Evaluation of the cellular and molecular effects of HCV ...

Evaluation of the cellular and molecular effects of HCV non-

structural proteins on mitochondrial mediated apoptotic

pathway

By

Farakh Javed

2009-NUST-DirPhD-V&I-43

Atta-ur-Rahman School of Applied Biosciences

National University of Sciences & Technology

Islamabad-Pakistan

2016

Evaluation of the cellular and molecular effects of HCV non-structural

proteins on mitochondrial mediated apoptotic pathway

By

Farakh Javed

2009-NUST-DirPhD-V&I-43

A dissertation submitted in the partial fulfillment of the requirement for the

degree of

Doctor of Philosophy

IN

VIROLOGY AND IMMUNOLOGY

Supervisor

Dr. Sobia Manzoor

Atta-ur-Rahman School of Applied Biosciences

National University of Sciences & Technology

Islamabad-Pakistan

2016

Dedicated

To

My PARENTS & my Son

Shahmir sheikh

TABLE OF CONTENTS

TITLE Page No.

Acknowledgements i

List of Abbreviations iii

List of Tables vi

List of Figures vii

Abstract xi

Chapter -1

INTRODUCTION

1.1 Introduction 01

1.2 Aims and objectives of the study 07

Chapter -2

LITERATURE REVIEW

2.1 Anatomy and physiology of Liver 07

2.2 Hepatitis 09

2.3 Viral hepatitis 09

2.3.1 Hepatitis A virus 10

2.3.2 Hepatitis B virus 10

2.3.3 Hepatitis C virus 11

2.3.4 Hepatitis D virus 12

2.4.5 Hepatitis E virus 12

2.4 The discovery of Hepatitis C virus 13

2.5 Epidemiology of HCV 14

2.6 HCV transmission 15

2.7 Treatment of HCV 16

2.8 HCV genomic organization 17

2.9 HCV replication and role of viral proteins 20

2.9.1 Core protein 21

2.9.2 Envelop proteins 23

2.9.3 P7 23

2.9.4. Nonstructural proteins (NS2, NS3, NS4A, NS4B, NS5A, NS5B) 24

2.9.4.1 NS2 24

2.9.4.2 NS3 24

2.9.4.3 NS4A 25

2.9.4.4 NS4B 25

2.9.4.5 NS5A 26

2.9.4.6 NS5B 26

2.10 Apoptosis and HCV 27

2.11 Apoptosis 29

2.12 Apoptosis molecular mechanism 30

2.12.1 Bcl-2 Family 32

2.12.2 Caspases executors of apoptosis 34

Chapter -3

MATERIALS AND METHODS

3.1 Materials 37

3.1.1 Expression vectors and host cells 37

3.1.2 Chemicals and other consumables 37

3.1.3 Enzymes 37

3.1.4 Antibodies 38

3.1.5 Antibiotics 39

3.1.6 Molecular weight markers 39

3.1.7 Reagents 39

3.1.8 Media 39

3.1.9 Buffers 40

3.1.10 Instrumentations 44

3.2 Methodology 44

3.2.1 Primer designing 44

3.2.2 Amplification of NS3, NS3-4A and NS4A genes 44

3.2.3 Amplification of NS3 gene using pFLAG-CMV2 primers 46

3.2.4 Amplification of NS3 gene using pEGFP-C1 primers 47

3.2.5 Amplification of NS3-4A gene using pFLAG-CMV2 primers 48

3.2.6 Amplification of NS3-4A gene using pEGFP-C1 primers 49

3.2.7 Amplification of NS4A gene using pFLAG-CMV2 primers 50

3.2.8 Amplification of NS4A gene using pEGFP-C1 primers 51

3.2.9 Agarose gel electrophoresis 52

3.2.10 Purification of DNA products from agarose gel 52

3.2.11 Construction of pEGFP-C1 recombinant plasmids 53

3.2.12 Construction of pFLAG-CMV2 recombinant plasmids 53

3.2.13 Selection of positive clones 54

3.2.14 Large scale preparation of plasmid DNA 54

3.2.15 Cell culture and transfection 55

3.2.16 Preparation of whole cell lysate for SDS page 55

3.2.17 SDS-poly acrylamidegel electrophoresis 56

3.2.18 Western Blotting 57

3.2.19 Immunofluorescence Microscopy 58

3.2.20 Crystal violet cell viability assay 59

3.2.21 Subcellular Fractionation 59

3.2.22 Mitochondrial Superoxide Estimation 60

3.2.23 Measurement of Mitochondrial Complex I Enzyme Activity 60

3.2.24 Hoechst Staining 61

3.2.25 Statistical analysis 61

Chapter -4

RESULTS

4.1 Amplification and construction of recombinant vectors 62

4.2 Sequencing of GFP-tagged recombinantvectors 66

4.3 Sequencing of FLAG-tagged recombinantvectors 70

4.4 Western blot analysis of FLAG-tagged HCV NS3, NS3-4A

and NS4A proteins 74

4.5 Western blot analysis of GFP-tagged HCV NS3, NS3-4A

and NS4A proteins 76

4.6 Immunofluorescence analysis of GFP tagged recombinant

vectors 78

4.7 Immunofluorescence analysis of FLAG tagged recombinant

vectors 81

4.8 NS3-4A and NS4A proteins induces cell death 84

4.9 Intracellular localizations of NS3, NS3-4A and NS4A proteins. 88

4.10 NS3-4A and NS4A proteins induces mitochondrial

fragmentation/fission 91

4.11 BAX translocation and Bcl-XL regulation in NS3-4A and NS4A

expressing cells 94

4.12 NS4A and NS3-4A increased mitochondrial superoxide

generation in Huh-7 cells 98

4.13 Cytochrome c translocation in NS4A and NS3-4A

expressing cells 101

4.14 Effects of NS4A and NS3-4A proteins on the mitochondrial

oxidative Phosphorylation system 103

4.15 Activation of caspase-3, 7, 9 and cleavage of poly

(ADP-ribose) Polymerase (PARP) in NS4A and NS3-4A expressing

cells 107

4.16 Chromatin condensation in NS4A and NS3-4A expressing

cells 113

Chapter -5 116

Discussion

Chapter -6

References 123

i

Acknowledgements

All the acclamation is for all Almighty “Allah”, Who bestowed the mankind

with knowledge and wisdom. All the respect and honor for Holy Prophet

Muhammad (PBUH) for enlighting with the essence of faith in Allah and guiding

the mankind, the true path for life.

I feel pleasure to place on record my deep sense of thankfulness and

indebtedness to my honorable supervisor Dr. Sobia Manzoor, Assistant professor,

ASAB-NUST, for her kind supervision, dexterous, incentive teaching, scholarly and

sympathetic attitude and help throughout this research and in preparation of this

dissertation.

I am honored to express my deep sense of gratitude and indebtedness to respecter

Prof. Dr. Aleem Siddiqui, University of California, San Diego, USA, who provided

me a golden opportunity to conduct my partial research work in his lab for a period of

seven months. I am really thankful to him for his valuable suggestions that make my

research work more strengthen.

These lines provide me the opportunity to rightly acknowledge, unmatched

sincerity of Dr. Peter John, principal, ASAB-NUST, who encouraged and helped me

to conduct and complete this research work.

I would like to extend my heartiest gratitude to Dr. Ghulam Hussain Syed and

Dr. Mohsin khan, UCSD, USA, for their kind guidance, cooperation and technical

support in my research work. I acknowledge the cooperation, moral encouragement,

inspiration and valuable suggestions of my research project Guidance and

Examination Committee (GEC) members honorable Dr. Aneela Javed, Assistant

professor, ASAB-NUST, Dr. Muhammad Faraz Bhatti, Assistant Professor,

ASAB-NUST and Dr. Ali Raza Awan, Assistant Professor, Department of

Biochemistry, University of veterinary and Animal Sciences, Lahore.

I also would like to thank my class fellows and my lab fellows Sana Gul, Fahed

Parvaiz, Shamim Bhatti, Zia-ur-rehman, Fazal Jalil, Sadia, Yasir Waheed,

Muhammad Imran, Rehan Zafar and Babar Aslam for their cooperation during my

work.

ii

I feel obligatory to express my thanks to my friends and lab Juniors Muqddas

Tariq, Madiha Khalid, Laeeque Ahmed, Huma Tariq, Abbas Raza, Mustafeez Babar,

Naghmana Kanwal, Yasmeen Badshah, Waseem Ashraf, Beenish Bashir,

Khushbakht Hanif, Yusara Naveed, Maheen Bokhari, Sibgha Noor and Tabinda

Hussain. I also acknowledge the cooperation and sympathetic behavior of all Faculty

and Staff members, ASAB-NUST.

I would like to heartiest and profound thanks to my friends in University of

Haripur, Dr. Aamer Ali Khattak, Dr. Sadiq Noor Khan, Dr. Darima Ashfaq, Miss

Afshan Saleem, Miss Javeria Asghar and Miss Naureen Aurangzeb.

I must acknowledge the financial support of Higher Education Commission of

Pakistan (HEC). I am also grateful to UCSD, USA and ASAB-NUST, Pakistan

for providing support and technical resources to conduct this research.

And at last but not the least, I deem it a great honor and privilege to record

profound sense of gratitude and extend my compliments to my affectionate parents,

sisters (Sadia Asad and Nadia Sajjad) and brothers (Sheikh Jibran and

Sheikh Waqas) for their encouragement and inspiration for higher ideas, moral and

their love and affection, amicable attitude and their countless prays for my glorious

success about my pursuits throughout my life. I would do no more than to reaffirm my

eternal devotion to all the members of my family.

I would like to express my whole love to my sweet nephews, niece and son Nafih,

Muneeb, Taha, Aman, Meerab and lovely Shahmir.

“I do appreciate all of those who remembered me in their prayers and encouraged me

throughout my life and education carrier”.

Farakh Javed Shiekh

iii

LIST OF ABBREVIAT`IONS

Ab Antibody

Ag Antigen

APS Ammonium persulfate

BCA Bicinchoninic acid assay

bp Base pair

BSA Bovine serum albumin

CPE Cytopathic effect

C-terminal Carboxy terminal

DMEM Dulbecco’s modified eagle medium

DNA Deoxyribonucleic acid

DTT Dithiothreitol

EDTA Ethylenediamine tetracetic acid

ELISA Enzyme linked immunosorbent assay

EMEM Eagle’s minimum essential medium

ER Endoplasmic reticulum

FBS Fetal bovine serum

GAPDH Glyceraldehyde -3-phosphate dehydrogenase

HBSS Hank’s balanced salt solution

HCC Hepatocellular carcinoma

HCV Hepatitis C virus

HIS Hyper immune sera

HPI Hours post infection

HRP Horse radish peroxidase

iv

IFA Immunofluorescence assay

IFN Interferon

IPTG Isopropyl β-D-thio-galactopyranoside

IRES Internal ribosomal entry site

Kan Kanamycin

kb Kilo base pairs

kDa Kilo dalton

LB Luria bertani broth

mAb Monoclonal antibody

NS3 Non-structural protein 3

NS4A Non-structural protein 4A

N-terminal Amino terminal

OD Optical density

ORF Open reading frame

PAGE Polyacrylamide gel electrophoresis

PARP Poly (ADP-ribose) polymerase

PBS Phosphate buffer saline

PBST Phosphate buffered saline with Tween-20

PCR Polymerase chain reaction

PI Propidium iodide

PMSF Phenylmethyl sulfonyl fluoride

RNA Ribose nucleic acid

ROS Reactive oxygen species

RT-PCR Reverse transcriptase polymerase chain reaction

SD Standard deviation

v

SDS Sodium dodecyl sulphate

SDS-PAGE Sodium dodecyl sulphate-polyacrylamide gel

TBS Tris buffer saline

TBST Tris buffer saline with Tween-20

TEMED N, N, N', N'-Tetramethylethylenediamine

WHO World Health Organization

β-ΜΕ Beta mercaptoethanol

vi

LIST OF TABLES

Table No. Title Page No.

Table 3.1 List of antibiotics 39

Table 3.2 List of primers used in the study 45

Table 3.3 Composition of different SDS-PAGE gels 57

vii

LIST OF FIGURES

Figure No. Title

Page No.

Figure 2.1 Anatomy of liver

08

Figure 2.2 Hepatitis C virus (HCV): model structure. 19

Figure 2.3 Genome organization of hepatitis C virus

19

Figure 2.4 Replication cycle of HCV

22

Figure 2.5 Mitochndrail mediated apoptosis pathway induced by HCV

proteins

28

Figure 2.6 Diagrammatic illustration of the main molecular pathways

leading to apoptosis

33

Figure 4.1 1% agarose gel electrophoresis shows the results of double

digestion of recombinant pEGFP-C1 plasmids.

63

Figure 4.2 1% agarose gel electrophoresis shows the results of double

digestion of recombinant pFLAG-CMV2 plasmids.

64

Figure 4.3 Maps of recombinant pEGFP-C1 and pFLAG-CMV2

constructs

65

Figure 4.4 Representative chromatograms and sequence homology of

NS3 gene

67


NS3-4A gene

68

Figure 4.6 Representative chromatograms and sequence homology of 69

viii

NS4A gene


NS3 gene

71


NS3-4A gene

72


NS4A gene

73

Figure 4.10 Western blot analyses of FLAG tagged NS3, NS3-4A and

NS4A proteins

75

Figure 4.11 Western blot analysis of GFP tagged NS3, NS3-4A and NS4A

proteins

77

Figure 4.12 (A) Immunofluorescence analysis of recombinant pEGFP-C1

plasmids

79

Figure 4.12 (B) Graphical representation of immunofluorescence analysis of

recombinant pEGFP-C1 vectors.

80

Figure 4.13 (A) Immunofluorescence analysis of recombinant pFLAG-CMV2

plasmids

82

Figure 4.13 (B) Graphical representation of immunofluorescence analysis of

recombinant pFLAG-CMV2

83

Figure 4.14 Cell death induced by NS4A and NS3-4A proteins

85

Figure 4.15 Cell death induced by NS4A and NS3-4A proteins

87

Figure 4.16 Intracellular localizations of NS3, NS3-4A and NS4A proteins

89

ix

Figure 4.17 NS3-4A and NS4A induces mitochondrial fragmentation

90

Figure 4.18 (A) NS3-4A and NS4A induces BAX translocation to

mitochondria, up regulation of BAX and down regulation of

Bcl-XL proteins expression

92

Figure 4.18 (B) Graphical representation of NS3-4A and NS4A induces

mitochondrial fragmentation

93

Figure 4.19 (A) NS3-4A and NS4A increased the mitochondrial superoxide

generation

96

Figure 4.19 (B) Western blot analysis of pro-apoptotic protein BAX 97

Figure 4.20 (A) NS3-4A and NS4A increased the mitochondrial superoxide

generation

99

Figure 4.20 (B) Graphical representation of NS3-4A and NS4A increased the

mitochondrial superoxide generation

100

Figure 4.21 Cytochrome c translocation in NS4A and NS3-4A expressing

cells

102

Figure 4.22 (A) Graphical representation of OXPHOS Complex I activity

between whole HCV genome (HCVcc) and Huh-7 cells

(mock)

104

Figure 4.22 (B) Graphical representation of the effect of HCV individual

proteins on the reduction of OXPHOS Complex I activity

105

Figure 4.22 (C) Western blot analysis of HCV proteins used for the assay. β-

actin was used as an internal loading control

106

Figure 4.23 (A) Western blot analysis of caspase-9 in NS3-4A and NS4A

expressing cells

109

x

Figure 4.23 (B) Western blot analysis of caspase-7 in NS3-4A and NS4A

expressing cells

110

Figure 4.23 (C) Western blot analysis of caspase-3 in NS3-4A and NS4A

expressing cells

111

Figure 4.23 (D) Western blot analysis of caspase-3 in NS3-4A and NS4A

expressing cells

112

Figure 4.24 (A) Chromatin condensation in NS4A and NS3-4A expressing

cells

114

Figure 4.24 (B) Graphical representation of chromatin condensation in NS3-4A

and NS4A expressing cells

115

xi

ABSTRACT

Presently about 170 million of the world population are suffering with Hepatitis C

virus (HCV) that is the major cause of liver diseases, which leads to liver fibrosis,

cirrhosis and hepatocellular carcinoma. Approximately 10 % of the Pakistani

population is infected with HCV, while genotype 3a is the most prominent genotype

with the prevalence rate between 75-90 %. Genetic heterogeneity is the only main

reason to compare the apoptotic pathway in different HCV genotypes. Present study

illustrates that HCV non-structural proteins NS3-4A and NS4A of genotype 3a

induces apoptosis by mitochondrial-mediated, caspase-3 dependent pathway as

confirmed by Hoechst staining. Findings of present study reveal that NS3-4A and

NS4A induces cell death in Huh-7 cells. Moreover, our results revealed that NS3-4A

and NS4A was not only localized on endoplasmic reticulum but also on the

mitochondria. Bax a pro-apoptotic protein translocated to the mitochondria in NS3-

4A and NS4A expressing cells, while up-regulated expression of Bax and down-

regulated expression of anti-apoptotic Bcl-xL protein was also observed with

increased level of cytosolic cytochrome c. High level of mitochondrial superoxide

generation, mitochondrial fragmentation and reduction of OXPHOS Complex I

activity was also observed. In addition, protein immunoblot assays were done which

showed that NS3-4A and NS4A triggers a cascade mechanism of activation starting

from caspase-9, then caspase-7 and caspase-3 ends on cleavage of poly (ADP-ribose)

polymerase PARP. Collectively findings of the present study suggest that HCV NS3-

4A and NS4A alone may possibly induce apoptosis through Bax-triggered,

mitochondrial-mediated, caspase-3 dependent pathway.

Introduction

Chapter 1 Introduction

1

INTRODUCTION

Hepatitis C virus (HCV) isolated in 1989, is a blood borne pathogen causing of acute

and chronic liver disease worldwide. HCV infection is the main source of viral

hepatitis, steatosis, cirrhosis and liver cancer (Moradpour, et al., 2007). World Health

Organization (WHO) declared that 3 % of world’s population is suffering from this

deadly virus (Scheel and Rice, 2013). Each year about 3 to 4 million new cases of

HCV are reported. In Pakistan, approximately 10 % of the population is chronically

infected with HCV out of which 85 % is of genotype 3a (Butt, et al., 2011).

Due to significant genetic heterogeneity, the virus can be classified into six genotypes,

but the major ones are genotype 1-3. These genotypes are further divided into more

than 50 subtypes that differ in their nucleotide sequences by 10-30 % while a

nucleotide variation of 30-50 % is found among genotypes (Hoofnagle, 2002). Source

of this variation is HCV genome coded its error prone RNA polymerase with high

mutation rate (Timm and Roggendorf, 2007).

HCV, a member of flaviviridae family belongs to genus hepacivirus and have a

single-stranded RNA genome with 9.6-kb-long size, which encodes a polyprotein of

about 3,010 amino acids (Alter, et al., 1992). HCV genome contains a single large

open-reading frame (ORF) flanked by non-coding regions at 5' and 3' ends (Tang and

Grise, 2009). The polyprotein is post-translationally cleaved by both viral/cellular

proteases to produce about 10 polypeptides that include structural (core, E1, E2, p7)

and six mature nonstructural (NS2, NS3, NS4A, NS4B, NS5A, NS5B) proteins with

diversity in their functions (Ivanov, et al., 2013). C gene encodes the core (capsid)

protein, which form the viral particle, include the core which forms the viral

nucleocapsid protein and E1, E2 encodes envelope glycoproteins E1 & E2. A short


2

membrane peptide p7 separates both Structural and non-structural proteins from each

other and putative roles of p7 include cation channel activity, productive infection,

virion maturation and egress. (Penin, et al., 2004).

HCV non-structural protein NS2 is a small protein that interacts with its

adjacent protein forming NS2/NS3 protease catalyzing site. Three residues

(His143, Glu163 and Cys184) have been explicitly found to be involved in proteolytic

activity (Grakoui et al., 1993).

69 kDa HCV non-structural protein NS3 is a multifunctional protein and is

indispensable for HCV replication. NS3 has protease and helicase activities which are

essential replicative components of HCV (Kolykhalov, et al., 2000; Chevaliez and

Pawlotsky, 2006; Lam and Frick, 2006). NS3 protein’s N-terminal domain is an

integral part of NS2-NS3 proteinase. NS3 protein has a serine protease activity with

assistance of cofactor non-structural protein NS4A permits its stabilization and

localization at the endoplasmic reticulum (ER) membrane (Bartenschlager, Lohmann

et al., 1995). Another important function of NS3-4A serine protease is to cleave its

own NS2-NS3 junction with all other (NS3/ NS4A, NS4A/NS4B, NS4B/NS5A and

NS5A/NS5B) intersections (Brass, et al., 2006; Tang and Grise, 2009). Whereas on

the other hand C-terminal domain of NS3 is a superfamily 2 RNA helicase/ NTPase,

which unwinds RNA-RNA substrates, resolving secondary structures during RNA

replication and also take part in assembly of viral particle (Ma, et al., 2008; Tang and

Grise, 2009).

HCV nonstructural protein NS4A a 7 kDa is a small multifunctional protein with 54

amino acids residues. NS4A act as an essential co-factor for the NS3 protease enzyme

(Tang and Grise 2009; Joyce and Tyrrell 2010). NS4A has three domain i.e.


3

membrane anchorage, hydrophobic N terminal domain directs NS3/4A complex to the

mitochondrial outer membrane and endoplasmic reticulum, hydrophobic central

domain involved in the activation of NS3 that works as a cofactor peptide and its

acidic C terminal domain promotes helicase directed ATP hydrolysis at the time of

RNA replication (Wolk, et al., 2000; Beran, et al., 2009; Zaidi, et al., 2012). HCV

non-structural protein NS4b is a highly hydrophobic protein that strongly interacts

with lipid moieties and thereby favors viral replication (Palomares-Jerez et al.,

2012).

NS5A is a phosphorylated protein with 56 kDa (basal form) and 58 kDa

(hyperphosphorylated form) molecular weight. It is located in the cytoplasm where it

is found to be in association with endoplasmic reticulum via its amphipathic α-helix

and induces viral replication (Brass et al., 2002; Bartenschlager and Lohmann, 2000).

NS5A has a prominent role in HCV induced disease progression primarily

because of interferon resistance. HCV non-structural protein NS5b is an RNA

dependant RNA polymerase (RdRp) that make use of negative stranded RNA as

the template favoring the synthesis of negative stranded RNA (genomic RNA).

NS5b of HCV shares a common crystal structure of RdRp showing right hand with

the palm, thumb and finger domains (Butcher et al., 2001).

As a result of high genetic mutability among all HCV genotypes they differ in their

biology, transmission dynamics, persistence, disease development and sensitivity to

therapeutics (Simmonds, 2005; Feld and Hoofnagle, 2005; Gottwein, et al., 2010).

High prevalence of genotype 3a is reported worldwide, especially in several countries

of South America and Asia including Pakistan. In Pakistan, type 3 is the prominent

genotype with the prevalence rate 75–90 % (Qureshi, et al., 2009).


4

Lack of cheap and efficient in vitro cell culturing facilities, no animal model to study

HCV pathogenesis, molecular pathways and screening of candidate antiviral drugs are

the main limiting factors in the study of HCV(Couto and Kolykhalov, 2006; Butt, et

al., 2011; Tariq, et al., 2012). Although the complete mechanism of HCV associated

pathogenesis is not completely understood yet although a significant digits of reports

proposed a potential role of apoptosis in HCV infections (Deng, et al., 2008; Malhi

and Gores, 2008). The apoptotic process is thought to be crucial in establishing the

persistent viral infections, viral clearance, antiviral immunity and hepatocellular

carcinoma (Jang, et al., 2014).

Apoptosis can be better explained as “ Scheduled cell death having a sequale of

events” coming after one another in a progrmmed and coordinated manner after any

damage or diseased condition of cell. The possible outcomes of cell death as a result

of apoptotis include cell deformate like shrinkage of cell size, condensation of

chromatin, DNA disintegration, apoptotic body development, vacuolization of

cytoplasmic and cell breakdown (Zhao, et al., 2012). Mitochondria are very

important organelles in cell performing many essential functions and play crucial role

during the induction of apoptosis through increasing permeabilization of

mitochondrial membrane during oxidative stress (Ivanov, et al., 2013). This leading

role of mitochondria has been categorize in three phases: Initiation phase; proapototic

messengers accumulation, responsible for membrane permeabilization (MP), second

decision phase; event of mitochondrial membrane permeabilization (MMP) third and

last degradation phase; commencement of caspases and hydrolases activities (Mordon

and Blanchemaison, 2008; Sala, et al., 2008).

Apoptic cell death occurs through intrinsic and extrinsic pathways. Receptor mediated

extrinsic pathway starts with binding of tumor necrosis factor (TNF)-α, Fas ligand


5

and glucocorticoids to their specific receptors and leads to the activation of its

subsequent messengers e.g., Caspase-8 activation (Bantel and Schulze-Osthoff, 2003;

Chou, et al., 2005; Jang, et al., 2014). This pathway can results in two consequences;

cell survival or cell death.

Intrinsic pathway is initiated as a result of ROS production. It is based on the

transition in membrane permeabilization of mitochondria as a result of proapoptotic

signals which in turn cause the release of inter membrane space proteins (such as

cyto-chrome c, apoptosis inducing factor (AIF), Endo G and Smac/DIABLO (Second

mitochondria-derived activator of caspase /direct IAP binding protein with a low pI)

in the cytosol and form apoptosome having ATP and APAF-1 (Fischer, et al., 2007).

Activation of Caspase-9 eventuates following the formation of apoptosome (Galle, et

al., 1994). Caspase-9 promotes the activation of effector Caspase-3, PARP poly

(ADP-ribose) polymerase and downstream apoptotic events (Owen, et al., 1994;

Kumar, 2007).

There are different reports suggesting apoptotic and anti-apoptotic functions of

different HCV proteins, for instance NS3, NS4A, core and E2 are to induce apoptosis

(Prikhod'ko, et al., 2004; Benali-Furet, et al., 2005; Nomura-Takigawa, et al., 2006;

Lee, et al., 2007). Clones of HCV genotype 2a in human hepatocellular carcinoma

cell line have reported to be an efficient replication system for virus and proved HCV

induces apoptosis in the cell culture system (Deng, et al., 2008). In Chronic HCV

infection apoptosis is related to be involved in liver damage. However, extensive

mechanism is still unclear (Valva, et al., 2010). Infection with hepatitis C virus causes

hepatocellular death by tempts mitochondrial mediated death signaling pathways

(Deng, et al., 2008).


6

Many findings provide ample evidence of involvement of various structural and non-

structural proteins in the induction of extrinsic as well as intrinsic apoptosis pathways.

HCV non-structural protein NS4A and NS4B has been studied with reference to the

induction of mitochondrial mediated apoptotic pathway. Among HCV non-structural

proteins, complex of NS3-4A proteins is the most potent proteins that can damage

host cellular machinery for viral and disease propagation, that can favor

oxidative stress, production of reactive oxygen species with demolition of

mitochondria. However, there is no conclusive study so far that describes potential

role of NS3-4A protein in the induction through Bax-triggered, mitochondrial-

mediated, caspase-3 dependent pathway. Therefore, the present study was designed to

investigate, the cellular and molecular effects of HCV non-structural NS3-4A protein

in the induction of mitochondrial death pathway.

1.2 Aims and objectives of the study

Aims and objectives of the current study are:

• Establish a cell culture based system expressing HCV non-structural proteins.

• Evaluate protein expression of different key cellular genes involved in

mitochondrial mediated apoptosis in transiently expressing cell culture based

system (cell line containing HCV non-structural proteins).

• Investigate the HCV induced mitochondrial mediated apoptotic pathway.

Review of

Literature

Chapter 2 Review of literature

7

REVIEW OF LITERATURE

2.1 Anatomy and Physiology of Liver

A vital lobular organ of the human body located in upper right quadrate of

abdominal cavity “Liver” consist of four lobes. Maintenance of homeostasis,

energy metabolism, detoxification of toxic substances, processing, storage and

distribution of dietary products like lipoproteins, purines, ketones bodies and

glucose are the key roles of liver in human body (Malarkey et al., 2005). When

different types of functional cells combined to one structural unit in liver then this

unit is called as Acinus. Hepatocytes (liver cells) make up 70-80 % of liver

volume, cells of bile duct, Kupffer cells, Endothelial cells, Oval cells, Pit cells and

Hepatic stellate cells (HSC) form remaining 20-30 % of liver. Liver parenchymal

cells cover the whole liver and thus have high rate of metabolic activity. Liver

epithelial cells form threads and junctions between them allow the fluids and

nutrients movement between neighboring cells. Endothelial cells form Hepatic

sinusoids which have large endocytic activity. Mediators like Interferon,

Interleukin 1, 6 and nitric oxides secreted by these endothelial sinusoids act as

paracrine secretions (Kmiec, 2001; Malik, Selden, and Hodgson, 2002).

Macrophages of liver i.e. Kupffer cells have immunomodulatory functions. These

cells play important role in the antigen/bacterial destruction, removal of debris and


8

Figure 2.1: Anatomy of Liver. Liver is composed of various types of functional

cells. Liver anatomy showing the location of different cells types. Major portion of

liver consist of hepatocytes, rest is made up of endothelial cells. Blood cells

migrate through the fenestrations of liver. Adapted from (Saladin, 2012).


9

dead cells from the blood stream by producing hydrolytic enzymes, hydrogen

peroxide, superoxide anions and eicosanoids. Pit cells are intrahepatic leukocytes

of liver believed to have Natural killer activity. Pit cells involve in cytotoxic role

against viral infections and tumors (Wake, 2004).

2.2 Hepatitis

Hepatitis is a Latin word which is derived from two words Hepa means “liver” and

titis means “Inflammation, so hepatitis is the term used for liver inflammation.

There are many types of hepatitis like drug induced hepatitis, alcohol, toxins,

chemicals, parasitic, bacterial and viral hepatitis. Viral hepatitis is a major health

issue around the world, especially of many Asian countries (Lu et al., 2003).

Depending on the severity of disease, hepatitis has two clinical conditions acute

and chronic. Acute is condition in which disease is progressive and short term

which later on convert to chronic condition while, chronic is long term and more

aggressive lead to severe symptoms.

2.3 Viral hepatitis

The term viral hepatitis is coined for the viruses targeting hepatocytes (liver cells),

therefore, also known as hepatotropic viruses. This group of viruses is not new

rather it is as old at the beginning of mankind. It includes a diverse group of

viruses named as hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C

virus (HCV), hepatitis D virus (HDV), hepatitis E virus (HEV), hepatitis F virus

(HFV) and hepatitis G virus (HGV). After infection, they can move from acute to

chronic infections. As very little is known about HFV and HGV, so hepatitis A

through E will be discussed here. Each of these viruses infects and damages the

liver causing the classic symptoms of jaundice with elevated level of liver


10

enzymes. HAV and HEV use fecal oral route for its transmission and infection

mostly resolve after acute stage. HBV, HCV and HDV conversely spread via blood

transfusion, sexual, vertical and parenteral, can lead to both acute and chronic

infection. All this viral hepatitis can be diagnose by testing patient’s blood by

serological and molecular tests (Schiff, 2007).

2.3.1 Hepatitis A virus

HAV belongs from Picornaviridae family and this virus cause acute viral hepatitis

which is the most common viral hepatitis worldwide (Feinstone et al., 1975).

Route of transmission for the spread of HAV is mainly by the fecal-oral route via

contaminated food and water. HAV is endemic in poor and socioeconomically

weak countries with lack of good hygienic food, poor sanitation, clean drinking

and irrigating water resources. Transmission through injection drug user, sexual

contact, blood transfusion and needle stick injury are rarely reported. Mother to

fetus HAV transmission is less frequently reported (Mohebbi et al., 2012; Franco

et al., 2012).

2.3.2 Hepatitis B virus

Presently about 350 million peoples around the globe are HBV carriers. It is

double stranded DNA virus replicate through reverse transcription and is a member

of hepadnavirus family. Mostly transmission through injection drug user, sexual

contact, blood transfusion and needle stick injury and mother to fetus transmission

of HBV is less primary mode of infection. Identification of Hepatitis B surface

Antigens (HBsAg) of HBV can be done by immunochromatographic technique,

enzyme linked immune sorbent assay (ELISA) and final confirmation of this viral

infection can be by amplification of HBV DNA by polymerase chain reaction


11

(PCR). But sometime the viral DNA amplification from patient’s serum shows

negative results but HBV still there in hepatocytes, this (false negative) dormancy

condition is termed as HBV occult infection (Arababadi et al., 2012).

2.3.3 Hepatitis C virus

In 1989 HCV virus was discovered and was known as non-heptatitis A, non-

heptatitis B virus (Farci et al., 2002). HCV is positive sense single stranded RNA,

enveloped virus belongs to genus Hepacivirus and family Flaviviridae. Based on

genotypic analysis HCV genome has been classified into six main genotypes.

Based on nucleotide sequences these genotypes 30-33 % on average differs from

each other and closely related subtypes which show less heterogeneity of 20-25 %

in nucleotide sequences like genotypes 1a and 1b. Error-prone synthesis of RNA in

HCV infected patient produces many variants of HCV known as quasispecies.

HCV is a fatal blood borne pathogen targeting hepatocytes. At present nearly 160

million peoples are HCV infected and in many cases it remain asymptomatic acute

infection but 50 % – 80 % of unclear infected cases progress to a persistent state of

viral replication and results in hepatitis (Farci et al., 2002). HCV molecular

organization, life cycle, replication and pathogenesis will be explicate below in

details.

2.3.4 Hepatitis D virus

In 1977 HDV was discovered (Rizzetto et al., 1977) and termed as “delta agent”.

HDV is circular single stranded RNA virus, 36-nm particle size and show gross

similarities with main viruses, viral satellites and viroids of plant origin. HBV,


12

HCV and HDV have common routes of transmission. This is defective RNA virus

can only infect persons that have HBV infection which play the role of carrier host.

HBV and HDV together cause progressive chronic liver disease which could lead

to cirrhosis and cancer of liver in about 80 % of patients that have both HBV and

HDV infection. This virus is significant cause of severe acute liver injury in many

countries of the world (Kumar et al., 1992). Prevalence of HDV infection in

HBsAg positive individuals are about 16.6 % in Pakistani population. The major

source of HDV is the poor hygienic conditions, yet there is some decline in the

HDV cases in Pakistan. The study showed that these individuals infected with

HBV may have either HDV super infection or co-infection of with HBV (Mumtaz,

2005).

2.3.5 Hepatitis E virus

HEV is RNA based positive polarity single stranded genome virus without envelop

is about 32 to 34 nanometers in size. It is the only member of the Hepevirus genus

in the family of Hepeviridae. Like HAV the transmission and distribution of this

hepatitis virus depend on the geographic location. In 1983 HEV was for the first

time isolated from the facial sample of volunteer who was experimentally infected

with HEV (Balayan et al., 1983). This virus is generally categorized in four groups

i.e. 1, 2, 3 and 4 with single serotype. In about 96 % of HEV infected cases,

increased level of serum bilirubin and elevated liver enzymes have been observed.

But neither HAV nor HEV infection progress to chronic case and the mortality rate

in HEV infection is high as compared to HAV in pregnant women especially (Zhao

et al., 2009; Li et al. 2006).


13

2.4 The discovery of Hepatitis C virus

Acute viral hepatitis has history of over 2,000 years described by Hippocrates.

Within last thirty years epidemiology, Biology, Immunology, Pathology, Genetics

and clinical feature different viral hepatitis have been identified as hepatitis has a

very long history in humans. Previously it was speculated that hepatitis might be

cause by an infectious agent, after many decades with the development of advance

complicated research tools and methodology researcher discovered different viral

hepatitis A, B, and C. Detection of hepatitis infection in blood transfusion

recipients lead towards the discoveries of these viruses. Patients with increased

serum liver enzymes level with symptoms of fever, jaundice, vomiting and nausea

were documented before 1940s, after almost 150 years of first ever human blood

transfusion (Beeson, 1943). Clinical history and infection pattern in viral hepatitis

gave a clue that more than one type of virus is responsible of hepatitis instead of

"serum" hepatitis. In 1947 for the first time for the hepatitis A and hepatitis B

terms were brought in to differentiate between the two different forms of

hypothesized hepatitis (MacCallum, 1947).

With the advancement in diagnosis of viral infection, in 1974 serological

diagnostic procedure was discovered for HAV and HBV infection and so their

contribution in spread of post transfusion hepatitis was cleared (Prince et al.,

1974). Since the serum screening tests for hepatitis A and B in donor blood was

not screened it was obvious that there is still another unrevealed infectious agent

liable for mass post transfusion hepatitis infections, so for the first time ever “non-

A, non-B hepatitis” (NANBH) terminology was used (Alter et al., 1975; Feinstone

et al., 1975). With the continuous research progress for about decade, while


14

digging for this NANBH's causative agent, during that period other viruses causing

hepatitis i.e. HDV and HEV were discovered (Balayan et al., 1983; Bonino et al.,

1984; Rizzetto et al., 1977). Since 1940 or longer that virus might exist but in 1989

it was identified for the first time. Chiron Corporation in USA unambiguously

identified and did genetic mapping of HCV by using very advance tool i.e.

molecular biology and recombinant DNA technology (Shepard et al., 2005).

2.5 Epidemiology of HCV

HCV infection is a global health problem and victimizing 180 million people

worldwide out of which 130 million are chronic carrier (Shepard et al., 2005).

Countries like Canada, Australia, USA, Japan and in most of European countries

incidence of HCV infection is about > one percent. While approximately 2 %

population of Africa and Southeast Asia infected with HCV (Nakamura et al.,

2008). According to epidemiology survey of HCV about 10 million Pakistanis are

suffering from HCV infection (Raja and Janjua, 2008) and provincial HCV

surveillance data revealed that Punjab province is ranked highest in HCV

prevalence. And in male population incidence of this infection is higher as

compared to female. More than half of the HCV positive population belong from

age group of 40-50 years (Idrees and Riazuddin, 2008). Healthy blood donors

show high prevalence of HCV infection and different studies conducted at national

level reported about 4 % of blood donor are sub-clinically infected with HCV

(Waheed et al., 2009). According to Arif et al. (2008) hemophilic and thalassemic

population showed about 49% HCV infection and in health care workers HCV

infection percent incidence is almost 5 % (Hamid et al., 2004). Every year Pakistan

adds approximately 0.37 million new cases of HCV infections (Ali et al., 2009).


15

2.6 HCV transmission

In past HCV main mode of transmission was through blood transfusion, now HCV

first and foremost spread by means of direct contact to HCV infected blood, body

fluid and blood products (Burns et al., 2003). HCV infections in children and HCV

positive antibodies in their parents clearly depict that transmission of HCV to them

probably by exposure to infected blood or contaminated syringes (Strickland et al.,

2005). According to CDC (center for disease control) HCV transmission as

compared to Human Immuno deficiency (HIV) via sexual intercourse is

infrequently but from the saliva and semen its virions have been isolated (Schultz,

2005). There is high rate of HCV infection in individual with multiple sex partners,

sex workers and homosexual however, there are very less cases of sexual

transmission have been reported so far. In case of intravenous drug user, sharing of

shaving razors, toothbrushes are also potential sources of HCV transmission

(Pasquier et al., 2003; Schultz, 2005). Hospital acquired infection of HCV from

patient to healthcare worker and from patient to patient is very common in which

needle-stick injury contributes about 10 % in the transmission of HCV infections

(Foley et al., 2009). Unsterilized razors, scissors, brushes at barber shops, piercing

of different body parts and tattooing helps in spreading of HCV infection (Burns et

al., 2003).

Transmission via hemodialysis (HD) is very rare in developed countries but this

rate is quite high in under developed and in developing countries, in which HCV

infected HD machines and biologically unhygienic/infectious practices of health

care workers are in common practices (Bracho et al., 2005; Nemati et al., 2009). In

semen, cervical smear, viginal fluids, saliva, nasal secretion and breast milk HCV


16

RNA has been also identified (Lock et al., 2006; Aaron et al., 2008). Mother to

child (vertical transmission) are slightly high i.e. 5-8 % in pregnant women with

increased viral load (HIV/ HCV co-infected). Role of mosquito in the spread of

HCV is still unclear. But few studies reported the presence of HCV RNA in

mosquito fed on HCV positive blood (Chang et al., 2001).

2.7 Treatment of HCV

HCV treatment regimens are constantly improving with time and have HCV

replication inhibiting capabilities and with improvement. First approve drug for the

treatment of HCV was recombinant interferon alfa-2b. Interferons are basically

cytokines that have antiviral and anti-proliferative activity consequent of multiple

gene expression as virus enters the host body. By this way viral replication inhibits

and induces anti-proliferative effect on the cell (Neumann et al., 1998). In

combination ribavirin increases treatment response rates in HCV infected patients

when treatment with interferon and ribavirin in combination given for 24 weeks.

But failure to this response is also observed in non respondent and relapse patients

(Chevaliez et al., 2007). But treatment of HCV with Peg-IFN has is more effective

but that in combination with ribavirin the treatment response is more robust. Those

patients that were treated with ribavirin only show poor treatment response. When

there is mutation at 415 codon amino acid in NS5B domain (RNA-dependent RNA

polymerase) ribavirin shows resistance. Genetic diversity of HCV affect antiviral

treatment response in HCV infected patients (Hayashi and Takehara, 2006).

2.8 HCV Genomic organization

HCV viral genome is described as a positive sense single-stranded RNA of almost

9.6 kilo base approximately 10000 nucleotides (Takamizawa et al., 1991). HCV


17

genome encodes a single long open reading frame (ORF) encoding a polypeptide

of 3010 amino acids residues (Fig 2.2) (Grakoui, 1993). ORF of HCV translates

through a ~340 nucleotide and 5’ un-translated regions (UTRs) which performs

entry site for internal ribosome (IRES). In the absence of translation initiation

factors RNA binds with 40S ribosomal subunit in such a way that P site become

direct neighborhood for initiation codon (Hellen and Sarnow, 2001). It allows

ribosomes to bind ORF’s start codon. Cellular and viral proteases enzymes cleave

newly formed HCV polypeptide into three main structural proteins i.e. for core

protein/nucleocapsid C, envelop glycoprotein1 E1 and for envelop glycoprotein2

with six non-structural proteins (NS2, NS3, NS4A, NS4B, NS5A and NS5B) is E2

(Kato, 1993).

Very less is known about NS1 but it is thought that its functions are linked with

E2. NS2 translate in trans-membrane proteins whereas 630 amino acid protein NS3

having three enzymatic activities domains, 180 residues peptide with N terminal

and C terminal have serine protease, helicase and nucleoside triphosphate activities

respectively. Unwinding of viral genome and cleavage of different non-structural

proteins (NS3-4A, NS4A-4B, NS5A-5B) at different junction sites by NS3

protease (Bartenschlager et al., 1993).

NS4 plays the role of co-factor for NS3 protease which is indispensable for

polyprotein processing (Failla et al., 1994). NS5a are interferon-resistance protein

whereas NS5b play role of RNA-dependent RNA polymerase indispensable for

viral replication (Behrens et al., 1996).


18

Figure 2.2: Hepatitis C virus (HCV): model structure. Adopted from

http://www.the-scientist.com/?articles.view/articleNo/24336/title/

Culturing-Hepatitis-C/

Figure 2.3: Genome Organization of Hepatitis C virus.


19

2.9 HCV replication and role of viral proteins

HCV replication mainly take place in hepatocytes but there are many evidences

that it can replicate in macrophages, B and T cells in vitro cell lines (Esteban et al.,

1996), in gut epithelial cells (Deforges et al., 2004) and nerons (Forton et al.,

2004). HCV cell cycle starts with the attachment of this deadly virus with host cell

by specific interaction between host cell surface a receptor protein (CD81 a

member of tetra-spanin) cell surface protein express on all cells, and protein (E2

glycoprotein evident from in vitro studies) on the HCV surface (Pileri et al., 1998).

Furthermore, the virus has ability to enter in host cell via low density lipoprotein

receptors binding (Monazahian et al., 1999). While after many structural

rearrangements in E1 fusion peptide take part in fusion of membrane of the E1

which facilitates in viral particle entry into the host cytoplasm (Flint et al., 1999).

As virus binds to its receptor, internalization completes with the release of

nucleocapsid into the cytoplasm. After decapsidation, translation for polypeptide

and replication occur in cytoplasm. Protein translation directly takes place as HCV

RNA is positive polarity RNA and this RNA function as mRNA as well. This

translation is cap independent unlike other cellular RNAs where cap binding to

ribosome machinery is prerequisite for translation. Translation initiation of HCV

RNA starts by ribosomal binding of 5/ end of IRES. Rough endoplasmic reticulum

(RER) is the main site for HCV RNA translation for synthesis of single

polypeptide. For the production of structural and non structural proteins co/post

cleavage of this single polyprotein take place via cellular and viral proteases. For

the replication of HCV genome, synthesis of negative strand RNA take place by

RNA-dependent RNA polymerase (NS5B) which will later on serve as template


20

for the synthesis of positive sense RNA (El-Hage and Luo, 2003; Gosert et al.,

2003). Viral non structural and proteins of host cell form a membranous web

known as replication complex nearer to perinuclear membranes is the site for

replication and post-translational process. Process like encapsidation of viral

genome and enveloping of nucleocapsids take place in ER while final processing

and mature at in Golgi apparatus after that newly formed virions release by

exocytosis in pericellular spaces (Penin et al., 2004).

2.9.1 Core protein

Core protein contains HCV first 191 amino acids, 3 domain (on the basis of

hydrophobicity) basic protein which forms viral nucleocapsid. In the serum of

HCV infected patient 21 kDa core proteins has been isolated. This protein is

involved in activation of many signaling pathways by interacting with different

host cellular proteins. The significant role of core protein is encapsidation of viral

genome and assists its replication (Imran et al., 2012). Cytosolic membrane-bound

this core protein has been linked with ER, mitochondria, nucleus and lipid droplets,

Involved in steatosis and in liver carcinogenesis (Hope et al., 2002; Lerat et al.,

2002). Cell functions can be influence as HCV core protein interacts with different

host.


21

Figure 2.4: Replication cycle of HCV. (1) Binding of virus to receptors. (2)

Endocytosis. (3) Uncoating. (4) Translation of genomic RNA and proteolytic

processing of the polyprotein associated with the endoplasmic reticulum. (5) RNA

replication complex formation in the membranous web. (6) Virions

morphogenesis(genome replication). (7) Encapsidation of genomic RNA and

assembly of virus particles through interactions between the ER and lipid droplets

(maturation). (8) Release of virus particles from the cell (Exocytosis). Adapted

from New and experimental therapies for HCV (Arema and Jacobson, 2009).


22

2.9.2 Envelop proteins

HCV consist of highly glycosylated two envelop proteins (E1 and E2) having

significant role in HCV entry in host cell. These E1 and E2 proteins are 35 and 72

kDa correspondingly. Envelope proteins are considered to involve in cell-mediate

cell entry by identifying receptor proteins of cellular membrane probably for

membrane fusion. E1 and E2 proteins leads polyprotein precursor to the ER moves

to ER lumen and after cleavage these remain fixed on the inner side of ER lumen.

Two hypervariable regions have been recognized in E2 protein which is

responsible for mutation, possibly neutralizing antibodies target (Ashfaq et al.,

2011).

2.9.3 P7 protein

A polypeptide found between E2 and NS2 genes, a 63-amino acid is known as P7.

It is a trans-membrane protein found on ER with two domains one connected

through cytoplasmic loop and other is adjusted in the direction of ER luman. It is

clear that C-terminal this trans-membrane domin of P7 can perform a signal

sequence direct NS2 translocation to cleave by host cell signal peptidases in ER

lumen. P7 proteins also form ion channels causing HCV infection’s pathogenic

effect. P7 HCV protein has similar features like a group of proteins known as

viroporins and this protein is crucial for viral particle assembly and release (Ashfaq

et al., 2011).


23

2.9.4 Nonstructural proteins (NS2, NS3, NS4A, NS4B, NS5A and NS5B)

2.9.4.1 NS2

A trans-membrane protein 21-23 kDa NS2 is indispensable for in vitro and in

vivo for viral replication cycle completion (Khromykh and Westaway, 1997). N-

terminal amino acids are highly hydrophobic with 3-4 trans-membrane helices

anchored in ER membrane. Some part of C-terminal of NS2 and NS2/3 show auto

protease activity collectively with of N-terminal NS3. Chelating agents (EDTA)

studies showed lose of protease activity of NS2-3 metalloprotease have exogenous

zinc medicated protease. This zinc element is important for NS3 structural

stabilization present at its active site (Lorenz et al., 2006).

2.9.4.2 NS3

A multifunctional NS3 67 kDa protein’s C-terminal show NTPase/helicase

whereas N-terminal performs serine protease activity (Gallinari et al., 1998). NS3

and NS4A are ER membrane bounded proteins (Wolk et al., 2000). N-terminus of

NS3 protease of HCV is involved in cleavage between NS3-4A, 4A-4B, 4B-5A

and 5A-5B. NTPase/helicase enzymatic activity of the NS3 is crucial for HCV

RNA replication. Presumed functions of this protein may be unwinding of double

stranded RNA intermediates during replication, RNA secondary structures removal

or to split nucleic acid binding proteins from genome. Current advancement in

molecular mechanisms understanding NS3 could be use novel antiviral

strategy (Serebrov and Pyle, 2004).


24

2.9.4.3 NS4A

It is 54 amino acids residues containing HCV protein serve as cofactor for NS3.

Deletion analysis of this protein’s showed that N-terminal is involved in directing

NS3 to the ER membrane (Wolk et al., 2000). NS4A and NS3 interaction is

stimulated between NS3 core residues and NS4A C-terminal. This interaction

favors active site activation of NS3 which leads to more proficient protease

cleavage (Kim et al., 1996). NS5A phosphorylation takes place by NS4A and also

directly interacts with NS5A. Amino acids deletion from the central region of

NS5A protein revealed NS4A dependent phosphorylation of NS5A (Asabe et al.,

1997).

2.9.4.4 NS4B

Small 27 kDa hydrophobic protein NS4B, have significant role in employment

many viral proteins (Lundin et al., 2006). This protein directly interacts with

NS4A and indirectly with NS3 and NS5A. It is ER localized integral membrane

protein and ER membrane also contains non-structural proteins (Lin et al., 1997).

Electron microscopy data on NS4B protein of HCV revealed that it from a

structure known as membranous web by changing ER membrane morphology

(Gretton et al., 2005). It is evident from studies that replication complex

formation takes place here as all viral proteins were localized to ER (Egger et al.,

2002). Oncogenic and cytopathic effect of NS4B in transgenic mice’s liver is still

unclear (Wang et al., 2006).


25

2.9.4.5 NS5A

A phospho-protein NS5A is hydrophilic in nature without any transmembrane

domains, performs different tasks for HCV like activation of cell signaling

pathways, interferon responses and viral replication (Macdonald et al., 2004).

Some studies reported its linked with other HCV proteins purposed it as part of

replication complexes (Neddermann et al., 1999). NS5A mutations are critical for

maintaining replicon cell line and HCV replication (Lohmann et al., 1999). NS5A

gain its popularity due to its crucial part in interferon response modulating it also

contain interferon resistant associated region which impart resistance in HCV virus

against treatment with it (Gale et al., 1997). It is suggested that NS5A has

interactions with numerous proteins of cell signaling pathways and influencing

their function. NS5A can alter the 3 main pathways of MAPK (regulate growth and

activation) which are responsible for host cell mitogenic signaling. Both pro-

apoptotic and anti-apoptotic pathways are also modulated by NS5A proteins.

NS5A is also associated in altering phosphatidylinositol 3-kinase signalling and

ROS pathways that are consider to cause transformation in hepatocytes and leading

to hepatocellular carcinoma (Macdonald et al., 2004).

2.9.4.6 NS5B

A 65 kDa NS5B protein is a tail anchored protein which substitute for RNA

dependent RNA polymerase so have crucial role in HCV new genome

synthesis (Behrens et al., 1996). This polymerase activity was discovered after

sequence analysis of an amino acid motif GDD (Yamashita et al., 1998). NS5B

structural organization is distinctive polymerase (right hand shape) with encircled


26

active site having sub domains of finger, palm, and thumb (Lesburg et al., 1999).

RNA genome serve as template for synthesis of negative strand of a

complementary and the succeeding synthesis positive strand RNA of genomic

from this negative sense RNA strand intermediate. Playing central part in HCV

replicase, now NS5B is potential biomarker for new pharmaceutical (antiviral)

discoveries (De Francesco and Migliaccio, 2005).

2.10 Apoptosis and HCV

Apoptosis of hepatocyte is manifested in liver related injury either by metabolic

diseases, alcoholic, autoimmune, drug induced or viral hepatitis. For the normal

cellular homeostasis apoptosis plays a critical role by removing damaged,

abnormal proliferated and aged cells (Shin et al., 1998; Favaloro et al., 2012).

Sometime certain stimuli cause collapse apoptosis mechanism leads to form

various in tumor which are resistant to cytotoxic therapy (Pitot, 1993). Apoptosis

in mammalian cells can be induced via two major pathways 1st death receptor

pathway (extrinsic pathway) and 2nd

apoptosis pathway (intrinsic pathway) is

mitochondrial mediated in response to viral proteins, DNA damage and oxidative

stress. In mitochondrial mediated apoptosis expression Bax, Bad, Bak pro-

apoptotic genes and Bcl-2 or Bcl-xL anti-apoptotic protein express leading to PM

(Fischer, 2007) as shown in figure 2.7.


27

Figure 2.5: Interference of HCV proteins with the apoptosis cascade. Pro and

anti-apoptotic effects of HCV proteins converge at the mitochondria (e.g., NS2,

NS3/4A, NS5A, E2, core), partly indirectly via p53 (NS5A, core) and activation

of PKB/Akt, c-Jun kinase JNK (core) or NFkB (NS5A). Adapted from (Fischer,

Baumert et al. 2007).


28

HCV proteins perform mitochondrial mediated apoptosis by playing role as

antiapoptotic or proapototic proteins, it all depends on the expression system and

experimental condition (Marusawa et al., 1999). NS3 and NS5a protein of HCV

have anti-apoptotic while core protein has regulatory properties (Macdonald et al.,

2004). It is evident from many studies that hepatocytic apoptosis is involved in

pathogenic effect of HCV infection. It is thought that core protein of HCV restrains

c-myc, TNF-α, cisplatin or Fas mediated apoptosis but mechanism behind this

HCV core protein involvement is still not fully known. Due to unavailability of

effective tissue culture for HCV or animal model, the study of hepatocyte

apoptosis induced by HCV infection (Zekri et al., 2011).

2.11 Apoptosis

Employment of complex signalling mechanism for the removal disease or

damaged condition of cells leads by series of steps in a programmed and codinated

manner or we can say programmed cell death coordinnated with sequale of events.

There are many stimuli and causative agents that are consider to take part in the

event of apoptosis. This phenomena starts with discrepancy in the normal ongoing

functions in the cell. The most important of which is irregularity in redox condition

of the cell. Broadly apoptotic stimuli can be categories in two main groups; stress

and physiological stimuli Physiological stimuli like (viral, irradiation, UV light and

bacterial infections) lead to death by cell surface receptors (TNF or CD95) and

initiate mitochondria induced stress apoptosis (Gulbins, 2003).

The leading and vital organelle in performing cellular important functions and even

in apoptosis is mitochondria. Whenever cell faces oxidative stress condition the

membrane permeability of mitochondria increases leading to induction of


29

apoptosis. The major function of mitochondria in apoptosis can be categories in 3

parts: Initiation, decision and degradation phases. In initial phase gathering of

proapototic messengers implicated in MP, in decision phase event of MMP take

place and in degradation phase caspases and hydrolases activation happen (Mordon

and Blanchemaison, 2008; Sala et al., 2008).

Mitochondria is target organelle for different stress responses type of like reactive

oxygen species, ceramide, fatty acids their oxidation products, superoxides, nitric

oxide, hydrogen peroxides etc these pro-apoptotic signals leads to mitochondrial

MP as a results in release of many mitochondrial proteins in cytosol which ends on

mitochondrial induced apoptosis. Metabolites and enzymes concentration for

instance NADPH oxidases persuade the strength of MMP (Wang et al., 2008).

Mitochondria stop pro-apototic proteins from performing their duties in cytoplasm

so we can call it as act as gatekeeper. Protein like cytochrome, caspase 9,

mitochondrial activator of caspases, apoptosis-inducing factor, high temperature

requiring proteins and endonuclease G release from mitochondria as result of

marked increase in leading apoptosis (Gulbins, 2003).

2.12 Apoptosis molecular mechanism

Ubiquitous form of cell death (Apoptosis) takes place in hepatic diseases.

Apoptosis is a form of cell death occurring in human liver diseases.

Morphologically apoptotic cell show distinctive features cytoplasmic shrinkage,

fragmentation of nucleus, condensation of chromatin, plasma membrane blebbing

and apoptotic bodies. There are two ways of hepatocytes apoptosis first death

receptor (apoptosis via extrinsic pathway) secondly by cellular perturbations


30

(apoptosis via intrinsic pathway) and both congregate on mitochondria (Goldman,

1994).

i) The extrinsic pathway

Extrinsic mean outside, cell surface transmembrane proteins act as death receptor

in extrinsic pathway, these belongs from receptor super-family of tumor necrosis

factor and nerve growth factor. These are distinct on basis of their specificity to

ligand i.e. Fas ligand, tumor necrosis factor alpha or tumor necrosis factor related

apoptosis inducing ligand. These cell surface proteins have N-terminus

extracellular that binds with ligands and intracellular C-terminal domain containing

a conserve region which is called as death domain. This pathway activate when an

external ligand such as tumor necrosis factor, Fas ligand, glucocorticoids,

cytokines binds with their specific receptor leading to the down regulation of

secondary messengers with the activation of caspase 8. Caspase 8 cleaves

proapoptotic BH3 only protein (Bcl-2 family) Bid to tBid proteolytically, leads to

activation of Bax and Bak results in mitochondria pore formation. The outcome of

this pathway can be either cell survival or death as a result of apoptosis at all

depends on signals availability and induced pathways. Activation of transcription

factor (NFkB) can also occur due the balance between them and give a cell

survival signal (Owen et al., 1994).

ii) The Intrinsic (Mitochondrial mediated apoptosis) pathway

Intrinsic mean starts from inside, this type of apoptosis activates in response to loss

of cell-survival factors, DNA damage and different severe intracellular stresses

receive and induce by cell’s membrane bound organelle like lysosomes and ER. C-

jun N terminus kinase activator of intrinsic pathway of apoptosis can be activated


31

by DNA damage and steatosis. All these processes transduced by proteins of Bcl-2

family (pro-apoptotic and anti-apoptotic proteins) come together on mitochondria

so called as mitochondrial or Bcl-2-regulated apoptic pathway (Dreschers and

Bock, 2003). It starts with the production of ROS modification in MMP as a result

of proapoptotic signals induces the release of many intermembrane space proteins

e.g Endo G, apoptosis inducing factor, cyto-chrome c etc induces apoptosome

formation which eventuates activates Caspase 9 (Galle et al., 1994). Caspase 9

additional activates caspase 7 and caspese 3 (effectors caspases) ending with the

start of membrane degradation, apoptotic bodies formation and fragmentation of

DNA (Owen et al., 1994). Figure 2.6 below in brief represents the types and

mechanism apoptotic pathways.

2.12.1 Bcl-2 Apoptosis Regulator Family

Bcl-2 is apoptosis regulator family proteins which govern MMP and can perform

pro-apoptotic proteins (BAD, Bak, Bok, Bax etc) or can play as anti-apoptotic

proteins (Bcl-w, Bcl-2 proper, Bcl-xL). Mitochondrial integrity is control by

protein of Bcl-2 family present on the outer membrane of mitochondrial. About 24

years ago B-cell lymphoma-2 (Bcl-2) consequence of up-regulation in follicular B

cell lymphoma, it was declared that Bcl-2 doesn’t promotes proliferation in tumors

rather it restrains apoptosis (Hockenbery et al., 1993). During research it is

discovered that in this family there are about 25 members and on the bases of

homology to certain extend this Bcl-2 family is segregate in two sub-families i.e

anti-apoptotic and pro-apoptotic subfamilies. Over-expression of this protein is

http://en.wikipedia.org/wiki/Protein_family

http://en.wikipedia.org/wiki/Apoptosis

http://en.wikipedia.org/wiki/Bcl-2-associated_death_promoter

http://en.wikipedia.org/wiki/Bcl-2_homologous_antagonist_killer

http://en.wikipedia.org/wiki/BOK_(gene)

http://en.wikipedia.org/wiki/Bcl-2-associated_X_protein

http://en.wikipedia.org/wiki/Bcl-w

http://en.wikipedia.org/wiki/Bcl-xL


32

Figure 2.6: Diagrammatic illustration of the main molecular pathways

leading to apoptosis. In the extrinsic pathway upon ligand binding to specific

receptors the DISC complex is formed and caspase 8 activated. In the intrinsic

pathway release of cyt c from the mitochondria result in the formation of the

apoptosome and activation of caspase 9. Caspase 8 and 9 then activate downstream

caspases such as caspase 3 resulting in cell death. The two pathways are connected

through the cleavage of the BH3 only protein BID. Adapted from (Favaloro et al.,

2012).


33

attributable to translocation of chromosome as it has been observed in many

hematological malignancies (Reed et al., 2005). In different model systems for

example glucocorticoid-induced apoptosis of lymphoma cells, Bcl-2 had proved its

role as inhibitor of apoptosis.

2.12.2 Caspases executors of Apoptosis

Caspases cysteine proteases play important function in inflammation, necrosis and

apoptosis and belong to family cysteine-aspartic or we can say cysteine-

dependent aspartly-directed proteases. These proteases are found in many

membranous organelles and cytoplasm. Based on structural analogy and substrate

specificity, 14 different caspases have been found (Kaufmann and Earnshaw,

2000). These are also known as executioner based on their significant role in cells

for apoptosis and synchronized at post-translational stage. Produced in inactive

form known as pro-caspases with two subunits (smaller and larger) but the effector

caspases has very smaller (Chandra et al., 2000). The caspases contains domain

that facilitates them to activate after interacting with other molecules which

ultimately ends on effector caspase. On C-terminal, there is aspartate amino acid

residue a point for cleavage (Fan et al., 2005).

Two terms auto-activation or sometime proteolytic cascade are used for caspase

activation which occur when proteolytic cleavage of aspartate residues not less

than ultimately separates two subunits transforming inactive form into active form

(Ozben, 2007). There are three caspases activation pathways: 1. Cytotoxic T

lymphocytes and Natural killer cells release granzyme B which are responsible for

caspase-3/-7 activation. 2. TRAIL receptors, Fas, and TNF receptor activate

caspase -8/ -10. 3. Cytochrome c and the Bcl-2 protein family (as in case of HCV

http://en.wikipedia.org/wiki/Cytotoxic_T_lymphocyte

http://en.wikipedia.org/wiki/Cytotoxic_T_lymphocyte

http://en.wikipedia.org/wiki/NK_cells

http://en.wikipedia.org/wiki/Granzyme_B

http://en.wikipedia.org/wiki/TRAIL

http://en.wikipedia.org/wiki/Fas_ligand

http://en.wikipedia.org/wiki/Tumor_necrosis_factor_receptor

http://en.wikipedia.org/wiki/Cytochrome_c

http://en.wikipedia.org/wiki/Bcl-2


34

infection induced apoptosis) regulated via apoptosome results in activation of -9

caspase. Human twelve caspases -3, to -10 may expose to have a major

contribution in programmed cell death. Based on task and caspases activations in

signaling pathway they have been categorized in 3 classes: first apoptotic

activators -2, 8, 9, 10 (Initiator caspases), second apoptotic executors -3, 6, 7

(Effector caspases) and caspase -1, 4, 5, 11, 12, 13, 14 (Inflammatory caspases).

Activation of effector caspases starts when pro-apoptotic stimuli activate initiator

caspases and start their proteolytic cleavage. These caspases then perform their

functions by deterioration of cell and expanding the proteins cleavage, obstructing

apoptotic activity by releasing apoptotic inhibitors. All catalysis enzymes and

regulatory proteins become free progressing in collapse of enzyme activity. Chief

effector caspase (8, 9) are caspases and effector caspase (3, 6, 7) destroying

proteolytic enzymes leading cells towards apoptosis (Pop and Salvesen, 2009; Li

and Yuan, 2008).

There are many contradictory studies that reported many HCV pro-apoptotic or

anti-apoptotic proteins are directly involved in apoptosis. In some reports it is

declare that core proteins, E1, E2, NS3, NS4A, and NS5A and NS5B HCV

proteins activate apoptosis. Some studies reported that these HCV proteins work as

anti-apoptotic. Apoptosis induced by HCV by two ways external and internal

pathways. Hepatocyte apoptosis occur in patients with HCV chronically infected

patients. TNF-R1, TRAIL-R1, Fas and TRAIL-R2 express on liver cells (Tatsuo

Kanda et al., 2013).

In case of hepatocytes hepatic apoptosis the role of Fas and TNF-R1 are well

documented on the bases of both in vitro and in vivo agonist antibodies anti-Fas

http://en.wikipedia.org/wiki/Apoptosome

http://en.wikipedia.org/wiki/Caspase-9


35

and TNFa induced hepatotoxicity. TRAIL induced hepatotoxicity is still under

discussion but it was thought that minor role in apoptosis progression however its

expression is caused by DNA damage. HCV non-structural NS3 protein induces

host cell transformation and tumor suppressor p53 and the N-terminus of NS3

forms a complex which in turn inactivates actinomycin D-induced apoptosis. Many

research studies have revealed that HCV proteins interact with host cells proteins

and thought that induce hepatocarcinogenesis (Tatsuo Kanda et al., 2013).

Material &

Methods

Chapter 3 Materials and methods

37

3.1 Materials and Methods

3.1.1 Expression vectors and host cells

Human hepatoma cell line (Huh-7) used in this study was grown in high-glucose

DMEM (Gibco) supplemented with 10 % fetal bovine serum (Hyclone), 1 % MEM

non-essential amino acids (Gibco), 100 units/ mL penicillin (Gibco) and 100 mg/

mL streptomycin (Gibco).

HCV non-structural proteins NS3, NS3-4A and NS4A were amplified from cDNA

clone of HCV genotypes 3a (pS52 strain), accession no GU814263 and cloned in

the pEGFP-C1 and pFLAG-CMV2 vectors. Recombinant vectors containing NS3,

NS3-4A and NS4A genes pEGFP-C1/NS3, pEGFP-C1 /NS3-4A, pEGFP-C1

/NS4A, pFLAG-CMV2/NS3, pFLAG-CMV2 /NS3-4A and pFLAG-CMV2 /NS4A

were transfected using trans-LT1 transfection reagent in Huh7 cells (Mirus 2300,

USA). HCV infection in this study was carried out using cell culture-derived HCV

Jc1 genotype 2a HCVcc (HCV infectious in cell culture) that were maintained in

the presence of 0.4 mg/ mL G418 (Invitrogen). HCVcc infection was carried out at

multiplicity of infection (MOI) of 1.

3.1.2 Chemicals and consumables

All the chemicals were purchased from Sigma St. Louis, USA and Fisher

scientific, USA.

3.1.3 Enzymes

DNA amplification enzyme Platinum® Taq DNA Polymerase High Fidelity and

Proteinase K were purchased from (Life Technologies Invitrogen, USA).


38

Restriction endonucleases include (BglII & BamHI), T4 DNA ligase, antarctic

phosphatase was purchased from (New England Biolabs Inc. MA, USA). Rnase

cocktail enzyme mix was obtained from (Life Technologies Ambion, USA).

3.1.4 Antibodies

Antibodies used in present study were purchased from (Cell Signaling Technology,

USA, Sigma, USA, Abcam, USA and Thermo Scientific, USA, Molecular Probe,

USA). Primary antibodies were included the following: rabbit polyclonal anti-

BAX; rabbit monoclonal (Cell Signaling); anti-β-actin (Cell Signaling); rabbit

polyclonal anti-Bcl-xL (Cell Signaling); rabbit polyclonal anti-Caspase 7 (Cell

Signaling); rabbit polyclonal anti-Caspase 9 (Cell Signaling); rabbit polyclonal

anti-Caspase 3 (Cell Signaling); rabbit polyclonal anti-Cytochrome c (Cell

Signaling); rabbit polyclonal anti-PARP (Cell Signaling); rabbit polyclonal anti-

GFP (Cell Signaling); mouse monoclonal anti-FLAG (Sigma); rat monoclonal anti-

KDEL (Abcam); mouse monoclonal anti-HCV core (Thermo Scientific). The

secondary antibodies used for immunofluorescence were Alexa Fluor 350, 488,

568, 594, or 647 anti-donkeys, mouse, rabbit, or goat IgG (Molecular Probe). The

secondary antibodies used for immunoblot analysis were RP-conjugated anti-

mouse IgG (Cell Signaling), HRP-conjugated anti-rabbit IgG (Cell Signaling).


39

3.1.5 Antibiotics

Table 3.1: List of antibiotics used in the present study

3.1.6 Molecular weight markers

1 Kb ladder, Mass DNA ladder and 100 bp DNA ladders were obtained from

(Biolabs, USA). Protein molecular weight marker was purchased from MBI

(BioRad, USA).

3.1.7 Reagents

Reagents used in the study were included the following: dNTPS mix (Invitrogen

Life Technologies, USA), Trans-LT1 transfection reagent (Mirus, USA), Super

signal (West Femto Maximum Sensitivity Substrate) (Thermo Scientific, USA),

Immuno Western blot (Chemiluminesent HRP Substrate (Millipore, USA),

MitoTracker CMXRos Red stain (Invtrogen), MitoSOX™ Red mitochondrial

superoxide stain (Invitrogen), Hoechst 33342 stain (Invitrogen), Mounting agent

ProLong® Gold Antifade Reagent with DAPI (Invitrogen).

3.1.8 Media

(A) Bacteria

(a) Luria Bertani (LB) Broth (per liter)

LB (Sigma) 25 g

Reagent Stock solution Final concentration in use

Ampicillin

Kanamycin

IPTG

IPTG

100 mg/ mL

50 mg/ mL

238 mg/mL

1 M

100 µg/ mL

50 µg/ mL

1 µg/mL

1 mM


40

Dissolve 25 g LB broth to the 900 mL dH2O. After mixing adjust the volume up to

1 L.

(b) Luria Bertani (LB) Agar (per liter)

LB (Sigma) 37 g

Dissolve 37 g LB agar to the 900 mL dH2O. After mixing adjust the volume up to

1 L.

(B) Media used for cell lines

(a) DMEM (Gibco)

(b) RPMI (Gibco)

(c) Fetal bovine serum (Hyclone)

(d) 1% MEM non-essential amino acids (Gibco)

(e) Penicillin / streptomycin (Gibco)

(f) Geneticin® Selective Antibiotic (G418 Sulfate) (Invitrogen)

3.1.9 Buffers

(a) 1X Tris EDTA (TE) Buffer (500 mL)

Tris HCl 1 M 5 mL

EDTA 0.5 M 1 mL

dH2O - 496 mL

Buffers for Agarose Gel Electrophoresis

(a) Tris Acetate EDTA (TAE) Buffer, pH 8.3 (per Liter)

Tris base 242 g

EDTA (0.5M) 100 mL

Glacial acetic acid 57.1 mL

http://www.lifetechnologies.com/order/catalog/product/10131035


41

Mix all chemicals together in 800 mL dH2O. After mixing adjust to volume up to 1

L.

(b) Ethidium-bromide dye (10 mg/ mL)

Ethidium- bromide 10 mg

Milli Q water 1 mL

(c) 6X loading dye for agarose gel electrophoresis (Biolabs, USA)

Reagents and Buffers for SDS-Page

(a) RIPA buffer Quantity (1mL)

1 M TRIS pH 7.4 50 μL

2.5 M NaCl 60 μL

10 % NP40 100 μL

10 % DOC 25 μL

10 % SDS 10 μL

10 mM PMSF 10 μL / 255 μL

dH2O 74 5μL

(b) Acrylamide (30 %)

Acrylamide 29.2 g

N, N' methylene bisacrylamide 0.8 g

Milli Q water 60 mL


42

The solution was stirred to dissolve the acrylamide. The volume was made up to

100 mL and the solution was filtered through Whattman filter paper no. 1 before

use.

(c) Ammonium per sulfate 12.5% (w/v)

(d) TEMED 8.4% (v/v)

(e) Resolving buffer

Tris base 9.08 g

SDS 0.2 g

Dissolve in 60 mL of distilled water and adjust pH to 8.8 with conc. HCl and make

up to 100 mL.

(f) Stacking buffer

Tris base 3.03 g

SDS 0.2 g

Dissolve in 60 mL of distilled water and adjust pH to 6.8 with conc. HCl and make

up to 100 mL.

(g) 10 X Tris-Glycine buffer (per/liter)

Tris base 30.3 g

Glycine 144.1g

SDS 10 g

(h) Coomassie brilliant blue staining solution (per Liter)

Brilliant blue (R250) 1 g

Acetic acid 100 mL


43

Methanol 400 mL

Milli Q water 500 mL

(i) Lysis Buffer/ Loading dye

Tris base 1.51 g

SDS 4 g

Glycine 20 g

Bromophenol blue 0.002 g

Dissolve in 60 mL of water and make up to 90 mL. Add 10 mL -mercaptoethanol

just before use.

Reagents for Western blot Analysis

(a) Transfer buffer (per liter)

Tris Base 3 g

Glycine 14.4 g

Methanol 200 mL

(b) Blocking buffer 5 % non-fat milk in TBS

(c) Wash buffer 0.1 % Tween 20 in TBS (TBS-T)

Reagents for cell viability assay

(a) Plaque Staining Solution

Crystal violet 0.2 %


44

3.1.10 Instrumentation

Sorvall RT7 plus (Ultra Centrifuge), Eppendorff (5415R) Centrifuge, Premium

Biotech Visible Spectrophotometer Ultra space 1000, Kodak (Digital Science)

image station (440), i cycler (Bio-Rad), Weighing Balance (OHAUS), PH Meter

(Accumet Basic Fisher Scientific), Incubator (Boeuel Scientific), Kodak (M35A-

OMAT Processor), Transilluminator (Fisher Biotech), Olympus X cite (Series

120Q) EXFO, ELx 800 Universal Microplate Reader (Bio-TEK Instruments), New

Bronswick Scientific Excella E25 Incubator Shaker Series, Castel Autoclave

System, Mini-PROTEAN Tetra Handcast System (Bio-Rad), Mini-Sub Cell GT

System (Bio-Rad), Wide Mini-Sub Cell GT System (Bio-Rad).

3.2 Methodology

3.2.1 Primer designing

Primers for amplification of HCV non-structural NS3, NS3-4A and NS4A genes

and primers for the sequencing of positive clones were designed according to

mammalian expression vectors (pFLAG-CMV2 & pEGFP-C1) using online

available oligo calculator and synthesized from (IDT-Integrated DNA

Technologies, USA). Primers sequences are given in the Table 3.2.

3.2.2 Amplification of HCV non-structural NS3, NS3-4A and NS4A genes

Infectious cDNA clone of HCV genotypes 3a (pS52 strain), accession no

GU814263 was used for the amplification of HCV non-structural NS3, NS3-4A &

NS4A genes. These genes were amplified using Platinum® Taq DNA Polymerase

High Fidelity (Invitrogen). The reaction mixture and cycling conditions for PCR

amplification of each gene are given in Table 3.2.


45

Table 3.2: Nucleotide sequences of the synthetic primers for sequencing and PCR:

All primers were successfully annealed to their respective targets. The sequences

were designed from reported sequences of HCV genomes (NZL & pS52 of

genotype 3a) available at NCBI. Sequences of the restriction enzymes used for

each primer is italicized while stop codons in reverse primers are underlined.

S. No Primer ID Primer Sequence 5’ to 3’ Restriction site Product Size

PCR PRIMERS

1. NS3-GFP F ATCTAAAAGATCTGGCCGTGAGGTGTTG BglII NS3 (1.9 kb)

NS3-4A (2.1 kb) 2. NS3-FLAG F ATCTAAAAGATCTCGGCCGTGAGGTGTTG BglII

3. NS3 R TTAATTGGATCCTCAGGTGGTTACTTCCAG BamHI

4. NS4A-GFP F ATCTAAAAGATCTGGCCGTGAGGTGTTG BglII NS4A (168 bp)

NS4A (168 bp) 5. NS4A-FLAG F ATCTAAAAGATCTCAGCACCTGGGTGTTG BglII

6. NS4A R TTAATTGGATCCTCAGCACTCCTCCATC BamHI

SEQUENCING PRIMERS

1. pFLAG-CMV2 F ATAACCCCCCGTTG

2. pFLAG-CMV2 R TTAGGACAAGGCTGGTGG

3. pEGFP-C1 F AGCACCCAGTCCGCCCTGAGC

4. pEGFP-C1 R GAAATTTGTGATGCTATTGC


46

3.2.3 Amplification of NS3 gene using pFLAG-CMV2 primers

Reaction mixture

10 mM dNTPs--------------------------------------------------------1μL

2 mM MgSO4 (25 mM)----------------------------------------------2 μL

HF Buffer (10X)------------------------------------------------------5 μL

NS3-FLAG F (10 pmole/μL)---------------------------------------1 µL

NS3-FLAG R (10 pmole/μL)---------------------------------------1 μL

Template (DNA 640 ng/ µL)----------------------------------------1.5 μL

HF Taq polymerase (1U)-------------------------------------------0.2 μL

Nuclease free water-------------------------------------------------38.3 μL

Total volume---------------------------------------------------------50 μL

The following conditions were followed for amplification of NS3 gene.

PCR cycling conditions


47

3.2.4 Amplification of NS3 gene using pEGFP-C1 primers

Reaction mixture

10 mM dNTPs---------------------------------------------------------1 μL

2 mM MgSO4 (25 mM)----------------------------------------------2 μL

HF Buffer (10 X)------------------------------------------------------5 μL

NS3-FLAG F (10 pmole/ μL)--------------------------------------1 µL

NS3-FLAG R (10 pmole/ μL)--------------------------------------1 μL

Template (DNA 640 ng/ µL)---------------------------------------1.5 μL

HF Taq polymerase (1U)-------------------------------------------0.2 μL

Nuclease free water-------------------------------------------------38.3 μL

Total volume---------------------------------------------------------50 μL

The following conditions were followed for amplification of NS3 gene.



48

3.2.5 Amplification of NS3-4A gene using pFLAG-CMV2 primers

Reaction mixture

10 mM dNTPs--------------------------------------------------------1 μL

2 mM MgSO4 (25 mM)----------------------------------------------2 μL

HF Buffer (10X)------------------------------------------------------5 μL

NS3-FLAG F (10 pmole/ μL)--------------------------------------1 µL

NS3-FLAG R (10 pmole/ μL)---------------------------------------1 μL

Template (DNA 640 ng/ µL)----------------------------------------1.5 μL

HF Taq polymerase (1U)---------------------------------------------0.2 μL

Nuclease free water----------------------------------------------------38.3μL

Total volume------------------------------------------------------------50 μL

The following conditions were followed for amplification of NS3-4A gene



49

3.2.6 Amplification of NS3-4A gene using pEGFP-C1 primers

Reaction mixture

10 mM dNTPs----------------------------------------------------------1 μL

2 mM MgSO4 (25 mM) ----------------------------------------------2 μL

HF Buffer (10 X) -----------------------------------------------------5 μL

NS3-FLAG F (10 pmole/ μL) --------------------------------------1 µL

NS3-FLAG R (10 pmole/ μL) --------------------------------------1 μL

Template (DNA 640 ng/ µL) ---------------------------------------1.5 μL

HF Taq polymerase (1U) --------------------------------------------0.2 μL

Nuclease free water---------------------------------------------------38.3 μL

Total volume----------------------------------------------------------50 μL

The following conditions were followed for amplification of NS3-4A gene.



50

3.2.7 Amplification of NS4A gene using pFLAG-CMV2 primers

Reaction mixture

10 mM dNTPs----------------------------------------------------------1 μL

2 mM MgSO4 (25 mM) -----------------------------------------------2 μL

HF Buffer (10 X) ------------------------------------------------------5 μL

NS3-FLAG F (10 pmole/ μL) ---------------------------------------1 µL

NS3-FLAG R (10 pmole/ μL) ---------------------------------------1 μL

Template (DNA 640 ng/ µL) ----------------------------------------1.5 μL

HF Taq polymerase (1U) ---------------------------------------------0.2 μL

Nuclease free water----------------------------------------------------38.3 μL

Total volume------------------------------------------------------------50 μL

The following conditions were followed for amplification of NS4A gene.



51

3.2.8 Amplification of NS4A gene using pEGFP-C1 primers

Reaction mixture

10 mM dNTPs----------------------------------------------------------1 μL

2 mM MgSO4 (25 mM) -----------------------------------------------2 μL

HF Buffer (10 X) ------------------------------------------------------5 μL

NS3-FLAG F (10 pmole/ μL) --------------------------------------1 µL

NS3-FLAG R (1 0pmole/ μL) --------------------------------------1 μL

Template (DNA 640 ng/ µL) ---------------------------------------1.5 μL

HF Taq polymerase (1U) --------------------------------------------0.2 μL

Nuclease free water---------------------------------------------------38.3 μL

Total volume----------------------------------------------------------50 μL

The following conditions were followed for amplification of NS4A gene.



52

3.2.9 Agarose gel electrophoresis

Agarose gel 1-1.5 % premixed with 10 mg/ mL Ethidium- bromide were used for

the resolving of PCR products when run containing TAE buffer in the gel

electrophoresis chamber. Size of the desired band was determined either by 1 kb or

100 bp ladder, while gel was run at 70 V for 60 minutes and observed in UV light

(Tran illuminator).

3.2.10 Purification of DNA products from agarose gel

Amplified DNA products of the particular genes were eluted from agarose gel

using DNA clean and concentrator kit according to the manufacturer’s instructions.

Briefly, particular DNA sample was run on 1 % agarose gel prepared in TAE

buffer. The required fragment was sliced out under UV light and transferred to 1.5

mL microcentrifuge tube. 2-5 volumes of DNA binding buffer to each volume of

DNA sample was added in the tube, mixed and incubated at 55 oC in water bath for

approximately 10-15 minutes, to dissolve the agarose completely. Then mixture

were transferred to Zymo-spin column, centrifuged for 30 sec at room temperature

and discarded the flow-through. Next, 200 μL wash buffer was added to the

column and centrifuged for 30 sec at room temperature. Washing step was repeated

and then column was air dried, poured with 20-30 µL pre-warmed nuclease free

water, incubated at room temperature for 1 min and spun down for 1 min at 13,000

rpm for the elution of DNA. Concentration of eluted DNA was estimated by

running on 1 % agarose gel, with Mass DNA ladder.


53

3.2.11 Construction of pEGFP-C1 recombinant vectors

Respective amplified DNA products of NS3, NS3-4A and NS4A separately and

expression vector pEGFP-C1 were digested with selected restriction enzymes, gel

purified and further ligated using T4 DNA ligase overnight at 4 oC. 2-5 µl of

ligation mixture was mixed with 100 µl to Z-competentTM

E. coli strain competent

cells and incubated on ice for 30 minutes. The tubes were placed at 42 oC in a

water bath for 90 seconds and on ice for 1 minute. After the addition of 400 µl LB

medium, tubes were then incubated at 37 oC for 30 to 60 minutes. After that 150 µl

of transformation culture was plated onto LB agar plate containing ampicillin (100

ug / mL).

3.2.12 Construction of pFLAG-CMV2 recombinant vectors

Respective amplified DNA products of NS3, NS3-4A and NS4A separately and

expression vector pFLAG-CMV2 were digested with selected restriction enzymes,

gel purified and further ligated using T4 DNA ligase overnight at 4 oC. 2-5 µl of

ligation mixture was mixed with 100 µl to Z-competentTM

E. coli strain competent

cells and incubated on ice for 30 minutes. The tubes were placed at 42 oC in a

water bath for 90 seconds and on ice for 1 minute. After the addition of 400 µl LB

medium, tubes were then incubated at 37 oC for 30 to 60 minutes. After that 150 µl

of transformation culture was plated onto LB agar plate containing Kanamycin

(100 ug / mL).


54

3.2.13 Selection of positive clones

Positive clones of particular genes were separately screened out first through

restriction digestion (BamHI and BglII) and then by sequencing (Eton Biosciences,

USA). First, plasmids from 32 selected colonies were isolated by “QIAprep®

Miniprep Kit” according to manufacturer’s instruction. Further, were digested

using selected restriction enzymes and was incubated in an eppendorf tube at 37 oC

for 1-2 hrs. The digested DNA was checked by agarose gel electrophoresis.

Selected clones were further confirmed by automated sequencing, which was

performed commercially form Eton Biosciences, USA.

3.2.14 Large scale preparation of plasmid DNA

High concentration of plasmid DNA was prepared by using “Qiagen® plasmid

midi kit” according to manufacturer’s concentration. Shortly, 150 mL LB broth

containing ampicillin (100 μg/ mL) was inoculated with a transformed E. coli

colony and incubated overnight in a shaking incubator at 37 ºC. Further cells were

harvested by centrifuging at 6000 g for 10 min at 4 ºC and bacterial pellet was

resuspended in 4 mL ice chilled buffer P1. 4 mL P2 buffer was poured in the tube

for 5 min to lysed the cells. After 5 min 4 mL ice chilled P3 buffer was poured in

the and immediately inverted 4 - 6 times and incubated on ice for 15 min. Further

tube was centrifuged at 13,000 g for 30 min at 4 ºC and supernatant was placed in a

new centrifugation tube. A QIAGEN-tip column was equilibrated by the addition

of 4 mL buffer QBT and allowed it to empty. Then supernatant was applied to the

column and allowed to drain through by gravity than washed the column by the


55

addition of 10 mL QC buffer. The plasmid DNA was eluted by the addition of 5

mL QF buffer and collected in new tube. For cleaning purpose 3.5 mL isopropanol

was added to the eluted DNA and further mixed and centrifuged at 17,000 g for 30

min at 4 ºC. Further, supernatant was discarded and the pellet was washed with 2.5

mL 70 % ethanol and was centrifuged at 17,000 g for 10 min at 4 ºC. Discard the

supernatant and was allowed the pellet to completely dry for 5-10 min and finally

resuspended in 100 μL TE buffer or nuclease free water. DNA concentration was

determined using spectrophotometer at 595nm.

3.2.15 Cell culture and transfection

Huh-7 cells were maintained in Dulbecco’s modified eagle medium (DMEM)

supplemented with 100 μg/mL penicillin; streptomycin, 1 % Non-essential amino

acids (MEM) and 10 % fetal bovine serum (Gibco, USA) at 37 °C with 5 % CO2.

Cells were seeded in 60mm plates and cultured until they became 50-60 %

confluent. Constructed plasmids about 1-2 μg of pEGFP-C1 (non-expressing

control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A, pEGFP-C1/NS4A, pFLAG-CMV2

(non-expressing control), pFLAG-CMV2/NS3, pFLAG-CMV2/NS3-4A &

pFLAG-CMV2/NS4A were separately transfected in 40 % confluent cells with

trans-LT1 transfection reagent. 6hrs post transfection media (with transfection

reagent and plasmid) was changed.

3.2.16 Preparation of whole cell lysate for SDS page

Whole cell lysate for SDS PAGE was prepared by washing twice with PBS 72hrs

post transfection. Cells were scraped out using scraper and poured in 1.5 mL


56

microcentrifuge tube. Further these cells were dissolved in freshly prepared 1 mL

RIPA buffer (1 M TRIS pH 7.4, 2.5M NaCl, 10 %NP40, 10 % DOC, 10 %SDS, 10

mM PMSF and proteinase inhibitor), incubated on ice for 30 mints and sonicated

6-8 times. After being sonication extracts were centrifuged at 12000 rpm for 20

mints at 4 oC, supernatants were poured in new ice chilled 1.5 mL microcentrifuge

tube and stored at -80 oC. Protein Assay kit (Bio-Rad) was used according to

manufacturer’s instructions to measure protein concentration.

3.2.17 SDS polyacrylamide gel electrophoresis

Protein was separated by SDS polyacrylamide gel electrophoresis. 8 and 10 % gels

were used for the separation of protein bands. Following recipe were followed for

the preparation of above mentioned gels (Table 3.3). After addition and mixing of

all ingredients in the tube, TEMED was added in it to allow the gel to polymerize.

Gel was poured between the assembled gel plates up to 2/3 portion.

Small amount of butan-2-ol was added on the top of the resolving gel to allow a

smooth interface on the gel. After polymerization of the gel butan-2-ol was

removed from the top of the gel and washed twice with distilled H2O. Further,

stacking gel was poured on the top of resolving gel and comb was inserted to the

gel for the preparation of wells for loading of protein samples. After

polymerization comb was carefully removed and placed the plates in the

electrophoresis tank having 1X gel running buffer. Protein samples were mixed

with 5X SDS loading buffer and boiled for 5 mints at 100 oC. 50ug of each sample

was loaded in each lane of the gel and precision plus protein standard dual color


57

was also loaded in one lane to estimate the size of loaded samples. Finally gel was

electrophoresed at 25 V for 1 hour.

Table 3.3: Composition of different SDS-PAGE gels

3.2.18 Western Blotting

For western blotting proteins bands were transferred to Hybond-C extra

nitrocellulose membrane electrophoretically using tank blotting apparatus. The gel

was removed from the tank and stacking gel discarded from the resolving gel. A

blotting sandwich was made where the gel was placed with a piece of

nitrocellulose membrane, two pieces of 3 MM Whatman paper and two fiber pads.

SDS-PAGE

S. NO Chemical Resolving 8% Resolving 10% Stacking Gel

1. 40 % Acrylamide 2.4 mL 3 mL 0.75 mL

2. 1.5 M Tris-HCl 4 mL 4 mL -

3. 1 M Tris-HCl - - 2.25 mL

4. Water 5.3 mL 4.7 mL 3 mL

5. 10 % SDS 150 μL 150 μL 75 μL

6. 10 % APS 150 μL 150 μL 75 μL

7. TEMED 5 μL 5 μL 5 μL


58

The sandwich was fixed in a cassette and was placed into the transblot apparatus

and filled the tank with transfer buffer (Tris glycine buffer). Electrotransfer was

carried out at 100 mA for 1:30 hrs or 25 mA at 4 ºC overnight.

After successfully transferred, blot was blocked with 5 % skimmed milk for 1 hr

at room temperature followed by one washed with TBS-T buffer (0.05 % Tween

20). Further, blots were incubated with appropriate primary antibodies (1:1000)

overnight at 4 oC. After being washing three times with TBS-T buffer blot was

incubated with particular horseradish peroxidase (HRP) labeled secondary

antibodies (1:10000) at room temperature for 1 hr. After being washed three times

with TBS-T buffer, the membrane were incubated with chemiluminescent HRP

substrate for 1 minute at room temperature to visualized the positive bands using

Kodak image station (Digital science, 440) according to the manufacturer’s

instructions.

3.2.19 Immunofluorescence Microscopy

The cells expressing NS3, NS3-4A and NS4A proteins were grown on glass cover

slips. After removal of medium from plates cells were fixed with 4 %

paraformaldehyde for 10 mints at room temperature. After fixation cells were

washed five time using 1 X PBS. MitoTracker CMXRos Red was used to stain

mitochondria in live cells for 10 mints before fixation. Next, cells were blocked

with blocking buffer (3 % BSA, 5 % Goat serum, 0.05 % Triton X-100) for 1 hr at

room temperature. After blocking cells were incubated with particular primary

antibodies (1:1000) overnight at 4 oC. Further, cells were washed thrice with PBS


59

and then incubated with particular Alexa flour secondary antibodies (1:10000) in

the dark. After secondary antibody incubation cells were washed thrice with PBS.

Further, nuclei were stained with DAPI. Images were visualized under a 100X oil

objective using an Olympus FluoView 1000 confocal microscope. Quantification

of images was conducted with ImageJ or MBF ImageJ softwares.

3.2.20 Crystal violet cell viability assay

The effect of cell viability was determined by measuring crystal violet dye

absorbance of living cells. Briefly, cells were transfected with pEGFP-C1 (empty

vector/ non-expressing control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A, pEGFP-

C1/NS4A, pFLAG-CMV2 (empty vector/ non-expressing control), pFLAG-CMV2

/NS3, pFLAG-CMV2 /NS3-4A and pFLAG-CMV2 /NS4A recombinant vectors in

three different sets of experiments. 72 hrs post transfections cells were treated with

crystal violet dye, stabilized with 33 % acetic acid and fixed with 4 %

paraformaldehyde. Optical density was measured at wave length 595 nm using

premium biotech visible spectrophotometer ultra-spec 1000.

3.2.21 Subcellular Fractionation

For the isolation and separation of mitochondrial and cytosolic fractions from

experimental cells, Huh-7 cells were transfected with pEGFP-C1 (non-expressing

control/ empty vector), pEGFP-C1/NS3, pEGFP-C1/NS3-4A and pEGFP-

C1/NS4A. 3 days post-transfection, cells were scraped and pure cytosolic and

mitochondrial fractions were isolated using mitochondrial isolation kit for cultured

cells according to the manufacturer’s instructions. Briefly, 800 μL Reagent A were

added in the homogenized cells and incubated on ice for 2 mints. Next, cells were


60

dounce homogenized then mixed with 800 μL Reagent C and centrifuged at 700 g

for 10 mints at 4 oC. Supernatant were collected in fresh 1.5 mL microcentrifuge

tube and again centrifuged at 12,000 g for 15 mints at 4 oC. Supernatant were

removed and pellet (mitochondria) were washed with 500 μL Reagent C and

centrifuged at 12,000 g for 5 mints at 4 oC. Supernatant (Cytosolic fraction) were

collected in new tube while pellet (mitochondrial fraction) were resuspended in TE

buffer. Equivalent amounts of protein from each fraction were analyzed by

Western blotting with the indicated primary and secondary antibodies.

3.2.22 Mitochondrial Superoxide Estimation

Huh-7 cells were seeded on glass cover slips and transfected with pEGFP-C1 (non-

expressing control/ empty vector), pEGFP-C1/NS3, pEGFP-C1/NS3-4A and

pEGFP-C1/NS4A for the estimation of mitochondrial superoxide (byproduct of

oxidative phosphorylation of complexes I and III of the electron transport chain).

72 hrs post transfection cell were washed with PBS and stained with MitoSOX™

Red mitochondrial superoxide indicator 10 µM for 10 min at 37 oC. After being

fixed with 4 % paraformaldehyde, superoxide production was estimated at 100X

oil under florescence microscope (Olympus).

3.2.23 Measurement of Mitochondrial Complex I Enzyme Activity

The activity of mitochondrial oxidative phosphorylation respiratory chain complex

I (NADH dehydrogenase) in NS3, NS3-4A and NS4A expressing cells were

measured by using mitochondrial complex I activity assay kit according to the


61

manufacturer’s instructions. Briefly, Huh-7 cells were transfected with pFLAG-

CMV2 (non-expressing control/ empty vector), pFLAG-CMV2 /NS3, pFLAG-

CMV2 /NS3-4A and pFLAG-CMV2 /NS4A. Huh-7 cells were used as negative

control (mock) while Huh-7 cells infected with HCVcc used as positive control.

Cells were harvested 72 hrs post transfection and processed for further

experimentation.

3.2.24 Hoechst Staining

Cells were seeded on glass cover slips and transfected with pEGFP-C1 (non-

expressing control/ empty vector), pEGFP-C1/NS3, pEGFP-C1/NS3-4A and

pEGFP-C1/NS4A. At various time points (24hrs, 48hrs and 72hrs) cells were fixed

using 4 % paraformaldehyde, washed five times with PBS and stained with 10mM

Hoechst 33342 at room temperature for 10 min. After incubation cells were gently

washed and mounted. The morphology of the nuclei of the cells was examined at

100 X oil under florescence microscope (Olympus).

3.2.25 Statistical analysis

To analyze the significance of numerical data, Student’s t-test was performed by

using Graph Pad Prism version 5.0 (GraphPad Software, Inc., CA, USA). Data are

presented as mean ± standard error of the mean. p-values < 0.05 were considered

statistically significant (p < 0.05, p < 0.01 and p < 0.001).

Results

Chapter 4 Results

62

RESULTS

4.1 Amplification and construction of recombinant vectors

Genes for HCV non-structural proteins NS3, NS3-4A and NS4A were successfully amplified

from cDNA clone of HCV genotypes 3a (pS52 strain) using two different sets of primers for

each gene i.e. one set of primers for pEGFP-C1 clones and other set of primers for pFLAG-

CMV2 clones. Positive clones were confirmed by restriction digestion analysis. Figure 4.1(A &

B) shows the double digestion of positive clones of pEGFP-C1 /NS3 containing NS3 (1.9 kb),

pEGFP-C1 /NS3-4A containing NS3-4A (2.1kb) and pEGFP-C1/NS4A containing NS4A (165

bp), while figure 4.2(A & B) shows the double digestion of positive clones of pFLAG-CMV2

/NS3 containing NS3 (1.9 kb), pFLAG-CMV2 /NS3-4A containing NS3-4A (2.1 kb) and

pFLAG-CMV2 /NS4A containing NS4A (165 bp).

Maps of above mentioned recombinant vectors are shown in Figure 4.3 (A & B).

Chapter 4 Results

63

Figure 4.1: 1% agarose gel electrophoresis shows the results of double digestion of recombinant

pEGFP-C1 vectors. (A) Lane 1 refer to 1 kb ladder, lane 2 refers to undigested recombinant

vector (pEGFP-C1/NS3), lane 3 refer to digested vector (4.7 kb) releasing NS3 (1.9 kb) gene,

lane 4 refer to undigested recombinant vector (pEGFP-C1/NS3-4A) while, lane 5 refer to

digested vector (4.7 kb) releasing NS3-4A (2.1 kb) gene. (B) Lane 1 refer to undigested

recombinant vector (pEGFP-C1/NS4A), lane 2 refer to digested vector (4.7 kb) releasing NS4A

(165 bp) gene while, lane 3 refer to 1 kb ladder.

(A) (B)

Chapter 4 Results

64

Figure 4.2: 1% agarose gel electrophoresis shows the results of double digestion of recombinant

pFLAG-CMV2 vectors. (A) Lane 1 refer to 1 kb ladder, lane 2 refer to digested vector (4.7 kb)

releasing NS3 (1.9 kb) gene, lane 3 refers to undigested recombinant vector (pFLAG-

CMV2/NS3), lane 4 refer to digested vector (4.7 kb) releasing NS3-4A (2.1 kb) gene while, lane

5 refer to undigested recombinant vector (pFLAG-CMV2/NS3-4A). (B) Lane 1 refer to 1 kb

ladder, lane 2 refer to undigested recombinant vector (pFLAG-CMV2/NS4A), while, lane 3 refer

to digested vector (4.7 kb) releasing NS4A (165 bp) gene.

(A) (B)

Chapter 4 Results

65

Figure 4.3 (A): Maps of recombinant pEGFP-C1 constructs. pEGFP-C1/NS4A vector

containing HCV NS3-4A gene, pEGFP-C1/NS3 vector containing HCV NS3 gene while

pEGFP-C1/NS4A vector containing HCV NS4A gene.

Figure 4.3 (B): Maps of recombinant pFLAG-CMV2 constructs. pFLAF-CMV2/NS3-4A

vector containing HCV NS3-4A gene, PFLAG-CMV2/NS3 vector containing HCV NS3 gene

while pFLAG-CMV2/NS4A vector containing HCV NS4A gene.

(A)

(B)

Chapter 4 Results

66

4.2 Sequencing of GFP-tagged recombinant vectors

Positive clones of pEGFP-C1/NS3, pEGFP-C1/NS3-4A & pEGFP-C1/NS4A were confirmed by

commercial sequencing (Eton Biosciences, USA) from both directions using forward and reverse

primers. Figure 4.4 depicts the representative chromatogram and sequence homology of HCV

non-structural NS3 gene with reported sequences. Figure 4.5 shows the representative

chromatogram and sequence homology of HCV non-structural NS3-4A gene with reported

sequences while; Figure 4.6 is showing the representative chromatogram and sequence

homology of HCV non-structural NS4A gene with reported sequences.

Chapter 4 Results

67

Figure 4.4: Representative chromatograms and sequence homology of HCV non-structural NS3

gene with reported sequences.

Chapter 4 Results

68

Figure 4.5: Representative chromatograms and sequence homology of HCV non-structural NS3-

4A gene with reported sequences.

Chapter 4 Results

69

Figure 4.6: Representative chromatograms and sequence homology of HCV non-structural

NS4A gene with reported sequences.

Chapter 4 Results

70

4.3 Sequencing of FLAG-tagged recombinant vectors

Positive clones of pFLAG-CMV2/NS3, pFLAG-CMV2/NS3-4A, pFLAG-CMV2/NS4A were

confirmed by commercial sequencing from both directions using forward and reverse primers.

Figure 4.7 depicts the representative chromatogram and sequence homology of HCV non-

structural NS3 gene with reported sequences. Figure 4.8 shows the representative chromatogram

and sequence homology of HCV non-structural NS3-4A gene with reported sequences while;

Figure 4.9 is showing the representative chromatogram and sequence homology of HCV non-

structural NS4A gene with reported sequences.

Chapter 4 Results

71

Figure 4.7: Representative chromatograms and sequence homology of HCV non-structural NS3

gene with reported sequences.

Chapter 4 Results

72

Figure 4.8: Representative chromatograms and sequence homology of HCV non-structural NS3-

4A gene with reported sequences.

Chapter 4 Results

73

Figure 4.9: Representative chromatograms and sequence homology of HCV non-structural

NS4A gene with reported sequences.

Chapter 4 Results

74

4.4 Western blot analysis of FLAG-tagged HCV non-structural NS3, NS3-4A and NS4A

proteins

Transient expression of FLAG-tagged HCV non-structural NS3, NS3-4A and NS4A proteins

were analyzed by western blotting. Cell lysates were harvested 72 hrs post transfection using

RIPA buffer and were analyzed with anti-FLAG antibody. Figure 4.10 (A) shows no band (non-

expressing control) in lane 1 while specific band of 7 kDa representing the fusion complex of

FLAG with NS4A protein in lane 2. On the other hand figure 4.10 (B) shows specific band of 72

kDa representing the fusion complex of FLAG with NS3 protein in lane 1 while specific band of

72 kDa representing fusion complex of FLAG with NS3-4A protein in lane 2. Internal loading

control β-actin was used.

Chapter 4 Results

75

Figure 4.10: Western blot analyses of pFLAG-CMV2/NS3, pFLAG-CMV2/NS3-4A,

pFLAG-CMV2/NS4A vectors expressing HCV non-structural NS3, NS3-4A and NS4A

proteins. (A) Lane 2 Shows specific band of 7 kDa representing the fusion complex of FLAG

with NS4A protein. (B) Lane 1 shows specific band of 72 kDa representing the fusion complex

of FLAG with NS3 protein, while lane 2 shows specific band of 72 kDa representing fusion

complex of FLAG with NS3-4A protein. β-actin was used as an internal loading control.

(A) (B)

(A)

Lane 1: Empty vector

Lane 2: NS4A-FLAG

(B)

Lane 1: NS3-FLAG

Lane 2: NS3-4A-FLAG

Chapter 4 Results

76

4.5 Western blot analysis of GFP-tagged HCV non-structural NS3, NS3-4A and NS4A

proteins

Transient expression of GFP-tagged HCV non-structural NS3, NS3-4A and NS4A proteins were

analyzed by western blotting. Cell lysates were harvested 72 hrs post transfection using RIPA

buffer and were analyzed with anti-GFP antibody. Figure 4.11 shows specific band of 27 kDa

representing GFP protein in lane 1, 33 kDa representing the fusion complex of GFP with NS4A

protein in lane 2, 98 kDa representing fusion complex of GFP with NS3 in lane 3 while specific

band of 98k Da representing the fusion complex of GFP with NS3-4A protein in lane 4. β-actin

was used as internal loading control.

Chapter 4 Results

77

Figure 4.11: Western blot analysis of pEGFP-C1/NS3, pEGFP-C1/NS3-4A & pEGFP-

C1/NS4A vectors expressing HCV non-structural NS3, NS3-4A and NS4A proteins. Specific

band of 27 kDa representing GFP protein in lane 1, 33 kDa representing the fusion complex of

GFP with HCV non-structural NS4A protein in lane 2, 98 kDa representing fusion complex of

GFP with HCV non-structural NS3 protein in lane 3 while, specific band of 98 kDa representing

the fusion complex of GFP with HCV non-structural NS3-4A protein in lane 4. β-actin was used

as internal loading control.


Lane 2: NS4A-GFP

Lane 1: NS3-GFP

Lane 2: NS3-4A-GFP

Chapter 4 Results

78

4.6 Immunofluorescence analysis of GFP tagged recombinant vectors

To determine the GFP tagged HCV non-structural NS3, NS3-4A and NS4A protein expression

transiently, cells were fixed 48 hours post transfection on glass coverslips, mounted with DAPI

containing ProLong® Gold Antifade Reagent to stain the nuclei and observed under fluorescence

microscope. Figure 4.12 (A), depicts the transfected GFP tagged pEGFP-C1 (non-expressing

control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A and pEGFP-C1/NS4A vectors containing NS3,

NS3-4A and NS4A proteins expressing Huh-7 cells in green, while nuclei counterstained with

DAPI in blue. Figure 4.12 (B) depicts the graphical representation of transfection efficacy of

GFP tagged expressing cells in percentage, pEGFP-C1 (non-expressing control) shows 59 %

transfection, pEGFP-C1/NS3 containing NS3 protein shows 46%, pEGFP-C1/NS3-4A

containing NS3-4A protein shows 45 % while pEGFP-C1/NS4A containing NS4A protein shows

55 % transfection.

Chapter 4 Results

79

Figure 4.12 (A): Immunofluorescence analysis of pEGFP-C1/NS3, pEGFP-C1/NS3-4A &

pEGFP-C1/NS4A vectors expressing HCV non-structural NS3, NS3-4A and NS4A proteins.

Huh-7 cells transiently expressing pEGFP-C1 (non-expressing control), pEGFP-C1/NS3,

pEGFP-C1/NS3-4A and pEGFP-C1/NS4A vectors containing HCV non-structural NS3, NS3-4A

and NS4A proteins (left panel) were stained with DAPI (middle panel) to stain nuclei. Overlaid

pictures (right panel) showing transfected and untransfected cells.

(A)

Chapter 4 Results

80

Figure 4.12 (B): Graphical representation of pEGFP-C1/NS3, pEGFP-C1/NS3-4A &

pEGFP-C1/NS4A vectors expressing HCV non-structural NS3, NS3-4A and NS4A proteins.

pEGFP-C1 (non-expressing control) shows 59 % transfection efficiency, NS3/GFP shows 46 %,

NS3-4A/GFP shows 45 % while NS4A/GFP shows 55 % transfection efficiency.

(B)

Chapter 4 Results

81

4.7 Immunofluorescence analysis of FLAG tagged recombinant vectors

FLAG tagged HCV non-structural NS3, NS3-4A and NS4A expression transiently, cells were

fixed 48hours post transfection on glass coverslips, incubated first with anti-FLAG antibody

mouse and second with Alexa Fluor 488 anti-mouse (green) antibody and then mounted with

ProLong® Gold Antifade Reagent with DAPI to stain the nuclei and observed under

fluorescence microscope. Figure 4.13 (A) depicts the transfected FLAG tagged pFLAG-CMV2

(non-expressing control), pFLAG-CMV2 /NS3, pFLAG-CMV2 /NS3-4A, pFLAG-CMV2

/NS4A vectors containing HCV non-structural NS3, NS3-4A and NS4A proteins expressing

Huh-7 cells in green and nuclei counterstained with DAPI in blue. Figure 4.13 (B) depict the

graphical representation of transfection efficacy of FLAG tagged expressing Huh-7 cells in

percentage, pFLAG-CMV2 (non-expressing control) shows 58 % transfection, pFLAG-CMV2

/NS3 containing NS3 protein shows 48 %, pFLAG-CMV2 /NS3-4A containing NS3-4A protein

50 % while pFLAG-CMV2 /NS4A containing NS4A protein shows 49 % transfection.

Chapter 4 Results

82

Figure 4.13 (A): Immunofluorescence analysis of pFLAG-CMV2/NS3, pFLAG-CMV2/NS3-4A,

pFLAG-CMV2/NS4A vectors containing HCV non-structural NS3, NS3-4A and NS4A

proteins. Huh-7 cells transiently expressing pFLAG-CMV2 (non-expressing control), pFLAG-

CMV2 /NS3, pFLAG-CMV2 /NS3-4A and pFLAG-CMV2 /NS4A vectors containing HCV non-

structural NS3, NS3-4A and NS4A proteins (left panel) were incubated first with anti-flag mouse

antibody and second with Alexa Fluor 488 anti-mouse antibody (left panel) and counter stained

with DAPI (middle panel) to stain nuclei. Overlaid pictures (right panel) showing transfected and

untransfected cells.

(A)

Chapter 4 Results

83

Figure 4.13 (B): Graphical representation of pFLAG-CMV2/NS3, pFLAG-CMV2/NS3-4A,

pFLAG-CMV2/NS4A vectors expressing HCV non-structural NS3, NS3-4A and NS4A

proteins. pFLAG-CMV2 (non-expressing control) shows 58 % transfection efficiency,

NS3/FLAG containing NS3 protein shows 48 %, NS3-4A/FLAG containing NS3-4A protein

shows 50 % while NS4A/FLAG containing NS4A protein shows 49 % transfection efficiency.

a)

(B)

Chapter 4 Results

84

4.8 HCV non-structural NS3-4A and NS4A proteins induces cell death

One of the most common application of crystal violet dye use is to determine the maximum cell

viability by checking the absorbance of the dye taken up by the cells (Gillies, Didier et al., 1986;

Shaik, Chatterjee et al., 2004; Thomas, Finnegan et al., 2004). To check the cell viability in

pEGFP-C1 (non-expressing control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A, pEGFP-C1/NS4A

vectors containing HCV non-structural NS3, NS3-4A and NS4A proteins. Huh-7 cells

transfected in three sets of experiments were used for each vectors and cell viability was

determined by measuring crystal violet dye absorbance of living cells. pEGFP-C1 (non-

expressing control) shows 100 % cell viability, pEGFP-C1/NS3 containing NS3 protein shows

65 %, pEGFP-C1/NS3-4A containing NS3-4A protein shows 45 % and pEGFP-C1/NS4A

containing NS4A protein shows 46 % cell viability (Fig.4.14 B). These results depict maximum

cell death in NS3-4A and NS4A expressing Huh-7 cells (Fig. 4.14 A).

Chapter 4 Results

85

Figure 4.14: Cell death induced by HCV non-structural NS3-4A and NS4A proteins. Huh-7

cells transiently expressing pEGFP- C1 (empty vector/ non-expressing control), pEGFP-C1/NS3,

pEGFP-C1/NS3-4A, pEGFP-C1/NS4A vectors containing HCV non-structural NS3, NS3-4A

and NS4A proteins were examined for cell viability by crystal violet cell viability assay. (A)

Huh-7 cells transfected with above mentioned vectors stained with crystal violet dye which

clearly showing the cell death in HCV non-structural NS3-4A and NS4A proteins expressing

(A)

(B)

Chapter 4 Results

86

cells. (B) Graphical representation of cell viability of vectors-harbouring cells. P values were

calculated by using an unpaired Student’s t-test (mean ± SEM; n=03; ***p<0.001, **p<0.01).

While pFLAG-CMV2 (non-expressing control), pFLAG-CMV2 /NS3, pFLAG-CMV2 /NS3-4A

and pFLAG-CMV2 /NS4A vectors containing NS3, NS3-4A and NS4A proteins were also used

to check the cell viability. Huh-7 cells transfected in three sets of experiments were used for each

vectors. pFLAG-CMV2 (non-expressing control) shows 100 % cell viability, pFLAG-CMV2

/NS3 containing NS3 protein shows 62 %, pFLAG-CMV2 /NS3-4A containing NS3-4A protein

shows 45 % and pFLAG-CMV2 /NS4A containing NS4A protein shows only 48 % viability

(Fig.4.15 B). These results depict maximum cell death in HCV non-structural NS3-4A and NS4A

proteins expressing Huh-7 cells (Fig. 4.15 A).

Chapter 4 Results

87

Figure 4.15: Cell death induced by HCV non-structural NS3-4A and NS4A proteins. Huh-7

cells expressing pFLAG-CMV2 (non-expressing control), pFLAG-CMV2 /NS3, pFLAG-CMV2

/NS3-4A, pFLAG-CMV2/NS4A vectors containing HCV non-structural NS3, NS3-4A and

NS4A proteins were examined for cell viability by crystal violet cell viability assay. (A) Huh-7

cells transfected with above mentioned vectors stained with crystal violet dye which clearly

showing the cell death in HCV non-structural NS3-4A and NS4A proteins expressing cells. (B)

(A)

(B)

Chapter 4 Results

88

Graphical representation of cell viability of vectors-harbouring cells. P values were calculated by

using an unpaired Student’s t-test (mean ± SEM; n=03; ***p<0.001, **p<0.01).

4.9 Intracellular localizations of HCV non-structural NS3, NS3-4A and NS4A proteins

We examined the intracellular localization of HCV non-structural NS3, NS3-4A and NS4A

proteins to endoplasmic reticulum and mitochondria. GFP tagged pEGFP-C1 (non-expressing

control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A and pEGFP-C1/NS4A vectors containing NS3,

NS3-4A and NS4A proteins were used to observe localization. KDEL antibody was used to stain

Endoplasmic reticulum while MitoTracker CMXRos Red was used to stain mitochondria in live

cells. Confocal immunofluorescence microscopic analysis showed that all HCV non-structural

NS3, NS3-4A and NS4A proteins were localized on endoplasmic reticulum (Fig.4.16). While in

the case of Mitochondria, only HCV non-structural NS3-4A complex and NS4A proteins shown

significance localization to the perinuclear region (Fig.4.17). These analyses suggest that HCV

non-structural NS4A protein alone or in complex with NS3 induces mitochondrial perinuclear

clustering.

Chapter 4 Results

89

Figure 4.16: Intracellular localizations of HCV non-structural NS3, NS3-4A and NS4A

proteins on endoplasmic reticulum. Huh-7 cells transiently expressing pEGFP- C1 (empty

vector/ non-expressing control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A, pEGFP-C1/NS4A vectors

containing HCV non-structural NS3, NS3-4A and NS4A proteins (left panel) were stained with

KDEL-ER marker primary antibody (middle panel). Overlaid pictures show in the (right panel).

Yellow color in the overlaid pictures showing that HCV non-structural NS3, NS3-4A & NS4A

localized on endoplasmic reticulum.

Chapter 4 Results

90

Figure 4.17: Intracellular localizations of HCV non-structural NS3, NS3-4A and NS4A

proteins on mitochondria. Huh-7 cells transiently expressing pEGFP- C1 (empty vector/ non-

expressing control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A, pEGFP-C1/NS4A vectors containing

HCV non-structural NS3, NS3-4A and NS4A proteins (left panel) were stained with mitotracker

(CMXROS) to stain mitochondria (middle panel). Overlaid pictures are shows in the (right

panel). Yellow color in the overlaid pictures showing that HCV non-structural NS3-4A & NS4A

localized on mitochondria.

Chapter 4 Results

91

4.10 HCV non-structural NS3-4A and NS4A proteins induces mitochondrial

fragmentation/ fission

To examine the induced mitochondrial dynamics changes in HCV non-structural NS3-4A, NS4A

proteins expressing Huh-7 cells, transfected cells were stained with membrane potential

dependent mitotracker-Red. The mitochondria network was severely damaged in pEGFP/NS3-

4A and pEGFP/NS4A expressing cells, while in pEGFP-C1 (non-expressing control) and

pEGFP/NS3 expressing cells shows filamented mitochondria with no damage (Fig. 4.18A).

Graphical representation of percentage of fragmented mitochondria shows almost 82 %

fragmented mitochondria in pEGFP/NS4A containing NSA protein expressing cells, 78 % in

pEGFP/NS3-4A containing NS3-4A protein expressing cells, while 4 % in pEGFP/NS3

containing NS3 protein expressing cells and 1 % in pEGFP-C1 (non-expressing control) (Fig.

4.18 B). Hence these results collectively suggest that HCV non-structural NS4A protein alone

and in complex (NS3-4A) localized into mitochondria and disrupt its morphology.

Chapter 4 Results

92

Figure 4.18 (A): HCV non-structural NS3-4A and NS4A proteins induce mitochondrial

fragmentation. Huh-7 cells transiently expressing pEGFP- C1 (empty vector/ non-expressing

control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A, pEGFP-C1/NS4A vectors containing HCV non-

structural NS3, NS3-4A and NS4A proteins (middle panel) were stained with mitotracker

(CMXROS) to stain mitochondria (right panel). Overlaid pictures are showing in the (left panel).

HCV non-structural NS3-4A & NS4A proteins expressing cells (right panel) clearly shows the

mitochondrial fragmentation. Areas marked with green boxes were enlarged (zoom-in).

Chapter 4 Results

93

Figure 4.18 (B): Graphical representation of HCV non-structural NS3-4A and NS4A

proteins induces mitochondrial fragmentation. Cells with fragmented mitochondria were

counted randomly. P values were calculated by using an unpaired Student’s t-test (mean ± SEM;

n=03; ***p<0.001, *p<0.05).

(B)

Chapter 4 Results

94

4.11 BAX translocation and Bcl-XL regulation in HCV non-structural NS3-4A and NS4A

proteins expressing Huh-7 cells

BAX is multidomain protein of Bcl-2 family a pro-apoptotic protein and essential for all events

of apoptosis via the intrinsic pathway (Oltvai, Milliman et al., 1993; Wei, Zong et al., 2001).

Normally BAX is expressed in an inactive state in the cytosol and in response to apoptotic

stimuli, conformational alterations regulates its activation and ultimately translocate the BAX

towards mitochondria (Crow, Mani et al., 2004). While Bcl-XL is an anti-apoptotic protein,

mostly localize to the outer membrane of mitochondria and inhibit the cytochrome c release to

the cytosol (Krajewski, Tanaka et al., 1993; Kluck, Bossy-Wetzel et al., 1997).

GFP tagged pEGFP-C1 (non-expressing control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A and

pEGFP-C1/NS4A vectors containing HCV non-structural NS3, NS3-4A and NS4A proteins were

transfected to analyze the BAX translocation. Confocal immunofluorescence analysis shows the

maximum BAX protein translocation towards mitochondria in HCV non-structural NS3-4A and

NS4A expressing cells, while NS3 and pEGFP-C1 (non-expressing control) shows negligible

translocation (Fig. 4.19A). Immunoblotting technique was used to analyze the expression levels

of BAX and Bcl-XL proteins were analyzed using anti-BAX and anti-Bcl-XL antibodies.

Transfection of Huh-7 cells were done with pEGFP-C1 (non-expressing control), pEGFP-

C1/NS3, pEGFP-C1/NS3-4A and pEGFP-C1/NS4A vectors containing HCV non-structural NS3,

NS3-4A and NS4A proteins, cells treated with staurosporine served as positive control, while

Huh-7 cells serve as mock. BAX protein expression were observed up regulated in positive

control huh-7 cells, HCV non-structural NS3-4A and NS4A proteins expressing cells, while

down regulated in mock cells, pEGFP-C1 (non-expressing control) and in pEGFP-C1/NS3

containing HCV non-structural NS3 protein expressing cells (Fig. 4.19 B). In the case of Bcl-XL

Chapter 4 Results

95

protein expression, down regulated expression were observed in positive control Huh-7 cells,

pEGFP-C1/NS3-4A containing HCV non-structural NS3-4A and in pEGFP-C1/NS4A containing

HCV non-structural NS4A protein expressing cells, while up regulated expression was observed

in mock cells, pEGFP-C1 (non-expressing control) and in pEGFP-C1/NS3 containing HCV non-

structural NS3 protein expressing cells (Fig. 4.19 C). These results overall demonstrate that HCV

non-structural protein NS3-4A, NS4A containing Huh-7 expressing cells and positive control

shown down regulated expression of Bcl-XL protein which is anti-apoptotic in nature while

shown up regulated expression of BAX protein which is pro-apoptotic in nature hence, HCV

non-structural protein NS4A alone and in complex with NS3 (NS3-4A) accumulate on

mitochondria that disturb the mitochondrial dynamics and ultimately up and down regulate the

expression of anti and pro-apoptotic proteins.

Chapter 4 Results

96

Figure 4.19 (A): HCV non-structural NS3-4A and NS4A induces BAX translocation to

mitochondria. Huh-7 cells transiently expressing pEGFP- C1 (empty vector/ non-expressing

control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A, pEGFP-C1/NS4A vectors containing HCV non-

structural NS3, NS3-4A and NS4A proteins (left panel) were incubate with BAX primary

antibody rabbit (second left panel) and were stained with mitotracker (CMXROS) to stain

mitochondria (second right panel). Yellow color in the overlaid pictures (right panel) showing

that in HCV non-structural NS3-4A & NS4A proteins expressing cells, BAX protein induces

translocation to mitochondria.

Chapter 4 Results

97

Figure 4.19 (B-C): Western blot analysis of pro-apoptotic BAX protein and Bcl-XL protein.

Blot was probed with anti-BAX antibody and up regulated expression was observed in positive

control (Huh-7 cells treated with Staurosporine), pEGFP-C1/NS3-4A vector expressing HCV

non-structural NS3-4A protein & in pEGFP-C1/NS4A vector expressing HCV non-structural

NS4A protein. β-actin was used as an internal loading control. (C) Western blot analysis of anti-

apoptotic Bcl-XL protein. Blot was probed with anti-Bcl-XL antibody and down regulated

expression observed in positive control (huh-7 cells treated with Staurosporine), pEGFP-

C1/NS3-4A vector expressing HCV non-structural NS3-4A protein & in pEGFP-C1/NS4A

vector expressing HCV non-structural NS4A protein. β-actin was used as an internal loading

control.

(B)

Lane 1: + control

Lane 2: Mock


Lane 4: NS3-GFP

Lane 5: NS3-4A-GFP

Lane 6: NS4A-GFP

(C)

Lane 1: Mock

Lane 2: + control


Lane 4: NS3-GFP

Lane 5: NS3-4A-GFP

Lane 6: NS4A-GFP

Chapter 4 Results

98

4.12 HCV non-structural NS3-4A and NS4A proteins increased mitochondrial superoxide

generation in Huh-7 cells

Oxidative phosphorylation of complexes I and III of electron transport chain produce

mitochondrial superoxide as byproduct (Liu, Fiskum et al., 2002; Kudin, Bimpong-Buta et al.,

2004). In the presence of viral proteins or other environmental stress ROS level become

increases dramatically. For detection of superoxide in the mitochondria of live cells a

MitoSOX™ Red mitochondrial superoxide indicator a fluorogenic dye with highly selective

detection was used. To estimate the mitochondrial superoxide generation in GFP tagged pEGFP-

C1 (non-expressing control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A and pEGFP-C1/NS4A

vectors containing NS3, NS3-4A and NS4A proteins expressing cells, 72 hrs post transfection

cells were stained with MitoSOX™ Red dye. Immunofluorescence images show highly

increased superoxide generation in pEGFP-C1/NS3-4A and pEGFP-C1/NS4A vectors expressing

HCV non-structural NS3-4A and NS4A proteins expressing cells and almost none in pEGFP-C1

(non-expressing control) and pEGFP-C1/NS3 containing HCV non-structural NS3 protein

expressing cells (Fig. 4.20 A). Figure 4.20 B depicts the graphical representation of percentage of

superoxidation in mitochondria, in which pEGFP-C1/NS4A containing HCV non-structural

NS4A proteins expressing cells shows 84 % superoxide generation, pEGFP-C1/NS3-4A

containing HCV non-structural NS3-4A protein shows 79 %, pEGFP-C1/NS3 containing HCV

non-structural NS3 protein shows 4 % and pEGFP-C1 (non-expressing control) shows 3 %

generation.

Chapter 4 Results

99

Figure 4.20 (A): HCV non-structural NS3-4A and NS4A proteins induced the

mitochondrial superoxide generation. Huh-7 cells transiently expressing pEGFP- C1 (empty

vector/ non-expressing control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A, pEGFP-C1/NS4A vectors

containing HCV non-structural NS3, NS3-4A and NS4A proteins (left panel) were stained with

MitoSOX™ Red mitochondrial superoxide (right panel). Overlaid pictures show in the (middle)

panel. Right panel pictures showing that HCV non-structural NS3-4A & NS4A proteins

expressing cells generate high amount of superoxide species.

Chapter 4 Results

100

Figure 4.20 (B): Graphical representation of HCV non-structural NS3-4A and NS4A

proteins increased the mitochondrial superoxide generation. Cells with increased level of

superoxide generation were counted randomly. P values were calculated by using an unpaired

Student’s t-test (mean ± SEM; n=03; ***p<0.001).

(B)

Chapter 4 Results

101

4.13 Cytochrome c translocation in HCV non-structural NS3-4A and NS4A proteins

expressing Huh-7 cells

During mitochondrial mediated apoptosis outer membrane permeabilization allowed cytochrome

c release to cytosol (Goldstein, Waterhouse et al., 2000). To assess the cytochrome c

translocation, Huh-7 cells were transfected with pEGFP-C1 (non-expressing control), pEGFP-


NS3-4A and NS4A proteins, cells treated with staurosporine served as positive control, while

Huh-7 cells serve as mock. Immunoblot analysis of mitochondrial fractions shows down

regulated expression in positive control, NS3-4A and NS4A expressing cells and up regulated in

mock, pEGFP-C1 (non-expressing control) and in HCV non-structural NS3 protein expressing

cells (Fig. 4.21 A), while cytosolic fraction shows up regulated expression in positive control,

NS3-4A and NS4A expressing cells and down regulated in mock, pEGFP-C1 (non-expressing

control) and in NS3 expressing cells (Fig.4.21 B). These results collectively represented the

mitochondrial membrane damage and increase in membrane permeability.

Chapter 4 Results

102

Figure 4.21: Cytochrome c translocation in HCV non-structural NS4A and NS3-4A

proteins expressing cells. Huh-7 cells were transfected with pEGFP-C1 (non-expressing

control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A and pEGFP-C1/NS4A vectors containing HCV

non-structural NS3, NS3-4A and NS4A proteins. Huh-7 cells treated with staurosporine served as

positive control, while only Huh-7 cells serve as mock. (A) Down regulated expression was

observed in mitochondrial fractions in positive control (treated with Staurosporine), pEGFP-

C1/NS3-4A & pEGFP-C1/NS4A vectors containing HCV non-structural NS3-4A and NS4A

proteins expressing Huh-7 cells. β-actin was used as an internal loading control. (B) Up regulated

expression was observed in cytosolic fractions in positive control (Huh-7 cells treated with

Staurosporine), pEGFP-C1/NS3-4A & pEGFP-C1/NS4A vectors containing HCV non-structural

NS3-4A and NS4A proteins expressing huh-7 cells. β-actin was used as an internal loading

control.

(A & B)

Lane 1: Mock

Lane 2: + control


Lane 4: NS3-GFP

Lane 5: NS3-4A-GFP

Lane 6: NS4A-GFP

Chapter 4 Results

103

4.14 Effect of HCV non-structural NS3-4A and NS4A proteins on the mitochondrial

oxidative phosphorylation system

Previous studies show that HCV infection affects the oxidative phosphorylation (Piccoli, Scrima

et al., 2007; Kim, Syed et al., 2013). Hence, we designed an experiment to compare the effects

of OXPHOS Complex I activity between whole HCV genome and individual HCV non-

structural proteins i.e. NS3, NS4A and NS3-4A. Huh-7 cells infected with HCVcc for 3 days

while only Huh-7 cells serve as mock. Graphical representation shows the percentage activity of

OXPHOS Complex I in Transfection of Huh-7 cells was done with pFLAG-CMV2 /NS3,

pFLAG-CMV2 /NS3-4A, pFLAG-CMV2 /NS4A vectors containing HCV non-structural

proteins and pFLAG-CMV2 vector serve as (non-expressing control). 72 hrs post transfection

cells were harvested and mitochondrial I enzyme activity was analyzed as per manufacturer’s

instruction. NS3-4A protein expressing cells shows total 16 % reduction, NS4A protein

expressing cells shows 19 % reduction while NS3 protein expressing cells shows only 15 %

reduction (Fig.4.22 B). Expression levels of HCV non-structural NS3, NS3-4A and NS4A

proteins used in assay were confirmed by immunoblotting (Fig.4.22 C). From these results we

inferred that HCV non-structural NS3, NS3-4A, NS4A proteins individually and HCVcc leads to

overall 15-20 % reduction of OXPHOS Complex I activity as compared to mock.

Chapter 4 Results

104

Figure 4.22 (A): Graphical representation of OXPHOS Complex I activity between whole

HCV genome (HCVcc) and Huh-7 cells (mock). Huh-7 cells infected with HCVcc and

harvested 3 days post infection while only Huh-7 cells used as mock. Activity of mitochondrial I

enzyme was measured according to manufacturer’s instruction. P values were calculated by

using an unpaired Student’s t-test (mean ± SEM; n=03; **p<0.01).

(A)

Chapter 4 Results

105

Figure 4.22 (B): Graphical representation of the effect of HCV individual HCV non-

structural NS3, NS3-4A, NS4A proteins on the reduction of OXPHOS Complex I activity.

Huh-7 cells expressing HCV non-structural NS3, NS3-4A, NS4A proteins and pFLAG-CMV2

vector (non-expressing control) were transfected for 72 hrs and used to analyze the activity of

mitochondrial I enzyme. P values were calculated by using an unpaired Student’s t-test (mean ±

SEM; n=03; **p<0.01, *p<0.05).

(B)

Chapter 4 Results

106

Figure 4.22 (C): Western blot analysis of HCV non-structural NS3, NS3-4A and NS4A proteins

used for the assay reduction of OXPHOS Complex I activity. β-actin was used as an internal

loading control.


Lane 2: NS3-FLAG

Lane 3: NS3-4A-FLAG

Lane 1: empty vector

Lane 2: NS4A-FLAG

Lane 1: Mock

Lane 2: Core protein

Chapter 4 Results

107

4.15 Caspase -3, 7, 9 activation and poly (ADP-ribose) polymerase (PARP) cleavage in HCV

non-structural NS3-4A and NS4A expressing Huh-7 cells

After destruction of mitochondrial functions, next step of intrinsic apoptosis is to activate

procaspases (Crow, Mani et al., 2004). Once cytochrome c released to cytosol it works together

with Apaf-1 (apoptotic protease activating factor 1) to activate procaspase-9 an initiator caspase

(Lawen, 2003). Activation of caspase-9 then activates procaspase-7 and 3 (effector caspases).

Further caspase-3 plays an important role in the cleavage of PARP (poly (ADP-ribose)

polymerase) (Boulares, Yakovlev et al., 1999). Active caspase-3 become capable to cleave

cellular substrate PARP which ultimately induces apoptosis is the cell i.e. blebbing of membrane,

DNA fragmentation and deterioration of cell structure (Coleman, Sahai et al., 2001; Leverrier

and Ridley, 2001; Sebbagh, Renvoize et al., 2001).To confirm the activation of caspase-9, 7, 3

and cleavage of PARP cells were transfected with pEGFP-C1 (non-expressing control), pEGFP-


NS3-4A and NS4A proteins. Cells treated with staurosporine served as positive control, while

Huh-7 cells serve as mock. Blot treated with anti procaspase 9 antibody shown 47 kDa band

representing procaspase-9 in all experimental cell while beside 47 kDa, a polypeptide of 35 kDa

representing the cleavage form of procaspase-9 have also observed in positive control, HCV non-

structural NS3-4A and NS4A proteins expressing Huh-7 cells (Fig.4.23 A). Blot treated with anti

procaspase-7 antibody shown 35 kDa band of procaspase-7 in all experimental cells while beside

35 kDa, a polypeptide of 19 kDa band has also observed in positive control, HCV non-structural

NS3-4A and NS4A protein expressing Huh-7 cells representing the active form of caspase-7

(Fig.4.23 B). For capase-3 activation blot were treated with anti procaspase-3 antibody, all

experimental cells shown procaspase-3 expression with 35 kDa band while positive control,

Chapter 4 Results

108

HCV non-structural NS3-4A and NS4A proteins expressing Huh-7 cells have shown a

polypeptide of 17 kDa band representing the caspase-3 active form (Fig. 4.23C). Consistent with

the caspase-3 activation, western blot analysis of all experimental cells shown the full length

inactive form of PARP protein with 116 kDa band while positive control, HCV non-structural

NS3-4A and NS4A proteins expressing Huh-7 cells shown the cleavage of PARP protein into a

smaller unit of 85 kDa band (Fig. 4.23 D).

Chapter 4 Results

109

Figure 4.23: (A) Western blot analysis of Caspase-9 protein in HCV non-structural NS3-4A

and NS4A proteins expressing Huh-7 cells. Huh-7 cells were transfected with pEGFP-C1

(non-expressing control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A and pEGFP-C1/NS4A containing

HCV non-structural NS3, NS3-4A and NS4A proteins. Cells treated with staurosporine served as

positive control, while only Huh-7 cells serve as mock. 72 hrs post transfection cells were

harvested and used for western blot analysis. Blot was probed with anti procaspase-9 antibody

and activation of procaspase-9 was observed only in positive control (treated with

Staurosporine), pEGFP-C1/NS3-4A & pEGFP-C1/NS4A containing HCV non-structural NS3-

4A and NS4A proteins expressing cells. β-actin was used as an internal loading control.

(A)

Lane 1: Mock

Lane 2: + control


Lane 4: NS3-GFP

Lane 5: NS3-4A-GFP

Lane 6: NS4A-GFP

Chapter 4 Results

110

Figure 4.23: (B) Western blot analysis of Caspase-7 protein in HCV non-structural NS3-4A

and NS4A proteins expressing Huh-7 cells. Huh-7 cells were transfected with pEGFP-C1

(non-expressing control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A and pEGFP-C1/NS4A containing






4A and NS4A proteins expressing Huh-7 cells. β-actin was used as an internal loading control.

(B)

Lane 1: Mock

Lane 2: + control


Lane 4: NS3-GFP

Lane 5: NS3-4A-GFP

Lane 6: NS4A-GFP

Chapter 4 Results

111

Figure 4.23: (C) Western blot analysis of Caspase-3 protein in HCV non-structural NS3-4A

and NS4A proteins expressing Huh-7 cells. Huh-7 cells were transfected with pEGFP-C1 (non-

expressing control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A and pEGFP-C1/NS4A containing






4A and NS4A proteins expressing Huh-7 cells. β-actin was used as an internal loading control.

(C)

Lane 1: Mock

Lane 2: + control


Lane 4: NS3-GFP

Lane 5: NS3-4A-GFP

Lane 6: NS4A-GFP

Chapter 4 Results

112

Figure 4.23: (D) Western blot analysis of PARP protein in HCV non-structural NS3-4A and

NS4A proteins expressing cells. Huh-7 cells were transfected with pEGFP-C1 (non-expressing

control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A and pEGFP-C1/NS4A containing HCV non-

structural NS3, NS3-4A and NS4A proteins. Cells treated with staurosporine served as positive

control, while only Huh-7 cells serve as mock. 72 hrs post transfection cells were harvested and

used for western blot analysis. Blot was probed with anti PARP antibody and cleavage of PARP

was observed only in positive control (treated with Staurosporine), pEGFP-C1/NS3-4A &

pEGFP-C1/NS4A containing HCV non-structural NS3-4A and NS4A proteins expressing Huh-7

cells. β-actin was used as an internal loading control.

(D)

Lane 1: + control

Lane 2: Mock


Lane 4: NS3-GFP

Lane 5: NS3-4A-GFP

Lane 6: NS4A-GFP

Chapter 4 Results

113

4.16 Chromatin condensation in HCV non-structural NS3-4A and NS4A proteins

expressing Huh-7 cells

Apoptosis ends on chromatin condensation which is one of the most important occasion.

Caspase-3, -7 (execution caspases) activates cytoplasmic endonucleases and proteases which

degrades nuclear material and cytoskeletal proteins in the cell (Elmore, 2007). Endonuclease

CAD (Caspase-activated DNAse) degrades chromosomal DNA and cause the chromatin

condensation (Sakahira, Enari et al., 1998). To analyze the condensed nuclei in HCV non-

structural NS4A and NS3-4A proteins expressing Huh 7 cells, cells were transfected with

pEGFP-C1 (non-expressing control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A and pEGFP-

C1/NS4A vectors containing HCV non-structural NS3, NS3-4A and NS4A proteins. Cells were

harvested at different time points (24 hrs, 48 hrs & 72 hrs) and stained with Hoechst 33342 stain

and were observed under the florescence microscope. More condensed nuclei were observed at

72 hrs post transfection in pEGFP-C1/NS3-4A and pEGFP-C1/NS4A vectors containing HCV

non-structural NS3-4A and NS4A proteins while pEGFP-C1 (non-expressing control), pEGFP-

C1/NS3 vector containing HCV non-structural NS3 protein expressing cells shown negligible

amount of condensed nuclei (Fig. 4.24 A). Fig. 4.24 B depicts the graphical representation of

percentage cells with condensed nuclei in which pEGFP-C1/NS3-4A vector containing HCV

non-structural NS3-4A shown 48 % condensed nuclei, pEGFP-C1/NS4A vectors containing

HCV non-structural NS4A shown 50 % while pEGFP-C1 (non-expressing control) and pEGFP-

C1/NS3 vector containing HCV non-structural NS3 shown only 10-15 % condensed nuclei at 72

hrs post transfection.

Chapter 4 Results

114

Figure 4.24 (A): Chromatin condensation in HCV non-structural NS3-4A and NS4A

proteins expressing cells. Huh-7 cells transiently expressing pEGFP- C1 (empty vector/ non-

expressing control), pEGFP-C1/NS3, pEGFP-C1/NS3-4A, pEGFP-C1/NS4A vectors containing

HCV non-structural NS3, NS3-4A and NS4A proteins Huh-7 cells were harvested 24 hrs (left

panel), 48hrs (middle panel) and 72 hrs (right panel) post transfection. Nuclei of the cells were

stained with Hoechst 33342 stain. 72hrs post transfected stained nuclei showing more condensed

Chapter 4 Results

115

nuclei (bright) in pEGFP-C1/NS3-4A & pEGFP-C1/NS4A vectors containing HCV non-

structural NS3-4A and NS4A proteins expressing Huh-7 cells.

Figure 4.24 (B): Graphical representation of chromatin condensation in NS3-4A and NS4A

expressing cells. Cells with condensed nuclei were counted randomly. P values were calculated

by using an unpaired Student’s t-test (mean ± SEM; n=03; ***p<0.001).

(B)

Discussion

Chapter 5 Discussion

116

DISCUSSION

Hepatitis C virus (HCV) is a major cause of viral hepatitis in humans. It is a blood borne

pathogen that targets hepatocytes and moves from acute to chronic phase, favoring

complicated hepatic and extra-hepatic pathologies like apoptosis, fibrosis and cirrhosis,

eventually leads to hepatocellular carcinoma (HCC) (Qadri, et al., 2004; Howe et al., 2004;

Joyce et al., 2009). A strong association is being documented between chronic HCV infection

with genotype 3a and HCC (63.44 % of tested HCC patients) in Pakistani population (Idrees et

al., 2009). HCV shows hepatocyte specific tropism, where it propagates, infects the

neighboring hepatocytes and takes control over the host machinery by perturbing normal

signaling pathways to favor its replication (Clement, et al., 2009; Joyce et al., 2009).

HCV induces several complex pathways leading to generation of reactive oxygen species,

hepatic inflammation, hepatic fibrosis and HCC (Fartoux et al., 2005; Pekow et al., 2007; Bieche

et al., 2005). With the advancement of research in molecular virology study related to HCV

proteomics revealed many underlying pathways involved in HCV associated pathogenesis but

the factors involved in HCV induced pathogenesis are still unclear (Sheikh et al., 2008; Joyce et

al., 2009).

Many viruses including HCV have been shown to induce oxidative stress during replication and/

or protein expression. Hepatitis C infection in human liver as well as different experimental

models is associated with increased hepatic oxidative stress (Liu et al., 2003; Qadri et al., 2006;

Ghaziani et al., 2006). The previous study indicated that HCV and its certain proteins NS4A

and NS4B modulate the cellular signaling pathways in such a way that these proteins


117

accumulates on the mitochondria and ultimately disturb the mitochondrial dynamics which lead

the cells towards the mitochondrial mediated apoptotic pathway.

In the present study we examined the possible effects of HCV non-structural NS4A protein alone

and in complex with NS3 (NS3-4A) in the induction of apoptosis via mitochondrion mediated

pathway. Constructions of intergenotypic and intragenotypic chimeras of strain (JFH-1)

genotype 2a and HCV genotype 1b cloned genome (bicistronic replicons) are working efficiently

to get the advantage of boosted replication (Blight, Kolykhalov et al. 2000; Lindenbach, Evans et

al. 2005). In previous study novel clones of HCV genotype 3a infectious cDNA named as strain

S52 and of genotype 4a known as strain ED43, however robust cell culture model for expression

of individual hepatitis C virus proteins of different genotypes, especially genotype 3a are still

missing. (Gottwein, Scheel et al. 2010) From Pakistan Butt et al. (Butt, Idrees et al. 2011) have

only reported the construction of few mammalian expression plasmids encoding some genes of

HCV genotype 3a.

In the present study, we successfully amplified and cloned the full length NS3, NS3-4A & NS4A

genes of HCV genotype 3a separately in pFLAG-CMV2 and pEGFP-C1 expression vectors.

Positive clones were confirmed by restriction digestion analysis and sequencing from both

directions. Each particular clone was transfected separately to Huh-7 cells and expression was

analyzed using Western blot assays. Expression of transfected cells were also analyzed using

florescence microscopy after having probed with particular florescent antibodies. pFLAG-CMV2

expression vector used in the present study has the ability for intracellular transient expression of

N-terminal Met-FLAG which is fused with desired HCV non-structural NS3, NS3-4A and NS4A

proteins and detected by using anti-FLAG antibody. While pEGFP-C1 expression vector has the


118

red-shifted variant of wild-type GFP protein which is fused with desired HCV non-structural

NS3, NS3-4A and NS4A proteins and can easily detected by using anti GFP antibody.

Fluorescence and confocal microscopy is a very powerful tool for labeling of different organelles

and proteins within a living cell to investigate there interaction with other organelles, protein and

to investigate the transfected proteins expression in the eukaryotic cell. Efficient cell culture

based systems have the ability to express individual HCV non-structural NS3, NS3-4A and

NS4A protein separately in Huh-7 cells.

Apoptosis, programmed/ planned cell death or cell suicide, is a normal physiological process and

occurs normally during development, aging, hemostasis mechanism and defense mechanism in

pathological conditions (Kerr, Winterford et al. 1994; Elmore 2007). Different studies suggest

that apoptosis occurs in the human hepatocytes mostly by mitochondria-mediated apoptosis

pathway but still it is under investigations that whether apoptosis is mediated by T lymphocytes

or by HCV replication itself. (Bantel and Schulze-Osthoff 2003; Deng, Adachi et al. 2008). HCV

infection prompts Bax-induced, mitochondrial mediated, caspase-3 dependent apoptosis when

infected Huh-7.5 cells with chimeric J6/JFH1 strain of HCV genotype 2a was used in their

experiments (Deng, Adachi et al. 2008). Zhu et al. was successful in culturing a human hepatoma

novel cell line (LH86) permitted JFH-1 HCV genotype 2a infection which induced cell apoptosis

which was related to the viral replication in the cell.

Different structural and non-structural proteins of HCV are reported to be involved in the

induction of the mitochondrial-mediated caspase-3 dependent apoptosis pathway when expressed

in different cell culture systems. (Chou, Tsai et al. 2005; Chiou, Hsieh et al. 2006; Nomura-

Takigawa, Nagano-Fujii et al. 2006). HCV Core protein expressing in Huh7 cells activated

TRAIL-mediated apoptosis during the chronological induction of caspase-8 activation by


119

triggering of mitochondrial mediated apoptosis signaling pathway (Chou, Tsai et al. 2005). HCV

E2 protein of HCV have the capability to induce apoptosis because they have the genetic

similarity with the envelope proteins of other viruses of the flaviviridae family i.e. dengue and

Langat virus (Chiou, Hsieh et al. 2006). While Nomura-Takigawa et al. reported that HCV non-

structural NS4A (genotype 1b) is probably involved in the induction of apoptosis through

mitochondrial mediated apoptosis while HCV non-structural NS3-4A complex is more prone to

translocate towards mitochondria as compared to HCV non-structural NS3 protein alone. Our

study clearly shown that HCV non-structural NS4A protein (genotype 3a) alone and in complex

with NS3 (NS3-4A) induces apoptosis via Bax-induced, mitochondrial mediated, caspase -3

dependent pathway.

Our results indicated the significant number of cell death in Huh-7 cells expressing HCV non-

structural NS3-4A and NS4A proteins in contrast to NS3 expressing and vector transfected non-

expressing control cells (Fig. 4.1). Intracellular compartmentalization of HCV protein is

considered as an important aspect and it is clearly understood that HCV structural and non-

structural proteins accumulates on ER for maturation (Moradpour, Penin et al. 2007), while some

of HCV protein were reported to be localized on mitochondria as well. Our results clearly shows

the localization of HCV non-structural NS3, NS3-4A and NS4A proteins to ER (Fig. 4.2A) while

only NS3-4A complex and NS4A shown localization on the mitochondria (Fig. 4.2B) and this

result confirms that both HCV non-structural NS3-4A and NS4A proteins localized on

mitochondria and disturb the mitochondrial dynamics. Furthermore our results clearly showed

the significant mitochondrial fragmentation in HCV NS3-4A and NS4A expressing Huh-7 cells

(Fig. 4.3). Bax proteins and Bcl-2 proteins belong to Bcl-2 family that takes part in prominent

role in mitochondrial mediated apoptotic pathway and in addition to the regulation of


120

cytochrome c release from mitochondria to cytosol (Borner 2003; Qi, Li et al. 2010). A pro-

apoptotic protein Bax, translocates and anchors on the outer mitochondrial membrane (OMM),

while Bcl-2 or Bcl-xL anti-apoptotic proteins inhibit the Bax protein to integrate in the

mitochondria. In the current study we have observed increased accumulation of Bax and

conformational changes on mitochondria in the HCV non-structural NS3-4A and NS4A proteins

expressing Huh-7 cells (Fig 4.4A). The current study also demonstrated the up regulated

expression of Bax protein and down-regulated expression of Bcl-2 protein in HCV non-structural

NS3-4A and NS4A expressing Huh-7 cells (Fig. 4.4B & C). These results overall demonstrate

that HCV non-structural protein NS3-4A, NS4A containing Huh-7 expressing cells and positive

control shown down regulated expression of Bcl-XL protein which is anti-apoptotic in nature

while shown up regulated expression of BAX protein which is pro-apoptotic in nature hence,

HCV non-structural protein NS4A alone and in complex with NS3 (NS3-4A) accumulate on

mitochondria that disturb the mitochondrial dynamics and ultimately up and down regulate the

expression of anti and pro-apoptotic proteins.

I observed increased production of mitochondrial superoxide in HCV non-structural NS3-4A and

NS4A proteins expressing Huh-7 cells (Fig. 4.5) because mitochondrial superoxide is an

important supply of reactive oxygen species (ROS) in the cell and may contribute to prompt the

conformational changes of Bax protein, its dimerization and mitochondrial translocation

(D'Alessio, De Nicola et al. 2005; Nie, Tian et al. 2008). Bax protein ultimately integrates into

the outer mitochondrial membrane (OMM), and from mitochondria cytochrome c releases into

the cytosol. The present research found HCV non-structural NS3-4A and NS4A proteins

expression prompted the release of cytochrome c into the cytosol (Fig. 4.6). Activation of

caspases takes part as dominant character in the completion of apoptosis and in the same manner


121

released cytochrome c from mitochondria activates effector caspases. Normally cytochrome c is

located on the mitochondrial inner membrane although its cofactors Apaf-1 and procaspase-9 are

expressing in the cytosol. Once Cytochrome c is released to the cytosol forms a multimeri Apaf-

1/cytochrome c complex and ultimately activates the procaspase-9. After the activation of

caspase-9, it cleaves and activate the downstream caspase i.e. caspase-7 and -3 (Budihardjo,

Oliver et al. 1999; Denault and Salvesen 2002; Lawen 2003; Gogvadze, Orrenius et al. 2006).

Further active caspase-3 cleaved its substrate PARP into two fragments i.e. p89 and p24 leading

the cell towards apoptosis by DNA fragmentation, Nuclei condensation, membrane blebbing,

nuclear breakdown, apoptotic bodies etc. (Boulares, Yakovlev et al. 1999; Loeffler and Kroemer

2000; Lockshin and Zakeri 2001). Western blot analysis in our study demonstrates the activation

of caspase-9, caspase-7, caspase -3, and cleavage of PARP in HCV non-structural NS3-4A and

NS4A proteins expressing Huh-7 cells (Fig. 4.8 A, B, C & D).

Various research studies clearly indicate that affects of HCV infection on the respiratory chain

complex I enzyme (NADH dehydrogenase) of mitochondria via oxidative phosphorylation which

ultimately promote the destruction of mitochondrial outer membrane (Korenaga, Okuda et al.

2005; Korenaga, Wang et al. 2005; Piccoli, Scrima et al. 2007; Kim, Syed et al. 2013). In the

present study we compare the consequences of OXPHOS Complex I activity of HCV infected

cells (HCVcc) with HCV non-structural NS3, NS3-4A and NS4A proteins expressing Huh-7

cells in which our results shown that there is a 15 % reduction in HCVcc and NS3 expressing

cells (Fig. 4.7A) and 18-20 % reduction in HCV non-structural NS3-4A and NS4A proteins

expressing Huh-7 cells (Fig. 4.7B) as compared mock. These results clearly suggest that HCV

non-structural NS3-4A and NS4A proteins accumulate on mitochondria hence promote the

destruction of mitochondrial outer membrane and induces the mitochondrial-mediated apoptosis.


122

Chromatin condensation which is the terminal stage of apoptosis is the clear evidence of

apoptosis induced cell death. Chromatin condensation has been observed in NS3-4A and NS4A

expressing cells at 72 hrs post transfection (Fig. 4.9). In conclusion, current study clearly

demonstrates the directly involvement of HCV genotype 3a non-structural NS3-4A and NS4A

proteins in the triggering of Bax translocated, mitochondrial-mediated, Caspase-3 dependent

apoptotic pathway.

Future prospects

The role of NS3-4A and NS4A proteins in mitochondrial-mediated apoptosis pathway can also

be confirm by synthesis of the mutants of these particular proteins by producing mutation at

different conserved regions in their genes. Beside the investigation of HCV non-structural NS3,

NS4A and NS3-4A proteins role in the induction of mitochondrial mediated apoptosis pathway,

these transiently expressing cell lines can also be used and facilitate in the development of novel

antiviral strategies to inhibit the replication of this noxious pathogen. These cell culture based

systems can also play a dynamic role to test the novel drugs for its inhibitory action, the

evaluation of vaccine candidates, characterization of humoral immune responses and also in the

evaluation of different signaling pathways.

References

Chapter 6 References

123

REFERENCES

Aaron, S., McMahon, M. J., Danielle, M., Torres, L., Clatts, M., Tortu, S., Mildvan,

D. and Simm, M. (2008). Intranasal transmission of hepatitis C virus:

virological and clinical evidence. Clin. Infect. Dis., 47, 931-934.

Alter, M. J., Holland, P. V., Morrow, A. G., Purcell, R. H., Finestone, S. M. and

Moritsuqu, Y. (1975). Clinical and serological analysis of transfusion-

associated hepatitis. Lancet, 11, 838-841.

Alter, M. J. (2002). Prevention of spread of hepatitis C. Hepatology, 36, S93-S98.

Alter, M. J., Margolis, H. S., Krawczynski, K., Judson, F. N., Mares, A., Alexander,

W. J., Hu, P. Y., Miller, J. K., Gerber, M. A. and Sampliner, R. E. (1992). The

natural history of community-acquired hepatitis C in the United States. The

Sentinel Counties Chronic non-A, non-B Hepatitis Study Team. N. Engl. J.

Med., 327, 1899-1905.

Arababadi, M. K., Nasiri Ahmadabadi, B., Yousefi Daredor, H. and Kennedy, D.

(2012). Epidemiology of occult hepatitis B infection among thalassemic,

hemophilia, and hemodialysis patients. Hepat Mon., 12, 315-319.

Arema, A. P. and Jacobson, I. M. ( 2009). New and experimental therapies for HCV.

Nature Rev. Gastroenterol. Hepatol., 6, 403-411

Arif, F., Fayyaz, J. and Hamid, A. (2008). Awareness among parents of children with

thalassemia major. J. Pak. Med. Assoc., 58, 621-624.


124

Asabe, S. I, Tanji, Y., Satoh, S., Kaneko, T., Kimura, K. and Shimotohno, K. (1997).

The N-terminal region of hepatitis C virus-encoded NS5A is important for

NS4A-dependent phosphorylation. J. Virol., 71, 790-796.

Ashfaq, U. A., Javed, T., Rehman, S., Nawaz, Z. and Riazuddin, S. (2011). An

overview of HCV molecular biology, replication and immune

responses. Virol. J., 8, 161.

Australian Institute of Health and Welfare (2007). Statistics on drug use in Australia

2006 Canberra: Australian Institute of Health and Welfare.

Balayan, M. S., Andjaparidze , A. G. and Savinskaya, S. S. ( 1983). Evidence for a

virus in non-A, non-B hepatitis transmitted via the fecal-oral route.

Intervirology, 20, 23-31.

Bantel, H. and Schulze-Osthoff , K. (2003). Apoptosis in hepatitis C virus infection.

Cell Death Differ., 10, S48-58.

Bartenschlager, R., Laake, L. A., Mous, J. and Jacobsen, H. (1993). Non-structural

protein 3 of the hepatitis C virus encodes a serine-type proteinase required for

cleavage at the NS3/4 and NS4/5 junctions. J. Virol., 67, 3835-3844.

Bartenschlager, R., Lohmann, V., Wilkinson, T. and Koch, J. O. (1995). Complex

formation between the NS3 serine-type proteinase of the hepatitis C virus and

NS4A and its importance for polyprotein maturation. J. Virol., 69, 7519-7528.

Bartenschlager, R. and Lohmann, V. (2000). Replication of hepatitis C virus. J.

Gen. Virol., 81, 1631-1648.


125

Bartenschlager, R., Frese, M. and Pietschmann, T. (2004). Novel insights into

hepatitis С virus replication and persistence. Adv. Virus. Res., 63, 71-180.

Beeson, P. B. (1943). Jaundice occurring one to four months after transfusion of

blood or plasma. Report of seven cases. JAMA., 1, 1332-1334.

Behrens, S. E., Tomei, L. and De, Francesco, R. (1996). Identification and properties

of the RNA-dependent RNA polymerase of hepatitis C virus. EMBO. J., 15,

12-22.

Benali-Furet, NL., Chami, M., Houe, L., De, Giorgi, F., Vernejoul, F., Logorce, D.,

Buscail, L., BratenSchlager, R., Ichas, F., Rizzuto, R. and Paterlini-Brechot, P.

(2005). Hepatitis C virus core triggers apoptosis in liver cells by inducing ER

stress and ER calcium depletion. Oncogene, 24, 4921-4933.

Beran, R. K., Lindenbach, B. D. and Pyle, A. M. (2009). The NS4A protein of

hepatitis C virus promotes RNA-coupled ATP hydrolysis by the NS3 helicase.

J. Virol., 83, 3268-3275.

Bieche, I., Asselah, T., Laurendeau, I., Vidaud, D. and Degot, C. (2005). Molecular

profiling of early stage liver fibrosis in patients with chronic hepatitis C virus

infection. Virology, 332, 130-144

Blight, K. J., Kolykhalov, A. A. and Rice, C. M. (2000). Efficient initiation of HCV

RNA replication in cell culture. Science, 290, 1972-1974.

Bonino, F., Hoyer, B., Shih, J. W., Rizzetto, M., Purcell, R. H. and Gerin, J. L.

(1984). Delta hepatitis agent: structural and antigenic properties of the delta-

associated particle. Infect. Immun., 43, 1000-1005.

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Behrens%20SE%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Tomei%20L%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract

http://www.ncbi.nlm.nih.gov/pubmed?term=%22De%20Francesco%20R%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract

javascript:AL_get(this,%20'jour',%20'EMBO%20J.');


126

Borner, C. (2003). The Bcl-2 protein family: sensors and checkpoints for life-or-death

decisions. Mol. Immunol., 39, 615-647.

Boulares, A. H., Yakovlev, A. G., Ivanova, V., Stoica, B. A., Wang, G., Iyer, S. and

Smulson, M. (1999). Role of poly(ADP-ribose) polymerase (PARP) cleavage

in apoptosis. Caspase 3-resistant PARP mutant increases rates of apoptosis in

transfected cells. J. Biol. Chem., 274, 22932-22940.

Bracho, M. A., Gosalbes, M. J., Blasco, D., Moya, A. and Gonzalez-Candelas, J.

(2005). Molecular epidemiology of a hepatitis C virus outbreak in a

hemodialysis unit. Clin. Microbiol., 43, 2750-2755.

Branch, A. D., Stump, D. D., Gutierrez, J. A., Eng, F. and Walewski, J. L. (2005). The

hepatitis C virus alternate reading frame (ARF) and its family of novel

products: the alternate reading frame protein/F-protein, the double-frameshift

protein, and others. Semin. Liver Dis., 25, 105-117.

Brass, V., Bieck, E., Montserret, R., Wolk, B., Hellings, J. A., Blum, H. E., Penin, F.

and Moradpour, D. (2002). An amino-terminal amphipathic alpha-helix

mediates membrane association of the hepatitis C virus nonstructural

protein 5A. J. Biol. Chem., 277, 8130-8139.

Brass, V., Moradpour, D. and Blum, H. E. (2006). Molecular virology of hepatitis C

virus (HCV): 2006 update. Int. J. Med. Sci., 3, 29-34.

Budihardjo, I., Oliver, H., Lutter, M., Luo, X., and Wang, X. (1999). Biochemical

pathways of caspase activation during apoptosis. Annu. Rev. Cell. Dev. Biol.,

15, 269-290.


127

Burns, J., Burrow, S., Genovese, E., Pumphrey, M., Sims, E. and Thomson, N.

(2003). The health of Indigenous Australians. South Melbourne, Oxford

University Press, 29, 397-444.

Butcher, S. J., Grimes, J. M., Makeyev, E. V., Bamford, D. H. and Stuart, D. I.

(2001). A mechanism for initiating RNA-dependent RNA polymerization.

Nature, 410, 235-240.

Butt, S., Idrees, M., Rehman, I. U., Ali, L., Hussain, A., Ali, M., Ahmed, N., Saleem,

S. and Fayyaz, M. (2011). Establishment of stable Huh-7 cell lines expressing

various hepatitis C virus genotype 3a protein: an in-vitro testing system for

novel anti-HCV drugs. Genet. Vaccines. Ther., 9, 12.

Carrere-Kremer, S., Montpellier-Pala, C., Cocquerel, L., Wychowski, C., Penin, F.

and Dubuisson, J. (2002). Subcellular localization and topology of the p7

polypeptide of hepatitis C virus. J. Virol., 76, 3720-3730.

Chandra, J., Samali, A. and Orrenius, S. (2000). Triggering and modulation of

apoptosis by oxidative stress. Free Radic. Biol. Med., 29, 323-33.

Chang, T. T., Chang, T. Y., Chen, C. C., Young, K. C., Roan, J. N., Lee, Y. C.,

Cheng, P. N. and Wu, H. L. (2001). Existence of hepatitis C virus in Culex

quinquefasciatus after ingestion of infected blood: experimental approach to

evaluating transmission by mosquitoes. J. Clin. Microbiol., 39, 3353-3355.

Chevaliez, S. and Pawlotsky, J. M. (2006). HCV Genome and Life Cycle. Tan, L. S.

(editor), Chp. 01., Horizon Bioscience, Norfolk, UK.


128

Chevaliez, S., Brillet, R., Lazaro, E., Hezode, C. and Pawlotsky, J. (2007). Analysis

of ribavirin mutagenicity in human hepatitis C virus Infection. J. Virol., 81,

732-7741.

Chiou, H. L., Hsieh, Y. S., Hsieh, M. R. and Chen, T. Y. (2006). HCV E2 may induce

apoptosis of Huh-7 cells via a mitochondrial-related caspase pathway.

Biochem. Biophys. Res. Commun., 345, 453-458.

Choo, Q. L., Kuo, G., Weiner, A. J., Overby, L. R., Bradley, D. W. and Houghton,

M. (1989). Isolation of a cDNA clone derived from a blood-borne non-A,

non-B viral hepatitis genome. Science, 244, 359-362.

Choo, Q. L., Richman, K. H., Han. J. H., Berger, K., Lee, C., Dong, C., Gallegos, C.,

Coit, D., Madina-Selby, R. and Barr, P. J. (1991). Genetic organization and

diversity of the hepatitis C virus. PNAS., 88, 2451-2455.

Chou, A. H., Tsai, H. F., Wu, Y. Y., Hu, C. Y., Hwang, L. H., Hsu, P. I. and Hsu, P.

N. (2005). Hepatitis C virus core protein modulates TRAIL-mediated

apoptosis by enhancing Bid cleavage and activation of mitochondria apoptosis

signaling pathway. J. Immunol., 174, 2160-2166.

Clement, S., Pascarella, S. and Negro, F. (2009). Hepatitis C virus infection:

molecular pathways to steatosis, insulin resistance and oxidative stress.

Viruses, 1, 126-143.

Coleman, M. L., Sahai, E. A., Yeo, M., Bosch, M., Dewar, A. and Olson, M. F.

(2001). Membrane blebbing during apoptosis results from caspase-mediated

activation of ROCK I. Nat. Cell. Biol., 3, 339-345.


129

Couto, L. B. and Kolykhalov, A. A. (2006). Animal Models for HCV Study. Tan, L.

S. (editor), Chp. 12., Horizon Bioscience, Norfolk, UK.

Crow, M. T., Mani, K., Nam, Y. J., and Kitsis, R. N. (2004). The mitochondrial death

pathway and cardiac myocyte apoptosis. Circ. Res., 95, 957-970.

D'Alessio, M., De Nicola, M., Coppola, S., Gualandi, G., Pugliese, L., Cerella, C.,

Cristofanon, S., Civitareale, P., Ciriolo, M. R., Bergamaschi, A., Magrini, A.

and Ghibelli, L. (2005). Oxidative Bax dimerization promotes its translocation

to mitochondria independently of apoptosis. FASEB. J., 19, 504-1506.

De Francesco, R. and Migliaccio, G. (2005). Challenges and successes in developing

new therapies for hepatitis C. Nature, 436, 953-960.

Deforges, S., Evlashev, A., Perret, M., Sodoyer, M., Pouzol, S., Scoazec, J. Y.,

Bonnaud, B., Diaz, O., Paranhos-Baccala, G., Lotteau, V. and Andre, P.

(2004). Expression of hepatitis C virus proteins in epithelial intestinal cells in

vivo. J. Gen. Virol., 85, 2515-2523.

Denault, J. B. and Salvesen, G. S. (2002). Caspases: keys in the ignition of cell death.

Chem. Rev., 102, 4489-4500.

Deng, L., Adachi, T., Kitayama, K., Bungyoku, Y., Kitazawa, S., Ishido, S., Shoji, I.,

and Hotta, H. (2008). Hepatitis C virus infection induces apoptosis through a

Bax-triggered, mitochondrion-mediated, caspase 3-dependent pathway. J.

Virol., 82, 10375-10385.

E, Dreschers, S., and Bock, J. (2003). Role of mitochondria in apoptosis. Exp.

Physiol., 88, 85-90.


130

Egger, D., Wolk, B., Gosert, R., Bianchi, L., Blum, H. E., Moradpour, D. and Bienz,

K. (2002). Expression of hepatitis C virus proteins induces distinct membrane

alterations including a candidate viral replication complex. J. Virol., 76, 5974-

5984.

El-Hage, N. and Luo, G. (2003). Replication of hepatitis C virus RNA occurs in a

membrane-bound replication complex containing nonstructural viral proteins

and RNA. J. Gen. Virol., 84, 2761-2769.

Elmore, S. (2007). Apoptosis: a review of programmed cell death. Toxicol. Pathol.,

35, 495-516.

Esteban, J. I., Gomez, J., Martell, M., Cabot, B., Quer, J., Camps, J., Gonzalez, A.,

Otero, T., Moya, A. and Esteban, R. (1996). Transmission of hepatitis C virus

by a cardiac surgeon. N. Eng. J. Med., 334, 555-560

Failla, C., Tommei, L. and Francesco, R. D. (1994). Both NS3 and NS4A are

required for proteolytic processing of hepatitis C virus non-structural

proteins. J. Virol., 68, 3753-3760.

Fan, T. J., Han, L. H., Cong, R. S. and Liang, J. (2005). Caspase family proteases and

apoptosis. Acta. Biochim. Biophys. Sin., 37, 719-27.

Farci, P., Choo, Q. L., Kuo, G., Weiner, A. J., Overby, L. R., Bradely, D. W. and

Houghton, M. (2002). Isolation of a cDNA clone derived from a blood-

borne non-A, non-B viral hepatitis genome. Science, 244, 359-362.

Favaloro, B., Allocati, N., Graziano, V., DiIlio, C. and De Laurenzi, V. (2012). Role

of apoptosis in disease. Aging, 4, 330-349.

http://www.virologyj.com/sfx_links?ui=1743-422X-8-161&bibl=B43


131

Feinstone, S. M., Kapikian, A. Z. and Purceli, R. H. (1973). Hepatitis A: detection by

immune electron microscopy of a virus like antigen associated with acute

illness. Science, 182, 1026.

Feinstone, S. M., Kapikian, A. Z., Purcell, R. H., Alter, H. J. and Holland, P. V.

(1975). Transfusion-associated hepatitis not due to viral hepatitis type A or B.

N. Engl. J. Med., 292, 767-770.

Feld, J. J. and Hoofnagle, J. H. (2005). Mechanism of action of interferon and

ribavirin in treatment of hepatitis C. Nature, 436, 967-972.

Fischer, R., Baumert, T. and Blum, H. E. (2007). Hepatitis C virus infection and

apoptosis. World J. Gastroenterol., 13, 4865-4872.

Flint, M., Thomas, J. M., Maidens, C. M., Shotton, C., Levy, S., Barclay, W. S. and

McKeating , J. A. (1999). Functional analysis of cell surface-expressed

hepatitis C virus E2 glycoprotein. J. Virol., 73, 6782-6790.

Foley, Suzanne, B. A., Abou-Saleh. And Mohammed, T. (2009). Risk behaviors and

transmission of hepatitis C in injecting drug users. Addict. Disord. Treat., 8,

13-22.

Forton, D. M., Karayiannis, P., Mahmud, N., Taylor-Robinson, S. D. and Thomas, H.

C. (2004). Identification of unique hepatitis C virus quasispecies in the central

nervous system and comparative analysis of internal translational efficiency of

brain, liver, and serum variants. J. Virol., 78, 5170-5183.


132

Franco, E., Meleleo, C., Serino, L., Sorbara, D. and Zaratti, L. (2012). Hepatitis A:

Epidemiology and prevention in developing countries. World J. Hepatol., 4,

68-73.

Gale, M. J., Jr, Korth, M. J., Tang, N. M., Tan, S. L., Hopkins, D. A., DeverT, E.,

Polyak, S. J., Gretch, D. R. and Katze, M. G. (1997). Evidence that hepatitis

C virus resistance to interferon is mediated through repression of the PKR

protein kinase by the nonstructural 5A protein. Virology, 230, 217-227.

Galle, J., Herzog, C., Schollmeyer, P. and Wanner, C. (1994). Oxygen-derived

radicals stimulate renin release of isolated juxtaglomerular cells. FEBS Lett.,

351, 314-316.

Gallinari, P., Brennan, D., Nardi, C., Brunetti, M., Tomei, L., Steinkuhler, C. and De,

Francesco, R. (1998). Multiple enzymatic activities associated with

recombinant NS3 protein of hepatitis C virus. J. Virol., 72, 6758-6769.

Germi, R., Crance, J. M., Garin, D., Guimet, J., Thelu, M. A., Jouan, A., Zarski, J. P.

and Drouet, E. (2001). Mosquito cells bind and replicate hepatitis C virus. J.

Med. Virol., 64, 6-12.

Ghaziani, T., Shan, Y., Lambrecht, R.W, Donohue, S.E., Pietschmann,T.,

Bartenschlager, R. and Bonkovsky, H. L. (2006). HCV proteins increase

expression of heme oxygenase-1 (HO-1) and decrease expression of Bach1 in

human hepatoma cells. J. Hepatol., 45, 5-12.

Gillies, R. J., Didier, N. and Denton, M. (1986). Determination of cell number in

monolayer cultures. Anal Biochem., 159, 109-113.


133

Gogvadze, V., Orrenius, S. and Zhivotovsky, B. (2006). Multiple pathways of

cytochrome c release from mitochondria in apoptosis. Biochim. Biophys.

Acta., 1757, 639-647.

Goldman, M. (1994). Elda E. Anderson Award. Presented to James G. Tripodes.

Health. Phys., 67, 445-6.

Goldstein, J. C., Waterhouse, N. J., Juin, P., Evan, G. I. and Green, D. R. (2000). The

coordinate release of cytochrome c during apoptosis is rapid, complete and

kinetically invariant. Nat. Cell. Biol., 2, 156-162.

Gosert, R., Egger, D., Lohmann, V., Bartenschlager, R., Blum, H. E., Bienz, K. and

Moradpour, D. (2003). Identification of the hepatitis C virus RNA replication

complex in Huh-7 cells harboring subgenomic replicons. J. Virol., 77, 5487-

5492.

Gottwein, J. M., Scheel, T. K., Callendret, B., Li, Y. P., Eccleston, H. B., Engle, R.

E., Govindarajan, S., Satterfield, W., Purcell, R. H., Walker, C. M. and Bukh,

J. (2010). Novel infectious cDNA clones of hepatitis C virus genotype 3a

(strain S52) and 4a (strain ED43): genetic analyses and in vivo pathogenesis

studies. J. Virol., 84, 5277-5293.

Grakoui, A., McCourt, D. W., Wychowski C., Feinstone, S. M. and Rice, C. M.

(1993). A second hepatitis C virus-encoded proteinase. PNAS., 90, 10583-

10587.


134

Grakoui, A., McCourt, D. W. and Wychowski, C. (1993). Characterization of the

hepatitis C virus-encoded serine proteinase: determination of proteinase-

dependent polyprotein cleavage sites. J . Virol., 67, 2832-2843.

Gretton, S. N., Taylor, A. I. and McLauchlan, J. (2005). Mobility of the hepatitis C

virus NS4B protein on the endoplasmic reticulum membrane and membrane-

associated foci. J. Gen. Virol., 86, 1415-1421.

Griffin, S. D., Harvey, R., Clarke, D. S., Barclay, W. S., Harris, M. and Row, lands,

D. J. (2004). A conserved basic loop in hepatitis C virus p7 protein is required

for amantadine-sensitive ion channel activity in mammalian cells but is

dispensable for localization to mitochondria. J. Gen. Virol., 85, 451-461.

Gulbins, E. (2003). Regulation of death receptor signaling and apoptosis by

ceramide. Pharmacol. Res., 47, 93-399.

Hamid, S., Umar, M., Alam, A., Siddiqui, A. and Qureshi, H. Butt. (2004). PSG

consensus statement on management of hepatitis C virus infection. J. Pak.

Med. Assoc, 54, 146-150.

Hayashi, N. and Takehara, T. (2006). Antiviral therapy for chronic hepatitis C

past,present, and future. J. Gastroenterol., 41, 17-27.

Hellen, C. U. and Sarnow, P. (2001). Internal ribosome entry sites in eukaryotic

mRNA molecules. Genes Dev., 15, 1593-612.

Hockenbery, D. M., Oltvai, Z. N., Yin, X. M., Milliman, C. L. and Korsmeyer, S. J.

(1993). Bcl-2 functions in an antioxidant pathway to prevent apoptosis. Cell,

75, 241-251.

http://www.genesdev.org/cgi/content/full/15/13/1593

http://www.genesdev.org/cgi/content/full/15/13/1593


135

Hoofnagle, J. H. (2002). Course and outcome of hepatitis C. Hepatol., 36, S21-29.

Hope, R. G., Murphy, D. J. and McLauchlan, J. (2002). The domains required to

direct core proteins of hepatitis C virus and GB virus-B to lipid droplets share

common features with plant oleosin proteins. J. Biol. Chem., 277, 4261-4270.

Horner, S. M., Park, H. S. and Gale, M. Jr. (2012). Control of innate immune

signaling and membrane targeting by the Hepatitis C virus NS3/4A protease

are governed by the NS3 helix-α 0 . J . Virol., 86, 3112-3120.

Howard, C., Thomas, Anna, S. F., Lok, Stephen, A., Locarnini, Arie, J. and

Zuckerman, (eds), (2014). Viral hepatitis, ED. 4th, Wiley-Blackwell.

Howe, A.Y.M., Bloom, J., Baldick, C.J., Benetatos, C.A., Cheng, H., Christnsen, J.S.,

Chunduru, S.K., Coburn, G.A., Feld, B., Gopalsamy, A., Gorczyca, W.P.,

Herrmann, S., Johann, S., Jiang, X., Kimberland, M.L., Krisnamurthy, G.,

Olson, M., Orlowski, M., Swanberg, S., Thompson, I., Thorn, M., Vecchio,

A.D., Young, D.C., Zeijl, M.V., Ellingboe, J.W., Upeslacis, J., Collett, M.,

Mansour, T.S. and O’Connell, J.F. (2004). Novel nonnucleoside inhibitor of

hepatitis C virus RNA-dependent RNA polymerase. Antimicrobial agents and

chemotherapy, 48, 4813-4821.

http://www.the-scientist.com/?articles.view/articleNo/24336/title/Culturing-Hepatitis

Idrees, M. and Riazuddin, S. (2008). Frequency distribution of hepatitis C virus

genotypes in different geographical regions of Pakistan and their possible

routes of transmission. BMC Infect. Dis., 8, 69.

http://eu.wiley.com/WileyCDA/Section/id-302479.html?query=Howard+C.+Thomas

http://eu.wiley.com/WileyCDA/Section/id-302479.html?query=Anna+S.+F.+Lok

http://eu.wiley.com/WileyCDA/Section/id-302479.html?query=Stephen+A.+Locarnini

http://eu.wiley.com/WileyCDA/Section/id-302479.html?query=Arie+J.+Zuckerman

http://eu.wiley.com/WileyCDA/Section/id-302479.html?query=Arie+J.+Zuckerman


136

Imran, M., Waheed, Y., Manzoor, S., Bilal, M., Ashraf, W., Ali, M. and Ashraf, M.

(2012). Interaction of Hepatitis C virus proteins with pattern recognition

receptors.Virol. J., 9, 126.

Ivanov, A. V., Bartosch, B., Smirnova, O. A., Isaguliants, M. G. and Kochetkov, S. N.

(2013). HCV and oxidative stress in the liver. Viruses, 5, 439-469.

Jang, J. Y., Kim, S. J., Cho, E. K., Jeong, S. W., Park, E. J., Lee, W. C., Lee, S. H.,

Kim, S. G., Kim, Y. S., Kim, H. S., Kim, B. S., Lin, W. and Chung, R. T.

(2014). TRAIL Enhances Apoptosis of Human Hepatocellular Carcinoma

Cells Sensitized by Hepatitis C Virus Infection: Therapeutic Implications.

PLoS One, 9, e98171.

Joyce, M. A., Walters, K. A., Lamb, S. E., Yeh, M. M., Zhu, L. F., Kneteman, N.,

Doyle, J. S., Katze, M. G. and Tyrrell, D. L. (2009). HCV Induces Oxidative

and ER Stress, and Sensitizes Infected Cells to Apoptosis in SCID/Alb-uPA

Mice. PLoS Pathog., 5.

Joyce, M. A. and Tyrrell, D. L. (2010). The cell biology of hepatitis C virus. Microbes

Infect., 12, 263-271.

Kato, N., Hijikata, M., Ootsuyama, Y., Nakagawa, M., Ohkoshi, S., Sugimura, T. and

Shimotohno, K. (1990). Molecular cloning of the human hepatitis C virus

genome from Japanese patients with non-A, non-B hepatitis. Proc Natl Acad

Sci., 87, 9524-9528.

Kaufmann, S. H. and Earnshaw, W. C. (2000). Induction of apoptosis by cancer

chemotherapy. Exp. Cell. Res., 256, 42-9.


137

Kerr, J. F., Winterford, C. M. and Harmon, B. V. (1994). Apoptosis. Its significance

in cancer and cancer therapy. Cancer, 73, 2013-2026.

Khromykh, A. A. and Westaway, E. G. (1997). Subgenomic replicons of the

flavivirus Kunjin: construction and applications. J. Virol., 71, 1497-1505.

Kim, J. L., Morgenstern, K. A., Lin, C., Fox, T. anf Dwyer, M. D., Landro, J. A.,

Chambers, S. P., Markland, W., Lepre, C. A. and O'Malley, E. T.

(1996). Crystal structure of the hepatitis C virus NS3 protease domain

complexed with a synthetic NS4A cofactor peptide. Cell, 87, 343-355.

Kim, S. J., Syed, G. H. and Siddiqui, A. (2013). Hepatitis C virus induces the

mitochondrial translocation of Parkin and subsequent mitophagy. PLoS

Pathog., 9, e1003285.

Kluck, R. M., Bossy-Wetzel, E., Green, D. R. and Newmeyer, D. D. (1997). The

release of cytochrome c from mitochondria: a primary site for Bcl-2 regulation

of apoptosis. Science, 275, 1132-1136.

Kmiec, Z. (2001). Cooperation of liver cells in health and disease. Adv. Anat.

Embryol. Cell. Biol, 161, 1-151.

Kolykhalov, A. A., Mihalik, K., Feinstone, S. M. and Rice, C. M. (2000). Hepatitis C

virus-encoded enzymatic activities and conserved RNA elements in the 3'

nontranslated region are essential for virus replication in vivo. J. Virol., 74,

2046-2051.


138

Korenaga, M., Okuda, M., Otani, K., Wang, T., Li, Y. and Weinman, S. A. (2005).

Mitochondrial dysfunction in hepatitis C. J. Clin. Gastroenterol., 39, S162-

166.

Korenaga, M., Wang, T., Li, Y., Showalter, L. A., Chan, T., Sun, J. and Weinman, S.

A. (2005). Hepatitis C virus core protein inhibits mitochondrial electron

transport and increases reactive oxygen species (ROS) production. J. Biol.

Chem., 280, 37481-37488.

Krajewski, S., Tanaka, S., Takayama, S., Schibler, M. J., Fenton, W. and Reed, J. C.

(1993). Investigation of the subcellular distribution of the bcl-2 oncoprotein:

residence in the nuclear envelope, endoplasmic reticulum, and outer

mitochondrial membranes. Cancer Res., 53, 4701-4714.

Kudin, A. P., Bimpong-Buta, N. Y., Vielhaber, S., Elger, C. E. and Kunz, W. S.

(2004). Characterization of superoxide-producing sites in isolated brain

mitochondria. J. Biol. Chem., 279, 4127-4135.

Kumar, S. (2007). Caspase function in programmed cell death. Cell Death Differ., 14,

32-43.

Kumar, V., Cotran, R.S. and Robins, S.L. (1992). Basic Pathology, ED.5th, W.B.

Saunders Company, 75-77, 305-310.

Lam, A. M. and Frick, D. N. (2006). Hepatitis C virus subgenomic replicon requires

an active NS3 RNA helicase. J. Virol., 80, 404-411.

Lawen, A. (2003). Apoptosis-an introduction. Bioessays, 25, 888-896.


139

Lee, S. H., Kim, Y. K., Kim, C. S., Seol, S. K., Kim, J., Cho, S., Song, Y. L.,

Bartenschlager, R. and Jang, S. K. (2007). Interaction of HCV core protein

with 14-3-3epsilon protein releases Bax to activate apoptosis. Biochem

Biophys. Res. Commun., 352, 756-762.

Lerat, H., Honda, M., Beard, M. R., Loesch, K., Sun, J., Yang, Y., Okuda, M., Gosert,

R., Xiao, S. Y., Weinman, S. A. and Lemon, S. M. (2002). Steatosis and liver

cancer in transgenic mice expressing the structural and nonstructural proteins

of hepatitis C virus. Gastroenterology, 122, 352-365.

Lesburg, C. A., Cable, M. B., Ferrari, E., Hong, Z., Mannarino, A. F. and Weber, P.

C. (1999). Crystal structure of the RNA-dependent RNA polymerase from

hepatitis C virus reveals a fully encircled active site. Nat. Struct. Biol., 6, 937-

943.

Leverrier, Y. and Ridley, A. J. (2001). Apoptosis: caspases orchestrate the ROCK 'n'

bleb. Nat. Cell. Biol., 3, 91-93.

Li, J. and Yuan, J. (2008). Caspases in apoptosis and beyond. Oncogene, 27, 6194-

6206.

Lin, C, Wu, J. W., Hsiao, K. and Su, M. S. (1997). The hepatitis C virus NS4A

protein: interactions with the NS4B and NS5A proteins. J. Virol., 71, 6465-

6471.

Lindenbach, B. D., Evans, M. J., Syder, A. J., Wolk, B., Tellinghuisen, T. L., Liu, C.

C., Maruyama, T., Hynes, R. O., Burton, D. R., McKeating, J. A. and Rice, C.


140

M. (2005). Complete replication of hepatitis C virus in cell culture. Science,

309, 623-626.

Liu, Y., Fiskum, G. and Schubert, D. (2002). Generation of reactive oxygen species

by the mitochondrial electron transport chain. J. Neurochem., 80, 780-787.

Liu, C., Gaca, M., Swenson, E. S., Vellucci, V. F., Reiss, M. and Wells, R. G. (2003).

Smad2 and Sn-mad3 are differentially activated by transforming growth factor

beta in quiscent and avctivated hepatic stellate cells in TGF- beta independent.

J. Biol. Chem., 278, 1172-1178.

Lock, G., Dirscherl, M., Obermeier, F., Gelbmann, C. M., Hellerbrand, C., Knoll, A.,

Scholmerich, J. and Jilg, W. (2006). Hepatitis C contamination of

toothbrushes: myth or reality? J. Viral Hepat., 13, 571-573.

Lockshin, R. A. and Zakeri, Z. (2001). Programmed cell death and apoptosis: origins

of the theory. Nat Rev Mol. Cell. Biol., 2, 545-550.

Loeffler, M. and Kroemer, G. (2000). The mitochondrion in cell death control:

certainties and incognita. Exp. Cell. Res., 256, 19-26.

Lohmann, V., Korner, F., Koch, J., Herian, U., Theilmann, L. and Bartenschlager, R.

(1999). Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell

line. Science, 285, 110-113.

Lorenz, I. C., Marcotrigiano, J., Dentzer, T. G. and Rice, C. M. (2006). Structure of

the catalytic domain of the hepatitis C virus NS2-3 protease. Nature, 442,

831-835.


141

Lu, L., Li, C. and Haqedorn, C. H. (2006). Phylogenetic analysis of global

hepatitis E virus sequences: genetic diversity, subtypes and zoonosis. Rev.

Med. Virol., 16, 5-36.

Lu, S. N., Chen, T. M., Lee, C. M., Wang, J. H., Tung, H. D. and Wu, J. C. (2003).

Molecular epidemiological and clinical aspects of hepatitis D virus in a unique

triple hepatitis viruses (B, C, D) endemic community in Taiwan. J. Med.

Virol., 70, 74-80.

Lundin, M., Lindstrom, H., Gronwall, C., Persson, M. A. (2006). Dual topology of the

processed hepatitis C virus protein NS4B is influenced by the NS5A protein.

J. Gen. Virol., 87, 3263-3272.

Lyn, R. K., Kennedy, D. C., Stolow, A., Ridsdale, A. and Pezacki, J. P. (2010).

Dynamics of lipid droplets induced by the hepatitis C virus core protein.

Biochem. Biophys. Res. Commun., 399, 518 -524.

Ma, Y., Yates, J., Liang, Y., Lemon, S. M. and Yi, M. (2008). NS3 helicase domains

involved in infectious intracellular hepatitis C virus particle assembly. J.

Virol., 82, 7624-7639.

MacCallum, F, O. (1947). Homologous serum jaundice. Lancet, 2, 691.

Macdonald, A., Crowder, K., Street, A., McCormick, C. and Harris, M. (2004). The

hepatitis C virus NS5A protein binds to members of the Src family of tyrosine

kinases and regulates kinase activity. J. Gen. Virol., 85, 721-729.


142

MacIntyre, C. R., Burgess, M., Isaacs, D., MacIntyre, P. B., Menzies, R. and Hull, B.

(2007). Epidemiology of severe hepatitis A in Indigenous Australian children.

J. Paed. Child Health., 43, 383-387.

Malarkey, D. E., Johnson, K., Ryan, L., Boorman, G. and Maronpot, R. R. (2005).

New insights into functional aspects of liver morphology. Toxicol. Pathol., 33,

27-34.

Malhi, H. and Gores, G. J. (2008). Cellular and molecular mechanisms of liver injury.

Gastroenterology, 134, 1641-1654.

Malik, R., Selden, C. and Hodgson, H. (2002). The role of non-parenchymal cells in

liver growth. Semin. Cell. Dev. Biol., 13, 425-31.

Marusawa, H., Hijikata, M., Chiba, T. and Shimotohno, K. (1999). Hepatitis C virus

core protein inhibits Fas- and tumor necrosis factor alpha-mediated apoptosis

via NF-kappaB activation. J. Virol., 73, 4713-20.

McCaughan, G. W. and Torzillo, P. J. (2000). Hepatitis A, liver transplants and

Indigenous communities. Med. J. Australia., 172, 6-7.

Mohebbi, S. R. and Nejad, M. R. (2012). Seroepidemiology of hepatitis A and

Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral

hepatitis genome. Science, 244, 359-362.

Monazahian, M., Bohme, I., Bonk, S., Koch, A., Scholz, C., Grethe, S., Thomssen, R.

(1999). Low density lipoprotein receptor as a candidate receptor for hepatitis

C virus. J. Med. Virol., 57, 223-229.


143

Moradpour, D., Penin, F. and Rice, C. M. (2007). Replication of hepatitis C virus.

Nat. Rev. Microbiol., 5, 453-463.

Mordon, S. and Blanchemaison, P. (2008). Re: Histologic evaluation of interstitial

lipolysis comparing a 1064, 1320 and 2100 nm laser in an ex vivo model. by

Khoury JG, Saluja R, Keel D, Detwiler S, Goldman MP. Lasers. Surg. Med.,

40, 402-406.

Mumtaz, K., Hamid, S. S., Adil, S., Afaq, A., Islam, M., Abid, S., Shah, H. A. and

Jafri, W. (2005). Epidemiology and clinical pattern of hepatitis delta virus

infection in Pakistan. J. Gastroenterol. Hepatol., 20, 1503-1507.

Nakamura, M.T., Cheon, Y., Li, Y. and Nara, T.Y. (2004). Mechanisms of regulation

of gene expression by fatty acids. Lipids, 39, 1077-1083.

Neddermann, P., Clementi, A. and De Francesco, R. (1999). Hyperphosphorylation of

the hepatitis C virus NS5A protein requires an active NS3 protease, NS4A,

NS4B, and NS5A encoded on the same polyprotein. J. Virol., 73, 9984-9991.

Nemati, E., Alavian, S. M., Taheri, S., Moradi, M., Pourfarziani, V. and Einollahi, B.

(2009). Hepatitis C virus infection among patients on hemodialysis: A report

from a single center in Iran. Saudi J. Kidney Dis. Transpl., 20, 147-153.

Neumann, A. U., Lam, N. P., Dahari, H. D., Gretch, I., Wiley, T. E., Layden, T. J. and

Perelson, A. S. (1998). HCV dynamics in vivo and the antiviral efficacy of

interferon alfa therapy. Science, 282, 103-107.

Nie, C., Tian, C., Zhao, L., Petit, P. X., Mehrpour, M. and Chen, Q. (2008). Cysteine

62 of Bax is critical for its conformational activation and its proapoptotic


144

activity in response to H2O2-induced apoptosis. J. Biol. Chem., 283, 15359-

15369.

Nomura-Takigawa, Y., Nagano-Fujii, M., Deng, L., Kitazawa, S., Ishido, S., Sada, K.

and Hota, H. (2006). Non-structural protein 4A of Hepatitis C virus

accumulates on mitochondria and renders the cells prone to undergoing

mitochondria-mediated apoptosis. J. Gen. Virol., 87, 1935-1945.

Oltvai, Z. N., Milliman, C. L. and Korsmeyer, S. J. (1993). Bcl-2 heterodimerizes in

vivo with a conserved homolog, Bax, that accelerates programmed cell death.

Cell, 74, 609-619.

Owen, R. A., Molon-Noblot, S., Hubert, M. F., Kindt, M. V., Keenan, K. P. and

Eydelloth, R. S. (1994). The morphology of juxtaglomerular cell hyperplasia

and hypertrophy in normotensive rats and monkeys given an angiotensin II

receptor antagonist. Toxicol. Pathol., 22, 606-19.

Ozben, T. (2007). Oxidative stress and apoptosis: impact on cancer therapy. J.

pharma. Sci., 96, 2181-2196.

Palomares-Jerez, M. F., Nemesio,H. and Villalaín J. (2012). Interaction with

membranes of the full C-terminal domain of protein NS4B from

Hepatitis C virus. Biochim. Biophys. Acta., 1818, 2536-2549.

Park, S. E., Park, C., Kim, S. H., Hossain, M. A., Kim, M. Y., Chung, H. Y., Son, W.

S., Kim, G. Y., Choi, Y. H. and Kim, N. D. (2009). Korean red ginseng extract

induces apoptosis and decreases telomerase activity in human leukemia cells.

J. Ethnopharmacol., 121, 304-312.


145

Pasquier, C., Bujan, L., Daudin, M., Righi, L., Berges, L., Thauvin, L., Berrebi, A.,

Massip, P., Puel, J. and Izopet, J. (2003). Intermittent detection of hepatitis C

virus (HCV) in semen from men with human deficiency virus type 1 (HIV-1)

and HCV. J. Med. Virol., 69, 344-349.

Pekow, J. R., Bhan, A. K., Zheng, H. and Chung, R. T. (2007). Hepatic steatosis is

associated with increased frequency of hepatocellular carcinoma in patients

with hepatitis C-related cirrhosis. Cancer, 109, 2490-2496.

Penin, F., Brass, V., Appel, N., Ramboarina, S., Montserret, R., Ficheux, D., Blum, H.

E., Bartenschlager, R. and Moradpour, D. (2004). Structure and function of

the membrane anchor domain of hepatitis C virus nonstructural protein 5A. J.

Biol. Chem., 279, 40835-40843.

Penin, F. and Dubuisson, J. (2004). Structural biology of hepatitis C virus.

Hepatology, 39, 5-19.

Piccoli, C., Scrima, R., Quarato, G., D'Aprile, A., Ripoli, M., Lecce, L., Boffoli, D.,

Moradpour, D. and Capitanio, N. (2007). Hepatitis C virus protein expression

causes calcium-mediated mitochondrial bioenergetic dysfunction and nitro-

oxidative stress. Hepatology, 46, 58-65.

Pileri, P., Uematsu, Y., Campagnoli, S., Galli, G., Falugi, F., Petracca, R., Weiner, A.

J., Houghton, M., Rosa, D., Grandi, G. and Abrignani, S. (1998). Binding of

hepatitis C virus to CD81. Science, 282: 938-941.

Pisarev, A. V., Shirokikh, N. E. and Hellen, U. T. (2005). Translation initiation by

factorindependent binding of eukaryotic ribosomes to internal ribosomal entry

sites. C. R. Biol., 328, 589-605.


146

Pitot, H. C. (1993). The molecular biology of carcinogenesis. Cancer, 72, 962-970.

Pop, C. and Salvesen, G. S. (2009). Human caspases: activation, specificity, and

regulation. J. Biol. Chem., 284, 21777-21781.

Prikhod'ko, E. A., Prikhod'ko, G. G., Sieqel, R. M., Thompson, P., Major, M. E. and

Cohen, J. I. (2004). The NS3 protein of hepatitis C virus induces caspase-8-

mediated apoptosis independent of its protease or helicase activities. Virology,

329, 53-67.

Prince, A. M., Brotman, B., Grady, G. F., Kuhns, W. J., Hazzi, C., Levine, R. W. and

Millian, S. J. (1974). Long-incubation post-transfusion hepatitis without

serological evidence of exposure to hepatitis-B virus. Lancet, 2, 241-246.

Qadri, I., Iwahashi, M., Capasso, J. M., Hopken, M.W., Flores, S., Schaack, J. and

Simon, F.R. (2004). Induced oxidative stress and activated expression of

manganese superoxide dismutase during hepatitis C virus replication: role of

JNK,p38 MAPK and AP-1. Biochem. J., 378, 919-928.

Qadri,I., Iwahashi, M., Kullak-Ublick, G. A. and Simon, F. R. (2006). Hepatocyte

Nuclear Factor (HNF) 1 and HNF4 Mediate Hepatic Multidrug Resistance

Protein 2 Up-Regulation during Hepatitis C Virus Gene Expression. Mol.

Pharmacol., 70, no. 2.

Qi, F., Li, A., Zhao, L., Xu, H., Inagaki, Y., Wang, D., Cui, X., Gao, B., Kokudo, N.,

Nakata, M. and Tang, W. (2010). Cinobufacini, an aqueous extract from Bufo

bufo gargarizans Cantor, induces apoptosis through a mitochondria-mediated

pathway in human hepatocellular carcinoma cells. J. Ethnopharmacol., 128,

654-661.


147

Quarato, G., Scrima, R., Agriesti, F., Moradpour, D., Capitanio, N. and Piccoli, C.

(2013). Targeting mitochondria in the infection strategy of the hepatitis C

virus. Int. J. Biochem. Cell. Biol., 45, 156-166.

Qureshi, S., Batool, U., Iqbal, M., Qureshi, O., Kaleem, R., Aziz, H. and Azhar, M.

(2009). Response rates to standard interferon treatment in HCV genotype 3a.

J. Ayub. Med. Coll. Abbottabad., 21, 10-14.

Raja, N. S. and Janjua, K. A. (2008). Epidemiology of hepatitis C virus infection in

Pakistan. J. Microbiol. Immunol. Infect., 41, 4-8.

Reed, J. C. and Pellecchia, M. (2005). Apoptosis-based therapies for hematologic

malignancies. Blood, 106, 408-418.

Rizzetto, M., Canese, M. G., Aricó, S., Crivelli, O., Trepo, C. and Verme, G. (1977).

Immunofluorescence detection of a new antigen antibody system associated

to the hepatitis B virus in the liver and in the serum of HBsAg carriers. Gut.,

18, 997-1003.

Sakahira, H., Enari, M. and Nagata, S. (1998). Cleavage of CAD inhibitor in CAD

activation and DNA degradation during apoptosis. Nature, 391, 96-99.

Sala, J., Cardena, E., Holgado, M. C., Anez, C., Perez, P., Perinan, R. and Capafons,

A. (2008). The contributions of Ramon y Cajal and other Spanish authors to

hypnosis. Int. J. Clin. Exp. Hypn., 56, 361-72.

Saladin, K. (2012). Just the FACTS101 E-Study Guide For: Anatomy & Physiology:

A Unity of Form and Function. Cram., 101.


148

Scheel, T. K. and Rice, C. M. (2013). Understanding the hepatitis C virus life cycle

paves the way for highly effective therapies. Nat. Med., 19, 837-849.

Schiff, E. R. (2007). Schiff's Diseases of the Liver. 2 Lippincott Williams & Wilkins.

Schreiber, G. B., Busch, M. P., Kleinman, S. H. and Korelitz, J. J. (1996). The risk of

transfusion transmitted viral infections. The retrovirus epidemiology donor

study. N. Engl. J. Med., 334, 1685-1690.

Schultz, R. (2005). Hepatitis A outbreak in Central Australia Northern Territory. Dis.

Control Bulletin., 12, 4-7.

Sebbagh, M., Renvoize, C., Hamelin, J., Riche, N., Bertoglio, J. and Breard, J. (2001).

Caspase-3-mediated cleavage of ROCK I induces MLC phosphorylation and

apoptotic membrane blebbing. Nat. Cell. Biol., 3, 346-352.

Serebrov, V., Pyle, A. M. (2004). Periodic cycles of RNA unwinding and pausing by

hepatitis C virus NS3 helicase. Nature, 430, 476-480.

Shaik, M. S., Chatterjee, A. and Singh, M. (2004). Effects of monensin liposomes on

the cytotoxicity, apoptosis and expression of multidrug resistance genes in

doxorubicin-resistant human breast tumour (MCF-7/dox) cell-line. J. Pharm.

Pharmacol., 56, 899-907.

Shepard, C. W., Finelli, L. and Alter, M. J. (2005). Global epidemiology of hepatitis

C virus infection. Lancet Infect. Dis., 5, 558-67.


149

Shin, E. C., Shin, J. S., Park, J. H., Kim, J. J., Kim, H. and Kim, S. J. (1998).

Expression of Fas-related genes in human hepatocellular carcinomas. Cancer

Lett., 134, 155-162.

Simmonds, P., Bukh, J., Combet, C., Deleage, G., Enomoto, N., Feinstone, S., Halfon,

P., Inchauspe, G., Kuiken, C., Maertens, G., Mizokami, M., Murphy, D. G.,

Okamoto, H., Pawlotsky, J. M., Penin, F., Sablon, E., Shin-I, T., Stuywer, L.

J., Thiel, H. J., Viazov, S., Weiner, A. J. and Widell, A. (2005). Consensus

proposals for a unified system of nomenclature of hepatitis C virus genotypes.

Hepatology, 42, 962-973.

Strickland, G. T., Mohamed, M. K., Abdel-Hamid, M., Mikhail, N. N., Abdel-Aziz,

F., Mehat, A., Maqder, L. S. and Fix, A. D. (2005). Intrafamilial transmission

of hepatitis C in Egypt. Hepatology, 42, 683-687

Takamizawa, A., Mori, C., Fuke, I., Manabe, S., Murakami, S., Fujita, J., Onishi, E.,

Andoh, T., Yoshida, I. and Okayama, H. (1991). Structure and organization of

the hepatitis C virus genome isolated from human carriers. J. Virol., 65, 1105-

1113.

Tang, H. and Grise, H. (2009). Cellular and molecular biology of HCV infection and

hepatitis. Clin. Sci.,(Lond), 117, 49-65.

Tariq, H., Manzoor, S., Parvaiz, F., Javed, F., Fatima, K. and Qadri, I. (2012). An

overview: in vitro models of HCV replication in different cell cultures. Infect.

Genet. Evol., 12, 13-20.

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Takamizawa%20A%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Mori%20C%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Fuke%20I%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Manabe%20S%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Murakami%20S%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Fujita%20J%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Onishi%20E%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Andoh%20T%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Yoshida%20I%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Okayama%20H%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract


150

Tatsuo, K., Osamu, Y. and Masao, O. (2013). Hepatitis C Virus and Hepatocellular

Carcinoma. Biology, 2, 304-316.

Tellinghuisen ,T. L. and Rice, C. M. (2002). Interaction between hepatitis C virus

proteins and host cell factors. Curr. Opin. Microbiol., 5, 419-427.

Thomas, M., Finnegan, C. E., Rogers, K. M., Purcell, J. W., Trimble, A., Johnston, P.

G. and Boland, M. P. (2004). STAT1: a modulator of chemotherapy-induced

apoptosis. Cancer Res., 64, 8357-8364.

Timm, J. and Roggendorf, M. (2007). Sequence diversity of hepatitis C virus:

implications for immune control and therapy. World J. Gastroenterol., 13,

4808-4817.

Valva, P., De Matteo, E., Galoppo, M. C., Gismondi, M. I. and Preciado, M. V.

(2010). Apoptosis markers related to pathogenesis of pediatric chronic

hepatitis C virus infection: M30 mirrors the severity of steatosis. J. Med. Virol.

82, 949-957.

Waheed, Y., Shafi, T., Zaman, Safi, S. and Qadri, I. (2009). Hepatitis C virus in

Pakistan: A systematic review of prevalence, genotypes and risk factors.

World J. Gastroenterol., 15, 5647-5653.

Wake, K. (2004). Karl Wilhelm Kupffer And His Contributions To Modern

Hepatology. Comp. Hepatol., 3 Suppl 1, S2.

Wang, A. G., Moon, H. B., Kim, J. M., Hwang, S. B., Yu, D. Y. and Lee, D. S.

(2006). Expression of hepatitis C virus nonstructural 4B in transgenic mice.

Exp. Mol. Med., 38, 241-246.

http://www.virologyj.com/sfx_links?ui=1743-422X-8-161&bibl=B9


151

Wang, J., Zhou, W., Yuan, H. and Wang, Y. (2008). Characterization of a novel

fungal chitosanase Csn2 from Gongronella sp. JG. Carbohydr. Res., 343,

2583-2588.

Wei, M. C., Zong, W. X., Cheng, E. H., Lindsten, T., Panoutsakopoulou, V., Ross, A.

J., Roth, K. A., MacGregor, G. R., Thompson, C. B. and Korsmeyer, S. J.

(2001). Proapoptotic BAX and BAK: a requisite gateway to mitochondrial

dysfunction and death. Science, 292, 727- 735

Williams, R. (2006). Global challenges in liver disease. Hepatology, 44, 521-526.

Wolk, B., Sansonno, D., Krausslich, H. G., Dammacco, F., Rice, C. M., Blum, H. E.

and Moradpour, D. (2000). Subcellular localization, stability, and trans-

cleavage competence of the hepatitis C virus NS3-NS4A complex expressed

in tetracycline-regulated cell lines. J. Virol., 74, 2293-2304.

Yamashita, T., Kaneko, S., Shirota, Y., Qin, W., Nomura, T., Kobayashi, K. and

Murakami, S. (1998). RNA-dependent RNA polymerase activity of the soluble

recombinant hepatitis C virus NS5B protein truncated at the C-terminal

region. J. Biol. hem., 273, 15479-15486.

Zaidi, N., Kanwal, N., Ghazal, A., Fatima, K., Javed, F. and Qadri, I. (2012).

Phylogenetic and structural analysis of HCV nonstructural protein 4A from

Pakistani patients. Virus Genes, 44, 1-7.

Zekri, A. R., Bahnassy, A. A., Hafez, M. M., Hassan, Z. K. and Kamel, M. (2011).

Characterization of chronic HCV infection-induced apoptosis. Comp.

Hepatol., 10, 1476-5926


152

Zenetti, A. R., Tanzi, E. and Newell, M. L. (1999). Mother to infant transmission of

hepatitis C virus. J. Hepatol., 31, 96-100.

Zhao, C. , Ma Z., Harrison TJ., Feng R., Zhang C., Fan J., Ma H., Li M., Song A. and

Wang, Y. (2009). A novel genotype of hepatitis E virus prevalent among

farmed rabbits in China. J. Med. Virol., 81, 1371-1379.

Zhao, P., Han, T., Guo, J. J., Zhu, S. L., Wang, J., Ao, F., Jing, M. Z., She, Y. L., Wu,

Z. H. and Ye, L. B. (2012). HCV NS4B induces apoptosis through the

mitochondrial death pathway. Virus Res., 169, 1-7.

Zhu, H. and Briggs, J. M. (2011). Mechanistic role of NS4A and substrate in the

activation of HCV NS3 protease. Proteins, 79, 2428-2443.

Zhu, H., Dong, H., Eksioqlu, E., Hemminq, A., Cao, M., Crawford, J. M., Nelson, D.

R. and Liu, C. (2007). Hepatitis C virus triggers apoptosis of a newly

developed hepatoma cell line through antiviral defense system.

Gastroenterology, 133, 1649-1659.

Evaluation of the cellular and molecular effects of HCV ...

Documents

Transcript of Evaluation of the cellular and molecular effects of HCV ...