Everything you wanted to know about DNA but were afraid to ask.

DNA

• A molecule that is present in all living cells and contains the information that determines the traits that a living thing inherits and needs to survive.

DNA

• Gives you your characterisitcs• Traits like eye color, height, & hair

texture.

+DNA’s Two jobs

Instruction manual that builds and maintains cells

Able to copy itself each time a cell divides

DNADOUBLE HELIX-Twisted ladder or spiral staircase

Sides of ladder are made of molecules of sugar called deoxyribose alternating with molecules of phosphate

The rungs of the ladder are made of nitrogen bases:

Adenine A

Thymine T

Guanine G

Cytosine C

A little History

Rosalind Franklin• She made the first image of an actual DNA

molecule using x-ray diffraction• Through this breakthrough we learned that

DNA has a spiral shape

Watson & Crick

• 1953’s they built the first model of DNA

• Won the Nobel Prize

Erwin Chargaff• 1950’s Chargaff found equal amounts

between certain base pairs• Adenine=Thymine• Cytosine=Guanine • Called Chargaff’s Rules

+Making copies of DNA

This occurs in interphase

Adenine always

pairs w/ Thymine

A~~~~~~~~ T

Cytosine always

pairs w/ Guanine

C~~~~~~~~G

+How copies are made

1. DNA unwinds and separates (like a zipper)

2. Bases on the open strand are used as a pattern for the new strand

3. Nitrogen bases that are floating in the nucleus pair up with the bases on each half of the unzipped DNA

4. Half of DNA is old & half is new

+ How DNA works

About 2 meters of DNA in every cell of your body

It is wound, coiled and bundled to fit inside every cell

Order of the bases on one side is a CODE that carries information

Gene- is a piece of that code that gives the cell information on the trait it controls

+Reading the Code

ATTGGCCTTGATCCCCCATAGCGATGTGTACACTC

The code is read like a book from one end to another

They are split up by 3’s

AGC is a code for a protein called “serine”

+When things go wrong!

+ Mutations: the causes

DNA damage from environmental agents such as ultraviolet light (sunshine), nuclear radiation or certain chemicals

Mistakes that occur when a cell copies its DNA in preparation for cell division.

Changes in the number, type, or order of bases on DNA

Types of MutationsDeletion- When a base is left out

Insertion- When a base is added

Substitution - Occurs when the wrong base is used

+What can happen?

Improved trait

No change

Harmful trait such as sickle cell disease

Clones

• A new organism with an exact copy of DNA from another organism

• This is CopyCat: the first cat cloneResearchers in Texas have cloned a domestic cat, producing a two-month-old kitten called CopyCat.