APMIS 111: 197–211, 2003 Copyright C APMIS 2003Printed in Denmark . All rights reserved

ISSN 0903-4641

Expression of Wnt and Notch pathway genes in a pluripotenthuman embryonal carcinoma cell line and embryonic stem cells

JAMES WALSH and PETER W. ANDREWS

Department of Biomedical Science, University of Sheffield, Western Bank, Sheffield S10 2TN, United Kingdom

Walsh J, Andrews PW. Expression of Wnt and Notch pathway genes in a pluripotent human embry-onal carcinoma cell line and in human embryonic stem cells. APMIS 2003;111:197–211.

Embryonal carcinoma (EC) cells, the pluripotent stem cells of teratocarcinomas, show many similar-ities to embryonic stem (ES) cells. Since EC cells are malignant but their terminally differentiatedderivatives are not, understanding the molecular mechanisms that regulate their differentiation maybe of value for diagnostic and therapeutic purposes. We have examined the expression of multiplecomponents of two developmentally important cell-cell signalling pathways, Wnt and Notch, in thepluripotent human EC cell line, NTERA2, and the human ES cell line, H7. Both pathways have well-documented roles in controlling neurogenesis, a process that occurs largely in response to retinoicacid (RA) treatment of NTERA2 cultures and spontaneously in H7 cultures. In NTERA2, many ofthe genes tested showed altered transcriptional regulation following treatment with RA. These includemembers of the frizzled gene family (FZD1, FZD3, FZD4, FZD5, FZD6), encoding receptors forWnt proteins, the Frizzled Related Protein family (SFRP1, SFRP2, FRZB, SFRP4), encoding solubleWnt antagonists and also ligands and receptors of the Notch pathway (Dlk1, Jagged1; Notch1,Notch2, Notch3). Few differences were found in the repertoire of Wnt and Notch pathway genesexpressed by NTERA2 EC cells and H7 ES cells. We present a model in which interactions betweenand regulation of Wnt and Notch signalling are important in maintaining EC/ES stem cells and alsocontrolling their differentiation.

Key words: Embryonal carcinoma; embryonic stem; Wnt; Frizzled; Notch; neurogenesis.

Peter W. Andrews, Department of Biomedical Science, University of Sheffield, Western Bank, Shef-field, S10 2TN, UK. e-mail: P.W.Andrews/Sheffield.ac.uk

Teratocarcinomas are a class of germ cell tu-mours comprising a differentiated (teratoma)component, which may contain a variety of em-bryonic and adult tissues, and an undifferenti-ated (embryonal carcinoma, EC) stem cell com-ponent from which the differentiated cells arise(1, 2). The ability of certain EC cell lines to re-spond to developmental cues in vitro and theirmorphological and biochemical similarity tothe stem cells of the inner cell mass of the em-bryo led to their use as a paradigm for cell dif-ferentiation in mouse and human embryos (3,4). Even with the derivation of embryonic stem(ES) cell lines in both species (5–8), EC cellscontinue to provide a complementary experi-

197

mental tool, since they are easier to maintainand their more restricted lineage repertoire mayfacilitate the investigation of the molecularmechanisms that regulate differentiation.Further, since the differentiated derivatives ofEC cells commonly do not exhibit a malignantphenotype, the mechanisms that control EC dif-ferentiation could be expected to play a role ingerm cell tumour progression and determiningthe relative degree of aggressive malignancy inindividual tumours.

Among the more extensively studied EC celllines are the murine line, P19, and the humanline, NTERA2. Both differentiate in response toretinoic acid, with neurons prominent amongst

WALSH & ANDREWS

the cell types produced (9, 10). Two signallingpathways regulating neural differentiation fromuncommitted precursor cells during embryonicdevelopment are those related to Wnt and Notchgene function (11, 12). Both pathways arehighly conserved in divergent organisms andhave well documented roles in the process ofneurogenesis, as well as in the regulation of cellproliferation, differentiation and pattern for-mation in a wide variety of tissues. In particu-lar, Wnt activation tends to promote, andNotch activation tends to inhibit neuronal dif-ferentiation. Furthermore, dysfunction in eitherpathway can produce developmental abnor-malities and cancer. The expression of genes en-coding components of these systems and thecorresponding implied signalling activity istherefore of interest to developmental biologistsand cancer researchers alike.

The proteins encoded by the genes of the Wntfamily are secreted, diffusible ligands for mem-bers of the Frizzled family of 7-span transmem-brane receptors. A cysteine rich domain (CRD)on the extracellular domain of the Frizzled pro-teins constitutes the binding site for Wnts (13,14). This ligand-receptor interaction may be an-tagonised by a variety of secreted factors suchas Frizzled Related Proteins (FRPs), which con-tain a CRD similar to Frizzled, but lack trans-membrane regions (15). Other antagonists in-clude the products of Cerberus (16), Dickkopf(17) and WIF (18) loci. Both Frizzled and FRPproteins are highly promiscuous and show af-finity for multiple Wnt homologues, even thoseof evolutionarily divergent organisms. However,the receptors are not all functionally equivalentand the intracellular signalling cascade acti-vated is determined by the specific combinationof Wnt and Frizzled involved. In canonical sig-nalling, a cytoplasmic protein encoded by theDishevelled gene inhibits the phosphorylationand consequent degradation of b-catenin withina complex containing Axin, APC and GSK3b(19, 20). b-catenin then accumulates within thecell and a portion of the cytoplasmic pool istranslocated to the nucleus. Here, it serves as aco-factor for members of the TCF/Lef familyof DNA binding proteins, leading to enhancedtranscription of target genes (21, 22). The activ-ity of b-catenin-TCF/Lef is promoted in ver-tebrates but notably, inhibited in Drosophila byanother co-factor, CBP (23, 24). The TCF/Lef

198

proteins can also repress gene expression whencombined with members of the TLE family ofDrosophila Groucho homologues, even in thepresence of b-catenin (25, 26). A list of someof the target genes of the canonical pathway ismaintained at http://www.stanford.edu/∂rnus-se/pathways/targets.html.

Alternative signalling pathways activated byWnt-Frizzled binding have also been reported.These may lead to JNK activation via Dishev-elled and Ca(2π) fluxes that enhance the func-tion of responsive enzymes such as Protein Ki-nase C (27, 28).

Notch proteins are single span transmembranereceptors that undergo proteolytic cleavage uponinteraction with membrane-bound ligands of theDelta-Serrate-Lag-2 (DSL) family (29–32). Aportion of the intracelluar domain of the Notchreceptor (Nintra) then translocates to the nu-cleus, where it combines with the DNA bindingprotein, CBF1, to form a transcription factor(33, 34). However, the existence of an alternativemechanism is evidenced by the fact that Notchactivation can alter cell fate in the absence ofCBF1 (35, 36), although the means by which thisoccurs has not yet been described in detail and itstargets are not well defined. Among the reportedtargets of Nintra-CBF1 are genes of the Droso-phila Enhancer of Split complex (ES-C) encodingbasic helix-loop-helix factors and their homo-logues in other species (37, 38). These proteinsact as transcriptional repressors in combinationwith Groucho/TLE (39).

In developmental systems, the Wnt andNotch pathways may interact at several levelsand insights into these processes have been pro-vided by model organisms such as Drosophila.For example, in Drosophila, a group of genesthat are activated in response to Wnt signalling,the ‘‘proneural’’ Achaete-Scute complex (AS-C)family, may be silenced following Notch acti-vation (40, 41). Reciprocally, AS-C genes mayregulate signalling activity of the Notch path-way in a non-cell autonomous manner by con-trolling the expression of ligands such as Deltaand Serrate (39, 42). This constitutes the basisof ‘‘lateral inhibition’’, in which a restrictednumber of cells are permitted to differentiatewithin an initially uniform precursor popula-tion. Additionally, Wnt proteins can bind Notchand induce a qualitatively distinct responsefrom the receptor than that of DSL ligands (43–

NOTCH AND WNT EXPRESSION IN EC CELLS

45). Also, following activation by Frizzled in re-sponse to Wnt, Dishevelled can inhibit the func-tion of Nintra (46). It is therefore apparent thatan examination of the expression of compo-nents of each of these pathways in isolation willfail to provide as much information as a com-parative study involving both.

The expression of several Wnt genes has beendescribed in mouse EC and ES cells, many ofwhich show altered levels of transcription duringdifferentiation (47, 48). Furthermore, overex-pression of Wnt1 alone can induce the differen-tiation of P19 EC cells. These data suggest thatWnt signalling may play an important role inregulating the behaviour of mouse EC and EScells. A similar role is probable in human systemssuch as NTERA2, in which the expression of anumber of Wnt genes has also been described.These include Wnt13/2b, Wnt3, Wnt3a, Wnt8aand Wnt8b (49–51). However, the presence orotherwise of members of the Frizzled receptorfamily and other downstream componentsnecessary for signalling to occur has not beenstudied in detail. The significance of Wnt gene ex-pression in these cells therefore remains question-able. Likewise, data relating to the Notch path-way in human EC and ES cells is sparse.

We have now investigated the expression ofmultiple components of the Wnt and Notch sig-nalling pathways in the pluripotent human ECcell line NTERA2 and also in the human ES cellline H7. These include members of the frizzledand FRP gene families and also DSL and Notch.In the NTERA2 system, many of the genesexamined showed altered transcriptional regula-tion during differentiation induced by retinoicacid. Few differences were found in the repertoireof Wnt and Notch pathway genes expressed byNTERA2 EC cells and H7 ES cells, althoughsome that were detected might significantly affectthe relative degree of pluripotency of these cells.Based on these data, we present a tentative modelin which regulation of Wnt and Notch signallingis important for both maintaining EC/ES stemcells in an undifferentiated state and also di-recting their differentiation.

MATERIALS AND METHODS

Cell cultureNTERA2 cl.D1 EC cells (52) were passaged by

199

scraping with glass beads and maintained at 37 æC inDulbecco’s modified Eagle’s medium (DMEM),supplemented with 10% foetal calf serum under a hu-midified atmosphere of 10% CO2 in air. For retinoicacid treatment, the cells were harvested using 0.25%(w/v) trypsin in 1mM EDTA, and seeded at 106 cellsper 75 cm2 culture flask in medium containing 10ª5

M all-trans-retinoic acid (Eastman Kodak, Roches-ter, NY), diluted from a 10ª2 M stock solution indimethyl sulfoxide as previously described (9). TheH7 human ES cell line (8) was passaged by scrapingwith glass beads 5–10 minutes after treatment with 1mg/ml collagenase IV in DME F12 (GIBCO, Invi-trogen Corp., Paisley, UK). H7 cells were cultured inKnockout- DMEM medium (GIBCO) supplementedby 20% ‘‘Serum Replacement, SR’’ (GIBCO), onmouse embryo fibroblast feeder cells inactivated withmitomycin C, under a humified atmosphere of 5%CO2 in air.

RNA preparation and Northern blot analysisTotal RNA was isolated from cells using TRI Re-

agent (Sigma-Aldrich, Poole, Dorset, UK) andmRNA was purified from total RNA using oligo-dTcellulose (Ambion, Austin, TX), as per manufacturers’instructions. Northen blots were prepared using 5 mgmRNA blotted onto GeneScreen Plus membrane(NEN, Boston, MA) and fixed by UV cross linking.

TABLE 1. List of IMAGE clones

Accession no. IMAGE I.D. Clone name GeneAA587211 1090346 2729-m03 FZD1AA436403 756467 1860-e12 FZD3R26355 133114 186-p11 FZD4AA065217 529177 1268-q02 FZD6AA582269 1087557 2722-h22 FZD7AI697852 2341426 5809-m11 FZD10AA866116 1470340 3719-f05 CerberusAI081882 1662324 4219-e13 SFRP1H87071 220525 437-i14 SFRP2R63748 139284 203-a13 FRZBAA291847 725269 1779-a14 SFRP4AI188094 1734342 4406-n07 hDvl-1AA447930 786155 1937-i12 hDvl-2AA292323 723841 1775-f02 hDvl-3R75687 158891 254-b12 AxinAI092164 1694264 4302-h09 APCAA418102 767415 188-m16 GSK3AA206279 647684 1576-p21 TCF-1AI094681 1670453 4240-h06 TLE1AI498147 2165386 5348-f11 CBPAA825601 1372083 3463-h04 Notch1AI139986 1689908 4291-b21 Notch2AA557201 1056449 2641-h18 Notch3R31152 134246 189-o15 Notch4AA443405 783936 1931-n01 Delta-like1AI703128 2339033 5803-i18 JaggedU69180 153060 238-o13 Jagged2

WALSH & ANDREWS

The ‘‘Prime-a-Gene’’ random-primed DNA labellingkit (Promega, Madison, WI) was used to generateprobes radiolabelled with aP32 dATP, 3000 Ci/mmol(NEN). For template DNA, previously obtained PCRclones for FZD2 and Hfz5 were used (Wakeman et al.1998) and a FZD9 clone was supplied by Yuker Wang(Howard Hughes Medical Institute, Stanford MedicalCenter, CA). IMAGE clones supplied by the HumanGenome Mapping Project (HGMP, Cambridge, UK)were used as template DNA for the remaining genesexamined, shown in Table 1.

Hybridisation was carried out at 42 æC in buffercomprising 5¿ SSC, 50% (w/v) deionized formamide,1% SDS and 10% (w/v) dextran sulphate, Na salt(Molecular weight 500,000) (Sigma Aldrich, Poole,Dorset, UK).

b-actin, Accession number NM_00110 F: atctggcaccacaccttctacaatgagctgcgR: cgtcatactcctgcttgctgatccacatctgc (60 æC)

CBF1, Accession number XM_029255 F: tcctgtgcctgtggtagagaR: actgtggctgtagatgatgtga (60 æC)

Dlk1, Accession number U15979 F: cctcttgctcctgctggctttR: atgggttgggggtgcagctgtt (60 æC)

FZD2, Accession number NM_001466 F: tacccagagcggcctatcatttttR: acgaagccggccaggaggaaggac (60 æC)

FZD4, Accession number NM_012193 F: cctgggccatccccgcagtgaaaaR: gaataccgaaaaagtgcccagttg (60 æC)

Hfz5, Accession number NM_003468 F: gggcccgttcgtgtgcaagtgtcgR: atcgcggcggccaggaaccag (60 æC)

FZD6, Accession number NM_003506 F: tggcctgaggagcttgaatgtgacR: atcgcccagcaaaaatccaatgaa (60 æC)

Notch1, Accession number AF308602 F: gcggccgcctttgtggttctgttcR: gccggcgcgtcctcctcttcc (65 æC)

Notch2, Accession number XM_016986 F: tcgtgcaagagccagttacccR: aatgtcatggccgcttcagag (60 æC)

Notch3, Accession number NM_000435 F: aagttacccccaagaggcaagtgttR: aaggaaatgagaggccagaaggaga (58 æC)

SFRP4, Accession number AF026692 F: agaggagtggctgcaatgaggtcR: gcgcccggctgttttctt (60 æC)

TLE1, Accession number NM_005077 F: ctccagccatagaccccctcgttaR: cactatgagagtgcagccatcgggt (60 æC)

Waf1, Accession number U03106 F: cagggtcgaaaacggcggcaR: aggagccacacccctccaga (60(æC)

Wnt1, Accession number X03072 F: cctcctacctggggactcctR: cagtggaaggaaatactgat (60 æC)

Wnt13/2b, Accession number NM_004185 F: tgagtggttcctgtactctgR: actcacactgggtaacacgg (60 æC)

RESULTS

Expression of human frizzled homologues inNTERA2 cells

The expression of FZD1, FZD2, FZD3,FZD4, Hfz5, FZD6, FZD7, FZD9 and FZD10was examined in NTERA2 EC and retinoicacid-treated cells using Northern analysis (Fig.1). FZD1 and FZD6 were detected as bands of

200

Reverse transcription and polymerase chain reactionFor RT-PCR, 1 mg mRNA was reverse transcribed

using 0.5 mg oligo-dT primer with Moloney MurineLeukaemia Virus reverse transcriptase (Promega) ina 40 ml reaction volume containing 1.25 mM dNTPsat 37 æC. Oligonucleotide primers for use in PCR weredesigned using the PrimerSelect program from theDNASTAR software package (DNASTAR Inc., Ma-dison, WI).

PCR was performed using 1 ml of RT reaction in50 ml PCR containing 15 pMol of each primer, 0.1mM dNTPs and 0.3 units Taq polymerase (Promega).Thermal cycling for each pair of primers was as fol-lows: 94 æC 1 min; tA 1 min; 72 æC 1 min 30 s, re-peated 35 times, where tA is the annealing tempera-ture shown in brackets after each primer pair:

4.5 Kb and 4 Kb, respectively, both showing aprogressive increase in expression throughoutthe RA time course. A FZD3 probe identifiedfour bands, showing a broad size distribution,but with identical expression patterns. A majorband at 1.8 Kb was seen, together with weakerbands of about 4 Kb, 9 Kb and 14 Kb (notshown). These are consistent with the mRNAsizes reported by Kirikoshi et al. (53). Whilst

NOTCH AND WNT EXPRESSION IN EC CELLS

Fig. 1. Expression of multiple human frizzled homologues in NTERA2 EC cells and differentiated derivatives.Northern analysis of human frizzled homologues FZD1, FZD2, FZD3, FZD4, Hfz5, FZD6, FZD7 and FZD9in NTERA2 EC cells and retinoic acid (RA) treated cultures at 3, 7, 14 and 21 days (EC, RA3, RA7, RA14and RA21, respectively). Note that FZD1, FZD3, FZD4, Hfz5 and FZD6 all show altered levels of transcriptionfollowing RA-induced differentiation. The ubiquitously expressed b-actin gene was used as a loading control,an example of which is shown.

each FZD3 transcript was detected in both ECcells and RA-treated cultures, a substantial,transient increase in expression was seen at 14days following RA treatment. FZD4 was de-tected as a 7 Kb transcript which was transi-ently up-regulated at 3 and 7 days following RAtreatment. A Hfz5 probe identified a majorband at about 6 Kb, together with weaker bands(not shown) at 2.3 Kb and 1.8 Kb. The deducedmRNA size for Hfz5 is 2.3 Kb (14), raising thepossibility that NTERA2 cells express alterna-tive forms of this mRNA. Each Hfz5 transcriptshowed an identical pattern of regulation dur-ing differentiation. Strong expression was seenin EC cells, followed by a marked down-regula-tion 3 days after RA treatment. At 7 days, atransient up-regulation was seen, followed by areturn to low levels of expression at subsequenttime points. The patterns of variable expressiondetected for FZD3, FZD4 and Hfz5 were veri-fied in repeat experiments. FZD2, FZD4. FZD7and FZD9 did not show significant changes inexpression during differentiation and FZD10was not detected (not shown).

201

Expression of soluble Wnt antagonists inNTERA2 cells

To examine a possible role in regulating Wnt-Frizzled signalling, we analysed the expressionof several genes encoding soluble Frizzled Re-lated Proteins (FRP) which could act as antago-nists of Wnt ligands (Fig. 2). The nomenclatureused in this study for these human FRP genes isthat suggested by Roel Nusse on the Wnt GeneHomepage (http://www.stanford.edu/∂rnusse/wntwindow.html).

All four FRP-class transcripts examined wereexpressed by NTERA2. The SFRP1 probe iden-tified a single band of around 4 Kb, showingstrong expression in EC cells and marked down-regulation following RA treatment. A similarpattern of expression was observed for tran-scripts of SFRP2, at 1.3 Kb and 1.9 Kb, whichwere prominent in EC cells, but almost un-detectable following RA treatment. The FRZBprobe identified bands at 1.5 Kb, 1.9 Kb and2.6 Kb, each of which exhibited an identical,complex pattern of temporal regulation duringNTERA2 differentiation. After an initial, tran-

WALSH & ANDREWS

Fig. 2. Expression of multiple Frizzled Related Pro-tein homologues in NTERA2 EC cells and differen-tiated derivatives. Northern analysis of humanFrizzled Related Protein homologues SFRP1,SFRP2, FRZB and SFRP4 in NTERA2 EC cells andretinoic acid (RA) treated cultures at 3, 7, 14 and 21days (EC, RA3, RA7, RA14 and RA21, respectively).Note the prominent expression of SFRP1 andSFRP2 in EC cells and the down-regulation of thesetranscripts following RA treatment. Note also the in-duction of SFRP4 at 7 days after RA treatment andmarked up-regulation at 21 days.

sient up-regulation at 3 days following RAtreatment, each band was subsequently down-regulated at 7 and 14 days, then up-regulatedonce again by 21 days. Finally, in contrast tothe other three FRP genes examined, SFRP4was not detected in EC cells or at early stagesof RA treatment, but a weak band of 2.8 Kbwas seen by 7 days, and was substantially up-regulated at 21 days following RA treatment. Aweaker band at around 3.5 Kb showed a similarpattern of expression (not shown). Anothergene, Cerberus, which encodes a soluble antag-onist of Wnt signalling was not detected (notshown).

Expression of FZD6 and SFRP4 in clonedcDNA libraries derived from NTERA2 cells

To investigate the possibility that develop-mentally regulated frizzled and FRP transcriptsmay accumulate differentially in distinct sub-

202

populations of cells during NTERA2 differen-tiation, we performed PCR analysis on threecloned cDNA libraries derived from NTERA2EC cells, a purified NTERA2-derived neuronalpopulation and also an NTERA2-derived non-neuronal, differentiated population identified bythe expression of the ME311 antigen (54) (Fig.3). Since the neuron and ME311π libraries wereprepared from cells treated with RA for 3–4weeks, only FZD6, and SFRP4, which showsubstantial up-regulation at 21 days post RA,were analysed. For FZD6, equivalent levels ofexpression were detected in the EC andME311π libraries, whilst no expression wasfound in the NTERA2 neuron library. ThusFZD6 appears to be associated with the non-neuronal pathway of differentiation. ForSFRP4, no products were amplified from theNTERA2 EC library, but a band of the appro-priate size was readily amplified from ME311πlibrary. This is the same population of cells pre-viously described as expressing Wnt13/2b at

Fig. 3. Expression of FZD6 and SFRP4 in clonedcDNA libraries derived from NTERA2 EC cells anddifferentiated derivatives. PCR analysis of the humanfrizzled homologue, FZD6 and the Frizzled RelatedProtein, SFRP4 in three cloned cDNA libraries de-rived from NTERA2 cells. The libraries were fromNTERA2 EC cells (NT2 EC), a sorted, non-neuronalpopulation of differentiated cells recognised by theME311 antigen (ME311π) and a purified populationof neurons. FZD6 was detected at equivalent levels inboth NTERA2 EC and ME311π cells, but was notexpressed by neurons. SFRP4 was not detected inNTERA2 EC cells but was prominent in theME311π population and barely detectable inNTERA2 neurons. PCR for the ubiquitous, low leveltranscript, Waf, was used as a loading control.

NOTCH AND WNT EXPRESSION IN EC CELLS

high levels (51). Additionally, an extremely weakband was detected in the neuron library. Thismay represent low-level expression of SFRP4 byneurons, or may be an artefact arising fromcontamination of the neuronal cell populationwith non-neuronal cells during preparation ofthe library.

Expression of genes encoding downstreamcomponents of the Wnt pathway in NTERA2cells

In addition to frizzled and FRP class tran-scripts, multiple downstream components of theWnt pathway were also examined by Northernblot analysis. Dishevelled homologues 2 and 3,Axin 1 and 2, APC, GSK3b, CBP and TCF1were each readily detected, but did not show al-tered transcription during differentiation (notshown).

Expression of Notch pathway related genes inNTERA2 cells

We then examined NTERA2 cells for the ex-pression of genes encoding ligands and recep-tors of the Notch pathway, as well as TLE1,which encodes a member of a family of Grouchohomologues thought to be involved in both theNotch and Wnt pathways (Fig. 4). Delta-like 1

Fig. 4. Expression of genes encoding components of the Notch pathway in NTERA2 EC cells and differentiatedderivatives. Northern analysis of genes encoding the ligands Dlk1 and Jagged1, the receptors Notch1, Notch2and Notch3 and the co-repressor, TLE1 in NTERA2 EC cells and retinoic acid (RA) treated cultures at 3, 7,14 and 21 days (EC, RA3, RA7, RA14 and RA21, respectively). Dlk1 was expressed in EC cells and substan-tially down-regulated at 3 days after RA treatment, followed by a progressive recovery in expression. Jagged1was transiently up-regulated at 3 days. Both Notch1 and Notch3 were slightly down-regulated at 3 and 21 dayscompared to EC cells, whilst Notch2 increased at 14 and 21 days. Note that the pattern of TLE1 expressionfollowing RA treatment is very similar to that of Dlk1.

203

(Dlk1) was detected as a 1.5 Kb transcriptwhich was prominent in EC cells, but markedlydown-regulated after 3 days of RA treatment.However, a gradual recovery in expression wasseen at subsequent time points until by 21 days,expression of Dlk1 was approximately equiva-lent to that seen in EC cells. Jagged1 was de-tected as a transcript of around 5.5 Kb. Its ex-pression was weaker than that of Dlk1 in ECcells, but showed a transient up-regulation at 3days following RA treatment. Jagged2 was notdetected (not shown).

Of the receptor family, a band at around 7Kbcorresponding to Notch1 was present in bothEC and differentiated cultures of NTERA2.However, two distinct phases of slight down-regulation were seen in response to RA, at 3days and 21 days. A 9 Kb transcript for Notch2showed increased expression at around 14 daysfollowing RA-treatment, compared to that seenin EC cells. Notch3, detected as an 8 Kb band,had an expression profile indistinguishable fromthat of Notch1, with down regulation at 3 and21 days. Notch4 was not detected (not shown).

Notably, TLE1 showed a pattern of expres-sion strikingly similar to that of Dlk1. Readilydetected in EC cells as a 3.6 Kb transcript, asubstantial but transient down-regulation was

WALSH & ANDREWS

evident following RA treatment. This was mostprominent at the earliest time point tested (3days) with a progressive recovery in expressionthereafter.

A comparison of Wnt and Notch pathway genesin NTERA2 cells and human embryonic stemcells

We used RT-PCR analysis to compare the ex-pression of several Wnt and Notch pathwaygenes (Wnt13/2b, FZD2, FZD4, FZD6, SFRP4,TLE1, Dlk1, CBF1 and Notch1, Notch2 andNotch3) in NTERA2 EC cells and in the humanES cell line, H7 (Fig. 5). We also examined the

Fig. 5. A comparison of the expression of Wnt and Notch pathway genes in NTERA2 EC cells and H7 humanembryonic stem cells. RT-PCR analysis of several of the Wnt and Notch pathway genes (FZD2, FZD4, FZD6,Dlk1, Notch1, Notch2, Notch3, CBF1 and TLE1) in NTERA2 EC cells and the human ES cell line H7. Notethat only three of these genes showed substantial differences in expression between EC and ES cells. Dlk1appeared more abundant in H7 cells than in NTERA2, whilst for Notch1, the reverse was the case. Also, Wnt1was readily detected in H7 ES, but not NTERA2 EC cells. The ubiquitously-expressed b-actin gene was usedas both a loading control and a control for genomic contamination of RNA samples.

204

expression of Wnt1, which has previously beenreported in mouse EC and ES cells but notNTERA2. Each of the frizzled homologuestested showed equivalent expression inNTERA2 and H7, as did TLE1, CBF1, Notch2and Notch3. Also, neither of the RA-induciblegenes examined (Wnt2b and SFRP4) were de-tected in either cell line (not shown). However,three genes did show substantial differences inexpression: Dlk1 appeared more abundant inH7 cells than in NTERA2, whilst for Notch1,the reverse was the case. Additionally, Wnt1 wasdetected as an extremely faint band inNTERA2, but was readily seen in H7.

NOTCH AND WNT EXPRESSION IN EC CELLS

DISCUSSION

On examining the candidate receptor systemfor Wnt ligands in the NTERA2 system, fiveof the eight frizzled homologues expressedwere developmentally regulated. FZD1, FZD3,FZD4, FZD5 and FZD6 all showed markedchanges during differentiation. Since differentWnt-Frizzled combinations can elicit distinctsignalling activity (28, 55), these changes mayreflect an altered ability of differentiating cellsto respond to Wnt proteins, both qualitativelyand quantitatively. Further, FZD6 expressionwas not uniform among differentiated deriva-tives of NTERA2. Whilst a progressive andsubstantial up-regulation of this gene was ob-served in the mRNA of RA-treated cultures,it was detected at equivalent levels in cDNAlibraries derived from EC and ME311π cellsand not detected in the neuron library. Thesedata suggest that the marked up-regulation ofFZD6 occurs in a population of differentiatedcells distinct from the ME311π cells in whichhigh levels of Wnt-13/2b have been described(51) and that it is specifically excluded fromthe neuronal population. This raises the possi-bility that restricted expression of specificFrizzled receptors may be involved in lineageselection.

The FRP family of Wnt binding proteins alsoexhibited transcriptional changes which implythat dynamic regulation of the signalling activ-ity of this pathway is a feature of NTERA2 dif-ferentiation. Bearing in mind their promiscuity,it is likely that more than one of the FRPs ex-pressed by NTERA2 may bind any Wnt proteinsecreted by the cells and inhibit its function. Ifthis is indeed the case, then the expression datafor the four FRP homologues suggest that astrong inhibition of Wnt signalling is imposedon NTERA2 EC cultures by SFRP1, SFRP2and FRZB and that this inhibition is reduced atan early stage of differentiation, concurrentwith the onset of Wnt13/2b expression. At laterstages of differentiation, the induction ofSFRP4 may serve to extinguish Wnt signalling.Notably, in common with Wnt13/2b, SFRP4was abundant in a cDNA library derived fromME311π differentiated derivatives ofNTERA2, but was absent in EC and neuron lib-raries. One possibility is that SFRP4 may be in-duced in Wnt13/2b-producing cells by a feed-

205

back mechanism, when ligand concentrationreaches a critical level.

Downsteam of the receptors and antagoniststhat interact with Wnt proteins, a variety of in-tracellular components of the signalling path-way were also found to be present in NTERA2cells. These expression data further indicate thatthe cells are competent to respond to Wntligands. Most of the genes examined showed nosignificant transcriptional changes during dif-ferentiation, which probably reflects regulationof their functions by protein activation/inacti-vation rather than by abundance of mRNA.

On comparing the expression of a selectionof genes of the Wnt and Notch pathways in un-differentiated NTERA2 EC and H7 human EScells, few differences were found. Those thatwere present in the EC cells (FZD2, FZD4,FZD6, TLE1, Dlk1, CBF1 and Notch1, 2 and3) were also found in ES cells. Likewise, bothEC and ES cells lack of expression of the twoRA-inducable genes examined (Wnt13/2b andSFRP4). However, some differences wereevident. Wnt1 was detected in H7 ES but notNTERA2 EC, whilst Notch1 was expressed atfar lower levels in H7 ES cells than in NTERA2EC cells. These observations may offer a partialexplanation for some of the differences in be-haviour between the two lines. For example, it ispossible that the greater repertoire of cell typesproduced by mouse EC/ES and human ES cellscompared to human EC cells is a consequenceof higher levels of expression and/or a greaterrepertoire of Wnt genes. Also, for Notch1, thesubstantially lower expression in H7 ES cellscompared to NTERA2 EC cells may underlie alower overall inhibition of differentiation by theNotch pathway, rendering the stem cell pheno-type more unstable in the ES line.

Just as Wnt and Frizzled proteins exhibit alow level of specificity in their binding interac-tions with one another, so too do DSL ligandsand Notch homologues. In fact, it is probablethat no exclusive ligand-receptor pairs exist inthis system other than those determined simplyby restricted spatial expression. For example, ina cell-binding assay, Jagged1 has been shown tointeract with Notch1, 2 and 3 (56). However, inthis assay, the binding affinity of each ligand-receptor pair was not equivalent: Notch3 wasbound by Jagged1 with the greatest affinity,Notch2 was intermediate and Notch1 exhibited

WALSH & ANDREWS

Fig. 6. Interactions of the Wnt and Notch pathways. Both pathways may interact through several distinctmechanisms. Extracellularly, Wnt proteins may bind Notch and produce signalling activation that is distinctfrom that of DSL ligands and which includes an accumulation of the Notch receptor itself. Intracellularly, inresponse to Wnt signalling through Frizzled, the Dishevelled protein can bind Notch and inhibit its activation.In the nucleus, the TLE family of putative Notch target genes may bind TCF and inhibit the transcription ofWnt target genes. Reciprocally, the expression of Notch ligands and consequently, the activation of the Notchpathway in adjacent cells may be regulated by Wnt signalling.

the lowest affinity. These differences may be re-flected in quantitatively distinct signalling acti-vation through each of the receptors by Jag-ged1. Furthermore, the signals generated byNotch activation may also be qualitatively dis-tinct, as described for murine Notch3 comparedto Notch1 and 2 (38). Expression data inNTERA2 suggest that Notch signalling acti-vation through Dlk1 may be substantially de-creased shortly after RA treatment. By contrast,Notch activation by Jagged1 appears likely tobe enhanced in response to RA. It could be an-ticipated that the pattern of regulation of theseligands would cancel one another such thatthere is little or no overall change in signallingactivity of the pathway. However, Dlk1 and Jag-ged1 may exhibit preferential binding interac-tions with alternative receptors.

206

An attractive candidate for Dlk1 is Notch1,having been highlighted as a putative receptorfor this ligand in other systems (57, 58). If afavoured binding interaction does exist betweenthis ligand-receptor pair, then the reduced ex-pression of Dlk1 in response to RA would beanticipated to specifically reduce signallingthrough Notch1 to a greater extent than theother receptors. An insight into the likely conse-quences of this may be provided by mouse em-bryonic and EC model systems. Mice carrying anull mutation for Notch1 develop a neurogenicphenotype similar to that of the prototypicDrosophila Notch mutation (57). Reciprocally, adominant gain-of-function Notch1 was foundto inhibit the in vitro neuronal differentiationof murine P19 EC cells (59). Thus, a reductionin Dlk1 expression and consequently, Notch1

NOTCH AND WNT EXPRESSION IN EC CELLS

signalling may promote neurogenesis inNTERA2 cells. Similarly, since murine Jagged1exhibits a greater binding affinity for Notch3than Notch1 and 2 (56), it is possible that thetransient up-regulation of Jagged1 in NTERA2leads to preferential activation of Notch3. Ex-trapolating from observations in other systems(38, 60), this also would promote neurogenesis.

The regulation of neurogenesis by Notch in-volves controlling the expression of basic helix-loop-helix (bHLH) genes of the ES-C and theirhomologues in mammals (38, 39). The proteinsencoded by these genes act as transcriptional re-pressors when combined with co-factors of theGroucho/TLE family and inhibit neuronal dif-ferentiation. Similarly, loss of either bHLH ES-C or Groucho gene products can lead to excessneurogenesis (39). Following RA treatment ofNTERA2 EC cells, TLE1 and the Notch ligand,Dlk1 were regulated in a very similar manner.Furthermore, it has been reported that TLEgenes exhibit extensive co-expression withNotch homologues in developing mammaliansystems (61). Together, these data imply that inhumans, TLE1 may represent a target gene ofDlk1-Notch signalling. Since the TLE family ofGroucho homologues can convert TCF/Lefproteins into repressors of target genes (25, 26)it is possible that the pattern of TLE1 expres-sion shown here in NTERA2 EC and RA-treated cells reflects the level of silencing of Wnttarget genes in response to Notch activation.Accordingly, we present a model in which inter-actions of the Wnt and Notch signalling path-ways are important both in maintaining the un-differentiated state and also in regulating theprocess of differentiation itself among humanEC and ES cells (Fig. 6).

Our data suggest that inhibition of Wnt andactivation of Notch are features of undifferenti-ated human EC/ES cells and furthermore, thatthis situation is transiently reversed shortly afterRA treatment. It is possible that the predomi-nance of Notch signalling over Wnt is essentialfor maintaining the stem cell state and that oncethe balance is shifted beyond a critical point, thecells embark on a program of differentiation.During differentiation, Notch signalling mayalso be used and may even play an active rolein promoting neurogenesis. For example, Notchhas been shown to be required by a group ofcells at the Drosophila wing margin for induc-

207

tion and maintenance of wingless, the proto-typic fly Wnt gene (42, 62). The ligand producedby these cells then induces proneural develop-ment in an adjacent territory (63, 41). InNTERA2, an inductive, ligand producing popu-lation such as the ME311π cells that expressWnt13/2b may also be specified by Notch sig-nalling. Additionally, Notch may be used in alateral inhibition mechanism to restrict neur-onal differentiation among the cells respondingto Wnt ligands (62). Such a process could ac-count for the limited development of functional,post-mitotic neurons in differentiated NTERA2cultures, which represent approximately 5% ofthe total cell number.

This work was supported by grants from The Well-come Trust and Yorkshire Cancer Research. We aregrateful to Christine Pigott for excellent technical as-sistance, and to Jonathan Draper for the culture ofhuman ES cells.

REFERENCES

1. Kleinsmith LJ, Pierce GB. Multipotentiality ofsingle embryonal carcinoma cells. Cancer Res1964;24:1544–51.

2. Stevens LC, Hummel KP. A description of spon-taneous congenital testicular teratomas in strain129 mice. J Nat Cancer Inst 18:719–47.

3. Martin GR. Teratocarcinomas and mammalianembryogenesis. Science 1980;209:768–75.

4. Solter D, Damjanov I. Teratocarcinomas andthe expression of oncodevelopmental genes.Methods Cancer Res 1979;18:277–332.

5. Evans MJ, Kaufman MH. Establishment in cul-ture of pluripotential cells from mouse embryos.Nature 1981;292:154–6.

6. Martin GR. Isolation of a pluripotent cell linefrom early mouse embryos cultured in mediumconditioned by teratocarcinoma stem cells. ProcNatl Acad Sci USA 1981;78:7634–6.

7. Reubinoff BE, Pera MF, Fong C-Y, Trounson A,Bongso A. Embryonic stem cell lines from hu-man blastocysts: somatic differentiation in vitro.Nat Biotech 2000;18:399–404.

8. Thomson JA, Itskovitz-Eldor J, Shapiro SS,Waknitz MA, Swiergiel JJ, Marshall VS, et al.Embryonic Stem Cell Lines Derived from Hu-man Blastocysts. Science 1998;282:1145–7.

9. Andrews PW. Retinoic Acid Induces NeuronalDifferentiation of a Cloned Human EmbryonalCarcinoma Cell Line in Vitro. Dev Biol 1984;103:285–93.

10. McBurney MW, Jones-Villeneuve EM, Edwards

WALSH & ANDREWS

MK, Anderson PJ. Control of muscle and neur-onal differentiation in a cultured embryonal car-cinoma cell line. Nature 1982;299:165–7.

11. Cadigan KM, Nusse R. Wnt signaling: a com-mon theme in animal development. Genes Dev1997;11:3286–305.

12. Weinmaster G. The Ins and Outs of Notch Sig-naling. Mol Cell Neurosci 1997;9:91–102.

13. Bhanot P, Brink M, Samos CH, Hsieh JC, WangY, Macke JP, et al. A new member of the frizzledfamily from Drosophila functions as a Winglessreceptor. Nature 1996;382:225–30.

14. Wang Y, Macke JP, Abella BJ, Andreasson K,Worley P, Gilbert DJ, et al. A Large Family ofPutative Transmembrane Receptors Homologousto the Product of the Drosophila Tissue PolarityGene frizzled. J Biol Chem 1996;271:4468–76.

15. Rattner A, Hsieh JC, Smallwood PM, GilbertDJ, Copeland NG, Jenkins NA, et al. A familyof secreted proteins contains homology to thecysteine-rich ligand-binding domain of frizzledreceptors. Proc Natl Acad Sci USA 1997;94:2859–63.

16. Piccolo S, Agius E, Leyns L, Bhattacharyya S,Grunz H, Bouwmeester T, De Robertis EM. Thehead inducer Cerberus is a multifunctional an-tagonist of Nodal, BMP and Wnt signals. Nature1999;397:707–10.

17. Glinka A, Wu W, Delius H, Monaghan AP, Blu-menstock C, Niehrs C. Dickkopf-1 is a memberof a new family of secreted proteins and func-tions in head induction. Nature 1998;391:357–62.

18. Hsieh JC, Kodjabachian L, Rebbert ML, RattnerA, Smallwood PM, Samos CH. A new secretedprotein that binds to Wnt proteins and inhibitstheir activities. Nature 1999;398:431–6.

19. Ikeda S, Kishida S, Yamamoto H, Murai H,Koyama S, Kikuchi A. Axin, a negative regulatorof the Wnt signaling pathway, forms a complexwith GSK-3beta and beta-catenin and promotesGSK-3beta-dependent phosphorylation of beta-catenin. EMBO J 1998;17:1371–84.

20. Hart MJ, de los Santos R, Albert IN, RubinfeldB, Polakis P. Downregulation of beta-catenin byhuman Axin and its association with the APCtumor suppressor, beta-catenin and GSK3 beta.Curr Biol 1998;8:573–81.

21. Behrens J, von Kries JP, Kuhl M, Bruhn L, Wed-lich D, Grosschedl R, et al. Functional interac-tion of beta-catenin with the transcription factorLEF-1. Nature 1996;382:638–42.

22. Molenaar M, van de Wetering M, OosterwegelM, Peterson-Maduro J, Godsave S, Korinek V,et al. XTcf-3 transcription factor mediates beta-catenin-induced axis formation in Xenopus em-bryos. Cell 1996;86:391–9.

23. Hecht A, Vleminckx K, Stemmler MP, van RoyF, Kemler R. The p300/CBP acetyltransferasesfunction as transcriptional coactivators of beta-

208

catenin in vertebrates. EMBO J 2000; 19:1839–50.

24. Waltzer L, Bienz M. Drosophila CBP repressesthe transcription factor TCF to antagonizeWingless signalling. Nature 1998;395:521–5.

25. Cavallo RA, Cox RT, Moline MM, Roose J, Po-levoy GA, Clevers H, et al. Drosophila Tcf andGroucho interact to repress Wingless signallingactivity. Nature 1998;395:604–8.

26. Roose J, Molenaar M, Peterson J, Hurenkamp J,Brantjes H, Moerer P, et al. The Xenopus Wnteffector XTcf-3 interacts with Groucho-relatedtranscriptional repressors. Nature 1998;395:608–12.

27. Li L, Yuan H, Xie W, Mao J, Caruso AM,McMahon A, et al. Dishevelled proteins lead totwo signaling pathways.Regulation of LEF-1 andc-Jun N-terminal kinase in mammalian cells. JBiol Chem 1999;274:129–34.

28. Slusarski DC, Corces VG, Moon RT. Interactionof Wnt and a Frizzled homologue triggers G-protein-linked phosphatidylinositol signalling.Nature 1997;390:410–3.

29. Fleming RJ, Scottgale TN, Diederich RJ, Artav-anis-Tsakonas S. The gene Serrate encodes aputative EGF-like transmembrane protein essen-tial for proper ectodermal development in Droso-phila melanogaster. Genes Dev 1990;4:2188–201.

30. Gu Y, Hukriede NA, Fleming RJ. Serrate expres-sion can functionally replace Delta activity dur-ing neuroblast segregation in the Drosophila em-bryo. Development 1995;121:855–65.

31. Rebay I, Fleming RJ, Fehon RG, Cherbas L,Cherbas P, Artavanis-Tsakonas S. Specific EGFrepeats of Notch mediate interactions with Deltaand Serrate: implications for Notch as a multi-functional receptor. Cell 1991;67:687–99.

32. Schroeter EH, Kisslinger JA, Kopan R. Notch-1signalling requires ligand-induced proteolytic re-lease of intracellular domain. Nature 1998;393:382–6.

33. Hsieh JJ, Henkel T, Salmon P, Robey E, PetersonMG, Hayward SD. Truncated mammalianNotch1 activates CBF1/RBPJk-repressed genesby a mechanism resembling that of Epstein-Barrvirus EBNA2. Mol Cell Biol 1996;16:952–9.

34. Lu FM, Lux SE. Constitutively active humanNotch1 binds to the transcription factor CBF1and stimulates transcription through a promotorcontaining a CBF1-responsive element. Proc NatlAcad Sci USA 1996;93:5663–7.

35. Matsuno K, Go MJ, Sun X, Eastman DS, Artav-anis-Tsakonas S. Suppressor of Hairless-inde-pendent events in Notch signaling imply novelpathway elements. Development 1997;124:4265–73.

36. Shawber C, Nofziger D, Hsieh JJ-D, Lindsell C,Bogler O, Hayward D, et al. Notch signaling in-hibits muscle cell differentiation through a

NOTCH AND WNT EXPRESSION IN EC CELLS

CBF1-independent pathway. Development 1996;122:3765–73.

37. Bailey AM, Posakony JW. Suppressor of hairlessdirectly activates transcription of enhancer ofsplit complex genes in response to Notch receptoractivity. Genes Dev 1995;9:2609–22.

38. Beatus P, Lundkvist J, Oberg C, Lendahl U. TheNotch 3 intracellular domain represses Notch 1-mediated activation through Hairy/Enhancer ofsplit (HES) promotors. Development 1999;126:3925–35.

39. Heitzler P, Bourouis M, Ruel L, Carteret C,Simpson P. Genes of the Enhancer of split andachaete-scute complexes are required for a regu-latory loop between Notch and Delta during lat-eral signalling in Drosophila. Development 1996;122:161–71.

40. Couso JP, Bishop SA, Martinez-Arias A. Thewingless signalling pathway and the patterningof the wing margin in Drosophila. Development1994;120:621–36.

41. Phillips RG, Whittle JRS. Wingless expressionmediates determination of peripheral nervoussystem elements in late stages of Drosophila wingdisc development. Development 1993;118:427–38.

42. de Celis JF, Bray S. Feed-back mechanisms af-fecting Notch activation at the dorsoventralboundary in the Drosophila wing. Development1997;124:3241–51.

43. Brennan K, Klein T, Wilder E, Martinez-AriasA. Wingless Modulates the Effects of DominantNegative Notch Molecules in the DevelopingWing of Drosophila. Dev Biol 1999;216:210–29.

44. Wesley CS. Notch and Wingless Regulate Expres-sion of Cuticle Patterning Genes. Mol Cell Biol1999;19:5743–58.

45. Wesley CS, Saez L. Notch responds differently toDelta and Wingless in cultured Drosophila cells.J Biol Chem 2000;275:9099–101.

46. Axelrod JD, Matsuno K, Artavanis-Tsakonas S,Perrimon N. Interaction between Wingless andNotch signalling pathways mediated by dishev-elled. Science 1996;271:1826–32.

47. Lako M, Lindsay S, Lincoln J, Cairns PM, Arm-strong L, Hole N. Characterisation of Wnt geneexpression during the differentiation of murineembryonic stem cells in vitro: role of Wnt3 inenhancing haematopoietic differentiation. MechDev 2001;103:49–59.

48. Smolich BD, Papkoff J. Regulated Expression ofWnt Family Members during NeurectodermalDifferentiation of P19 Embryonal CarcinomaCells: Overexpression of Wnt-1 Perturbs NormalDifferentiation-Specific Properties. Dev Biol1994;166:300–10.

49. Katoh M. Regulation of WNT3 and WNT3AmRNAs in human cancer cell lines NT2, MCF-7, and MKN45. Int J Oncology 2002;20:373–7.

209

50. Saitoh T, Mine T, Katoh M. Expression andregulation of WNT8A and WNT8B mRNAs inhuman tumor cell lines: Up-regulation ofWNT8B mRNA by beta-estradiol in MCF-7cells, and down-regulation of WNT8A andWNT8B mRNAs by retinoic acid in NT2 cells.Int J Oncology 2002;20:999–1003.

51. Wakeman JA, Walsh J, Andrews PW. HumanWnt-13 is developmentally regulated during thedifferentiation of NTERA-2 pluripotent humanembryonal carcinoma cells. Oncogene 1998;17:179–86.

52. Andrews PW, Damjanov I, Simon D, Banting G,Carlin C, Dracopoli NC, et al. Pluripotent em-bryonal carcinoma clones derived from the hu-man teratocarcinoma cell line Tera-2: Differen-tiation in vivo and in vitro. Lab Invest1984;50:147–62.

53. Kirikoshi H, Koike J, Sagara N, Saitoh T, Toku-hara M, Tanaka K, et al. Molecular Cloning andGenomic Structure of Human Frizzled-3 atchromosome 8p21. Biochem Biophys Res Com-mun 2000;271:8–14.

54. Ackerman SL, Knowles BB, Andrews PW. Generegulation during neuronal and non-neuronaldifferentiation of NTERA2 human teratocarcin-oma-derived stem cells. Brain Res Mol Brain Res1994;25:157–62.

55. Yang-Snyder J, Miller JR, Brown JD, Lai CJ,Moon RT. A frizzled homolog functions in a ver-tebrate Wnt signaling pathway. Curr Biol1996;6:1302–6.

56. Shimizu K, Chiba S, Kumanu K, Hosoya N, Taka-hashi T, Kanda Y, et al. Mouse Jagged1 PhysicallyInteracts with Notch2 and Other Notch Recep-tors. J Biol Chem 1999;274:32961–9.

57. de la Pompa JL, Wakeham A, Correia KM,Samper E, Brown S, Aguilera RJ, et al. Conser-vation of the Notch signalling pathway in mam-malian neurogenesis. Development 1997;124:1139–48.

58. Lindsell CE, Boulter J, diSibio G, Gossler A,Weinmaster G. Expression Patterns of Jagged,Delta1, Notch1, Notch2, and Notch3 GenesIdentify Ligand-Receptor Pairs That May Func-tion in Neural Development. Mol Cell Neurosci1996;8:14–27.

59. Nye JS, Kopan R. Vertebrate ligands for Notch.Curr Biol 1995;5:966–9.

60. Lardelli M, Williams R, Mitsiadis T, Lendahl U.Expression of the Notch 3 intracellular domainin mouse central nervous system progenitor cellsis lethal and leads to disturbed neural tube devel-opment. Mech Dev 1996;59: 177–90.

61. Liu Y, Dehni G, Purcell KJ, Sokolow J, Carcang-iu M, Artavanis-Tsakonas S, et al. Epithelial Ex-pression and Chromosomal Location of HumanTLE Genes: Implications for Notch Signalingand Neoplasia. Genomics 1996;31:58–64.

WALSH & ANDREWS

62. Rulifson EJ, Blair SS. Notch regulates winglessexpression and is not required for the receptionof the paracrine wingless signal during wing mar-gin neurogenesis in Drosophila. Development1995;121:2813–24.

COMMENTS

J. Wolter Oosterhuis (Rotterdam, The Nether-lands): We believe that the embryonal carci-noma (EC) cells in germ cell tumours are de-rived from CIS cells which are the neoplasticcounterparts of primordial germ cells (PGC) orgonocytes. Are you suggesting that EC cells aremore similar to embryonic germ (EG) cells thanto embryonic stem (ES) cells? Also, are EG cellsreally similar to the embryonic cells, or are theredifferences? I would expect that they should bedifferent with respect to methylation and gen-omic imprinting.

Peter Andrews (Sheffield, UK): As you andothers have described, it seems likely in humansthat GCT arise by two steps – first the malig-nant transformation of PGC to CIS cells thateither progress as invasive seminomas or, in asecond step, convert to an ES-like phenotype asEC cells. In the mouse, CIS and seminomas arenot observed and, in our view, this can be mosteasily reconciled with the human case by theproposition that the second conversion stephappens with a much higher probability in themouse than in humans, so that mouse GCT ef-fectively by-pass the seminoma phase. As youknow, when mouse PGC are cultured in vitrothey convert to an ES-like phenotype and thesecells are known as EG cells. Based upon theforegoing hypothesis, we would have predictedthat the culture of human PGC would not yieldEG-like cells, but rather cells corresponding toCIS and seminoma. In fact, John Gearhart(Shamblott et al. Proc Natl Acad Sci USA1998;95:13726–31) has described human EGcells which are pluripotent and resemble humanES cells, thought interestingly there are rathermore substantial differences in growth patternsand marker antigen expression between humanEG and ES cells, than between mouse EG and

210

63. Couso JP, Martinez-Arias A. Notch is requiredfor wingless signaling in the epidermis of Droso-phila. Cell 1994;79:259–72.

ES cells. For example, the human EG cells ex-press SSEA1, which is not normally seen on hu-man ES cells, and they grow in ‘‘impossible’’clumps which are not easily disaggregated. De-spite the many similarities between mouse EGcells and ES cells, there are differences in theirimprinting patterns, and ability to repro-gramme somatic nuclei in cell fusion experi-ments. However, there is a lack of systemicstudies in the mouse comparing the imprintingpatterns in EC cells derived from testicular tu-mours, which one might assume to resemblemore closely EG cells, and EC cells derivedfrom teratocarcinomas resulting from embryotransplants, which might resemble blastocyst-derived ES cells. In the case of humans, therehave also been few studies though your grouphas, of course, reported biallelic expression ofimprinted genes in human GCT, consistent withan origin from PGC after imprinting erasure.All in all, however, it seems that EG cells, EScells and EC cells all resemble one another,though EG and EC cells may retain some fea-tures reflecting their PGC origin.

J. Wolter Oosterhuis: There is a big differencebetween PGCs and CIS cells in the human inthat human PGCs are diploid, and the tumourprecursor cells are tetraploid. We believe thatthe CIS cells are stuck in their maturation stagebecause they are tetraploid, and are thereforenot readily reprogrammable towards pluripot-ency.

Peter Andrews: That could be. Of course, theprogression of CIS to pluripotent ES-like cells,the EC cells, seems to be accompanied by geneloss.

Finn Edler von Eyben (Odense, Denmark): I am

NOTCH AND WNT EXPRESSION IN EC CELLS

confused by your diagram showing that CIS canprogress directly to seminoma, but must passthrough an ES (embryonic stem cell) stage be-fore progressing to EC (embryonal carcinoma).

Peter Andrews: EC cells are a caricature of EScells.

Finn Edler von Eyben: If the CIS cell passesthrough an ES stage, is it not possible that itcan give rise to different differentiated tissuecomponents derived from mesoderm, endodermand ectoderm? Such differentiation does not oc-cur if the CIS cell progresses to seminoma. Isthis pattern of differentiation related to thenotch system enabling differentiation in EC butblocking differentiation in seminoma?

Peter Andrews: I have no information on that.I assume that the differentiated components interatoma are due to differentiation of the EC/ES-like cells. In our view, Notch may play a rolein three separate areas pertinent to the biologyof GCT and EC and ES cells:

211

O Notch signalling might play a role in regulat-ing the switch from mitosis to meiosis inPGCs as they enter the male and female geni-tal ridges in early embryogenesis. This idea isbased in part on the studies of others in C.elegans; the hypothesis is that dysfunction ofthe postulated Notch system might lead toovergrowth of PGCs and initiation of GCT.

O Notch signalling between established ECcells might play a role in regulating their dif-ferentiation. In particular, we have con-sidered that EC cell: EC cell interaction byway of the Notch system might play a role inpreventing their differentiation and promot-ing self-renewal.

O Notch signalling may play a role in lineageselection when EC cells begin to differentiate.

Regarding the difference in pluripotency be-tween seminoma and EC, we have little relevantdata to address the question of whether Notchsignalling plays a role. We have detected Notch2 expression in seminoma and CIS, however, itis also expressed in EC.