuchi (17). The straincontaining a plasmid with the deleted attB site to be testedwas infected with wild-type bacteriophage L54a. The result-ant lysate was tested for the transduction efficiency of thedeleted plasmid to strain RN4220 by selecting for chloram-phenicol resistance. Because plasmids that carry a func-tional attB site can recombine with bacteriophage L54a bysite-specific recombination between the attB and the attPsites, these plasmids are transduced at a high frequency. Onthe other hand, plasmids carrying a nonfunctional attB siteas a result of a deletion cannot recombine with phage DNA,and they are transduced at a low frequency, which is at thesame level as that of the vector pLI50. However, in additionto the expected high and low levels of transduction effi-ciency, an intermediate frequency level was also detected,

VOL. 171, 1989

on March 24, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

1654 LEE AND BURANEN

-229Clal

0

| 9-

-

+330Kpnl

270

265

187

145

141

94*93*86*

82*

10

-.

I - -

I

-40

-161*

-142X 1

140A - -

-1128 --

il

+61

Plasmnd

p1.506

pLI51 1

pLI512

PCL 1620

pLI.513pCL1623

pCL 1626

pCL 1 623-3

pCL1623-2

pCL1629

pCL-1640

pCL11641

pLI521

pa11544

pCL1540

pCL01548

pCL 1552

pC011715

pCL1720

pC011729

Lipase Integration

+

+

+

+

+

+

+

+

+

+

4.

4.

+

+

+

+

FIG. 2. Integrative recombination of the plasmids carrying deleted attP sites. Numbers indicate the endpoints (in base pairs) from thecenter of the core sequence, which is denoted as position 0. Numbers with asterisks indicate that the endpoints were determined by DNAsequencing. Shuttle vector pLI50 was the cloning vehicle.

as shown in Fig. 3. The intermediate frequency (1.4 x 10-5to 4.2 x 10-5), which was about 6- to 40-fold lower than thehigh-frequency level (2.4 x 10-4 to 6.2 x 10-4) and 2- to10-fold higher than the low-frequency level (4.6 x 10-6 to 6.0x 10-6), can be interpreted to mean that the DNA fragmentcarried by those plasmids can recomibine with the genome ofL54a with a moderate efficiency.To define the minimum size of the attB site, we examined

the results shown in Fig. 3 for a decrease in the frequency asa function of deletion of the attB site toward the core. Thetransduction frequency of the plasmids containing deletionsthat extended from the right side of attB to position + 12remained at a high level, whereas deletion to position -1decreased transduction efficiency about 10-fold to an inter-mediate level. Further deletions beyond position -24 re-sulted in about a 100-fold decrease in the transductionfrequency to a level equivalent to that for plasmid vectorpLI50. These results imply that the right endpoint (i.e., B'arm) is limited to within +12 bp. It is interesting thatalthough half of the core sequence was deleted, plasmidpCL1337-3 was transduced at an intermediate frequency.Examination of the sequences after the deletion (with theaddition of a HindIII linker) revealed that there was nosignificant homology to the right half of the original coresequence. Thus, the partial recombination activity ofpCL1337-3 suggests that the left part of the core sequencecan serve as a functional attB site, but with a reducedefficiency.

Similarly, we were able to define the left endpoint to

within position -15 (Fig. 3). However, plasmids carryingdeletions beyond position -5 and even up to position +98,which deleted the entire core sequence, were all transducedat an intermediate frequency. This indicates that the se-quence between positions +98 and +363 contributes torecombination activity about two- to eightfold above thebasal level. To localize the DNA sequence that was respon-sible for the elevated recombination efficiency, we deletedplasmid pCL1323 from the HindIll site (right side) towardthe core by using BAL 31 exonuclease. Plasmid pCL1323-14, which carried the sequence from position +15 to aboutposition + 223, was transduced at an intermediate frequency,whereas plasmid pCL1323-21, which carried the sequencefrom position + 15 to about position + 173, was transduced ata low level (Table 1). This result indicates that the sequencebetween positions +173 and +223 contributes to partialrecombination activity. The DNA sequences around posi-tions +173 to +223 as well as around the core sequence ofattB are shown in Fig. 4.

DISCUSSION

Using plasmids that carry the bacteriophage L54a attP sitein the in vivo integrative site-specific recombination system,we showed that the size of the attP site is between 228 and235 bp. The sequence that is essential for recombination ofthe P' arm extends through position +86 but not beyondposition +93, whereas that of the P arm extends farther thanposition -140 but not beyond position -142. We therefore

l- J. BACTERIOL.

.-w-

on March 24, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

BACTERIOPHAGE ATTACHMENT SITE 1655

-240Accl

-60 -

6*~-57 -

-27 a

*-23 .

-18*1

+363Hindill0

Ii~ ~ ~ ~ ~ --~

'a-

I.

I. ~ ~ ~

I.

-15 U5*

+1*

+15

-71

+98

I :'

+36

+22** +12*-12

:-24*

Plasmid

pL12 1 0

pCL0131 1

pCL01314pCL01316p01.1318

pCL1318-2pCL01318-7

pCL1318-4pC011317pCL1320

pCL 1323

pCl11326

pCL01331

pCL1334pCL1340pCL01337pCL01337-3pC01343pC01346

pLJ50

Transductionfrequency5.Ox104

4.5x 1 4

3.lx10-45.3x10-4

4.5x10-42.6x1C4

4.5x1 4

2.4x10-5

3.5x10-51.4x10-5

1.6x105

2.4x 1i05

5.4x l0r4

6.2x10-42.4x1044.5x10-4

4.2x1l5

6.Ox 1 0-

4.6x104

5.2x 1a-6

FIG. 3. Integrative recombination of the plasmids carrying deleted attB sites. Symbols are the same as those described in the legend toFig. 2. The transduction frequency is expressed as the number of transductants per PFU.

located the right endpoint to within 7 bp and the left endpointto within 2 bp.We have previously suggested (13) that a nearly perfect

repeat sequence, AAAAAGGGCARA (where R is A or G),that is found four times (at positions -130, -110, +80, and+90) in the P and P' arms is the potential consensussequence for recombinase binding. The right repeat at the P'arm is located at positions +85 to +96. The results in Fig. 2indicate that when the P' arm is deleted from the right to

TABLE 1. Localization of the sequence to the right side of attBthat causes an elevated frequency in L54a transduction'

Position TransductionPlasmid of right

endpointb frequency

pCL1323 +363 1.6 x 10-5pCL1323-19 +266 4.3 x 10-5pCL1323-11 +256 3.1 x 10-5pCL1323-14 +223 4.1 x 10-5pCL1323-21 +173 6.6 x 10-6pCL1323-32 +93 4.8 x 10-6

a Plasmid pCL1323 was digested with HindIlI (at position +363), treatedwith exonuclease BAL 31, and ligatSd with a Hindlll linker. The resultantplasmids were transduced by bacteriophage L54a to S. aureus RN4220. Forall plasmids, the left endpoint was at position +15.

b The right endpoints of deletions were determined by agarose gel electro-phoresis. Plasmids were digested with BamHI (position + 15) and HindIlI andseparated on 2% agarose gels.

position +86, the integration function is abolished(pCL1626-2), indicating that the sequence beyond position+86, including part of the repeat, is essential for recombi-nation. However, the data also show that the sequencebeyond position +93 is not essential (pCL1326-3). Thisindicates that part of the 12-bp repeat is not required forintegration. Because of this and because a direct repeat ofGGGC was found to be repeated five times within thefunctional attP site (Fig. 4), we suggest that GGGC may bethe potential site for recombinase binding. However, theactual binding site requires further investigation. The notionthat GGGC may be the, potential binding site is supported bythe following. (i) The direct repeat GGGC, although a shortrepeat, is repeated three times (at positions -141, -130, and-110) in the P arm and two times (at positions +79 and +90)in the P' arm, with intervals of one or two helix turnsbetween the repeats. The intervals are thus perfect forprotein binding, if one considers that the DNA wraps aroundthe protein or protein complex so that one side of the DNAcomes into contact with the surface of the protein. It hasbeen shown that lambda Int specifically binds to the P' armat 10- to 11-bp intervals (3, 9, 22). Moreover, a similar periodof enhanced cutting (which may be related to the specific Intbinding of the P' arm) was obse;ved by DNase I protectionexperiments with a higher Int concentration than was re-quired for specific binding. The 10 bp of enhanced cuttingsuggests that lambda attP DNA wraps around Int and IHF toform a nucleosomelike structure during integrative recombi-

ommili

.

mmmmd

VOL. 171, 1989

I

on March 24, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

1656 LEE AND BURANEN

attP

-150 -140 -130 -120 -110 -100

5' GTTTTTTTGGGGCAAAAAAAGGGCAGATTATTTGA

-1 +1

AAAAGGGCAAACGCTl-------AT TA ---

+70 +80 +90 +100

-TAAT AGGGCAGATACC 3'

attB

-20 -10 -1+1 +10 +20

5' AAGTTAAACCAATCATACAAGGATGGGATCATGTCGATTT--+160 +170 +180 +190 +200 +210 +220 +230

---CTGAATTTAATATGCTATGTAAATCGTGCTGTTATCATGGCACATCAGATATAAGTAGCATCACAGTGTTG 3'

FIG. 4. Partial nucleotide sequences of the attP and attB sites. Sequences are numbered from the center of the core sequence; the baseimmediately to the right is position + 1, and the base immediately to the left is position -1. The core sequences are shown in boldface type.Underlined sequences are the direct repeats discussed in the text. Sequences to the right side of the attB site that contains the potentialsecondary site, as discussed in the text, are also shown.

nation (1, 6, 7, 20, 21). (ii) The average G+C content of S.aureus is only 30% (19), and hence, the probability of findinga GGGC sequence is once in every 1,975 bp. The fact thatthere are five such sequences within 235 bp indicates thatthis sequence does not occur randomly, and therefore, itspresence may be essential. (iii) Plasmid pCL1540, whichcarries the sequence to position -140 (deletion of a Gresidue from GGGC to GGC), was unable to integrate,whereas plasmid pCL1544, which carries the sequence toposition -142 with intact GGGC, did integrate.The size of the attB site was tested by an in vivo

recombination system. The functional attB site was limitedto within 27 bp, which included the 18-bp core sequence(Fig. 3). Although this approach was not as straightforwardas that used when the size of the attP site was determined,the experimental protocol gave a clear distinction (100-folddifference) in transduction frequency between a plasmidwith an intact attB site (pLI210) and a plasmid that containedno attB site (pLIS0). In S. aureus the high frequency oftransduction of plasmids has been observed (14, 18) whenhomologous sequences exist between transducing phage andthe plasmid being transduced. However, the homology wasextensive in those experiments. It has been documented thathomologous recombination in E. coli requires at least 20 bpof homology and that efficient homology recombinationrequires about 75 bp of homology (28). In the experimentsreported here, the homology between the transducing phageand the plasmids was only 18 bp; therefore, the high fre-quency of transduction that was observed was not due tohomologous recombination but to site-specific recombina-tion.

It is interesting that sequences between positions + 173 to+223 play a role in integrative recombination. One of thepossibilities is that a secondary integration site resideswithin these sequences. In the lambda system, numeroussecondary sites have been isolated and sequenced (23, 26).The efficiency of recombination between wild-type attP andvarious secondary sites has been compared (23). Althoughthe comparison did not give sufficient information to makequantitative predictions, the degree of homology of varioussecondary sites to the wild-type attB site at two junction-type Int protein-binding sites and the overlap region did,nevertheless, reflect the efficiency of integration with wild-type attP (23, 29). In L54a a computer search failed to revealany significant homology between the core sequence and theDNA sequence from about position +173 to about position+223. Since the protein-binding sites and the crossoverregion in L54a attB have not been identified, it is difficult tolocate the potential secondary site. Although it is likely thatthere is a secondary integration site, it is also possible that

the sequences between positions + 173 and +223 contributeto the elevated transduction frequency by a mechanism thatis not related to site-specific recombination. For example,the partial recombination activity could be caused by thesequence homology between the bacteriophage L54a ge-nome and the DNA between positions +173 and +223.However, this seems unlikely since we did not detect anyhomology between the L54a genome and the RN4220 chro-mosome by Southern hybridization even under low-strin-gency conditions.

In comparison, the size of attP in the lambda system was234 bp, from positions -152 to +82, and the attB siteconsisted only of the 15-bp core sequence plus 5 bp on eitherside (9, 16, 17). The L54a system is thus similar to thelambda system with respect to the size of attB and attP. Thefact that the functional L54a attP site is much larger than theattB site implies that the attP site plays a more importantrole in site-specific recombination than does the attB site.This contention is further supported by the observation thatthere are more potential protein-binding sites (sequencefeatures) in attP than in attB (13). In lambda, attP has beenshown to play a much more important role in integration andexcision (29).

In summary, we characterized the size of the attB and theattP sites of the staphylococcal phage L54a by using in vivosystems. The attP site was 228 to 235 bp long and was foundto be located between positions -142 and +93. The attB sitewas limited to within 27 bp, from positions -15 to + 12,which was only slightly larger than the core sequence.

ACKNOWLEDGMENTS

This work was supported in part by research grant DMB-8614082from the National Science Foundation and by BRSG grant S07RR05373 from the Biomedical Research Support Grant Program,Division of Research Resources, National Institutes of Health.

LITERATURE CITED1. Better, M., C. Lu, R. C. Williams, and H. Echols. 1982.

Site-specific DNA condensation and pairing mediated by the intprotein of bacteriophage lambda. Proc. Natl. Acad. Sci. USA79:5837-5841.

2. Chang, S., and S. N. Cohen. 1979. High frequency transforma-tion ofBacillus subtilis protoplasts by plasmid DNA. Mol. Gen.Genet. 168:111-115.

3. Davies, R. W., P. H. Sehreier, M. L. Kotewkcz, and H. Echols.1979. Studies on the binding of lambda Int protein to attachmentsite DNA; identification of a tight-binding site in the P' region.Nucleic Acids Res. 7:2255-2273.

4. Duval-flah, Y. 1972. Lysogenic conversion of the ligase gene inStaphylococcus pyogenes group III strains. Can. J. Microbiol.18:1491-1497.

___.

J. BACTERIUOL.

on March 24, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

BACTERIOPHAGE ATTACHMENT SITE 1657

5. Dyer, D. W., and J. J. landolo. 1983. Rapid isolation of DNAfrom Staphylococcus aureus. Appi. Environ. Microbiol. 46:283-285.

6. Echols, H., and G. Guarneros. 1983. Control of integration andexcision, p. 75-92. In R. W. Hendrix, J. W. Roberts, F. W.Stahl, and R. A. Weisberg (ed.), Lambda II. Cold SpringHarbor Laboratory, Cold Spring Harbor, N.Y.

7. Griffith, J. D., and H. A. Nash. 1985. Genetic rearrangement ofDNA induces knots with a unique topology: implications for themechanism of synapsis and crossing-over. Proc. Natl. Acad.Sci. USA 82:3124-3128.

8. Holmes, D. S., and M. Quigley. 1981. A rapid boiling method forthe preparation of bacterial plasmids. Anal. Biochem. 114:193-197.

9. Hsu, P. L., W. Ross, and A. Landy. 1980. The lambda att site:functional limits and interaction with Int protein. Nature(London) 285:85-91.

10. Kreiswirth, B. N., S. Lofdahl, M. J. Betley, M. O'Reilly, P. M.Shlievert, M. S. Bergdoll, and R. P. Novick. 1983. The toxicshock exotoxin structural gene is not detectably transmitted bya prophage. Nature (London) 305:709-712.

11. Lee, C. Y., and J. J. landolo. 1985. Mechanism of bacteriophageconversion of lipase activity in Staphylococcus aureus. J.Bacteriol. 164:288-293.

12. Lee, C. Y., and J. J. landolo. 1986. Lysogenic conversion ofstaphylococcal lipase is caused by insertion of the bacterio-phage L54a genome into the lipase structural gene. J. Bacteriol.166:385-391.

13. Lee, C. Y., and J. J. Iandolo. 1986. Integration of staphylococcalphage L54a occurs by site-specific recombination: structuralanalysis of the attachment sites. Proc. Natl. Acad. Sci. USA83:5474-5478.

14. Lofdahl, S., J. E. Sjostrom, and L. Philipson. 1981. Cloning ofrestriction fragments of DNA from staphylococcal bacterio-phage phi-11. J. Virol. 37:795-801.

15. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

16. Mizuuchi, K., R. Weisberg, L. Enquist, M. Mizuuchi, M. Burac-zynska, C. Foelier, P. L. Hsu, W. Ross, and A. Landy. 1981.Structure and function of the phage lambda att site: size,Int-binding sites, and location of the crossover point. ColdSpring Harbor Symp. Quant. Biol. 45:429-437.

17. Mizuuchi, M., and K. Mizuuchi. 1980. Integrative recombina-tion of bacteriophage lambda: extent of the DNA sequence

involved in attachment site function. Proc. Natl. Acad. Sci.USA 77:3220-3224.

18. Novick, R. P. 1967. Properties of a cryptic high-frequencytransducing phage in Staphylococcus aureus. Virology 33:155-166.

19. Oeding, P. 1984. Taxonomy and identification, p. 1-32. InC. S. F. Easmon and C. Adlam (ed.), Staphylococci and sta-phylococcal infections, vol. 1. Academic Press, Inc., NewYork.

20. Pollock, T. J., and H. A. Nash. 1983. Knotting of DNA causedby a genetic rearrangement: evidence for a nucleosome-likestructure in site-specific recombination of bacteriophagelambda. J. Mol. Biol. 170:1-18.

21. Richet, E., P. Abcarian, and H. A. Nash. 1986. The interaction ofrecombination protein with supercoiled DNA: defining the roleof supercoiling in lambda integrative recombination. Cell 46:1101-1121.

22. Ross, W., and A. Landy. 1982. Bacteriophage lambda Int proteinrecognizes two classes of sequence in the phage att site:characterization of arm-type sites. Proc. Natl. Acad. Sci. USA79:7724-7728.

23. Ross, W., and A. Landy. 1983. Patterns of lambda Int recogni-tion in the regions of strand exchange. Cell 33:261-272.

24. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

25. Shafer, M. W., and J. J. Iandolo. 1979. Genetics of staphylo-coccal enterotoxin B in methicillin-resistant isolates of Staphy-lococcus aureus. Infect. Immun. 25:902-911.

26. Shimada, K., R. A. Weisberg, and M. E. Gottesman. 1972.Prophage lambda at unusual chromosomal locations. I. Loca-tion of the secondary attachment sites and properties of thelysogens. J. Mol. Biol. 63:483-503.

27. Southern, E. M. 1975. Detection of specific sequences amongDNA fragments separated by gel electrophoresis. J. Mol. Biol.98:503-517.

28. Watt, V. M., C. J. Ingles, M. S. Urdea, and W. J. Rutter. 1985.Homology requirements for recombination in Escherichia coli.Proc. Natl. Acad. Sci. USA 82:4768-4772.

29. Weisberg, R. A., and A. Landy. 1983. Site-specific recombina-tion in phage lambda, p. 211-249. In R. W. Hendrix, J. W.Roberts, F. W. Stahl, and R. A. Weisberg (ed.), Lambda II.Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

30. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. ImprovedM13 phage cloning vectors and host strains: nucleotide se-quences of the M13mpl8 and pUC19 vectors. Gene 33:103-119.

VOL. 171, 1989

on March 24, 2020 by guest

http://jb.asm.org/

Dow

nloaded from