Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is...
Transcript of Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is...
![Page 1: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/1.jpg)
Evidence of Evolution
![Page 2: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/2.jpg)
Biogeography
![Page 3: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/3.jpg)
The Age of Earth and Fossils
Ancient artiodactyl
Modern whale
![Page 4: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/4.jpg)
Ancestors of Whales
Ambulocetus could both
swim in shallow water
and walk on land.
AmbulocetusRodhocetusPakicetus
Ancient
artiodactyl
Rodhocetus
probably spent
most of its time in
water.
![Page 5: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/5.jpg)
Evolution of Whales
Basilosaurus
Dorudon
Mysticetes
Odontocetes
Modern
whales
Basilosaurus
only swims.
Modern whales have
ancient structures
![Page 6: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/6.jpg)
![Page 7: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/7.jpg)
Gaps in the Fossil Record
![Page 8: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/8.jpg)
Homology
►What does the word Homologous mean?
►Homology is the study of similarity between organisms
►There are three major branches of homology: Anatomical Homology
Embryological Homology
Molecular Homology
![Page 9: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/9.jpg)
Homologous Structures
Ancient lobed-finned fish
Frog Alligator Chicken Horse
![Page 10: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/10.jpg)
Vestigial Structures
![Page 11: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/11.jpg)
Evidence of Evolution►Analogous Structures: structures similar in
function, but not inherited from a common
ancestor.
►Same function, different structure
![Page 12: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/12.jpg)
Development
![Page 13: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/13.jpg)
Embryological Homology
► The diagram below shows embryos of five different species: pig, chicken, fish, turtle, and human. Can you tell which is which?
![Page 14: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/14.jpg)
Figured it out yet?
![Page 15: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/15.jpg)
How about now?
![Page 16: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/16.jpg)
Did you guess correctly?
![Page 17: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/17.jpg)
![Page 18: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/18.jpg)
Embryological Homology
► Did you know that when you were inside your mother’s womb, for a while you looked almost exactly like a fish?
► Vertebrate embryos all share a similar pattern of development, suggesting that they may share common ancestry
![Page 19: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/19.jpg)
Human – 31 days
Chicken – 2 ½ days
Pig – 21 days
![Page 20: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/20.jpg)
Genetics and Molecular Biology
![Page 21: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/21.jpg)
Molecular Homology
►All living things contain DNA and RNA.
►Changes in Proteins, DNA and RNA can be traced from ancestors to their descendents.
►The fewer Amino Acid differences between organisms, the closer their inferred evolutionary relationship.
Hemoglobin and Cytochrome C are a group of proteins that are commonly found in manydifferent organisms
![Page 22: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/22.jpg)
Our ancient DNA
GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAG
►Codes for an RNA enzyme that plays a crucial role in protein synthesis
►Present in EVERY cell in the world (and some viruses…)
►Evolved in the common ancestor of ALL life
![Page 23: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/23.jpg)
Our modern DNA…
►There are around 100 mutations in your genome that are NOT present in your mother or father
![Page 24: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/24.jpg)
Testing Natural Selection
Platyspiza strips bark with a beak
designed to grip and hold tightly,
like a pair of pliers.
Certhidea picks insects off surfaces
with a straight, narrow beak, like
needle-nose pliers.
Pinaroloxias probes for insects, fruit,
and nectar with a curved beak, like
needle-nose pliers.
Geospiza breaks large, thick seeds with
a beak that is thick, strong, and sharp,
like heavy-duty wire cutters.
![Page 25: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/25.jpg)
Bird Survival Based on Beak Size
![Page 26: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/26.jpg)
Genes and Variation
![Page 27: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/27.jpg)
Genotype and PhenotypeGenotype: particular combination of alleles
Phenotype: physical, physiological, and behavioral characteristics
![Page 28: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/28.jpg)
Genetics and Evolutionary Theory
Natural selection acts on an organism’s characteristics, not on
its alleles.
![Page 29: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/29.jpg)
Allele Frequency
Number of times an allele occurs in a gene pool, as a percentage
of the total occurrence of all alleles
In 50 alleles:
20 alleles are B (black)
30 alleles are b (brown)
In 100 alleles:
are B (black)
are b (brown)
40
60
![Page 30: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/30.jpg)
Alleles in a PopulationEvolution involves any change in the frequency of alleles in a
population over time. In a population of 25 mice, how many mice
are in each genotype?
4
12
9
![Page 31: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/31.jpg)
Genetic Variation
Three evolutionary mechanisms
that generate genetic variation:
• mutation
• genetic recombination
• lateral gene transfer
Possible chromosome
combinations is 2n.
In humans, n = 23.
223 = 8,388,608
![Page 32: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/32.jpg)
Single-Gene Traits
Traits controlled by only one gene
With bands
Without bands
![Page 33: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/33.jpg)
Single-Gene Traits
Phenotypic ratios are determined by the frequency of alleles and
by whether the alleles are dominant or recessive.
23%
77%
![Page 34: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/34.jpg)
Polygenic Traits
Traits controlled by two or more genes
![Page 35: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/35.jpg)
Polygenic Traits
Height in humans is an example of a polygenic trait.
![Page 36: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/36.jpg)
Evolution as Genetic Change
in Populations
![Page 37: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/37.jpg)
How Natural Selection Works
An
is any genetically controlled trait
that increases an individual’s
fitness.
evolutionary adaptation
![Page 38: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/38.jpg)
Natural Selection on Single-Gene Traits
Natural selection on single-gene traits can produce changes in allele
frequencies that may be reflected by simple changes in phenotype
frequencies.
![Page 39: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/39.jpg)
Natural Selection on Polygenic Traits
Natural selection on polygenic traits can produce three types of
selection:
• directional selection
• stabilizing selection
• disruptive selection
![Page 40: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/40.jpg)
Directional Selection
Individuals at one end of the curve have higher fitness than
individuals in the middle or at the other end.
![Page 41: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/41.jpg)
Stabilizing Selection
Individuals near the center of the curve have higher fitness than
individuals at either end.
![Page 42: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/42.jpg)
Disruptive Selection
Phenotypes at the upper and lower ends of the curve have higher
fitness than individuals near the middle.
![Page 43: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/43.jpg)
Genetic Drift
Genetic drift is a random change in allele frequency.
• Genetic bottlenecks
• The founder effect
Founding
populationsDescendants
![Page 44: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/44.jpg)
Evolution Versus Genetic Equilibrium
If a population is not evolving, the
population is in genetic equilibrium.
• Sexual reproduction
• Hardy–Weinberg principle
![Page 45: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/45.jpg)
If p = 0.40 and q = 0.60:
Probability of genotype aa:
If p = 0.40 and q = 0.60:
Probability of genotype Aa:
If p = 0.40 and q = 0.60:
Probability of genotype AA:
Hardy–Weinberg Principle
and
In words, this is stated:
(frequency of AA) + (frequency of Aa) + (frequency of aa) = 100%
and
(frequency of A) + (frequency of a) = 100%
16%36%48%
![Page 46: Evidence of Evolution...Evolution as Genetic Change in Populations How Natural Selection Works An is any genetically controlled trait that increases an individual’s fitness. evolutionary](https://reader035.fdocuments.in/reader035/viewer/2022071509/612a027c22625b5ff82bcac2/html5/thumbnails/46.jpg)
Hardy–Weinberg Principle
To maintain genetic equilibrium there must be:
• Random mating
• Large population size
• No immigration or emigration
• No mutations
• No natural selection
The H-W Principle predicts that:
If any of these conditions occur
it can disturb genetic equilibrium,
causing evolution.