Cardiovascular pharmacology

Post-infarct treatment with [Pyr1]apelin-13 improves myocardialfunction by increasing neovascularization and overexpressionof angiogenic growth factors in rats

Yaser Azizi a, Mahdieh Faghihi a,n, Alireza Imani a, Mehrdad Roghani b, Ali Zekri c,Maryam Beigom Mobasheri c, Tayebeh Rastgar d, Maryam Moghimian e

a Department of Physiology, School of Medicine, Tehran University of Medical Sciences, Tehran, Islamic Republic of Iranb Neurophysiology Research Center, Shahed University, Tehran, Islamic Republic of Iranc Department of Medical Genetics, School of Medicine, Tehran University of Medical Sciences, Tehran, Islamic Republic of Irand Department of Anatomy, School of Medicine, Tehran University of Medical Sciences, Tehran, Islamic Republic of Irane Department of Physiology, School of Medicine, Gonabad University of Medical Sciences, Gonabad, Islamic Republic of Iran

a r t i c l e i n f o

Article history:Received 17 December 2014Received in revised form21 April 2015Accepted 22 April 2015Available online 1 May 2015

Keywords:[Pyr1]apelin-13Myocardial angiogenesisVEGFAAng-1eNOSRat

a b s t r a c t

Ischemic heart disease is the leading cause of mortality in the world. Angiogenesis is important forcardiac repair after myocardial infarction (MI) as restores blood supply to the ischemic myocardium andpreserves cardiac function. Apelin is a peptide that has been recently shown to potentiate angiogenesis.The aim of this study was to investigate angiogenic effects of [Pyr1]apelin-13 in the rat model of post-MI.Male Wistar rats (n¼36) were randomly divided into three groups: (1) sham (2) MI and (3) MI treatedwith [Pyr1]apelin-13 (MIþApel). MI animals were subjected to 30 min left anterior descending coronaryartery (LAD) ligation and 14 days of reperfusion. Twenty-four hours after LAD ligation, [Pyr1]apelin-13(10 nmol/kg/day) was administered i.p. for 5 days. Hemodynamic functions by catheter introduced intothe left ventricle (LV), myocardial fibrosis by Masson's trichrome staining, gene expression of vascularendothelial growth factor-A (VEGFA), VEGF receptor-2 (Kdr), Ang-1 (angiopoietin-1), Tie2 (tyrosine kinasewith immunoglobulin and epidermal growth factor homology domains 2) and eNOS by Real-timepolymerase chain reaction (Real-Time PCR) and myocardial angiogenesis by CD31 imunostaining wereassessed at day 14 post-MI. Post-infarct treatment with [Pyr1]apelin-13 improved LV function anddecreased myocardial fibrosis. [Pyr1]apelin-13 treatment led to a significant increase in the expression ofVEGFA, Kdr, Ang-1, Tie2 and eNOS. Further, treatment with [Pyr1]apelin-13 promoted capillary density.[Pyr1]apelin-13 has angiogenic and anti-fibrotic activity via formation of new blood vessels andoverexpression of VEGFA, Kdr, Ang-1, Tie2 and eNOS in the infarcted myocardium which could in turnrepair myocardium and improve LV function.

& 2015 Elsevier B.V. All rights reserved.

1. Introduction

Myocardial infarction (MI), the main cause of morbidity andmortality in the developed countries, is the most usual representation

of cardiovascular disease (Huusko et al., 2010; Mitsos et al., 2012). MI isfollowed by left ventricular (LV) enlargement and reduced capillarydensity in the infracted myocardium. Studies have indicated that thecapillary density in the border zone is profoundly decreased ascompared to the remote areas of the infracted myocardium (Fukudaet al., 2004). There have been major advances for preventing andtreating cardiovascular diseases such as coronary artery bypass graft-ing. Nevertheless, many patients experience disabling signs in spite ofintense pharmacotherapy which makes them unsuitable for invasiverevascularization therapies (Grass et al., 2006; Mitsos et al., 2012).Therefore, there stands a need for novel therapeutic strategies to treatthese patients. However, the challenge to improve blood flow to theischemic heart has led to the development of many innovativestrategies. Among them, the use of several compounds to increase

Contents lists available at ScienceDirect

journal homepage: www.elsevier.com/locate/ejphar

European Journal of Pharmacology

http://dx.doi.org/10.1016/j.ejphar.2015.04.0340014-2999/& 2015 Elsevier B.V. All rights reserved.

Abbreviations: (Ang-1), angiopoietin-1; (Apel), [Pyr1]apelin-13; (MI), myocardialinfarction; (LAD), left anterior descending coronary artery; (Tie2), tyrosine kinasewith immunoglobulin and epidermal growth factor homology domains 2; (VEGF),Vascular Endothelial Growth Factors; (HIF-1α), Hypoxia-Inducible Factor-1α;(NOS), nitric oxide syntheses; (NO), Nitric oxide; (GAPDH), Glyceraldehyde 3-phosphate dehydrogenase; (LV), Left ventricle; (LVEDP), Left ventricular end-diastolic pressure; (LVSP), Left ventricular systolic pressure; (dLVP), developed leftventricular pressure; (HR), heart rate; (RPP), Rate pressure product

n Corresponding author. Tel./fax: þ98 21 66419484.E-mail address: faghihim@sina.tums.ac.ir (M. Faghihi).

European Journal of Pharmacology 761 (2015) 101–108

the formation of new blood vessels has captured much attention.(Mitsos et al., 2012; Renault and Losordo, 2007).

Angiogenesis, the formation of new capillaries from pre-existing vessels, plays an essential role in a variety of physiologicaland pathological processes such as tumor growth and revascular-ization of the myocardium following MI (Bikfalvi, 2006; Wanget al., 2012; Zaitone and Abo-Gresha, 2012). As a compensatorymechanism, it takes place after ischemia to restore blood flow tothe ischemic myocardium and eventually preserve cardiac func-tion (Heil and Schaper, 2004; Zaitone and Abo-Gresha, 2012). Onthe other hand, impaired angiogenesis contributes to the myocar-dial fibrosis and myocardial dysfunction in idiopathic dilatedcardiomyopathy (Ohtsuka et al., 2005).

Evidences have shown that cytokines such as vascular endothe-lial growth factors (VEGF), angiopoietin-1 (Ang-1) and transcrip-tion factors like hypoxia-inducible factor-1α (HIF-1α) act asangiogenic molecules (Fagiani and Christofori, 2013; Jaumdallyet al., 2010; Tuo et al., 2008). VEGF and Ang-1 activate angiogenicand prosurvival signaling pathways and attract stem cell homingto the affected area (Su et al., 2009; Tao et al., 2011). Previousstudies have demonstrated that VEGF stimulates Akt/PKB, whichin turn phosphorylates and activates eNOS (Yamahara et al., 2003).Nitric oxide (NO) via cyclic GMP has been seen to participate inthis angiogenic effect of VEGF (Fukuda et al., 2006). VEGF is animportant regulator of angiogenesis, which stimulates prolifera-tion, migration, survival and proteolytic activity of endothelialcells (Huusko et al., 2010). In addition, Angiopoietin/Tie systemalso plays a significant role in the formation of vessels. Ang-1binds to Tie2 receptor in the endothelium and phosphorylates it,thereby preventing the leakage of plasma from the vessels.(Brindle et al., 2006; Fagiani and Christofori, 2013; Shyu et al.,2003).

Apelin, an adipocytokine, was first isolated from bovine sto-mach tissue extracts by Tatemoto et al (1998). This endogenouspeptide is a ligand for the apelin angiotension receptor-like 1 (APJ)(Dai et al., 2006). Apelin which is widely expressed in theendothelium, binds to and activates APJ receptors distributed inendothelial cells, myocardial cells, and some smooth muscle cells(Ashley et al., 2005; Sheikh et al., 2008). Studies have indicatedthat NOS inhibition can decrease [Pyr1]apelin-13 induced bloodflow in forearm. This implies the importance of NO as a signalingmolecule after activation of APJ in the endothelium (Japp et al.,2008, 2010). Apelin/APJ system has been found to promoteembryonic angiogenesis (Kalin et al., 2007). Apelin deficiencydecreases vascular sprouting and impairs sprouting of endothelialprogenitor cells, and in vivo myocardial angiogenesis (Wang et al.,2013). Furthermore, low serum apelin levels following MI havealso been documented. (Kuklinska et al., 2010; Weir et al., 2009).

Based on these reports, we designed this study to evaluate theeffects of post-MI treatment with apelin on VEGFA, VEGF receptor-2 (Kdr), Ang-1, Tie2 and eNOS, myocardial fibrosis and cardiacfunction in the MI rats.

2. Materials and methods

2.1. Animals

The present study was performed in accordance with theguidelines for the care and use of laboratory animals publishedby the US National Institutes of Health (NIH Publication No.85–23,revised 1996). The experimental protocol was approved by theinstitutional care and use committee of Tehran University ofMedical Sciences (Tehran, Iran). In this study, 36 male Wistar rats(weighing 250–300 g) were housed in controlled environmentalconditions (2272 1C; light–dark cycle 7 AM to 7 PM). Animals had

free access water and standard laboratory food ad libitum. Ani-mals were acclimated to environment for 7 days before theexperiments.

2.2. Rat model of myocardial ischemia and reperfusion

Acute intramural (focal) myocardial infarction was induced byligation of the left anterior descending coronary artery (LAD). Afterinduction of anesthesia (thiopental sodium; 60 mg/kg i.p.), theanimals were placed in the supine position and body temperaturewas maintained as close as possible to 37 1C by means of thermalpad and heating lamp. Next, they were intubated and ventilated byroom air using a rodent ventilator (tidal volume 2–3 ml, respira-tory rate 65–70 per minute, Harvard rodent ventilator model 683,Holliston, MA, USA). Left intercostal thoracotomy (between thefourth and fifth costal space) was performed under sterile condi-tions. The heart was exposed and pericardium was incised. Acuteintramural (focal) MI was produced by ligation of the LAD with6–0 polypropylene suture approximately 1–2 mm distal from itsorigin. Both ends of the silk suture were then passed through asmall vinyl tube, and the LAD was occluded by pulling the snare,which was fixed by clamping the tube with a mosquito hemostat.Successful LAD occlusion was characterized by ST segment ele-vation immediately after ligation and cyanosis of the affectedmyocardium. After 30 min of LAD occlusion, the occluder wasremoved and restoration of blood flow was verified. After comple-tion of all surgical procedures, the chest was closed in layers. Thelungs were inflated by increasing positive end expiratory pressureand the animals were removed from the ventilator and allowed torecover. The sham operated rats underwent the same procedure ofthoracotomy, without the LAD ligation. This protocol resultedin the formation of three groups: sham-operated group (sham,n¼12), MI group (MI, n¼12), and apelin-treated MI group(MIþApel, n¼12). Post-operative, rats were hydrated with normalsaline (s.c) and received buprenorphine (0.05 mg/kg) as an analge-sic. Tetracycline was used as post-operative antibiotic. [Pyr1]apelin-13 (Sigma) was dissolved in normal saline and adminis-tered i.p. 24 h after induction MI (10 nmol/kg/day, once a day) for5 days (Azizi et al., 2013). Sham and MI animals received normalsaline.

2.3. Assessment of myocardial function

Fourteen days after surgery, cardiac hemodynamic parameterswere measured. For this, rats were anesthetized with thiopentalsodium and ventilated. A small incision was made to the right ofthe midline in the neck. The right common carotid artery wasexposed and cannulated with a PE50 catheter connected to thePowerlab system via pressure transducer. Catheter was pusheddown until it had reached the left ventricular lumen. Left ven-tricular systolic pressure (LVSP), left ventricular end diastolicpressure (LVEDP), developed left ventricular pressure (dLVP), heartrate (HR), rate pressure product (RPP; HR�dLVP), the maximumrate of left ventricle systolic pressure (þdp/dt) and the minimumrate of left ventricle systolic pressure (�dp/dt) were all monitoredand recorded by Powerlab data acquisition system (AD Instrument,Australia).

2.4. Assessment of myocardial fibrosis

After measurement of hemodynamic parameters, the chest wasopened and the hearts were arrested during diastole by intraven-tricular injection of KCL (10%). Animal were sacrificed under deepanesthesia and the hearts were rapidly harvested. After washing innormal salin, hearts were fixed in 10% neutral buffered formalinfor 24–48 h and embedded in paraffin. Transverse sections (6 μm)

Y. Azizi et al. / European Journal of Pharmacology 761 (2015) 101–108102

of hearts were prepared using a microtome. Next, sections weredeparaffinized and stained with Masson's trichrome (Sigma-Aldrich Co., MO, USA) for measurement of fibrosis. The collagenvolume fraction in the infarcted and peri-infarcted areas of LV wascalculated by measuring the optical density of fibrotic area usingPhotoshop software (Ver. 7.0, Adobe System, San Jose, CA, USA).Myocardial fibrosis was expressed as a percentage of fibrotic areato left ventricular area (% of LV) in an average of 5 sections ineach heart.

2.5. Real-time polymerase chain reaction (Real-Time PCR)

After measurement of hemodynamic parameters, the myocar-dial samples of some animals from each group (n¼5) wereimmediately removed, rinsed in PBS, frozen in liquid nitrogenand stored at �80 1C for evaluation of gene expression. Total RNAwas extracted from frozen peri-infarct area and border zone of LVfree wall using RNX-Plus kit (Cat. No: RN7713C, Cinnagen, Iran).Complementary DNA (cDNA) was synthesized from 1000 ngof total RNA using a Rocket Script RT PreMix (BioNeer). cDNAsamples were then used as templates for quantitative reversetranscription polymerase chain reaction (qRT-PCR). Quantificationof gene expression was performed using the Rotor-Gene 6000(Qiagen). Real-Time PCR analysis was provided by the use ofAccuPower 2�Green star quantitative PCR Master Mix (BioNeer).The value for each sample was an average of three independentPCR measurements. Glyceraldehyde 3-phosphate dehydrogenase(GAPDH) was used as a housekeeping gene. The relative expressionof VEGFA, Kdr, Ang-1, Tie2 and eNOS were calculated using the2�ΔΔCT method (Pfaffl et al., 2002). The specific primer sequencesare listed in Table 1.

2.6. Immunohistochemistry

On day-14 postMI, capillary density (number/mm2) was mea-sured using a blood vessel staining kit peroxidase system (Cat No.ECM 590, Millipore, USA & Canada) for immunohistochemicalstaining of cardiac sections. The primary antibody used weremonoclonal mouse anti-human CD31, an endothelial cell marker;which cross-reacts with rabbit tissues. Using a light microscope(�400), vascular density was determined from the stained sec-tions by counting the number of vessels within the peri-infarctarea, ischemic and border zone, and image of each section wascaptured using a digital camera. The vessels in 6 random fieldswithin each section of 6 experimental hearts from each groupwere counted in a blinded fashion. The number of vessels in eachfield was averaged and expressed as the number of vessels/mm2.

2.7. Statistical analysis

All data are presented as means7S.E.M. All statistical analysiswas performed by SPSS software (Version 15.0, SPSS Inc., Chicago,IL). One-way ANOVA was used to compare mean differencesamong the sham, MI and MIþApel groups followed by Tukeypost-hoc test. A P-value less than 0.05 were considered statisticallysignificant.

3. Results

3.1. Effect of apelin on myocardial function

14 days after surgery, functional recovery of MI hearts wasmeasured by LVEDP, LVSP, dLVP, RPP, þdp/dt and �dp/dt. Hemo-dynamic data are shown in Fig. 1. Our results showed that therewas significant impairment in myocardial function in MI animals

in comparison with the sham group. Myocardial function wasimproved in MI animals by a 5-day treatment with apelin-13. For5 days could improve myocardial function in MI animals. As shownin Fig. 1, LVSP, dLVP and RPP were markedly declined and LVEDPwas significantly increased in MI animals when compared to thesham animals (Po0.001). Treatment with apelin significantlydecreased LVEDP (Po0.05), and increased dLVP (Po0.05) andRPP (Po0.001) as compared to MI animals (Fig. 1A–D). Also, ourresults showed that induction of MI decreased myocardial con-tractility (þdp/dt) and relaxation (�dp/dt) when compared to thesham group (Po0.001). Treatment with Apelin-13 improved both,contractility and relaxation (Po0.01) when compared to the MIgroup but could not reverse 7dp/dt (Po0.01) to the sham level(Fig. 1E and F).

3.2. Effect of apelin on myocardial fibrosis

Masson's trichrome staining showed a significant increase infibrosis and collagen deposition in MI animals than sham group(Po0.001). As shown in Fig. 2A and B, 5-day apelin treatm-ent markedly reduced interstitial fibrosis when compared to MIgroup (28.09071.612% vs. 10.71270.765% in MIþApel group,Po0.001). Moreover, there was seldom collagen in sham group(Fig. 2B).

3.3. Effect of apelin on gene expression

We investigated the potential mechanisms for apelin's actionon the mRNA expression of growth factors involved in myocardialangiogenesis. A total of 15 hearts were used for Real-Time PCRanalysis of mRNA expression of VEGFA, Kdr, Ang-1, Tie2 and eNOS.Fig. 3 shows that 5-day treatment with apelin-13 significantlyincreased VEGFA, Kdr, Ang-1, Tie2 and eNOS in the peri-infarct areaand border zone of LV area in MIþApel animals when compared tosham and MI animals (Po0.001 for all of them). Except for Ang-1,our data analysis showed no significant differences in mRNAexpression between MI and sham animals (Po0.01).

3.4. Effect of apelin on capillary density

The role of apelin-13 in angiogenesis after induction of MI wasassessed by CD31/PECAM-1 immunohistochemical staining.Representative photographs of stained sections are shown inFig. 4A–C. Myocardial sections of apelin-13 treated animalsshowed increased CD31-positive microvessels (capillary density)than sham and MI groups (Fig. 4D). Quantitative analysis of datashowed more vessels in MI group than in sham group (Po0.05).These results demonstrated that apelin-13 treatment promotedrevascularization by increasing capillary density in the LV after MI.

Table 1The sequence of primers used in Real-Time PCR.

Gene name Primer sequence PCR product size

VEGFA F: 50-CCATGAACTTTCTGCTCTCTT-30 497R: 50-GGTGAGAGGTCTAGTTCCCGA-30

Kdr F: 50-TGGTGTGTGGTCTTTTGGTG-30 152R: 50-GGTACATTTCTGGGGTGGTG-30

Ang-1 F: 50- CTGCAGAAGCAACAACTGGA -30 196R: 50- CCTTTTTGGGTTCTGGCATA -30

Tie2 F: 5’-CCTAGAGCCAGAGACT-30 309R: 5-0GCCTTCCTGTTTAGGG-3'

eNOS F: 50- CACGAGGACATTTTCGGACT -30 201R: 50- ACCTAATGAAGCGACGCAGT -30

GAPDH F: 50-TGGCCTCCAAGGAGTAAGAAAC-3' 69R: 50-GGCCTCTCTCTTGCTCTCAGTAT-30

Y. Azizi et al. / European Journal of Pharmacology 761 (2015) 101–108 103

4. Discussion

In the present study, we investigated the potential mechanismsfor apelin's action on myocardium in the rat model of post-MImyocardial dysfunction. For the first time, this study has shownthat 5-day treatment with apelin-13 resulted in improved myo-cardial function, increased capillary density and mRNA expressionof VEGFA, VEGF receptor-2 (Kdr), Ang-1, Tie2 and eNOS anddecreased collagen deposition and myocardial fibrosis, after acuteintramural MI induction.

Our previous study has demonstrated that 5-day treatmentwith apelin-13 after 24 h induction of acute intramural (focal) MI,has long term cardioprotective effects related to its antioxidantproperties and production of NO (Azizi et al., 2013). So here, we

have further studied the mechanisms for the long-term effects ofapelin-13 in improving of myocardial function. Our results showedthat post-infarct treatment with apelin-13 significantly improvesmyocardial performance. It markedly increased LVSP, dLVP andRPP and decreased LVEDP in comparison with the MI group. Inaddition, we found that apelin improved myocardial contractilityand relaxation. Likewise, Li et al. showed that treatment of post-MImice with myocardial injection of apelin overexpressing bonemarrow cells significantly improved end systolic pressure, þdp/dt and �dp/dt and (Li et al., 2013). Furthermore, they alsoreported that treatment with apelin-13 (1 mg/kg/day) for 3 daysbefore MI and for 14 days post-MI, significantly improved cardiaccontractility in post-MI mice and increased end systolic pressureand end systolic pressure–volume relationships (Li et al., 2012).

Sham MI MI+Apel

0

1

2

3

4

5

6***

$

Groups

LV

ED

P(m

mH

g)

Sham MI MI+Apel

0

20

40

60

80

100

120

140

****

Groups

LV

SP

(mm

Hg

)

Sham MI MI+Apel

0

5000

10000

15000

20000

25000

30000

35000

40000

45000

50000

***

$$$

Groups

RP

P

Sham MI MI+Apel

0

25

50

75

100

125

150

***

**$

Groups

dL

VP

(mm

Hg

)

Sham MI MI+Apel0

500

1000

1500

2000

2500

3000

3500

4000

***

**$$

Groups

+d

p/d

t

Sham MI MI+Apel

-4000

-3500

-3000

-2500

-2000

-1500

-1000

-500

0

*****$$

Groups

-dp

/dt

Fig. 1. Myocardial function (n¼8). (A) LVSP; left ventricular systolic pressure (mmHg). (B) LVEDP, left ventricular end diastolic pressure (mmHg). (C) dLVP, developed leftventricular pressure (mmHg). (D) RPP, rate pressure product. (E)þdp/dt, maximal rate of increase of ventricular pressure and (F) �dp/dt, maximal rate of decrease ofventricular pressure. MI; myocardial infarction, Apel; apelin. Data are presented as means7S.E.M. *Po0.05, **Po0.01 and ***Po0.001 vs. sham group. $Po0.05, $$Po0.01and $$$ Po0.001 vs. MI group.

Y. Azizi et al. / European Journal of Pharmacology 761 (2015) 101–108104

Moreover, we found out that apelin-13 exerts beneficial effects onthe histology of myocardium. As shown in Fig. 2, acute intramural MIinduction has deleterious effects on the myocardial tissue and causesdeposition of collagen and increases myocardial fibrosis. This is in linewith other studies which have reported that after MI, fibrosis isconsiderably increased in the affected myocardium (Wang et al., 2012;Xu et al., 2013; Zeng et al., 2012, 2008). This study reveals that apelin-13 decreases fibrosis 14 days post-MI.

Furthermore, apelin has angiogenic properties (Wang et al.,2013). Activation of APJ has shown to stimulate proliferation andmigration of endothelial cells (Ashley et al., 2005; Sheikh et al.,2008). In this study, we investigated post-infarct treatment effectsof apelin-13 on the gene expression of important angiogenicproteins. VEGF is one of the most important growth factorsinvolved in angiogenesis. As it binds to VEGF receptors especiallyKdr, it causes endothelial cell migration and proliferation andinhibits endothelial cell apoptosis. It stimulates NO productionby activating eNOS. In turn, NO contributes to some endothelialfunctions such as migration, proliferation, anti-apoptosis andvasorelaxation. These events are important processes in theinduction of angiogenesis. Furthermore, NO also induces endothe-lial progenitor cells mobilization (Lakkisto et al., 2010; Mitsoset al., 2012; Zeng et al., 2008). In this study we showed that post-infarct treatment with apelin-13 increases mRNA expression ofVFGFA, Kdr and eNOS in the left ventricular myocardium at day 14

post-MI. Li et al. reported that treatment with apelin-13 upregu-lates VEGF expression and Akt/eNOS phosphorylation 24 h afterischemia in the mice model of MI. Therefore, it is reasonable toinfer that apelin-13 binds to APJ receptor, and increases VEGFA, Kdrand eNOS expression in the endothelial cells which in turn mayincrease endothelial progenitor cell mobilization and endothelialcell migration, proliferation and survival. Through these mechan-isms, apelin can promote myocardial angiogenesis, restore bloodflow to the ischemic area, decrease fibrosis in the interstitium andimprove cardiac function.

It is also well-documented that proteins of angiopoietin (Angs)family such as Ang-1 and Ang-2 and their receptors Tie1 and Tie2are involved angiogenesis (Bikfalvi, 2006; Fagiani and Christofori,2013). Ang-1 binds to Tie2 receptor and phosphorylates it. Ang-1 isan endothelial cell survival factor as it prevents cellular apoptosisvia PI3K/Akt pathway. Furthermore, it has beneficial effects in thesetting of heart diseases and has protective role against ischemicheart disease. Ang-1/Tie2 signaling regulates vascular smoothmuscle cells, endothelial cells and pericyte maturation and is criticalfor the survival, maintenance, stabilization and formation of non-leaky vessels (Fagiani and Christofori, 2013; Zeng et al., 2012).

For the first time, this study showed that post-infarct treatmentwith apelin increases the expression of Ang-1 and Tie2 in the peri-infarct area and border zone of myocardium at day 14 after inductionof MI. We suggest that apelin, via activation of APJ, activates signaling

Sham MI MI+Apel

0

5

10

15

20

25

30

35

40

***

$$$

Groups

Fib

rosis

(%

of

LV

)

Fig. 2. Histological analysis of fibrosis at day 14 after myocardial infarction (n¼6). (A) Transverse sections of the hearts from apex to base stained with Masson's trichrome todetect interstitial fibrosis. Bar 2 mm, 400X magnification. (B) Quantification of interstitial fibrosis. LV; left ventricle, MI; myocardial infarction, Apel; Apelin. Data arepresented as means7S.E.M. ***Po0.001 vs. sham group and $$$Po0.001 vs. MI group.

Y. Azizi et al. / European Journal of Pharmacology 761 (2015) 101–108 105

pathways that cause elevation of Ang-1 and Tie2 expression and theirphosphorylation. In turn, it may increase survival of the endothelialcells that activated by VEGF and eNOS. In addition, these endothelialcells may form non leaky tube like structures and increase bloodsupply to the affected myocardium. Thus, by this mechanism it maydecrease fibrosis after MI and improve myocardial function.

Increased angiogenesis and neovascularization are critical pro-cesses in the resupply of myocardium and repair of ischemicdamages to the myocardium after MI. These events ultimately resultin improved myocardial function. As depicted in Fig. 4, treatmentwith apelin-13 increases myocardial capillary density and promotesformation of microvessels in the affected myocardium. This in turn

is accompanied by decreased collagen deposition in the affectedmyocardium and an improved cardiac function.

The post-MI heart has marked alteration in both, preload andafterload. Therefore, pressure–volume loop analysis is ideal. One ofthe limitations of this study was pressure–volume loop measure-ment. Western blot is another limitation of our study.

5. Conclusion

Taken together, our findings suggest that post-infarct treatmentwith apelin-13 can improve myocardial function, its contractility

VEGFA

Sham MI MI+Apel

0

1

2

3

4

5

6

***$$$

Groups

fold

of

ch

en

ges v

s. S

ham

Kdr

Sham MI MI+Apel

0

1

2

3

4

5

25

30

35

40

45

50

***$$$

Groups

fold

of

ch

en

ge

s v

s. S

ha

m

Ang-1

Sham MI MI+Apel

0.0

0.5

1.0

1.5

2.0

2.5

**

***$$$

Groups

fold

of

ch

en

ge

s v

s. S

ha

m

Tie2

Sham MI MI+Apel

0

1

2

3

4

5

50

60

70

80

90

100

***$$$

Groups

fold

of

ch

en

ges v

s. S

ham

eNOS

Sham MI MI+Apel

0

1

2

3

4

5

20

25

30

35

40

***$$$

Groups

fold

of

ch

en

ges v

s. S

ham

Fig. 3. Effects of apelin-13 on VEGFA, Kdr, Ang-1, Tie2 and eNOS mRNA expression in LV of sham and peri-infarct area and border zone of LV of MI and MIþApel groups 14days after surgery (n¼4). MI; myocardial infarction, Apel; apelin. Data are presented as means7S.E.M. **Po0.01 and ***Po0.001 vs. sham group. $$$Po0.001 vs. MI group.

Y. Azizi et al. / European Journal of Pharmacology 761 (2015) 101–108106

and relaxation via decreasing myocardial fibrosis. Further, it canpromote angiogenesis by increasing the expression of VEGFA, Kdr,Ang-1, Tie2 and eNOS. Thus, apelin-13 via its angiogenic actions,improves myocardial function, decreases fibrosis and preserves itsstructural integrity. Our results suggest that apelin-13 can be usedas a novel therapy for the treatment of patients with ischemicheart diseases.

Disclosures

None.

Conflict of interest

None.

Acknowledgments

This study was financially supported by Tehran University ofMedical Sciences (Tehran, Iran).

References

Ashley, E.A., Powers, J., Chen, M., Kundu, R., Finsterbach, T., Caffarelli, A., Deng, A.,Eichhorn, J., Mahajan, R., Agrawal, R., Greve, J., Robbins, R., Patterson, A.J.,Bernstein, D., Quertermous, T., 2005. The endogenous peptide apelin potentlyimproves cardiac contractility and reduces cardiac loading in vivo. Cardiovasc.Res 65, 73–82.

Azizi, Y., Faghihi, M., Imani, A., Roghani, M., Nazari, A., 2013. Post-infarct treatmentwith [Pyr1]-apelin-13 reduces myocardial damage through reduction of oxida-tive injury and nitric oxide enhancement in the rat model of myocardialinfarction. Peptides 46, 76–82.

Bikfalvi, A., 2006. Angiogenesis: health and disease. Ann. Oncol. 17 (Suppl 10),S65–S70.

Brindle, N.P., Saharinen, P., Alitalo, K., 2006. Signaling and functions ofangiopoietin-1 in vascular protection. Circ. Res. 98, 1014–1023.

Dai, T., Ramirez-Correa, G., Gao, W.D., 2006. Apelin increases contractility in failingcardiac muscle. Eur. J. Pharmacol. 553, 222–228.

Fagiani, E., Christofori, G., 2013. Angiopoietins in angiogenesis. Cancer Lett. 328,18–26.

Fukuda, S., Kaga, S., Sasaki, H., Zhan, L., Zhu, L., Otani, H., Kalfin, R., Das, D.K., Maulik,N., 2004. Angiogenic signal triggered by ischemic stress induces myocardialrepair in rat during chronic infarction. J. Mol. Cell. Cardiol. 36, 547–559.

Fukuda, S., Kaga, S., Zhan, L., Bagchi, D., Das, D.K., Bertelli, A., Maulik, N., 2006.Resveratrol ameliorates myocardial damage by inducing vascular endothelialgrowth factor-angiogenesis and tyrosine kinase receptor Flk-1. Cell. Biochem.Biophys. 44, 43–49.

Grass, T.M., Lurie, D.I., Coffin, J.D., 2006. Transitional angiogenesis and vascularremodeling during coronary angiogenesis in response to myocardial infarction.Acta. Histochem. 108, 293–302.

Heil, M., Schaper, W., 2004. Influence of mechanical, cellular, and molecular factorson collateral artery growth (arteriogenesis). Circ. Res. 95, 449–458.

Huusko, J., Merentie, M., Dijkstra, M.H., Ryhanen, M.M., Karvinen, H., Rissanen, T.T.,Vanwildemeersch, M., Hedman, M., Lipponen, J., Heinonen, S.E., Eriksson, U.,Shibuya, M., Yla-Herttuala, S., 2010. The effects of VEGF-R1 and VEGF-R2ligands on angiogenic responses and left ventricular function in mice. Cardi-ovasc. Res. 86, 122–130.

Japp, A.G., Cruden, N.L., Amer, D.A., Li, V.K., Goudie, E.B., Johnston, N.R., Sharma, S.,Neilson, I., Webb, D.J., Megson, I.L., Flapan, A.D., Newby, D.E., 2008. Vasculareffects of apelin in vivo in man. J. Am. Coll. Cardiol. 52, 908–913.

Japp, A.G., Cruden, N.L., Barnes, G., van Gemeren, N., Mathews, J., Adamson, J.,Johnston, N.R., Denvir, M.A., Megson, I.L., Flapan, A.D., Newby, D.E., 2010. Acutecardiovascular effects of apelin in humans: potential role in patients withchronic heart failure. Circulation 121, 1818–1827.

Jaumdally, R.J., Goon, P.K., Varma, C., Blann, A.D., Lip, G.Y., 2010. Effects ofatorvastatin on circulating CD34þ/CD133þ/ CD45- progenitor cells and indicesof angiogenesis (vascular endothelial growth factor and the angiopoietins 1 and2) in atherosclerotic vascular disease and diabetes mellitus. J. Intern. Med. 267,385–393.

Kalin, R.E., Kretz, M.P., Meyer, A.M., Kispert, A., Heppner, F.L., Brandli, A.W., 2007.Paracrine and autocrine mechanisms of apelin signaling govern embryonic andtumor angiogenesis. Dev. Biol. 305, 599–614.

Kuklinska, A.M., Sobkowicz, B., Sawicki, R., Musial, W.J., Waszkiewicz, E., Bolinska,S., Malyszko, J., 2010. Apelin: a novel marker for the patients with first ST-elevation myocardial infarction. Heart Vessels 25, 363–367.

Lakkisto, P., Kyto, V., Forsten, H., Siren, J.M., Segersvard, H., Voipio-Pulkki, L.M.,Laine, M., Pulkki, K., Tikkanen, I., 2010. Heme oxygenase-1 and carbonmonoxide promote neovascularization after myocardial infarction by modulat-ing the expression of HIF-1alpha, SDF-1alpha and VEGF-B. Eur. J. Pharmacol.635, 156–164.

Li, L., Zeng, H., Chen, J.X., 2012. Apelin-13 increases myocardial progenitor cells andimproves repair postmyocardial infarction. Am. J. Physiol. Heart Circ. Physiol.303, H605–H618.

Li, L., Zeng, H., Hou, X., He, X., Chen, J.X., 2013. Myocardial injection of apelin-overexpressing bone marrow cells improves cardiac repair via upregulation ofSirt3 after myocardial infarction. PLoS One 8, e71041.

Mitsos, S., Katsanos, K., Koletsis, E., Kagadis, G.C., Anastasiou, N., Diamantopoulos,A., Karnabatidis, D., Dougenis, D., 2012. Therapeutic angiogenesis for myocar-dial ischemia revisited: basic biological concepts and focus on latest clinicaltrials. Angiogenesis 15, 1–22.

Sham MI MI+Apel

0

25

50

75

100

125

150

*

***$$

Groups

Ca

pil

lary

De

ns

ity

(n

um

be

r/m

m2)

Fig. 4. Immunohistological analysis of neovascularization at day 14 after myocardial infarction (n¼6), A; sham, B; MI, C; MIþApel Representative digital micrographsshowing capillary density/CD31/PECAM-1 positive microvessels in different experimental groups. Bar 50 μm, 400X magnification. (D) Quantification of capillary density. MI;myocardial infarction, Apel; Apelin. Data are presented as means7S.E.M. *Po0.05 and ***Po0.001 vs. sham group, $$Po0.01 vs. MI group.

Y. Azizi et al. / European Journal of Pharmacology 761 (2015) 101–108 107

Ohtsuka, T., Inoue, K., Hara, Y., Morioka, N., Ohshima, K., Suzuki, J., Ogimoto, A.,Shigematsu, Y., Higaki, J., 2005. Serum markers of angiogenesis and myocardialultrasonic tissue characterization in patients with dilated cardiomyopathy. Eur.J. Heart Fail. 7, 689–695.

Pfaffl, M.W., Horgan, G.W., Dempfle, L., 2002. Relative expression software tool(REST) for group-wise comparison and statistical analysis of relative expressionresults in real-time PCR. Nucleic Acids Res. 30, e36.

Renault, M.A., Losordo, D.W., 2007. Therapeutic myocardial angiogenesis. Micro-vasc. Res. 74, 159–171.

Sheikh, A.Y., Chun, H.J., Glassford, A.J., Kundu, R.K., Kutschka, I., Ardigo, D., Hendry,S.L., Wagner, R.A., Chen, M.M., Ali, Z.A., Yue, P., Huynh, D.T., Connolly, A.J.,Pelletier, M.P., Tsao, P.S., Robbins, R.C., Quertermous, T., 2008. In vivo geneticprofiling and cellular localization of apelin reveals a hypoxia-sensitive,endothelial-centered pathway activated in ischemic heart failure. Am. J. Physiol.Heart Circ. Physiol 294, H88–H98.

Shyu, K.G., Chang, C.C., Wang, B.W., Kuan, P., Chang, H., 2003. Increased expressionof angiopoietin-2 and Tie2 receptor in a rat model of myocardial ischaemia/reperfusion. Clin. Sci. 105, 287–294.

Su, H., Takagawa, J., Huang, Y., Arakawa-Hoyt, J., Pons, J., Grossman, W., Kan, Y.W.,2009. Additive effect of AAV-mediated angiopoietin-1 and VEGF expression onthe therapy of infarcted heart. Int. J. Cardiol. 133, 191–197.

Tao, Z., Chen, B., Tan, X., Zhao, Y., Wang, L., Zhu, T., Cao, K., Yang, Z., Kan, Y.W., Su, H.,2011. Coexpression of VEGF and angiopoietin-1 promotes angiogenesis andcardiomyocyte proliferation reduces apoptosis in porcine myocardial infarction(MI) heart. Proc. Natl. Acad. Sci. USA 108, 2064–2069.

Tuo, Q.H., Zeng, H., Stinnett, A., Yu, H., Aschner, J.L., Liao, D.F., Chen, J.X., 2008.Critical role of angiopoietins/Tie-2 in hyperglycemic exacerbation of myocardialinfarction and impaired angiogenesis. Am. J. Physiol. Heart Circ. Physiol 294,H2547–2557.

Wang, L., Chen, Q., Li, G., Ke, D., 2012. Ghrelin stimulates angiogenesis via GHSR1a-dependent MEK/ERK and PI3K/Akt signal pathways in rat cardiac microvascularendothelial cells. Peptides 33, 92–100.

Wang, W., McKinnie, S.M., Patel, V.B., Haddad, G., Wang, Z., Zhabyeyev, P., Das, S.K.,Basu, R., McLean, B., Kandalam, V., Penninger, J.M., Kassiri, Z., Vederas, J.C.,Murray, A.G., Oudit, G.Y., 2013. Loss of Apelin exacerbates myocardial infarctionadverse remodeling and ischemia-reperfusion injury: therapeutic potential ofsynthetic Apelin analogues. J. Am. Heart Assoc. 2, e000249.

Weir, R.A., Chong, K.S., Dalzell, J.R., Petrie, C.J., Murphy, C.A., Steedman, T., Mark, P.B.,McDonagh, T.A., Dargie, H.J., McMurray, J.J., 2009. Plasma apelin concentrationis depressed following acute myocardial infarction in man. Eur. J. Heart Fail. 11,551–558.

Xu, C.W., Zhang, T.P., Wang, H.X., Yang, H., Li, H.H., 2013. CHIP enhances angiogen-esis and restores cardiac function after infarction in transgenic mice. Cell.Physiol. Biochem. 31, 199–208.

Yamahara, K., Itoh, H., Chun, T.H., Ogawa, Y., Yamashita, J., Sawada, N., Fukunaga, Y.,Sone, M., Yurugi-Kobayashi, T., Miyashita, K., Tsujimoto, H., Kook, H., Feil, R.,Garbers, D.L., Hofmann, F., Nakao, K., 2003. Significance and therapeuticpotential of the natriuretic peptides/cGMP/cGMP-dependent protein kinasepathway in vascular regeneration. Proc. Natl. Acad. Sci. USA 100, 3404–3409.

Zaitone, S.A., Abo-Gresha, N.M., 2012. Rosuvastatin promotes angiogenesis andreverses isoproterenol-induced acute myocardial infarction in rats: role of iNOSand VEGF. Eur. J. Pharmacol. 691, 134–142.

Zeng, H., Li, L., Chen, J.X., 2012. Overexpression of angiopoietin-1 increasesCD133þ/c-kitþ cells and reduces myocardial apoptosis in db/db mouseinfarcted hearts. PLoS One 7, e35905.

Zeng, X., He, H., Yang, J., Yang, X., Wu, L., Yu, J., Li, L., 2008. Temporal effect ofGuanxin No. 2 on cardiac function, blood viscosity and angiogenesis in ratsafter long-term occlusion of the left anterior descending coronary artery. J.Ethnopharmacol. 118, 485–494.

Y. Azizi et al. / European Journal of Pharmacology 761 (2015) 101–108108