Eur. J. Biochem. 227, 566-572 (1995) 0 FEBS 1995

Expression and purification of the high-affinity phosphate transporter of Saccharomyces cerevisiae Abraham BERHE, Ulrika FRISTEDT and Bengt L. PERSSON Department of Biochemistry, Arrhenius Laboratories for Natural Sciences, University of Stockholm, Sweden

(Received 22 AuguslJ13 October 1994) - EJB 94 1265/6

The plasma membrane high-affinity phosphate permease of Saccharomyces cerevisiae has been over- produced as a stable membrane-bound chimeric protein in Escherichia coli. Construction of a chimera between the permease and a peptide containing 10 consecutive histidine residues allowed selective bind- ing of the chimera to a chelating column charged with Ni”, and elution with imidazole in a high state of purity. Approximately 5 mg purified His,,-permease was obtained from 3 g (wet mass) cells. The purified phosphate permease chimera catalyzes uncoupler-sensitive phosphate transport after reconstitu- tion into proteoliposomes.

Keywords. PH084 ; phosphate-H’ symport ; affinity chromatography.

Intracellular levels of inorganic phosphate in the yeast Saccharomyces cerevisioe are regulated by the PHO system, i.e. a network of scattered genes involving structural and regulatory units (Tamai et al., 1985; Youshida et al., 1987). This complex is composed of at least five gene products through which signals on the presence or absence of a repressible amount of phosphate are conveyed, and operates through two major modes by which phosphate uptake across the plasma membrane is mediated. Phosphate uptake is accomplished by means of specific integral plasma membrane proteins, and two such systems with optima for phosphate uptake around pH 4.5 have been characterized (see Borst-Pauwels, 1981 for a review; Nieuwenhuis and Borst- Pauwels, 1984). The so-called low-affinity system, with an approximate K, for phosphate of 1 mM, is a constitutively ex- pressed P,/H+ cotransporter. The derepressible high-affinity transporter (K, 1-15 pM), responsible for uptake of orthophos- phate, the product of the PH084 gene (Bun-ya et al., 1991), is a 65-kDa hydrophobic plasma membrane protein that catalyzes the coupled transport of 2-3 protons with one monovalent anion of phosphate ( k , cotransport or symport; Cockburn et al., 1975; Roomans and Borst-Pauwels, 1979; Borst-Pauwels, 1993). The mechanism of the high-affinity proton-linked trans- port system has been proposed to be compatible with a model which is ordered, protons being transported before phosphate (Cerbon and Calderon, 1990). Previous studies of the high-affin- ity system in intact cells of S. cerevisiae have revealed that the kinetical parameters K,,, and V,,,t,x are dependent on the prevailing cellular ion concentration and pH, and that the transport kinetics of the high-affinity system can be accounted for by a transport system mediated by a mobile carrier (Borst-Pauwels and Peters, 1977). Acc0rdin.g to the mobile-carrier model, phosphate trans-

Correspondence to B. L. Persson, Department of Biochemistry, Arrhenius Laboratories for Natural Sciences, University of Stockholm, S-10691 Stockholm, Sweden

Fax: +46 8 153679. Abbreviarions. CCCP, carbonylcyanide m-chlorophenylhydrazone;

Cm‘, chloramphenicol resistant, HRP, horseradish peroxidase; IPTG, iso- propyl 1 -thio-b,D-galactopyranoside ; dp, proton motive force; RSO, right-side-out.

port across the plasma membrane is energized by the proton motive force (dp; Borst-Pauwels, 1981). Modulation of the transport activities of the phosphate permease(s) in S. cerevisiae have, moreover, been proposed to involve a 310-amino-acid-res- idue protein encoded by the GTRl gene, although its mode of interaction with the PHO84 transporter is so far unknown (Bun- ya et al., 1992). PH084 was recently cloned and sequenced, leading to the elucidation of the sequence of the 596-amino-acid residues in the PH084 permease (Bun-ya et al., 1991). Hydropa- thy prediction of the permease (Bun-ya et al., 1991) suggests that approximately 40% of the protein is confined to the lipid bilayer and that it is composed of 12 putative transmembrane segments that traverse the membrane in a zigzag fashion, con- nected by more hydrophilic domains and extended hydrophilic N-termini and C-termini (Fig. 1). With the exception of the above, no information is yet available on the topology of the protein within the membrane.

In this communication, we show, to our knowledge for the first time, that the high-affinity phosphate permease of S. cere- visiae can be stably expressed in E. coli, purified and reconsti- tuted in a functional state into proteoliposomes. Recombinant DNA technology allowed for the N-terminal fusion of the PH084 gene, encoding the phosphate permease, to a gene frag- ment encoding a stretch of 10 consecutive histidine residues. The PH084 fusion protein can be overproduced in vivo in E. coli and inserted into the cytoplasmic membrane in a stable state. The fusion protein can be readily purified in native form by a single step on a chelating column charged with Ni”, fol- lowed by elution with imidazole. In contrast to immune-affinity and ligand-affinity chromatography, this method is independent of the protein tertiary structure. It only requires that the histidine residues are accessible from the protein surface (Hochuli et al., 1987). When reconstituted into proteoliposomes, the purified permease catalyzes phosphate accumulation. Studies on the mechanism of phosphate transport across the plasma membrane of S. cerevisiae have so far been limited to intact cells, since no procedure for purifying and reconstituting the phosphate perme- ase(s> into proteoliposomes has been available. Studies in such a reconstituted model system have the important advantage over

Berhe et al. (Em J. Biochem. 227) 567

Fig. 1. Secondary structure model of S. cerevisiae PH084 phosphate permease. The model is based on hydropathy analysis of the deduced amino acid sequence (Bun-ya et al., 1991). The one-letter amino acid code is used and putative transmembrane segments are shown as cylinders.

intact cell studies in that phosphate transport is not influenced by its subsequent metabolism. Moreover, in the proteoliposomal system, the transport parameters can be varied and studied selectively.

EXPERIMENTAL PROCEDURES

Materials. Oligodeoxynucleotide primers were obtained from British Biotechnology Products and used without further purification. Adenosine 5'-[a-thioltriphosphate, 3zP (orthophos- phate, carrier free), anti-rabbit-Ig-donkey-antibody-conjugated horseradish peroxidase and the enhanced chemiluminescence detection kit were purchased from Amersham. The T7 DNA se- quencing kit was obtained from Pharmacia. Restriction endonu- cleases, Magic Mini Prepm kits and T4 DNA ligase were from Promega. The QIAEXTM DNA purification kit was from Qiagen. Factor Xa protease and Tuq DNA polymerase were from Boeh- ringer Mannheim. His-Bindm Resin was from Novagen. Site- directed rabbit polyclonal antisera against a decapeptide corre- sponding to the N-terminal amino acid sequence 1 - 10, and a nonodecapeptide corresponding to the C-terminal amino acid se- quence 578-596 of the PH084 permease (unpublished data) was prepared by Agrisera AB. Chromatographically pure phos- phatidylcholine (egg), phosphatidylethanolamine (egg), lyso- phosphatidylcholine (egg) and phosphatidylserine (bovine spinal cord) were purchased from Lipid Products. All other materials were reagent grade and obtained from commercial sources.

Bacterial strains and plasmids. The E. coli strain BL21(DE3)pLysS, F-ompT r;m; (DE3), obtained from Novagen, harboring the plasmid pLysS, Cm' (Cm: chloramphen- icol resistant) was used as carrier for the PET-16b expression plasmid purchased from Novagen. Plasmid pUC19 was used in amplification of PH084 DNA. The S. cerevisiae strain used was CW04, MATa, ade2, his3, leu2, trpl, uru3, can' (Banroques et al., 1986).

Amplification of the PH084 permease. The polymerase chain reaction was used to amplify the PH084 gene from a preparation of genomic DNA (Lee, 1992) from the S. cerevisiae strain CW04 (Banroques et al., 1986). PCR primers were de- signed to introduce unique NdeI and BumHI restriction sites at the 5' and 3' ends of the gene, respectively. These new sites uniquely flank a DNA fragment containing the permease gene with its ATG start and ATT stop codons. 200 ng genomic DNA was used as template with 50 pmol sense (NdeI oligonucleotide) and antisense (BumHI oligonucleotide) primers for 45 PCR cy- cles utilizing 1 U Taq DNA polymerase in buffer with 0.2 mM dNTP. The thermal cycle was as follows : denature at 94 "C for 1 min, ramp anneal to 37°C for 1.5 min, operation at 37°C for 1 min before raising the temperature to 72°C for 1 min. The PCR product was purified from a 0.8% agarose gel using the QiaexTM DNA purification kit, and the ends were trimmed with NdeI and BumHI. The isolated 1.8-kb fragment was ligated into pUC19 opened with NdeI and BumHI and sequenced to ensure the integrity of the amplified sequence.

568 Berhe et al. (Eur J. Biochern. 227)

Construction of the PH084 permease chimera. A chi- meric permease gene was constructed using plasmid pET16b as the source of DNA encoding a sequence of 10 histidine residues. The PH084 gene, flanked by the NdeI and BamHI sites, was cloned into the expression plasmid digested with the same two restriction endonucleases. In this construct, the 5‘ end of PH084 was fused in-frame with the 3’ end of the plasmid DNA encod- ing the histidine (His,,) sequence. The plasmid contains a factor- Xa ‘restriction’ protease site (Ile-Glu-Gly-Arg) between the N- terminus of the permease and the C-terminus of the histidine- rich sequence of the plasmid. Ligation products were screened by restriction-fragment analysis to verify the constructed chimera.

DNA sequencing. Double-stranded DNA prepared by Magic MiniprepTM (Promega) was sequenced using the dideoxynucleo- tide termination method (Sanger et al., 1977; Sanger and Coul- son, 1978) and synthetic sequencing primers, after alkaline denaturation (Hattori and Sakaki, 1986).

Growth of bacteria. JM109 cultures, grown aerobically at 37 “C in Luria-Bertani medium containing ampicillin (100 pg/ ml), were used for preparation of plasmid DNA. E. coli BL21 (DE3)pLysS transformed with the plasmid encoding the chimeric construct was grown aerobically at 30°C in Terrific Broth (TB; Sambrook et al., 1989) containing ampicillin (100 pg/ml) and chloramphenicol (34 pg/ml). Dense cultures of BL21(DE3)pLysS were diluted 20-fold and allowed to grow to an A,,, of 0.6 before induction with 0.5 mM isopropyl l-thio- P,D-galactopyranoside (IPTG). After further growth for 3 h at 30°C to an A,,, of 1.2, cells were harvested and used for prepa- ration of membranes.

Preparation of membranes. E. coli strain BL21(DE3)- pLysS harboring the PET plasmid containing PH084 was grown and induced as described above and right-side-out (RSO) mem- brane vesicles were prepared as described (Kaback, 1971) and stored in 25 mM ‘Tris/succinate, pH 4.5, at -80°C. S. cerevisiae CW04 cells were grown aerobically in a low-phosphate medium (Kaneko et al., 1982) at 30°C to an A,,, of 1.2. Cells were har- vested by centrifiugation at 3500Xg for 10 min. Plasma-mem- brane-enriched fractions were prepared as described (McCusker et al., 1987) and istored in 25 mM Tris/succinate, pH 4.5.

Preparation of cell extract. IPTG-induced E. coli BL21 (DE3)pLysS cells harboring plasmid pET-16blPH084 were harvested by centrifugation at 1OOOOXg for 15 min and resuspended in ice-cold 20 mM Tris/HCl equilibration buffer, pH 7.9, containing 0.5 M NaCl, 5 mM imidazole and 0.1 % Tri- ton X-100. Cell disruption was accomplished by sonication at 80 % efficiency with a micro-tip-type sonicator (MicosonTM Ultrasonic Cell Disruptor, Heat Systems). The cell lysate was incubated on ice for 30 min with constant stirring, and centri- fuged at 39000Xg for 20min. The supernatant was filtered through a 0.45-pin membrane before it was applied to the affin- ity column.

Purification of the phosphate permease. The Ni” chelate affinity column was prepared according to the procedure recom- mended by the manufacturer (Novagen). After equilibration of the column with 20 mM Tris/HCl equilibration buffer, pH 7.9, containing 0.5 M NaCI, 5 mM imidazole and 0.1 % Triton X-100, the filtered cell extract was applied. 15 ml extract (2.6 mg/ml) was applied at a flow rate of 0.25 ml/min. After several washes with equilibration buffer and wash buffer (20 mM Tris/HCl, pH 7.9, 0.5 M NaCl, 60 mM imidazole and 0.1 % Triton X-loo), retained protein was eluted with 20 mM Tris/HCl, pH 7.9, containing 0.5 M NaC1, 1 M imidazole and 0.1% Triton X-100. Alternatively, the Ni” column was stripped with 20 mM TridHCl, pH 7.9, containing 0.5 M NaCl, 100 mM

EDTA and 0.1 % Triton X-100. 0.5-ml fractions were collected and protein was analyzed by SDSPAGE.

SDSPAGE. Samples were dissolved in sample buffer at room temperature and subjected to SDS/polyacrylamide gel electrophoresis using a 12 % polyacrylamide and bisacrylamide gel system (Laemmli, 1970). Gels were stained with silver nitrate according to Wray et al. (1981). Immunoblotting was car- ried out on poly(viny1idene difluoride) membranes (Immobilon- PVDF, Millipore) according to the Amersham Western Blotting Protocol (Amersham). Immunological detection was accom- plished using purified PH084 anti-(C-terminus) IgG and anti- rabbit-Ig-donkey-antibody-conjugated HRP. After a short incu- bation with chemiluminescence substrate, the blot was exposed to film for 2 min. The molecular masses of separated proteins were determined by the relative mobilities of the stained marker proteins (Biorad) phosphorylase b (106 m a ) , bovine serum albumin (80 m a ) , ovalbumin (49.5 m a ) , carbonic anhydrase (32.5 kDa), soybean trypsin inhibitor (27.5 kDa) and lysozyme (18.5 kDa).

Preparation of proteoliposomes. The PH084 fusion protein was purified from E. coli BL21(DE3)pLysS membranes and reconstituted essentially according to the method of Eytan et al. (1987) with a phospholipid mixture composed of 42.5% phos- phatidylcholine, 42.5 % phosphatidylethanolamine, 10% lyso- phosphatidylcholine and 5 % phosphatidylserine (all mass/vol.). The appropriate amounts of phospholipids were dried under ni- trogen, redissolved in diethyl ether, dried, and suspended to a final concentration of 20 mg/ml in reconstitution buffer com- posed of 25 mM Tris/succinate, pH 7.5, 50 mM potassium chlo- ride, 10% methanol, 1 mM EDTA and 1 mM dithiothreitol. Li- posomes were prepared by sonication of the phospholipid sus- pension to clarity with a micro-tip-type sonicator (MicosonTM Ultrasonic Cell Disruptor, Heat Systems). A suspension of 0.5 ml sonicated liposomes was mixed with 0.2 ml column-puri- fied phosphate permease in elution buffer composed of 1 M imidazole, 0.5 M NaC1, 0.1 % Triton X-100 and 20 mM Tris/ HCl, pH 7.9, and incubated at 0°C for 30 min. The final concen- trations of permease and phospholipids were 0.14 mg/ml and 14 mg/ml, respectively. Reconstitution of tight proteoliposomes occurred upon a 50-fold detergent dilution in reconstitution buffer. After detergent dilution, the suspension was stirred, and proteoliposomes were collected by centrifugation at 143 OOOXg for 4 h, and resuspended in 25 mM Tris/succinate to a final pro- tein concentration of 0.32 mg/ml (the lipid concentration was 32 mg/ml).

Phosphate transport assay. An aliquot (1 pl) of proteolipo- somes was diluted 200-fold in 25 mM Tris/succinate, pH 4.5, containing 0.11 mM [32P]orthophosphate (0.1 8 Ci/pmol; 1 mCi = 37 MBq) to generate a ApH (interior alkaline). The suspension was immediately blended in a vortex mixer and incu- bated at 25°C. Transport assays were terminated at given times by quenching of the reactions with 1 ml ice-cold Trislsuccinate dilution buffer. The sample was filtered immediately, and the filter (type Supor-200, 0.2 Fm, Gelman Sciences, Inc.) was washed once with the same cold solution. Radioactivity retained on the filters was determined by liquid scintillation spectrom- etry.

Protein determination. Protein was assayed by a modified Lowry procedure (Peterson, 1977). Bovine serum albumin was used as standard.

RESULTS AND DISCUSSION

Construction and verification of the fusion protein gene. The PH084 phosphate-permease gene was amplified by PCR

Berhe et al. (Euc J. Biochern. 227) 569

NdeI pET-l6b---ATGGGC(CAT)IOAGCAGCGGCCATATCGAAGGTCGTCATATG

M G (H)lo S S G H I E G R F

BainHI GGATCCGGC ---pET-lGb

M TERM

Fig. 2. Construction of the His,,-PH084 permease fusion. Partial nucleotide and corresponding amino acid sequences of the PET-16b plasmid and PH084 are shown. (CAT),, represent the repetitive codon corresponding to the consecutive sequence of 10 histidine residues (H),o. The factor- Xa protease site (IEGR) is shown in italics. Underlined nucleotide sequences and vertical lines represents the endonuclease recognition and restriction sites, respectively, used for the in-frame integration of PH084 into the PET-16b plasmid.

from a preparation of genomic DNA from S. cerevisiae with concommitant introduction of unique restriction sites at the 5’ (NdeI) and 3’ (BamHI) termini of the PH084 gene. A chimeric construct was created in the expression plasmid pET-l6b, where the 5’ end of the PH084 gene was fused in-frame with the 3’ end of the PET-16b expression plasmid DNA encoding a consecutive sequence of 10 histidine residues as outlined in Fig. 2. The plas- mid contains a factor-Xa protease site in the fusion junction that allows removal of the expressed poly(histidine) domain by treat- ment with the protease if desired. The integrity of the amplified gene and the chimeric construct was verified by sequencing of double-stranded DNA and restriction fragment analyses.

Expression of the PH084 fusion protein in E. coli. E. coli BL21 (DE3)pLysS cells containing plasmid pLysS, were trans- formed with the plasmid harboring the chimeric PH084 gene illustrated in Fig. 2. The presence of pLysS increases the toler- ance of the BL21(DE3) strain for plasmids with toxic inserts (Moffatt and Studier, 1987; Studier, 1991). Moreover, the pres- ence of LysS has the further advantage of facilitating the prepa- ration of cell extracts (Inouye et al., 1973). Simply freezing and thawing, or adding 0.1% Triton X-100, will allow the resident T7 lysozyme to efficiently lyse the cells. The BL21(DE3)pLysS cells, harboring the expression plasmid containing the PH084 chimera, were grown in a medium containing chloramphenicol and ampicillin to select for the presence of the pLysS plasmid and the expression plasmid, respectively. After induction with IPTG and additional growth, cells were harvested and detergent extracted for protein purification, or RSO membrane vesicles were prepared.

Expression and membrane insertion of the construct was evaluated by Western-blot analysis of RSO membrane vesicles using anti-(C-terminus) Ig and HRP-conjugated secondary anti- body (anti-rabbit Ig donkey antibody). The specificity of the im- munoreactivity of the antibody was verified by Westem-blot analysis of the endogeneously expressed PH084 protein in iso- lated plasma membranes from S. cerevisiae (Fig. 3). The His,,- PH084 fusion protein exhibits a molecular mass of 76 kDa, whereas the endogeneously expressed PH084 protein exhibits an apparent molecular mass of 67 kDa. In addition, while both proteins react with anti-(C-terminus) IgG, the endogeneously expressed permease also reacts with PH084 anti-(N-terminus) IgG, whereas the His,,-PHO84 fusion protein does not (data not shown). Thus, the N-terminus of the permease is apparently in- accessible in the N-terminal fusion protein.

The advantage of fusion of a small peptide such as the poly- (histidine) domain to the protein should decrease the problems arising with larger protein segments, e.g. P-galactosidase com- monly used to produce fusions. The observation that the pres- ence of the poly-(histidine) domain of the permease does not

Fig. 3. Immunodetection of the PH084 permease by purified PH084 anti-(C-terminus) IgG. Lane 1, isolated plasma membranes of the S. cerevisiae strain CW04 containing the endogenously expressed PH084 protein; lane 2, RSO membrane vesicles of BL21 (DE3)pLysS harboring pET16b containing the His,,-PH084 fusion protein. Samples containing approximately 100 pg membrane proteins were subjected to SDSRAGE and electoblotting onto Immobilon poly(viny1idene difluoride) mem- branes, followed by treatment with PH084 anti-(C-terminus) IgG and anti-rabbit-Ig-donkey-antibody-conjugated HRP. The molecular masses of the standard proteins are indicated on the left.

perturb insertion into the E. coli membrane is consistent with this aspect.

Solubilization and purification of the PH084 fusion protein. The His,,-PH084 permease was purified on a His-BindTM col- umn prepared by saturating the chelating groups with Ni”. Cells were extracted by 0.1 % Triton X-100. The extract was then ap- plied to a 1.0-cmX2.0-cm NiZ’ affinity column, and unbound protein was eluted by extensive washing with equilibration buffer and wash buffer (Fig. 4A). When the A,,, of the eluate returned to baseline levels, bound material was eluted with 1 M imidazole. As shown by silver staining (Fig. 4B), the 280-nm absorbing material eluted with 1 M imidazole, exhibited a highly purified major band at approximately 76 kDa. Importantly, an identical banding pattern was obtained when fractions eluted with 1 M imidazole were reconstituted into proteoliposomes and probed with anti-(PH084 C-terminus) IgG (Fig. 4 B), thereby demonstrating that the purified reconstituted protein is indeed His,,-PH084 permease. Furthermore, RSO membrane vesicles harboring the expressed His,,-PH084 permease exhibit a single immunoreactive band at equivalent molecular mass (Fig. 3). Thus, the material obtained in fraction 111, eluted with imidazole, represents highly purified (> 90 %) His,,-PH084 permease. Starting from approximately 3 g cells (wet mass), the yield of

570 Berhe et al. ( E m J. Biochem. 227)

A

0 10 20 30 40 50 60 70 80 90

Column Fraction

B

Fig.4. Ni2+-affinity chromatography of His,,-PH084 fusion protein. (A) Elution profile from the Ni" column. An aliquot (15 ml) of Triton X- 100 extract from the BL21(DE3)pLysS membranes containing the His,,-PH084 fusion protein (2.7 mg/ml) was applied to a 1.0-cmX2.0-cm His- BindTM affinity column. The column was developed as described in Experimental Procedures and 0.5-ml fractions were collected. Peak I is the unbound fraction, peak I1 the fraction eluted with 60 mM imidazole and peak I11 the fraction eluted with 1 M imidazole. (B) SDSPAGE analysis of various fractions obtained during purification. Lane 1 , peak of unbound fraction I (60 pg); lane 2, peak of unspecifically bound fraction I1 (40 pg); lanes 3 and 4, peak of fraction 111 eluted with 1 M imidazole (20 pg and 50 pg, respectively); lane 5, proteoliposomes reconstituted with purified protein of fraction 111 (20 pg). Lanes 1-4 were stained with silver and lane 5 was iinmunoblotted and probed with PH084 anti-(C-terminus) IgG and anti-rabbit-Kg-donkey-antibody-conjugated HW. The niolecular-mass markers are shown on the left.

Table 1. Purification of PH084 high-affinity phosphate permease. 3 g E. coli cells, re'covered from 300 ml TB broth, were extracted as described in Experimental Procedures. The Triton X-100 extract was clarified by filtration through a 0.45-pm filter and purified on the NiZ+ chelating column (FLg. 4).

Sample Volume Protein Yield

ml mg %

Cell lysate 10 14 100 Triton X-100 extraci 15 40 53 Eluted His,,-permease (111) 10 5 7

purified protein was approximately 5 mg. This represent a 7 % yield with respect to the cell lysate preparation. The complete purification is shown in Table 1. Attempts to increase the amount of expressed permease by growing the cells for longer times, i.e. up to 12 h, did not result in an increased amount of

pure permease (not shown). Higher yields of purified permease could, however, be obtained simply by increasing the amount of processed cells in the present procedure (not shown). Further- more, the ease of preparation and the high purity of the eluted permease make the procedure highly attractive.

Reconstitution of the PHOS4 fusion protein. Fractions eluted with 1 M imidazole were pooled and reconstituted with phos- pholipids essentially according to a previously published pro- cedure (Eytan et al., 1987) to prepare well-sealed proteolipo- somes. When proteoliposomes prepared at pH 7.5 were diluted in 25 mM Tridsuccinate, pH 4.5, so that a d p (interior alkaline) is created, phosphate is taken up rapidly at an initial rate of approximately 1.3 pmol . min-' . mg protein-'. In the presence of dp, the accumulation of phosphate reaches a maximum level of 1.1 pinollmg protein after 10 min. Although the initial rate of phosphate accumulation is affected to a minor extent, the maxi- mum level of phosphate accumulation is decreased to approxi- mately 0.3 pmol/mg protein in the presence of the protonophore

Berhe et al. ( E m J. Biochem. 227) 57 1

Time (mid

Fig. 5. Phosphate uptake in proteoliposomes reconstituted with puri- fied PH084 permease fusion protein. PH084 permease chimera ex- pressed in E. coli BL21 (DE3)pLysS was solubilized, purified, reconstitu- ted into proteoliposomes and assayed for phosphate uptake as described in Experimental Procedures. The suspension contained 0.32 mg protein/ ml and 32 mg phospholipidml. Aliquots (1 )*I) of proteoliposomes were diluted 200-fold into 25 mM Trislsuccinate, pH 4.5, containing 0.11 mM [32P]orthophosphate (0.18 Cilpmol) in the absence (H) or presence (0) of 20pM CCCP. At given times, reactions were terminated, and the samples were assayed by rapid filtration and liquid scintillation spec- trometry.

carbonyl cyanide m-chlorophenylhydrazone (CCCP), consistent with a rapid dissipation of d p (Fig. 5). Initial rates of dp-driven uptake were determined from time points taken during the first 20 s of uptake of P, at 0.11 - 1 mM. Kinetic analysis using Li- neweaver-Burk plots revealed the presence of a P, transport sys- tem with an apparent K , of 24 pM and a V,,, of 1.4 pmol . min-' . mg protein-' (data not shown). This K,,, is close to that reported for the high-affinity phosphate-transport system in in- tact cells of s. cerevisiae. That essentially no phosphate accumu- lation is observed when liposomes prepared in the absence of protein are diluted in 25 mh4 Tris/succinate, pH 4.5, is consistent with the notion that the prepared liposomes are well sealed, and that phosphate accumulation is protein mediated (not shown). Removal of the His-Tag from the fusion protein is optional. In fact, its presence in the hydrophilic N-terminus domain of the reconstituted phosphate permease does not lead to inactivation of the protein. The results presented in this communication pro- vide clear demonstration that modification of the N-terminal tail of the PH084 permease does not affect insertion of the protein into the membrane, or its ability to catalyze P, uptake when re- constituted into proteoliposomes. The important conclusion that the purified protein is reconstitutively active provides the basis for detailed analyses of static and dynamic aspects of the perme- ase structure/function relationships.

In conclusion, the results presented here provide strong evidence that the PH084 gene encoding the S. cerevisiae high- affinity phosphate permease can be expressed in E. coli, and demonstrate that a recombinant DNA approach, involving fusion of a histidine-containing peptide sequence to the PH084 gene product, and Ni2+ chromatography, can be used for immobiliza- tion and purification of the high-affinity phosphate permease.

This research was financially supported by the Swedish Natural Science Research Council (NFR), and the foundations Magnus Berg- vallS Stijtelse and Lars Hiertas Minne.

REFERENCES Banroques, J., Delahodde, A. & Jacq, C. (1986) A mitochondria1 RNA

maturase gene transferred to the yeast nucleus can control mito- chondrial mRNA splicing, Cell 46, 837-844.

Borst-Pauwels, G. W. F. H. & Peters, P. H. J. (1977) Effect of the me- dium pH & the cell pH upon the kinetical parameters of phosphate uptake by yeast, Biochim. Biophys. Acta 466, 488-495.

Borst-Pauwels, G. W. F. H. (1981) Ion transport in yeast, Biochim. Bio- phys. Acta 650, 88-127.

Borst-Pauwels, G. W. F. H. (1993) Kinetical parameters of monovalent cation uptake in yeast calculated on accounting for the mutual in- teraction of cation uptake and membrane potential, Biochim. Bio- phys. Acta 1152, 201-206.

Bun-ya, M., Nishimura, M., Harashima, S . & Oshima, Y. (1991) The PH084 gene of Saccharomyces cerevisiae encodes an inorganic phosphate transporter, Mol. Cell. Biol. 11, 3229-3238.

Bun-ya, M., Harashima, S. & Oshima, Y. (1992) Putative GTP-binding protein, Ge l , associated with the function of the Pho84 inorganic phosphate transporter in Saccharomyces cerevisiae, Mol. Cell. Biol.

Cerbon, J. & Calderon, V. (1990) Proton-linked transport systems as sensors of changes in the membrane surface potential, Biochim. Bio- phys. Acta 1028, 261 -267.

Cockbum, M., Eamshaw, P. & Eddy, A. A. (1975) The stoicheiometry of the absorption of protons with phosphate and L-glutamate by yeasts of the genus Sarcharomyces, Biochem. J. 146, 705-712.

Eytan, G., Persson, B., Ekebacke, A. & Rydstrom, J. (1987) Energy- linked nicotinamide nucleotide transhydrogenase. Characterization of reconstituted ATP-driven transhydrogenase from beef heart mito- chondria, J. Bid. Chem. 262, 5008-5014.

Hattori, M. & Sakaki, Y. (1986) Dideoxy sequencing method using dena- tured plasmid templates, Anal. Biochem. 152, 232-238.

Hochuli, F., Dobeli, H. & Schacher, A. (1987) New metal chelate adsor- bent selective for proteins and peptides containing neighbouring his- tidine residues, J. Chromatog. 411, 177-184.

Inouye, M., Amheim, N. & Sternglanz, R. (1973) Bacteriophage T7 ly- sozyme is an N-acetylmuramyl L-alanine amidase, J. Biol. Chem. 248, 7247-7252.

Kaback, H. R. (1971) Bacterial membranes, Methods Enzymol. 22, 99- 120.

Kaneko, Y., Toh-e, A. & Oshima, Y. (1982) Identification of the genetic locus for the structural gene and a new regulatory gene for the syn- thesis of repressible alkaline phosphatase in Saccharomyces cerevi- siae, Mol. Cell. Biol. 2, 127-137.

Laemmli, U. K. (1970) Cleavage of the structural proteins during the assembly of the head of Bacteriophage T4, Nature 227, 680- 685.

Lee, E-J. S . (1992) Modified protocol for yeast DNA mini-preparation, Biotechniques 12, 677.

McCusker, J . H., Perlin, D. S. & Haber, J. E. (1987) Pleiotropic plasma membrane ATPase mutations of Saccharomyces cerevisiae, Mol. Cell. Biol. 7, 4082-4088.

Moffatt, B. A. & Studier, F. W. (1987) T7 lysozyme inhibits transcription by T7 RNA polymerase, Cell 49, 221 -227.

Nieuwenhuis, B. J. W. M. & Borst-Pauwels, G. W. F. H. (1984) Dere- pression of the high-affinity phosphate uptake in the yeast Saccharo- myces cerevisiae, Biochim. Biophys. Acta 770, 40-46.

Peterson, G. L. (1977) A simplification of the protein assay method of Lowry et al. which is more generally applicable, Anal. Biochem. 83,

Roomans, G. M. & Borst-Pauwels, G. W. F. H. (1979) Interactions of cations with phosphate uptake by Saccharomyces cerevisiae. Effect of surface potential, Biochem. J . 178, 521-527.

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular cloning: a laboratory manual, 2nd edn, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

12, 2958-2966.

346-356.

572 Berhe et al. ( E m J. Biochem. 227)

Sanger, F., NicMen, S . & Coulson, A. R. (1977) DNA sequencing with Wray, W., Boulikas, T., Wray, V. P. & Hancock, R. (1981) Silver staining chain-terminating inhibitors, Proc. Nut1 Acad. Sci. USA 74, 5463 - of proteins in polyacrylamide gels, Anal. Biochem. 118, 197- 5467. 203.

Sanger, F. 8~ Coulson, A. R. (1978) The use of thin acrYlamide gels for Youshida, K., Kuromitsu, Z., Ogawa, N., Ogawa, K. & Oshima, Y. DNA sequencing, FEBS Lett. 87, 107-110. (1987) in Phosphate metabolism and circular regulation in microor-

Studier, F. W. (1991) Use of Bacteriophage T7 lYsozYme to improve an ganisms (Toniani-Gorini, A,, Rothman, F. G., Silver, S., Wright, inducible T7 expression system, J. Mol. Biol. 219, 37-44. A. & Yagil, E., eds) pp. 49-55, American Society for Microbiology,

Tamai, Y., Toh-e, A. & Oshima, Y. (1985) Regulation of inorganic phos- phate transport systems in Saccharomyces cerevisiae, J. Bacteriol. 164, 964-968.