Expression, Puriﬁcation and Characterisation of Full .../file/RegA... · Rhodobacter sphaeroides...

Expression, Purification and Characterisation ofFull-length Histidine Protein Kinase RegB fromRhodobacter sphaeroides

Christopher A. Potter1, Alison Ward1, Cedric Laguri2

Michael P. Williamson2, Peter J.F. Henderson1 andMary K. Phillips-Jones1*

1Division of MicrobiologySchool of Biochemistry andMolecular Biology, Universityof Leeds, Leeds LS2 9JT, UK

2Department of MolecularBiology and BiotechnologyUniversity of SheffieldSheffield S10 2TN, UK

The global redox switch between aerobic and anaerobic growth inRhodobacter sphaeroides is controlled by the RegA/RegB two-componentsystem, in which RegB is the integral membrane histidine protein kinase,and RegA is the cytosolic response regulator. Despite the global regulatoryimportance of this system and its many homologues, there have been noreported examples to date of heterologous expression of full-length RegBor any histidine protein kinases. Here, we report the amplified expressionof full-length functional His-tagged RegB in Escherichia coli, its purifi-cation, and characterisation of its properties. Both the membrane-boundand purified solubilised RegB protein demonstrate autophosphorylationactivity, and the purified protein autophosphorylates at the same rateunder both aerobic and anaerobic conditions confirming that anadditional regulator is required to control/inhibit autophosphorylation.The intact protein has similar activity to previously characterised solubleforms, but is dephosphorylated more rapidly than the soluble form (half-life ca 30 minutes) demonstrating that the transmembrane segmentpresent in the full-length RegB may be an important regulator of RegBactivity. Phosphotransfer from RegB to RegA (overexpressed and purifiedfrom E. coli ) by RegB is very rapid, as has been reported for the solubledomain. Dephosphorylation of active RegA by full-length RegB has arate similar to that observed previously for soluble RegB.

q 2002 Elsevier Science Ltd. All rights reserved

Keywords: Rhodobacter sphaeroides; RegB; membrane receptor; Ni2þ affinitypurification; phosphorylation kinetics*Corresponding author

Introduction

The RegBA two-component system (also knownas PrrBA) serves as a major transcriptional regula-tor of gene expression in several photosyntheticand nitrogen-fixing bacteria.1 – 6 It has been studiedmost intensively in Rhodobacter sphaeroides andR. capsulatus, in which RegBA is a globally acting,redox-responsive system,7 and in nitrogen-fixingBradyrhizobium japonicum, in which it is involved

in oxygen-responsive regulation of nitrogen fix-ation genes.4 In Rhodobacter, RegB is the mem-brane-located histidine protein kinase (HPK)component of the system, sensing changes inredox conditions. Upon anaerobiosis, RegBbecomes autophosphorylated in an ATP-depen-dent reaction; RegB , P then transfers the phos-phoryl signal to Asp63 of the partner responseregulator RegA.8,9 Once phosphorylated,RegA , P then positively regulates photosynthesisgene expression ( puc, puf and puhA ),1 – 3 as well asexpression of genes involved in carbon dioxidefixation (cbbI and cbbII operons),10,11 nitrogenfixation (nifA2 ),7,12 electron transport functions( petABC, cycA, cycY ) and respiratory terminal elec-tron functions (cydAB, ccoNOPQ, dorCBA ).3,13,14

RegA , P also negatively regulates hydrogenaseexpression (hupSLC ).12 Here, we retain the name

0022-2836/02/$ - see front matter q 2002 Elsevier Science Ltd. All rights reserved

Present address: A. Ward, Astex Technology Ltd, 250Cambridge Science Park, Cambridge CB4 0WE, UK.

E-mail address of the corresponding author:[email protected]

Abbreviations used: HPK, histidine protein kinase;TMR, transmembrane region; DDM, dodecyl-b-D-maltoside.

doi:10.1016/S0022-2836(02)00424-2 available online at http://www.idealibrary.com onBw

J. Mol. Biol. (2002) 320, 201–213

Reg (rather than Prr) for the R. sphaeroides system,for consistency with the homologues identified inother bacterial species, including R. capsulatus, inwhich the Reg system was first described.1

RegB senses redox through changes in thevolume of electron flow through the cbb3-type cyto-chrome c oxidase of the respiratory electron trans-port chain.15 The precise mechanism is notelucidated, but may be mediated by the SenCprotein.16,17 In vivo studies suggest that underaerobic conditions, the volume of electron flowthrough cbb3 oxidase is sufficiently high to repressthe default kinase-positive mode of RegB, resultingin repression of the autophosphorylation of RegB.9

Anaerobic conditions relieve this repression andresult in autophosphorylation of RegB and sub-sequent signal transfer to RegA.9

R. sphaeroides RegB (462 amino acid residues)possesses two domains, an N-terminal trans-membrane domain (residues 1–182) predicted tocomprise six membrane-spanning regions, and acytosolic C-terminal histidine kinase domain(residues 183–462) for autophosphorylation, phos-phatase and phosphotransfer reactions.18 It is anatypical HPK because it appears to lack any poten-tial signal-sensing periplasmic domains betweenthe transmembrane regions (TMRs). This implieseither that RegB signal sensing occurs within theTMRs themselves, or that signals are sensed else-where within the soluble domain, with TMRsmerely serving as anchors to keep the protein inclose contact with the source of the signal. Thislack of significant periplasmic domains is charac-teristic also of ArcB, another HPK involved in

redox sensing.19 – 21 ArcB, like RegB, senses redoxsignals via the state of components of electrontransport; oxidised forms of quinone electroncarriers serve as negative signals that inhibit auto-phosphorylation of ArcB during aerobiosis.19 Inthe case of ArcB, the TMRs serve as membraneanchors, playing no detectable role in sensing orsignal transduction.19 However, this does notappear to be the case for RegB. Recent in vivo muta-genesis studies of the transmembrane domain ofR. sphaeroides RegB protein revealed the import-ance of a central portion of this domain, particu-larly the short second periplasmic loop andmembrane-spanning a-helices 3 and 4, for sensingand signal transduction.9 Thus, in future studiesof the signal-sensing and transduction mechanism,full-length versions of RegB that include the trans-membrane regions will be required. However,previous attempts to express full-length RegB andits homologues8,22 – 24 have consistently failed toobtain this protein in a soluble, folded and func-tionally active form; indeed, of all the membraneHPKs reported to date, only Escherichia coliKdpD25 and NarX26,27 have been expressed success-fully as enriched proteins in E. coli and utilised infunctional assays. Of these two proteins, onlyNarX26 retains functional activity after purificationfrom membranes. KdpD regains activity only afterreconstitution into membrane vesicles.25 Otherstudies, including those of RegB, have used trun-cated versions that lack the transmembranedomains.8,23,24

In order to address this problem, we utilisedplasmid pTTQ18His, a membrane protein

Figure 1. SDS-PAGE and Western analysis of mixed membrane proteins from IPTG-induced E. coli NM554 cellscarrying pTTQregB (full-length regB gene) and/or pTTQEP6 (truncated regB gene). (a) SDS-PAGE of mixed membranesof E. coli NM554 (pTTQregB ) uninduced or induced with 1 mM IPTG and resolved using 15% polyacrylamide gels andvisualised by staining with Coomassie brilliant blue. Lane 1, uninduced mixed membranes; lane 2, IPTG-inducedmixed membranes; lane 3, molecular mass markers. (b) Western analysis of mixed membranes from E. coli (pTTQregB )and E. coli (pTTQEP6 ). Lane 1, molecular mass markers (no His-tag). Lane 2, E. coli NM554 (pTTQEP6 ) (1 mg of mixedmembrane protein). Lane 3, E. coli NM554 (pTTQregB ) (1 mg of mixed membrane protein). Lane 4, E. coli (pTTQEP6 )(5 mg of mixed membrane protein). Lane 5, E. coli NM554 (pTTQregB ) (5 mg of mixed membrane protein).

202 Activities of Full-length RegB

expression plasmid that has been used for thesuccessful overexpression of 16 membraneproteins,28 – 30 to amplify expression, and sub-sequently isolate and purify, intact RegB. This isthe first successful overexpression of an HPK inan heterologous E. coli host. The overexpressedprotein is functional in E. coli inner membranes, asshown by its autophosphorylation activity and itsability to be dephosphorylated by RegA. Impor-tantly, it is functional following purification, sinceautophosphorylation, phosphotransfer and RegA-dephosphorylation activities were all demon-strable. Our kinetic data obtained for this intactprotein reveal important differences comparedwith the truncated version of soluble RegB fromR. sphaeroides,24 demonstrating that the trans-membrane region has important regulatoryactivity.

Results

Expression of RegB

The full-length regB gene was cloned into thepTTQ18His plasmid, to produce plasmidpTTQregB coding for the C-terminally His-taggedprotein RegB-His6 (referred to as RegB). Followingintroduction into E. coli NM554, bacterial growthand regB induction with IPTG, membranepreparations (mixed inner and outer membranes)were isolated using the procedure of Ward et al.29

SDS-PAGE and Western analysis of the membranesusing an anti-RGSH6 antibody demonstrate thatIPTG-induced E. coli cells carrying pTTQregB syn-thesise an additional membrane protein, comparedto cells carrying pTTQEP6 (which possesses a trun-cated version of the regB gene). This additionalprotein migrates on SDS/polyacrylamide gelswith an apparent mass of 46 kDa, contrasting withthe predicted mass of 52.2 kDa (Figure 1). How-ever, similar anomalous migration has beenreported for other membrane proteins subjected toSDS-PAGE analysis.29 After purification, thisprotein was identified unequivocally as full-lengthRegB (see below). From densitometry analysis ofCoomassie brilliant blue-stained gels, we estimatethat RegB represents 2–10% of the total proteincontent of mixed membranes of IPTG-inducedE. coli NM554 (pTTQregB ) cells (data not shown).The Western blots revealed an additional proteinband migrating with an approximate molecularmass of .98 kDa, suggesting the presence of adimeric form of RegB (Figure 1(b)).

Autophosphorylation of RegB in E. coli inside-out inner membrane vesicles

The RegB protein expressed in E. coli inside-outinner membrane vesicles was shown to be capableof autophosphorylation (Figure 2). Although mem-brane vesicles prepared from E. coli NM554 carry-ing IPTG-induced plasmid pTTQEP6 (Table 1)

(which does not express RegB) were shown topossess one major and several minor auto-phosphorylating E. coli inner membrane proteins,none of these proteins migrated at the same46 kDa position observed for full-length RegB(Figure 2). However, membranes from E. coliNM554 carrying IPTG-induced pTTQregB clearlyshowed the presence of an additional phosphoryl-ated protein band at this position and we concludethat this is induced RegB. Membrane-associatedRegB , 33P was dephosphorylated by the additionof RegA, which itself became phosphorylated(Figure 2). None of the pTTQEP6 autophosphoryl-ating inner membrane proteins was de-phosphorylated by RegA or could phosphorylatethis protein under the assay conditions employed(Figure 2).

Purification of RegB

Mixed membranes were fractionated into outerand inner membranes (Ward et al.29) and RegBwas purified by solubilisation of inner membranesin 1% (w/v) dodecyl-b-D-maltoside (DDM),followed by Ni2þ-NTA affinity column chromat-ography, washing with 20 mM imidazole and elut-ing with 60 mM imidazole. Densitometry analysisof Coomassie brilliant blue-stained (Figure 3(a))and visual analysis of silver-stained (Figure 3(b))

Figure 2. Autophosphorylation of RegB in E. coli innermembranes under aerobic conditions in the presence of[g-33P]ATP. Each reaction employed 20 mg of purifiedinner membranes obtained from IPTG-induced E. coliNM554 (pTTQEP6 ) (lanes 2 and 4) or NM554(pTTQregB ) (lanes 3 and 5). Reactions (20 ml finalvolumes) were incubated at 24 8C with 50 mM ATP,5 mCi of [g-33P]ATP and 1 mM DTT for ten minutesprior to the addition of 3 pmol of RegA (lanes 4 and 5).RegA was added to a reaction containing no innermembrane protein (lane 1). After a further ten minutesincubation, each reaction was added to 4 £ loadingbuffer and the 33P-labelled proteins visualised.

Activities of Full-length RegB 203

SDS/polyacrylamide gel-resolved proteinsdemonstrated that full-length RegB could be puri-fied to .98% purity. Batch cultivation and IPTGinduction of E. coli NM554 carrying plasmidpTTQ18regB in shake flasks achieved a yield of upto 1 mg of RegB per litre of culture. Fermentor-scale production (25 l) of RegB was attempted,and the cell pellet of 60 g (wet weight) of IPTG-induced E. coli NM554 yielded only approximately0.1 mg of RegB protein per litre.

N-terminal amino acid sequencing of RegBdemonstrated that the first 11 residues of the pro-tein were indeed as predicted (M-N-S-G-P-D-G-I-L-N-R-D), indicating that the region of the proteinencoding the predicted transmembrane sensingdomain was intact. Sequencing of the cloned geneconfirmed the fidelity of the gene sequence inplasmid pTTQregB. Since the His-tag used forRegB purification is situated at the C terminus,these data collectively confirm that a full-length

Figure 3. Purification of full-length His-tagged RegB. (a) Inner membranes were separated from outer membranes,extracted with 1% dodecyl-b-D-maltoside and the RegB protein purified by Ni2þ affinity chromatography. Proteinsfrom each of the fractions indicated below were resolved by SDS-PAGE (15% polyacrylamide resolving gel) andvisualised by staining with Coomassie brilliant blue. Lane 1, molecular mass markers. Lane 2, solubilised innermembrane proteins. Lane 3, solubilised inner membrane proteins after centrifugation (100,000 g, 40 minutes). Lane 4,solubilised inner membrane proteins after overnight incubation at 4 8C with Ni2þ-NTA resin. Lane 5, 20 mM imidazolewash fraction (first 10 ml wash volume). Lane 6, 20 mM imidazole wash fraction (final 10 ml wash volume). Lane 7,60 mM imidazole elute fraction. (b) The efficiency of the purification procedure was assessed by subjecting elutedRegB protein to SDS-PAGE (15% polyacrylamide resolving gel) analysis and staining with silver by the method ofHeukeshoven & Dernick;42 lane 1, molecular mass markers; lane 2, RegB in 60 mM imidazole elution buffer. All mem-brane and solubilised samples contain 30 mg of protein, eluted fraction samples contain 2.0 mg of RegB for stainingwith Coomassie brilliant blue or 1 mg of RegB for staining with silver.

Table 1. Bacterial strains and plasmids

E. coli strain Description Reference/source

DH5a supE44 Dlac U169 (f80 lacZDM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 Clontech UKBL21[DE3] F2 ompT gal [dcm] [lon] hsdSb (r2B m2

B ; an E. coli B strain) with DE3, a l prophage carryingthe T7 RNA polymerase gene

Novagen Inc.

NM554 recA 13 araD139 D(ara-leu)7696 D(lac)l7A galU galK hsdR rpsL (Strr) mcrA mcrB Stratagene

PlasmidpBluescript-SK Apr StratagenepBB1 Apr, pBluescript-SK with a 4.5 kb Bam HI fragment containing regA from R. sphaeroides 2 (unpublished

plasmid)pTTQ18His Apr, tac-based overexpression system encoding a C-terminal hexahistidine tag 29pTTQEP6 Apr, pTTQ18His with a 0.9 kb PstI–EcoRI fragment of regB from pREG464 This workpTTQregB Apr, pTTQEP6 with a 0.5 kb EcoRI regB fragment from pREG464 cloned as a translational

fusionThis work

pREG464 Apr, contains a 12 kb fragment of the R. sphaeroides reg cluster 40pBlregA1.2. Apr, pBluescript-SK with a 0.74 kb Eco RI-BamHI fragment from pREG464, containing the

R. sphaeroides regAThis work

pET14b Apr, T7 polymerase-based expression vector Novagen Inc.pETregA Apr, pET14b containing a 0.74 kb Nde I-Bam HI regA fragment from pBlregA1.2 cloned as a

translational fusionThis work


protein has indeed been expressed and purified.The circular dichroism spectrum between 190 and260 nm indicated that a-helix is the predominanttype of secondary structure in this protein, andthat structural integrity is maintained duringpurification (Figure 4).

Expression and purification of RegA

The response regulator protein RegA was clonedinto the pET14b plasmid, as described in Materialsand Methods, to produce plasmid pETregA codingfor the N-terminal His-tagged protein His6-RegA(referred to as RegA). This protein was expressedwith a high level of efficiency (18% of total cellularprotein) by IPTG-induced E. coli cells carrying pET-regA. The resulting protein was purified by Ni2þ

affinity chromatography to .99% as determinedby analysis of both Coomassie brilliant blue-stained and silver-stained SDS/polyacrylamidegels (data not shown). Elution of the protein fromthe Ni2þ-iminodiacetic acid (IDA) resin in 200 mMsodium acetate (pH 4.0), the addition of 1–10 mMDTT and maintenance of the protein concentrationat ,10 mg/ml during buffer exchange and concen-tration were required in order to prevent aggrega-tion and precipitation of the protein. N-terminalanalysis of RegA demonstrated that the first 26residues of the recombinant protein were aspredicted (G-S-S-H-H-H-H-H-H-S-S-G-L-V-P-R-G-S-H-M-A-E-D-L-V-F-E) after post-translational lossof the N-terminal fMet residue. Electrospray massspectrometry analysis gave a mass of 22,515 Dafor the protein (predicted mass 22,518 Da). Theprotein is functionally active and is able todephosphorylate RegB (Figures 5 and 7).

Autophosphorylation and dephosphorylationof purified full-length RegB

RegB/A is a redox-responsive system. Therefore,to examine autophosphorylation kinetics, purifiedRegB was allowed to autophosphorylate in thepresence of [g-33P]ATP under aerobic or anaerobicconditions. Figure 5 shows that RegB displays theexpected exponential increase in proportion ofphosphorylated protein, with a half-life of 8(^1)minutes. Similar autophosphorylation rates (half-life of seven minutes) have been observed beforeusing the truncated soluble R. sphaeroides RegB.24

Truncation of the protein therefore has little or noeffect on the autophosphorylation rate. The kineticsunder aerobic and anaerobic conditions isindistinguishable (Figure 5(d)). Moreover, whenRegA was added to the reaction mixture, andallowed to mix with RegB for ten minutes prior toaddition of ATP, the rate of autophosphorylation(which in this experiment was observed as phos-phorylation of RegA rather than RegB, due to therapid phosphotransfer step, as described in a latersection) remained identical (Figure 5(c) and (d)).The autophosphorylation rate is therefore indepen-dent of the redox status of the solution, and of thepresence of RegA.

To examine dephosphorylation of phosphory-lated RegB, the protein was allowed to auto-phosphorylate and reach equilibrium prior to theaddition of 1000-fold excess of unlabelled ATP(Figure 6). The dephosphorylation rate ofRegB , P follows a first-order decay with a half-life of 34(^5) minutes (Figure 6), which contrastsmarkedly with the value of 5.5 to six hoursobserved for truncated RegB24 (see Discussion). Itis of interest to note that only roughly half of theRegB , P is dephosphorylated in the initial rapidphase (shown here). This does not imply that onlyhalf of the RegB is “active”, since addition ofRegA results in rapid loss of all 33P signal (see thenext section). We are currently investigating theorigin of this observation.

Phosphorylation and dephosphorylation ofpurified RegA

Phosphotransfer from RegB , P to RegA was toorapid to be measured accurately in our assays,reaching 95–98% of completion within ten secondsof mixing (Figure 7(a) and (b)). Similar rapid rateshave been seen in other systems, including thesoluble truncated RegB,8,23,24 RegS22 and BarA.31

RegA was not phosphorylated in the absence ofRegB. We therefore confirm the conclusion reachedby Comolli et al.24 that the rate of phosphorylationof RegA is limited by the phosphorylation state ofRegB.

Phosphorylated RegA can be dephosphorylatedby a number of mechanisms, including intra-molecularly catalysed hydrolysis, or dephos-phorylation by RegB. Back-transfer from RegA toRegB is another formal possibility, though

Figure 4. CD spectrum of purified full-length RegBsensor HPK protein. Purified protein (1.37 mM) wassolubilised in 0.05% DDM, 10 mM sodium phosphate(pH 7.4). CD spectral analysis of RegB was performed at1 nm sampling intervals with a scan rate of 50 nm/minute. Sensitivity was set at 20 mdeg. with a responsetime of one second. The spectrum represents an averageof ten scans, from which any solvent contribution wassubtracted.


phosphotransfer reactions between HPKs andresponse regulators are generally considered to beeffectively unidirectional from HPK to responseregulator. Indeed, we found this to be the case forRegB/A. Using a range of ratios of RegA to RegB,phosphotransfer from RegB to RegA is very rapidand appears to lie very heavily in the direction ofphosphorylated RegA, since after the initial rapidphosphotransfer, no phosphorylated RegB couldbe detected using ratios in the range 1:10 to 10:1(data not shown). Therefore, back-transfer of thephosphate to RegB appears to be insignificant inthis system.

The half-life of phosphorylated responseregulators is very variable in different two-component systems (from seconds to several

hours), and is one of the most important waysof controlling the intensity and duration of thesignal produced by typical two-componentsystems. We therefore investigated the dephos-phorylation of RegA , P in the presence of full-length RegB.

Increasing amounts of RegB resulted in areduction in the half-life of RegA , P: a 1:1 ratio(RegB to RegA , P) gave a half-life of 14(^2) min-utes, while a 5:1 ratio gave a half-life of 8(^2) min-utes (Figure 8(a) and (b)). (We assume here thatmolar ratios are in terms of RegB transphosphory-lating dimers; thus, a 1:1 ratio of RegB to RegAmeans a 2:1 molar ratio.) We conclude that RegB iscapable of catalysing loss of phosphate fromRegA , P.

Figure 5. Autophosphorylation ofRegB under aerobic and anaerobicconditions, and simultaneousautophosphorylation of RegB andphosphotransfer to RegA underaerobic conditions. Anaerobic andaerobic reactions employed60 pmol of RegB protein in a finalreaction volume of 200 ml. This wasallowed to autophosphorylate inthe presence of [g-33P]ATP for 40minutes, and 20 ml samples wereremoved to loading buffer atselected time-points. Aerobic andanaerobic reactions were performedin the presence of 0.1 mM DTT. Forthe pre-mixed RegB–RegA phos-photransfer reaction, 30 pmol ofRegB was incubated in the presenceof 75 pmol of RegA and 1 mM DTTfor ten minutes prior to the additionof [g-33P] ATP (in a final reactionvolume of 100 ml). After thisaddition, 10 ml samples wereremoved to loading buffer atselected time-points to monitor thephosphotransfer reaction. Thequantity of 33P associated witheither RegB or His6-RegA ((a)aerobic; (b) anaerobic; (c) pre-mixed) was then determined.(d) Time-course of phosphorylation.The data are also shown graphically(aerobic (B– –) (half-life 8(^1)minutes); anaerobic (O· · ·) (half-life9(^1.0) minutes); pre-mixed (W—)(half-life 8(^1) minutes)). Becauseof the rapid phosphotransfer fromRegB to RegA, the measured 33Psignal was entirely on RegA andis shown by the circles and con-tinuous line.


Discussion

We have expressed in E. coli the full-length RegBsensor kinase from R. sphaeroides as a C-terminallyHis-tagged fusion protein (Figure 1), purified it

(Figure 3) and demonstrated activity in vitro(Figures 5–8). On analysis by SDS-PAGE, theprotein was found to migrate with an apparentmass of 46 kDa (compared to an expected mass of52.2 kDa) (Figures 1 and 3). Similar anomalous

Figure 7. Phospho-transfer ofphosphate from RegB , 33P toRegA. (a) Reactions employed60 pmol of RegB, which wasallowed to autophosphorylate inthe presence of [g-33P]ATP for 20minutes. After this time a 20 mlsample (6 pmol) was removed toloading buffer prior to the additionof 27 pmol of RegA (final reactionvolume 180 ml) and further incu-bation for 20 minutes. At selectedtime-points, 20 ml samples (6 pmolof RegB, 3 pmol of RegA) wereremoved to loading buffer and thequantity of 33P associated witheither RegB or RegA determined.An additional control reaction(RegB-) in which 3 pmol of RegAwas incubated in the presence of[g-33P]ATP for 20 minutes prior tothe addition of loading buffer wasperformed. The reaction was per-formed in the presence of 1 mMDTT and at a RegB to RegA ratio of1:1, assuming that RegB is presentas a functional dimer. (b) Time-course of phosphate transfer.

Figure 6. Stability of RegB , 33P.(a) The reaction employed 60 pmolof RegB, which was allowed toautophosphorylate for 20 minutesin the presence of 1 mM DTT,50 mM ATP and [g-33P]ATP prior tothe addition of a 1000-fold excessof unlabelled ATP in a final reactionvolume of 200 ml. At each time-point, 6 pmol (20 ml) of RegB wasremoved to loading buffer and thequantity of 33P associated withRegB determined. (b) Time-courseof phosphate transfer presentingthe best-fit exponential decay,which has a half-life of 34(^5)minutes, and an asymptote at 46%of initial activity.


migration has been reported for other membraneproteins subjected to SDS-PAGE analysis.29

Previous attempts to overexpress full-length RegBhave been unsuccessful;8,23,24 indeed no heter-ologous expression of a full-length HPK has beenreported. The only other membrane HPKs whoseamplified homologous expression and purificationhas been achieved to date are E. coli KdpD25 andNarX.26,27 The successful application of thepTTQ18His vector reported here may thereforeopen the door to more comprehensive studies offull-length HPKs, since it permits reproduciblepurification of high-purity functional RegB inmilligram quantities by shake-flask culture.Although fermentor-scale production of thisprotein is possible, optimisation of culture andinduction conditions will be required in order toachieve high yields.

Quantification of the 33P present in auto-phosphorylated RegB suggests that only 25–30%of RegB protein produced is phosphorylatedunder the conditions used in our assays. However,this is comparable to the fraction of phosphoryl-ated protein reported previously for the solubledomain.24 A greater fraction (50–60%) of abouttwice as much phosphorylated protein can beobtained by carrying out functional assays in thepresence of high concentrations (100 mM) of DTT.This increase in the fraction of phosphorylated

RegB implies that the relatively low proportion ofphosphorylated protein does not mean that thereis a large amount of unfolded or mis-translatedprotein. This is supported by the CD spectrum,which indicates the high helical content expectedof a correctly folded RegB protein (Figure 4). Thiseffect of a high concentration of DTT on RegBremains to be investigated and could implicateeither an artefact of the in vitro assay system, orthe reduction of an intermolecular disulphidebridge as part of the control of the RegB system.Although DTT is not of significance in vivo, theexistence of additional factors that enhance HPKautophosphorylation rates in response to theirstimuli has been noted; for example, FixL rates ofautophosphorylation are stimulated significantlyin response to oxygen when manganese is added.32

Until now, only soluble truncated forms ofRegB24 or its analogues in R. capsulatus8,23 andB. japonicum (RegS)22 have been used for in vitrofunctional analysis. For all these truncatedproteins, a constitutive activity was reported,which was suggested to be due to the absence ofthe N-terminal transmembrane domain that couldbe required for inhibiting autophosphorylation ofthe catalytic domain. More recently, it has beensuggested that the regulation of the RegB/A two-component system by O2 occurs indirectly, throughthe volume of electron flow through the cbb3-type

Figure 8. Phosphatase activity ofRegB towards RegA , P. (a) RegB(8 pmol)was allowed to auto-phosphorylate in the presence of[g-33P]ATP for 20 minutes prior tothe addition of 40 pmol of RegA.After allowing phosphotransferfrom RegB , 33P to RegA for 15minutes, the ATP was removedfrom the reaction by Centriconbuffer exchange. The reaction wasthen split into four aliquots, eachcontaining 1.5 pmol of RegB and7.5 pmol of RegA , 33P in a finalreaction volume of 80 ml. To eachof these reactions was then addeddifferent amounts of RegB: 74.25,14.25, 2.25 or 0 pmol, representingratios (RegB to RegA, assuming thepresence of a functional RegBdimer) of 5:1, 1:1, 1:5 and 1:10. Atselected time-points 20 ml sampleswere removed from each reactionto loading buffer and the quantityof 33P associated with RegB deter-mined. The reactions were per-formed in the presence of 1 mMDTT. The data are presented bothas (a) autoradiograms, and (b) as atime-course of phosphate transferwith fitted decay curves (1:5 O; 1:1B; 5:1 V). The data and fitted halflives for the 1:10 RegB to RegAratio are similar to the 1:5 ratio andare omitted from the Figure forclarity.


cytochrome c oxidase.9,15 We have observed thatfull-length RegB in inner membrane vesicles ofE. coli (which do not possess any identifiablehomologue of the RegB/A two-component system)demonstrates constitutive autophosphorylationunder aerobic conditions (Figure 2). Furthermore,the purified protein has identical autophosphoryla-tion kinetics under both aerobic and anaerobic con-ditions (Figure 5(d)). These results thereforeconfirm that the full-length RegB kinase is activeunder both aerobic and anaerobic conditions, andthat presumably an additional redox-responsiveregulator is required for repression, a potentialcandidate for which is the Rhodobacter proteinSenC,16,17 which may itself be modified byinteraction with an oxidised/reduced electroncarrier.

A recent study on the Sinorhizobium melilotiFixL/FixJ system demonstrated that complexationof the histidine protein kinase and responseregulator before phosphorylation increased theautophosphorylation rate by a factor of 10, andthat autophosphorylation and phosphotransferwere coupled.33 By contrast, the autophosphoryl-ation rate of full-length RegB is independent ofthe presence of RegA (Figure 5(d)), indicatingthat complexation of the two components is notnecessary for phosphorylation in this system.

The half-life of full-length RegB , P wasapproximately 34 minutes. By contrast, the solubledomain of RegB , P had a half-life of 5.5 to sixhours.24 This therefore suggests that the trans-membrane region has a regulatory role in thestability of the phosphorylated transmitter domain.If so, it implies that redox status will have an effecton the autophosphorylation rate of RegB, and onits dephosphorylation rate. Because the phospho-transfer step is very rapid compared to both theautophosphorylation and the dephosphorylationof RegB, the amount of RegA , P signal is regu-lated tightly by the phosphorylation status ofRegB. The dual effect of redox status on both phos-phorylation and dephosphorylation of RegB wouldtherefore accentuate the effectiveness of the redox-dependent switch; this is reminiscent of the switch-ing on or off of the glycolytic pathway regulated byphosphorylation of a single serine residue on thetandem enzyme phosphofructokinase 2/fructosebisphosphatase 2. Phosphorylation activates thephosphatase activity but inhibits the kinaseactivity, thereby exercising a dramatic effect on theconcentration of fructose 2,6-bisphosphate.34

Indeed, switching between kinase- and phos-phatase-dominant states is widely recognised asthe mechanism by which many bacterial HPKsrespond to environmental signals. For example,mutation studies of EnvZ, an HPK that regulatesporin expression in response to osmolarity inE. coli, have successfully identified the regionsand residues involved in these distinct activitiesand support the idea that the kinase-dominantstate is favoured in high osmolarity, whereas thepropensity for the phosphatase-dominant state

increases with decreasing osmolarity.35 Themechanism may be similar for RegB in responseto redox potential, though there are cleardifferences between the EnvZ/OmpR and RegB/RegA systems; the latter seems to exist in a kinase“on” or “off” state, whereas the former is in activesignalling states under high and low stimuluslevels.

Previous experiments with R. sphaeroides RegA24

have shown that RegA phosphorylated chemicallyusing acetyl phosphate has a half-life of ca 330minutes, while the very similar R. capsulatusRegA , P has a half-life of ca 90 minutes.23 Trun-cated RegB was found to decrease the half-life ofRegA , P to ca 20 minutes.24 Our results showthat full-length RegB decreases the half-life ofRegA , P to approximately eight minutes. Takinginto account experimental difficulties in obtainingaccurate rates in these assays, the results suggestthat truncated RegB has phosphatase activity thatdisplays approximately the same catalytic rate asthat of the full-length RegB. The TMR is thereforenot implicated in regulation of the loss of signalfrom the RegB/RegA system at the level ofRegA , P, although, as shown above, it is involvedin the control of the level of phosphorylation ofRegB. RegA/B regulates major metabolic changesin the cell in response to redox potential. This isan energy-consuming process and it is thereforenot unreasonable to find that there is more controlover the initiation of the signal than over itstermination. It is noteworthy that in all studies ofthe R. sphaeroides Reg system so far, including ourown of the full-length RegB, the RegB dephos-phorylation activity towards RegA is clearlydemonstrable in the absence of ATP. This contrastswith findings for some other two-componentsystems; for example, EnvZ-mediated dephos-phorylation of OmpR , P requires the presenceof ATP or some non-hydrolysable analogue, imply-ing that ATP was required as a co-factor, perhapsto permit EnvZ to adopt the correctconformation.37,38

In conclusion, we have demonstrated that func-tional full-length RegB can be expressed in E. coliusing the pTTQ18His vector. It has the same func-tion but displays different kinetics compared withsoluble versions that lack the transmembranedomain, suggesting that the TMR has a regulatoryfunction. The system has been developed for invitro studies to elucidate the signal sensingmechanism of RegB, by examining RegB auto-phosphorylation in combination with candidateinteracting proteins such as SenC and componentsof the cytochrome c oxidase complex. Targetedmutagenesis will facilitate elucidation of thestructure-activity relationships of the single RegB,RegA and regulatory proteins as well as theircomplexes. The ability to produce milligramquantities of highly purified RegB protein is alsoenabling us to undertake 2D/3D crystallisation inorder to elucidate the 3D structure of this sensorkinase by electron or X-ray diffraction.


Materials and Methods

Bacterial strains and plasmids, DNA manipulationand reagents

Bacterial strains and plasmids are listed in Table 1. Allrestriction enzymes and phage T4 ligase were obtainedfrom GibcoBRL; Pfu polymerase was obtained fromBoehringer Mannheim. [g-33P]ATP (3000 Ci/mmol) wasobtained from ICN Pharmaceuticals Ltd. Dodecyl-N-maltoside was obtained from Melford Biosciences.Agarose-immobilised Ni2þ-nitrilotriacetic acid (NTA)resin and anti-RGS(H6) monoclonal antibody wereobtained from Qiagen. Sepharose 6B fast-flow immobi-lised Ni2þ-iminodiacetic acid (IDA) resin was obtainedfrom Sigma Chemical Co. Goat anti-mouse IgG horseradish peroxidase (HRP)-conjugated antibody wasobtained from Stratech Scientific Ltd. All media, stockbuffers and procedures for growth of bacterial culturesand DNA manipulations followed the methods ofSambrook et al.38 All other chemicals and reagentsemployed were of AnalaR or equivalent grade unlessotherwise stated.

Construction of RegB and RegAoverexpression plasmids

To overexpress a full-length His6-tagged version ofRegB that includes the transmembrane sensing domain,regB was amplified by polymerase chain reaction usingpBB1 (pBluescript-SK possessing a 4.5 kb BamHI regfragment isolated from a pSUP202 plasmid library ofR. sphaeroides chromosomal DNA) as template.2 The regBgene was amplified using the upstream primer50ATGAGCTGCAATGAATTCCGGTCCCGACG and thedownstream primer 50-GGCGCCGGCTGCAGTCTG-GATCAGGACG. The PCR product possesses EcoRI andPst I sites for subsequent cloning into pTTQ18His, aplasmid based on expression vector pTTQ18 that wehave used previously to successfully overexpress 16bacterial membrane proteins.29 Both plasmids possess atac promoter that drives transcription of the gene ofinterest, but pTTQ18His possesses restriction sites thatpermit in-frame fusion of the inserted gene with a 30

sequence encoding a G-G-R-G-S-(H6) C-terminal tag.Since reg B possesses an internal EcoRI site, the amplifiedproduct was digested with EcoRI and PstI to producetwo fragments that were isolated and cloned in turninto pTTQ18His. First the 0.9 kb PstI–EcoRI reg B frag-ment was cloned into PstI–EcoRI-cut pTTQ18His tomake pTTQEP6, a control plasmid possessing only the0.9 kb 30 end of the 1.4 kb full-length reg B gene. The0.5 kb EcoRI fragment was then inserted into EcoRI-cutpTTQEP6 to create the full-length reg B plasmidpTTQreg B. The inserted fragments were sequenced toverify correct orientation and sequence. The cloningprocedure necessitated expression of a reg B productwith N-terminal sequence fM-N-S-G-P-D (rather thanthe native fM-I-L-G-P-D). The C-terminal region of RegBis predicted to possesses the His6 tag in the sequenceI-Q-T-A-G-G-R-G-S-(H)6, where I-Q-T are the last threeresidues in native RegB and the R-G-S(H)6 sequence canbe used in antibody-based detection of the Reg-Bprotein.

To overexpress RegA, the regA gene was amplified bypolymerase chain reaction using upstream primer 50-GAGTCGAATTCATATGGCTGAGGATCTGGTATTCG-AACTCG and downstream primer 50-GCAGAG-GATCCGCCTGCCAATGAAAAAGGCGGCAA using

pREG46439 (isolated from a pSUP202 library ofR. sphaeroides chromosomal DNA and possessing 12 kbof the reg region) as template. The 0.74 kb product wasdigested with EcoRI and BamHI for cloning into EcoRI–BamHI-cut pBluescript-SK to create pBlregA1.2. TheregA fragment was isolated from pBlregA1.2 using NdeIand Bam HI, and ligated into pET14b, resulting in thefinal expression plasmid pETregA. The expressed RegAprotein possesses an additional N-terminal M-G-S-S-(H6)-S-S-G-L-V-P-R-G-S-H-M-A-E-L sequence, whereA-E-L are the first three amino acid residues in nativeRegA.

DNA sequencing

DNA sequencing was performed using an ABIBigDyee deoxy terminator cycle sequencing kit, sup-plied by Applied Biosystems, and sequencingreactions were analysed on an Applied Biosystems 377Prism automated sequencer (University of Leicester,UK).

Overexpression of full-length RegB

E. coli NM554 carrying pTTQ18reg B was culturedaerobically at 37 8C in 2 l of Luria–Bertani (LB) medium38

in the presence of 100 mg/ml of carbenicillin, to anabsorbance at 595 nm (A595) of 0.45. Protein expressionwas induced through the addition of 1 mM IPTG. Aftera further three hours incubation at 37 8C, and atA595 . 1.4, cells were harvested by centrifugation for tenminutes at 8000 g and 4 8C. Cell pellets were resus-pended in 10 mM Tris–HCl (pH 8.0), 0.5 mM EDTA,20 mM mercaptoethanol wash buffer at 4 8C, re-centri-fuged and resuspended in wash buffer to a final volumeof 14 ml per litre of original culture. Cell suspensionswere then stored at 270 8C prior to purification of theRegB protein.

Overexpression of RegA

Recombinant RegA protein encoded by plasmid pET-regA possesses an N-terminal tag that includes R-G-S-(H6) that facilitates both Ni2þ-NTA affinity chroma-tography purification of the protein and its antibody-mediated detection. To obtain RegA protein, plasmidpPETregA was transformed into the expression hostBL21 [DE3] and cultured aerobically at 37 8C in LBmedium containing 500 mg/ml of carbenicillin in shake-flasks to A595 ¼ 0.7. Protein expression was then inducedby addition of 0.4 mM IPTG. After a further three hoursof incubation at 37 8C and at an A595 value of ,1.2, cellswere harvested by centrifugation at 8000 g for tenminutes at 4 8C. Cell pellets were washed once in10 mM Tris–HCl (pH 8.0), 0.5 mM EDTA at 4 8C,re-harvested and the pellets stored at 270 8C for sub-sequent purification of RegA protein.

Purification of RegB inner membrane fractions andsoluble protein

Cell suspensions were thawed slowly on ice and dis-rupted in a French pressure cell as described by Wardet al.29 E. coli inside-out inner membrane vesicles forautophosphorylation assays were purified by themethod of Ward et al.29 modified by including 10 mMKCl, 10 mM MgCl2 and 0.1 mM DTT in all buffers andall step-gradients employed. The purified vesicles were


resuspended in 20 mM Tris–HCl (pH 7.5) containing10 mM KCl, 10 mM MgCl2 and 0.1 mM DTT at a concen-tration of approximately 20 mg protein/ml of buffer.Membranes were employed in phosphorylation assaysimmediately after preparation.

To purify RegB protein, inner membrane vesicles wereagain prepared as described by the method of Wardet al.29 modified by including 20 mM mercaptoethanol inall step-gradients and wash buffers. The purified innermembranes were resuspended in 20 mM Tris–HCl (pH7.5) containing 20 mM mercaptoethanol, at a concen-tration of approximately 20 mg protein/ml, flash-frozenand stored at 270 8C. Affinity chromatography purifi-cation was then carried out according to the protocols ofWard et al.29,30 Inner membranes were thawed rapidlyby warming in tepid water and then resuspended at afinal concentration of 2 mg protein/ml in 10 mM Hepesbuffer (pH 7.6) containing 20% (w/v) glycerol, 20 mMimidazole, 1% (w/v) DDM and 20 mM mercaptoethanolfor two hours at 4 8C. The preparation was then centri-fuged at 4 8C for 40 minutes at 100,000 g to sedimentinsoluble material. His-tagged RegB protein in the super-natant fraction was then allowed to mix with and bind to0.5 ml of Ni-NTA agarose-immobilised resin (Qiagen) at4 8C for 18 hours. The resin was recovered by centrifu-gation at 1000 g and transferred to a 2 ml column (PerbioScience UK Ltd). The resin bed was washed with 80 mlof 10 mM Hepes buffer (pH 7.6) containing 0.05% DDM,20% glycerol, 20 mM imidazole and 20 mM mercapto-ethanol. RegB protein was then eluted in 10 mM Hepesbuffer (pH 7.6) containing 20% glycerol, 60 mM imida-zole and 20 mM mercaptoethanol. The eluted proteinwas concentrated in 10 mM Hepes buffer (pH 7.6) con-taining 50% glycerol, 0.05% DDM and 1 mM DTTthrough the use of a Centricon YM-10 (10 kDa cutoff) fil-ter (Millipore Co.), employed as per the manufacturer’sinstructions.

Purification of RegA protein

The pET system-specified affinity chromatographyprotocols of Novagen Inc. were used for the affinity chro-matography purification of His6-RegA. Cell pellets werethawed slowly on ice and resuspended in 4 ml (per250 ml original culture) of 20 mM imidazole bindingbuffer (20 mM Tris–HC1 (pH 7.9) containing 20 mMimidazole, and 500 mM NaCl). Resuspended cells werethen disrupted by sonication (eight cycles of ten secondssonication and 15 second intervals) on ice. Sonicatedmaterial was then centrifuged at 100,000 g for 40 minutesat 4 8C. His-tagged RegA protein in the supernatant wasallowed to bind to 1 ml of Ni2þ-NTA Sepharose resin(Sigma Chemical Co.) at 4 8C for 40 minutes. The resinwas recovered by centrifugation at 1000 g for 30 secondsand the supernatant removed. The resin was washedwith ten 10 ml volumes of 20 mM imidazole bindingbuffer and ten 10 ml volumes of 60 mM imidazole washbuffer (20 mM Tris–HC1 (pH 7.9) containing 60 mMimidazole, and 500 mM NaCl). The resin was then trans-ferred to a 2 ml column (Perbio Science UK) and thepacked resin bed washed with a further 20 ml of 60 mMwash buffer. RegA protein was eluted in 200 mM sodiumacetate buffer (pH 4.0) and stored in 100 mM sodiumacetate buffer (pH 4.0), containing 50 mM MgCl2, and10 mM DTT. Prior to use in transphosphorylationexperiments, RegA protein was concentrated to 7 mg/ml in 20 mM sodium acetate buffer (pH 4.0) containing10 mM MgCl2 and 1 mM DTT using a Centricon YM-10

(10 kDa cutoff) centrifugal filter device employed as perthe manufacturer’s instructions (Millipore Co.).

Western blotting

Mixed membranes from induced and uninducedE. coli cultures carrying pTTQEP6 and pTTQreg B wereprepared from French-pressed cells according to themethod of Ward et al.29 and separated by SDS-PAGE,employing 15% polyacrylamide resolving gels. Proteinswere then transferred to Fluorotranse membrane (PallBioSupport, UK) by semi-dry electroblotting (350 mAfor one hour). Membranes were incubated for 16 hoursin 5% (w/v) skimmed milk powder in TBST (10 mMTris–HCl (pH 8.0), containing 150 mM NaCl and 0.05%(v/v) Tween 20). A 1:2000 dilution of mouse anti-RGS(H6) monoclonal antibody (Qiagen Ltd) was thenprepared in TBST, into which the membrane wasimmersed and incubated with gentle agitation for onehour at room temperature. Following three washes in100 ml of TBST, a 1:5000 dilution of goat anti-mouse IgGhorse radish peroxidase conjugate (Stratech ScientificLtd) in TBST was added and the membrane incubatedfor one hour at room temperature. Following threewash steps with large volumes of TBST, the immunoblotmembrane was incubated with ECL Western blottingdetection reagent (Amersham Pharmacia Biotech UKLtd) and developed by autoradiography with Xographfilm (Eastman Kodak Co.).

Protein sequencing

Approximately 3 mg of purified RegB or 2 mg RegAwas loaded onto an SDS/15% polyacrylamide gel andtransferred to Fluorotranse membrane (Pall BioSupport,UK) by semi-dry electroblotting. The protein wasvisualised by staining with Coomassie brilliant blue,excised from the membrane and the N-terminalsequence determined by Edman degradation, courtesyof Dr Arthur Moir (University of Sheffield, UK).

Circular dichroism (CD) spectroscopy

Purified RegB was buffer-exchanged into 10 mMsodium phosphate (pH 7.4) containing 0.05% DDMusing a Centricon YM-40 (40 kDa cutoff) centrifugal filterdevice (Millipore Co.), employed as per the manu-facturer’s instructions. The concentration of protein inthe sample was adjusted to 1.37 mM, and 300 ml wastransferred to a Hellman quartz-glass cell of 1 mm path-length. Circular dichroism measurements were per-formed on a Jasco J-715 spectropolarimeter at 20 8C withconstant nitrogen flushing.

Electrospray mass spectroscopy

Samples of purified RegA were prepared for electro-spray mass spectroscopy by the method of Hufnagelet al.40 Samples were analysed on a single quadrupole,bench-top mass spectrometer (Platform II, MicromassUK Ltd). The mass spectrometer was fitted with a stan-dard electrospray ionisation source, which was used inthe positive ionisation mode with a probe tip voltage of3.5 kV, and a counter electrode voltage of 0.5 kV.Nitrogen was employed as both the nebulising and thedrying gas, with flow rates of 20 l per hour and 200 lper hour, respectively. The sampling cone voltagewas set at 40 V. The sample was dissolved in formic


acid/methanol/water (1:1:1, by volume) and infusedinto the ionisation source at a flowrate of 10 ml/minute.Data were acquired over the appropriate m/z range andwere processed using the MassLynx software suppliedwith the instrument. The m/z spectrum was transposedonto a true molecular mass scale for more facile identifi-cation using Maximum Entropy processing techniques.An external calibration was applied, using horse heartmyoglobin (16,951.49 Da) as the calibrant.

In vitro phosphorylation assays

Assays were carried out in an assay buffer containing50 mM Tris–HCl (pH 7.6), 10 mM MgCl2, 50 mM KCland 0.1–1 mM DTT and were performed at 24 8C (modi-fied from Inoue et al.8 and Bird et al.23). For auto-phosphorylation assays, 60 pmol of RegB protein wasused, whilst phosphorelay assay mixes employed 30–300 pmol of RegB and 50–150 pmol of RegA. Unlessstated otherwise, assays (190 ml) were initiated throughthe addition of 10 ml of radiolabelled ATP (10 mmol ATPcontaining 50 mCi of [g-33P]ATP). Samples (20 ml) wereremoved at intervals and reactions stopped by theaddition of 5 ml of 4 £ loading buffer (12% glycerol, 3%water, 10% (w/v) SDS, 1 M Tris–HCl (pH 7.2) 0.002%bromophenol blue, 3% mercaptoethanol). Assays per-formed under anaerobic conditions were performed in amicroflow anaerobic workstation system (Inter MedM.D.H) supplied with white-spot nitrogen (BritishOxygen Co.). For anaerobic assays, small volumes of allreagents were allowed to equilibrate under anaerobicconditions for one hour prior to the initiation of phos-phorylation experiments. All samples were stored at270 8C.

Quantification of 33P-labelled proteins

33P-labelled RegB and 33P-labelled RegA proteins wereresolved by SDS-PAGE using 12–15% resolving and4–5% stacking gels.38 Gels were dried at 80 8C under vac-uum, and the labelled proteins visualised by auto-radiography. Quantification of 33P-label incorporatedinto proteins was determined using a Fugii BAS 1000phosphorimaging system (Fujifilm Co.) using a series ofdiluted [g-33P]ATP standards. Densitometry analysis ofphosphoimager data was performed by means of Aida1D/2D analytical software (Raytest). Kinetic parameterswere fitted by a least-squares calculation using Excel(Microsoft Corp., Seattle).

Protein determinations

Protein assays for membranes containing RegB,purified RegB and RegA proteins were performed usingthe method of Schaffner & Weissman.41

Acknowledgments

We thank Dr Nick Rutherford for assistance in thepurification of RegB, John O’Reilly for the preparationof E. coli inner membranes, Dr Arthur Moir for analysisof N-terminal amino acid sequences and Dr AlisonAshcroft for the electrospray mass spectroscopy analysisof RegA. This work was supported by BBSRC grant24/B12958, and by the Wellcome Trust, who funded thecircular dichroism and mass spectrometry instruments.

References

1. Sganga, M. & Bauer, C. E. (1992). Regulatory factorscontrolling photosynthetic reaction center and light-harvesting gene expression in Rhodobacter capsulatus.Cell, 68, 945–954.

2. Phillips-Jones, M. K. & Hunter, C. N. (1994). Cloningand nucleotide sequence of regA, a putative responseregulator gene of Rhodobacter sphaeroides. FEMSMicrobiol. Letters, 116, 269–276.

3. Eraso, J. M. & Kaplan, S. (1994). prrA, A putativeresponse regulator involved in oxygen regulation ofphotosynthesis gene expression in Rhodobactersphaeroides. J. Bacteriol. 176, 32–43.

4. Bauer, E., Kaspar, T., Fischer, H. M. & Hennecke, H.(1998). Expression of the fixR-nifA operon inBradyrhizobium japonicum depends on a new responseregulator, RegR. J. Bacteriol. 180, 3853–3863.

5. Tiwari, R. P., Reeve, W. G., Dilworth, M. J. & Glenn,A. R. (1996). Acid tolerance in Rhizobium melilotistrain WSM419 involves a two-component sensor-regulator system. Microbiology, 142, 1693–1704.

6. Masuda, S., Matsumoto, Y., Nagashima, K. V.,Shimada, K., Inoue, K., Bauer, C. E. & Matsuura, K.(1999). Structural and functional analyses of photo-synthetic regulatory genes regA and regB fromRhodovulum sulfidophilum, Roseobacter denitrificans,and Rhodobacter capsulatus. J. Bacteriol. 181,4205–4215.

7. Joshi, H. M. & Tabita, F. R. (1996). A global two com-ponent signal transduction system that integrates thecontrol of photosynthesis, carbon dioxide assimila-tion, and nitrogen fixation. Proc. Natl Acad. Sci. USA,93, 14515–14520.

8. Inoue, K., Kouadio, J.-L. K., Mosley, C. S. & Bauer,C. E. (1995). Isolation and in vitro phosphorylationof sensory transduction components controllinganaerobic induction of light harvesting and reactioncenter gene expression in Rhodobacter capsulatus.Biochemistry, 34, 391–396.

9. Oh, J.-I., Ko, I.-J. & Kaplan, S. (2001). The defaultstate of the membrane-localized histidine kinasePrrB of Rhodobacter sphaeroides 2.4.1 is in the kinase-positive mode. J. Bacteriol. 183, 6807–6814.

10. Qian, Y. & Tabita, F. R. (1996). A global signal trans-duction system regulates aerobic and anaerobic CO2

fixation in Rhodobacter sphaeroides. J. Bacteriol. 178,12–18.

11. Dubbs, J. M., Bird, T. H., Bauer, C. E. & Tabita, F. R.(2000). Interaction of CbbR and RegAp transcriptionregulators with the Rhodobacter sphaeroides cbbI

promoter-operator region. J. Biol. Chem. 275,19224–19230.

12. Elsen, S., Dischert, W., Colbeau, A. & Bauer, C. E.(2000). Expression of uptake hydrogenase and moly-bdenum nitrogenase in Rhodobacter capsulatus iscoregulated by the RegB–RegA two-componentregulatory system. J. Bacteriol. 182, 2831–2837.

13. Swem, L. R., Elsen, S., Bird, T. H., Swem, D. L., Koch,H.-G., Myllykallio, H. et al. (2001). The RegB/RegAtwo-component regulatory system controls synthesisof photosynthesis and respiratory electron transfercomponents in Rhodobacter capsulatus. J. Mol. Biol.309, 121–138.

14. Kappler, U., Huston, W. M. & McEwan, A. G. (2002).Control of dimethylsulfoxide reductase expression inRhodobacter capsulatus: the role of carbon metabolitesand the response regulators DorR and RegA.Microbiology, 148, 605–614.


15. Oh, J. I. & Kaplan, S. (2000). Redox signaling:globalization of gene expression. EMBO J. 19,4237–4247.

16. Buggy, J. & Bauer, C. E. (1995). Cloning and charac-terization of senC, a gene involved in both aerobicrespiration and photosynthesis gene expression inRhodobacter capsulatus. J. Bacteriol. 177, 6958–6965.

17. Eraso, J. M. & Kaplan, S. (2000). From redox flow togene regulation: role of the PrrC protein ofRhodobacter sphaeroides 2.4.1. Biochemistry, 39,2052–2062.

18. Ouchane, S. & Kaplan, S. (1999). Topological analysisof the membrane-localized redox-responsive sensorkinase PrrB from Rhodobacter sphaeroides 2.4.1. J. Biol.Chem. 274, 17290–17296.

19. Georgellis, D., Kwon, O. & Lin, E. C. C. (2001).Quinones as the redox signal for the Arc two-component system of bacteria. Science, 292,2314–2316.

20. Kwon, O., Georgellis, D. & Lin, E. C. (2000). Phos-phorelay as the sole physiological route of signaltransmission by the Arc two-component system ofEscherichia coli. J. Bacteriol. 182, 3858–3862.

21. Taylor, B. L. & Zhulin, I. B. (1999). PAS domains:internal sensors of oxygen, redox potential, andlight. Microbiol. Mol. Biol. Rev. 63, 479–506.

22. Emmerich, R., Panglungtshang, K., Stehler, P.,Hennecke, H. & Fischer, H.-M. (1999). Phosphoryl-ation, dephosphorylation and DNA-binding of theBradyrhizobium japonicum RegSR two-componentregulatory proteins. Eur. J. Biochem. 263, 455–463.

23. Bird, T. H., Du, S. & Bauer, C. E. (1999). Auto-phosphorylation, phosphotransfer, and DNA-bind-ing properties of the RegB/RegA two-componentregulatory system in Rhodobacter capsulatus. J. Biol.Chem. 274, 16343–16348.

24. Comolli, J. C., Carl, A. J., Hall, C. & Donohue, T.(2002). Transcriptional activation of the Rhodobactersphaeroides cytochrome c2 gene P2 promoter by theresponse regulator PrrA. J. Bacteriol. 184, 390–399.

25. Stallkamp, I., Dowhan, W., Altendorf, K. & Jung, K.(1999). Negatively charged phospholipids influencethe activity of the sensor kinase KdpD of Escherichiacoli. Arch. Microbiol. 172, 295–302.

26. Walker, M. S. & DeMoss, J. A. (1993). Phosphoryl-ation and dephosphorylation catalyzed in vitro bypurified components of the nitrate sensing system,NarX and NarL. J. Biol. Chem. 268, 8391–8933.

27. Lee, A. I., Delgado, A. & Gunsalus, R. P. (1999).Signal-dependent phosphorylation of the mem-brane-bound NarX two-component sensor-transmitter protein of Escherichia coli: nitrate elicits asuperior anion ligand response compared to nitrite.J. Bacteriol. 181, 5309–5316.

28. Henderson, P. J. F., Hoyle, C. K. & Ward, A. (2000).Expression, purification and properties of multidrugefflux proteins. Trans. Biochem. Soc. 28, 513–517.

29. Ward, A., Sanderson, N. M., O’Reilly, J., Rutherford,N. G., Poolman, B. & Henderson, P. J. F. (1999). The

amplified expression, identification, purification,assay and properties of hexahistidine-taggedbacterial membrane transport proteins. In MembraneTransport—A Practical Approach (Baldwin, S. A., ed.),pp. 141–166, Oxford University Press, Oxford.

30. Ward, A., Hoyle, C., Palmer, S., O’Reilly, J., Griffith,J., Pos, M. et al. (2001). Prokaryote multidrug effluxproteins of the major facilitator superfamily: ampli-fied expression, purification and characterisation.Mol. Microbiol. Biotechnol. 3, 193–200.

31. Pernestig, A. K., Melefors, O. & Georgellis, D. (2001).Identification of UvrY as the cognate response regu-lator for the BarA sensor kinase in Escherichia coli.J. Biol. Chem. 276, 225–231.

32. Gilles-Gonzalez, M. A. & Gonzalez, G. (1993).Regulation of the kinase activity of heme proteinFixL from the two component system FixL/FixJ ofRhizobium meliloti. J. Biol. Chem. 268, 16293–16297.

33. Tuckerman, J. R., Gonzalez, G. & Gilles-Gonzalez,M. A. (2001). Complexation precedes phosphoryl-ation for two-component regulatory system FixL/FixJ of Sinorhizobium meliloti. J. Mol. Biol. 308,449–455.

34. Van Schaftingen, E. & Hers, H. G. (1986). Purificationand properties of phosphofructokinase 2/fructose2,6-bisphosphatase from chicken liver and frompigeon muscle. Eur. J. Biochem. 159, 359–365.

35. Russo, F. & Silhavy, T. J. (1991). EnvZ controls theconcentration of phosphorylated OmpR to mediateosmoregulation of the porin genes. J. Mol. Biol. 222,567–580.

36. Aiba, H., Mizuno, T. & Mizushima, S. (1989). Trans-fer of phosphoryl group between two regulatoryproteins involved in osmoregulatory expression ofthe ompF and ompC genes in Escherichia coli. J. Biol.Chem. 264, 8563–8567.

37. Igo, M. M., Ninfa, A. J., Stock, J. B. & Silhavy, T. J.(1989). Phosphorylation and dephosphorylation of abacterial transcriptional regulator by a trans-membrane receptor. Genes Dev. 3, 1725–1734.

38. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989).Molecular Cloning: A Laboratory Manual (Nolan, C.,ed.), Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY.

39. Hunter, C. N. & Turner, G. (1988). Transfer of genescoding for apoproteins of reaction center and light-harvesting LH1 complexes to Rhodobacter sphaeroides.J. Gen. Microbiol. 134, 1471–1480.

40. Hufnagel, P., Schweiger, U., Eckerskorn, C. &Oesterhelt, D. (1996). Electrospray ionization massspectrometry of genetically and chemically modifiedbacteriorhodopsins. Anal. Biochem. 243, 46–54.

41. Schaffner, W. & Weissmann, C. (1973). A rapid, sensi-tive, and specific method for the determination ofprotein in dilute solution. Anal. Biochem. 56, 502–514.

42. Heukeshoven, J. & Dernick, R. (1988). Improvedsilver staining procedure for fast staining in Phast-System development Unit. I. Staining of sodiumdodecyl sulfate gels. Electrophoresis, 9, 28–32.

Edited by B. Holland

(Received 25 February 2002; received in revised form 22 April 2002; accepted 29 April 2002)


Expression, Puriﬁcation and Characterisation of Full .../file/RegA... · Rhodobacter sphaeroides...

Documents

Transcript of Expression, Puriﬁcation and Characterisation of Full .../file/RegA... · Rhodobacter sphaeroides...