Eukaryotic Cell doi:10.1128/EC.00152-14 Copyright © 2014 ... · 7/4/2014 · zs undergo another...

1

1 2 3 4 5 6 7 8 9 10 11 12 13 14

Developmental cell fate and virulence are linked to trehalose homeostasis in 15 Cryptococcus neoformans 16

Michael R. Botts1,†, Mingwei Huang1, Regen K. Borchardt1¥, Christina M. Hull1,2,* 17 18 19

1Department of Biomolecular Chemistry, 2Department of Medical Microbiology and Immunology, 20 School of Medicine and Public Health, University of Wisconsin-Madison, Madison, WI 53706 21

22 23 24 25 26 27 *Address correspondence to: 28 Christina M. Hull, PhD 29 1135 Biochemistry Building 30 420 Henry Mall 31 Madison, WI 53706 32 Telephone: (608) 265-5441 33 Fax: (608) 262-5253 34 E-mail: [email protected] 35 36 †Current Address: 37 Division of Biological Sciences 38 University of California- San Diego 39 9500 Gilman Dr. #0349 40 4205 Bonner Hall 41 La Jolla, CA 92093-0349 42 43 ¥Current Address 44 Cellular Dynamics International, Inc. 45 525 Science Drive Suite 100 46 Madison, WI 53711 47 48 Keywords: Cryptococcus neoformans, spores, sexual development, trehalose, fungal 49 pathogenesis 50

51

EC Accepts, published online ahead of print on 7 July 2014Eukaryotic Cell doi:10.1128/EC.00152-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.

on Decem

ber 9, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

http://ec.asm.org/

2

Abstract 52

Among pathogenic environmental fungi, spores are thought to be infectious particles that 53

germinate in the host to cause disease. The meningoencephalitis-causing yeast Cryptococcus 54

neoformans is found ubiquitously in the environment and sporulates in response to nutrient 55

limitation. While the yeast form has been studied extensively, relatively little is known about 56

spore biogenesis, and spore germination has never been evaluated at the molecular level. 57

Using genome transcript analysis of spores and molecular genetic approaches we discovered 58

that trehalose homeostasis plays a key role in regulating sporulation of C. neoformans, is 59

required for full spore viability, and influences virulence. Specifically, we found that genes 60

involved in trehalose metabolism, including a previously uncharacterized secreted trehalase 61

(NTH2), are highly overrepresented in dormant spores. Deletion of the two predicted trehalases 62

in the C. neoformans genome, NTH1 and NTH2, resulted in severe defects in spore production, 63

a decrease in spore germination, and an increase in the production of alternate developmental 64

structures. This shift in cell types suggests that trehalose levels modulate cell fate decisions 65

during sexual development. We also discovered that deletion of the NTH2 trehalase results in 66

hypervirulence in a murine model of infection. Taken together, these data show that the 67

metabolic adaptations that allow this fungus to proliferate ubiquitously in the environment play 68

unexpected roles in virulence in the mammalian host and highlight the complex interplay among 69

the processes of metabolism, development, and pathogenesis. 70

71

on Decem


.org/D

ownloaded from

http://ec.asm.org/

3

Introduction 72

A fundamental requirement for organisms to survive is the ability to adapt to changes in the 73

availability of metabolic fuels. Metabolic acclimation enhances survival in a given environment 74

or provides the capacity to exploit a new one. In response to nutrient limitation, organisms 75

generally decrease their growth rates; however, when nutrients become severely limiting, many 76

microbes undergo a transition from active growth to dormancy (1). In some bacteria and fungi, 77

this transition results in the development of a new cell type, the spore, and is coupled with 78

structural and metabolic adaptations that allow spores to remain dormant and withstand severe 79

environmental stresses (2–4). Once spores encounter more favorable growth conditions, they 80

undergo another transition (germination) to resume vegetative growth (5). 81

For environmental human fungal pathogens, spores are likely infectious particles (6–9). 82

The properties of spores that allow them to withstand harsh conditions and disperse throughout 83

the environment (e.g. small size, tolerance for high temperatures, resistance to oxidative stress, 84

etc.) also allow them to encounter hosts and initiate disease-causing infections. This is true of 85

Cryptococcus neoformans, a human fungal pathogen for which both yeast and spore forms are 86

plausible infectious particles (10). C. neoformans spores are produced on aerial fruiting bodies 87

(basidia) allowing for dispersal, which along with their resistance to external stresses and ability 88

to cause disease in a murine model of infection, has led to the hypothesis that C. neoformans 89

spores are natural infectious particles (11, 12). C. neoformans infects people from 90

environmental sources through a respiratory route in which the organism is inhaled and 91

proliferates within the lung. In immunocompromised individuals, such as people with AIDS, this 92

infection can disseminate to the central nervous system and cause meningoencephalitis (13). C. 93

neoformans spores, also known as basidiospores, are produced during sexual development 94

that occurs in response to nutritional signals and involves the formation of several new cell 95

types that reside in multicellular structures. While the morphological changes that occur during 96

sexual development have been described, relatively little is known about the metabolic signals 97

on Decem


.org/D

ownloaded from

http://ec.asm.org/

4

or molecular pathways that influence cell fate decisions and ultimately lead to the production of 98

spores and their ability to germinate in new environments. 99

To begin to understand spore biogenesis and germination, we carried out an analysis of 100

spore transcripts in both dormant spores and a germinating population of spores. Transcripts of 101

genes important for trehalose metabolism were highly overrepresented in dormant spores, 102

suggesting a role for the sugar trehalose in C. neoformans spore biology. Trehalose is a 103

disaccharide of two -linked glucose molecules (-1,1-glucose) that has been broadly linked to 104

stress resistance and development in many organisms (14–18). In several fungi trehalose 105

biosynthesis has been intimately linked to virulence, morphogenesis, and production of viable 106

spores. In the human pathogen, Candida albicans, trehalose biosynthesis is required for 107

resistance to oxidative stress, and trehalose metabolism has been linked to both stress 108

resistance and the yeast to hyphal transition, which are both important for virulence. Trehalose 109

synthesis mutants of C. albicans also show decreased virulence (19–22). Similarly, trehalose 110

has well established roles in both virulence and spore production in the filamentous fungal 111

pathogen, Aspergillus fumigatus, in which trehalose synthesis is important for general stress 112

response and the production of robust, stress-resistant spores (23). In contrast to other fungal 113

pathogens, deletion of the trehalose biosynthesis genes in A. fumigatus, TPSA and TPSB, 114

resulted in increased virulence in a murine model of invasive aspergillosis, likely caused by 115

alterations in the cell wall making mutant hyphae resistant to phagocytosis by macrophages 116

(23). Taken together, these findings reveal a complex and diverse role for trehalose metabolism 117

in regulating the physiology of fungal pathogens. 118

In C. neoformans disruption of either of the genes involved in trehalose synthesis (TPS1 119

or TPS2) results in severe defects in both sexual development and virulence, but the 120

mechanisms by which trehalose controls these functions are not known (24–26). Previously, a 121

single trehalose-degrading enzyme NTH1 (Neutral TreHalase 1) was studied, and surprisingly, 122

deletion of this gene caused no observable phenotypes (25). Through our gene expression 123

on Decem


.org/D

ownloaded from

http://ec.asm.org/

5

analysis of spores, we discovered a second predicted trehalose-degrading enzyme that we 124

have designated NTH2 (Neutral TreHalase 2) that was overrepresented within dormant spores. 125

The discovery of this trehalase allowed us to assemble a more complete picture of 126

trehalose metabolism and the relationships between trehalose synthesis and breakdown during 127

spore formation, dormancy, and germination. We found that trehalase mutants harbor defects in 128

sexual development including, aberrant fruiting body (basidium) formation, a decrease in spore 129

formation, and decreased spore viability. We also observed that aberrant basidium formation 130

was accompanied by an increase in the production of apparent chlamydospores, a previously 131

described alternate developmental cell type (26), thus implicating trehalose as a signaling 132

molecule in C. neoformans cell fate determination. Finally, we determined that the absence of 133

NTH2 led to a significant increase in virulence in a murine model of infection, suggesting that 134

the trehalose catabolic pathway is active in the mammalian host. Overall, our results indicate 135

that trehalose metabolism is a core component of both sexual development and pathogenesis 136

and underscore the importance of trehalose homeostasis in these diverse processes in C. 137

neoformans. 138

139

Materials and Methods 140

Strains and media. All strains used were of the serotype D background (Cryptococcus 141

neoformans var. neoformans strains JEC20 (a) and JEC21 ()) (27). All were handled using 142

standard techniques and media as described previously (28). Sexual development assays were 143

conducted on V8 agar medium pH 7.0 at 22°C in the dark for 2-7 days. 144

145

Microscopy. All micrographs were created using an Axio Scope.A1 with long working-distance 146

objectives and an Axiovision MRM camera running Axiovision software. 147

148

RNA isolation and amplification. Spores were isolated by scraping sexually developing 149

on Decem


.org/D

ownloaded from

http://ec.asm.org/

6

populations of cells from V8 agar and suspending in 65% Percoll made isotonic with Phosphate 150

Buffered Saline (PBS). Suspensions were subjected to centrifugation (10,000 x g, 30 minutes, 151

4oC), and spores were collected from the bottom of the gradient and counted. A 4 x 108 spore 152

aliquot was frozen in liquid N2 to serve as the zero time point sample. The remaining spores (1.6 153

x109) were resuspended in 6 mL of liquid YPD and incubated at 30°C with shaking at 200 RPM. 154

Samples were collected every 2 hours for 10 hours and frozen in liquid nitrogen. RNA was 155

extracted from frozen spores using hot acid-phenol as described previously and was further 156

purified using the RNEasy Mini Kit (Qiagen, Valencia CA) (29). RNA amplification was carried 157

out using the MessageAmp II amplification kit (Ambion) according to manufacturer 158

specifications. 500 ng of total RNA from each germinating time point was used as the starting 159

material. After production of antisense RNAs containing aminoallyl-UTPs (aRNAs), each sample 160

was assessed for quantity and average length of aRNA using an RNA Pico Chip and the Agilent 161

Bionalyzer 2100 (Agilent Technologies, Santa Clara CA). Before hybridization, equal amounts of 162

aminoallyl-UTP incorporated aRNA were conjugated to Oyster dyes (Boca Scientific) according 163

to manufacturer instructions. 164

165

Microarray hybridization and analysis. Fluorescently labeled aRNAs were hybridized to C. 166

neoformans whole genome spotted microarrays of 70-mer oligonucleotides containing 167

7765 open reading frame (ORF) probes. The data presented for each experiment represent 168

eight-fold coverage of ORFs: quadruplicate experiments (including dye-swap), with each slide 169

containing ORF probes spotted in duplicate. Slides were incubated as reported previously (30). 170

Extracted data were analyzed using the GeneSpring 10.0 software package (Agilent 171

Technologies, Santa Clara CA). Data were normalized using the LOWESS 172

(locally weighted scatter plot smoothing) algorithm and assessed for statistical significance 173

utilizing ANOVA (31). Two thousand five hundred and twelve genes meeting the 174

criterion p<0.05 were considered statistically significant and used in further analyses (32). 175

on Decem


.org/D

ownloaded from

http://ec.asm.org/

7

Significant genes meeting a two fold-change threshold between any two time points (1,499) 176

were clustered using Cluster 3.0. Clusters were assessed for Kyoto Encyclopedia for Genes 177

and Genomes (KEGG) pathway, and Gene Ontology (GO) term enrichment using the Database 178

for Annotation, Visualization, and Integrated Discovery (DAVID) (33–35). The full dataset has 179

been deposited in the NCBI Gene Expression Omnibus database (GEO) and can be accessed 180

through GEO accession number GSE53912 (36). 181

182

Generation of deletion strains. Gene deletion constructs were created using fusion PCR (37). 183

The NTH1 5'- region was amplified with primers CHO1565 and CHO1566, and the 3'-region was 184

amplified with CHO1567 and CHO1568. The NATR cassette was amplified with CHO1569 and 185

CHO1570. PCR fusion using CHO1565 and CHO1568 was used to create the final nth1::NATR 186

deletion cassette. The NTH2 5'- region was amplified with primers CHO2636 and CHO2637, and 187

the 3'-region was amplified with CHO2638 and CHO2639. The NEOR cassette was amplified 188

with CHO2640 and CHO2641. PCR fusion using CHO2636 and CHO2639 was used to create 189

the final nth2::NEOR deletion cassette. The nth1::NATR and nth2::NEOR deletion cassettes were 190

transformed into JEC20 and JEC21 by biolistic transformation, grown on medium containing 1 M 191

sorbitol, and selected on medium containing 200 µg/mL G418 or 200 µg/mL nourseothricin (38). 192

Resulting colonies were screened using PCR for correct insertion of the knockout construct and 193

assessed via Southern blotting for single integration of the construct to identify multiple 194

independent knockouts (29). Each mutant was then crossed with wild type yeast to obtain 195

knockout progeny in both mating types. The resulting F1 progeny were then rescreened by PCR 196

for the absence of the deleted gene to confirm the strain genotype. Double mutants, nth1 197

nth2, were constructed by backcrossing a nth2 (CHY2082) with nth1 (CHY1710), isolating 198

and germinating spore progeny from this cross, and then replica plating these progeny onto 199

solid medium containing both nourseothricin and G418. Double mutants were then rescreened 200

on Decem


.org/D

ownloaded from

http://ec.asm.org/

8

by PCR to confirm the absence of NTH1 and NTH2 open reading frames (CHY2184). 201

202

NTH1 and NTH2 transcript analysis. RNA was prepared from C. neoformans yeast or crosses 203

as described previously (29). Northern blots were conducted according to standard protocols 204

using 10 µg total RNA per sample. Probes were generated by PCR amplification utilizing the 205

ExTaq PCR system (TaKaRa Bio Inc.) and oligos CHO2979 and CHO2980 (NTH1), CHO2938 206

and CHO2939 (NTH2) and CHO1696 and CHO1697 (GPD1). Probes were radiolabeled using 207

Ready-To-GoTM DNA Labeling Beads (GE Healthcare LifeSciences, Piscataway, NJ) according 208

to manufacturer’s instructions and hybridized to blots at 65ºC as described previously (39). Blots 209

were exposed to a phosphor screen and imaged with a Storm 860 PhosphorimagerTM 210

(Molecular Dynamics, GE Amersham). 211

212

Quantification of trehalose 213

Trehalose was quantified in C. neoformans crosses using a colorimetric enzyme linked 214

assay previously used in S. cerevisiae (40). Crosses were spotted on V8 for 5 days, harvested 215

into 100 mM sodium citrate pH 5.7, and boiled for 10 minutes. The resulting suspensions were 216

lysed using sonication on a 30% duty cycle at level 2 for five minutes, and lysis was confirmed 217

microscopically. Insoluble cell debris was pelleted and discarded. Lysates (100 µL) were treated 218

with 1U of porcine kidney trehalase (Sigma Aldrich) for 4 hours at 37°C. Glucose produced was 219

quantified using a glucose assay kit (Sigma Aldrich) according to manufacturer's instructions. 220

Absorbance at 540nm values for lysates was compared to a standard curve of glucose and 221

normalized to the starting mass of the cell pellet. Calculated trehalose levels were subjected to 222

one-way ANOVA comparing each sample to an a x cross. 223

224

Phenotype testing. A battery of common phenotypes was assessed, including melanin 225

production, capsule production, growth at 37°C, and cell wall integrity. In each case, wild type, 226

on Decem


.org/D

ownloaded from

http://ec.asm.org/

9

nth1, nth2, and nth1 nth2 strains were evaluated. Melanin production: grew cells on L-227

DOPA agar at 37°C for 3 days and visually assessed the production of pigment . Capsule 228

production: cultured strains in Dulbecco’s modified eagle medium (DMEM) with 5% fetal calf 229

serum at 37°C in 5% CO2 (41) for two days then stained with India ink and assessed 230

microscopically (42). Growth at 37°C: spotted serial dilutions of cells onto YPD agar, incubated 231

at 37°C for two days, and assessed visually (25). Cell wall integrity: spotted serial dilutions of 232

cells onto medium containing calcofluor white MR2, sodium dodecyl sulfate, or caffeine and 233

grew for two days at 37°C (43). Resistance to heat shock: grew cells on V8 agar pH 7.0 at 234

25°C for 2 days, suspended in PBS, and incubated at 42°C and 50°C for 5, 10, 15, and 30 235

minute intervals, diluted, and plated to YPD for 3 days at 30°C (3). Resistance to oxidative 236

stress: spread 1 x 106 yeast onto 100 mm diameter V8 agar plate with a 6 mm disc of Whatman 237

paper containing 10 µL 10% H2O2 in the center and incubated at 30°C for 3 days. (44). 238

Germination frequencies were determined by carrying out crosses on V8 for 5 days and 239

isolating spores. Spores were counted, plated onto rich medium, and allowed to germinate and 240

grow at 30°C for 3 days. Germination frequencies were determined by dividing the number of 241

colonies formed by the number of spores plated. Three replicates were performed for each 242

strain, and the mean for each strain was compared to wild type using the Student’s t-test. 243

244

Virulence analysis. Strain virulence was assayed using a murine intravenous model of 245

infection (45). Wild type nth1, nth2, and nth1 nth2 yeast were grown to mid-log 246

phase and washed three times in phosphate buffered saline (PBS). Five female Balb/c mice 247

were inoculated via tail vein with 1 x 106 yeast of each strain. Only the yeast cell type was used 248

to infect the mice because we could not recover sufficient numbers of mutant spores to carry out 249

spore-mediated infections. The mice were observed daily for rapid weight loss or signs of pain 250

at which point moribund mice were euthanized as described previously (12). The resulting 251

on Decem


.org/D

ownloaded from

http://ec.asm.org/

10

survival times were plotted on a Kaplan-Meyer plot, and median survival times of mice were 252

analyzed using a Wilcoxon rank-sum test. This experiment was carried out twice with 253

independently derived mutant strains, and the results were identical between experiments. The 254

animal studies were reviewed and protocol approved by the University of Wisconsin- Madison 255

Institutional Animal Care and Use Committee (Protocol A01506). The University of Wisconsin- 256

Madison is AAALAC accredited, and the facilities meet and adhere to the standards in the 257

“Guide and Care of Laboratory Animals.” 258

259

Results 260

Trehalose metabolism genes are overrepresented in dormant spores 261

To determine changes in gene expression that occur during spore germination into 262

yeast, total RNA was isolated from spores undergoing synchronous germination for whole 263

genome transcript analysis. Transcripts were competitively hybridized to a whole genome 264

microarray, and the resulting changes in transcript levels were assessed. Co-expressed groups 265

of genes were submitted to the Database for Annotation, Visualization, and Integrated 266

Discovery (DAVID) to assess functional groups and to the Kyoto Encyclopedia of Genes and 267

Genomes (KEGG) to determine placement within pathways. 268

One of the most enriched pathways within dormant spores was the KEGG annotated 269

pathway for “starch and sucrose metabolism." Transcripts of 14 genes in this pathway showed a 270

pattern of regulation in which their transcripts were overrepresented in dormant spores and 271

became rapidly underrepresented during the first two hours of germination (Figure 1A). Some 272

spore-enriched genes that fall into this metabolic pathway have been implicated previously in 273

spore- or germination-specific functions in other systems: SGA1, which is highly similar to a 274

spore-specific glucoamylase in S. cerevisiae is responsible for glycogen degradation during 275

sporulation; SPR1 is a sporulation-specific exo--1,3-glucan hydrolase in S. cerevisiae; and 276

CELA is a germination-specific spore-coat modifying enzyme from the spore-forming amoeba 277

on Decem


.org/D

ownloaded from

http://ec.asm.org/

11

Dictyostelium discoideum (46–48). Detection of these transcripts suggests that their roles may 278

be conserved across phyla. In addition, nine of the spore-enriched transcripts in this pathway 279

are involved directly in the biosynthesis and breakdown of trehalose or glycogen (Figure 1A, 280

1B). 281

Among these genes was CNG00690, predicted to encode a trehalose-degrading 282

enzyme. The presence of CNG00690 was unexpected because previous analyses of trehalose 283

synthesis and degradation in C. neoformans had not identified this gene (24, 25). Trehalose 284

biosynthesis genes had been shown to be critical for both the initiation of sexual development 285

(TPS1) and virulence in animal models (TPS1 and TPS2), but deletion of the only known neutral 286

trehalase, NTH1, yielded only a modest decrease in growth on trehalose and no discernable 287

phenotypes in sexual development or virulence (24). This finding was somewhat surprising 288

because many fungi harbor more than one trehalase gene, and their products often play key 289

roles in fungal metabolism (49–51). Our discovery of the enrichment of CNG00690 transcript in 290

dormant spores led us to hypothesize that this gene (which we have named NTH2 for Neutral 291

TreHalase 2) could encode an uncharacterized trehalase with specialized functions in sexual 292

development and/or spore biology. 293

The presence of NTH2 is consistent with the fact that fungi often harbor both cytosolic 294

and secreted trehalases with characteristic features: cytosolic trehalases usually contain a 295

calcium binding domain and a single trehalase domain; secreted trehalases harbor a secretion 296

signal and two trehalase domains (52, 53). Through their predicted functional domains and 297

features, NTH1 and NTH2 appear to be the only two genes encoding trehalase activity in the C. 298

neoformans genome; NTH1 is a predicted cytosolic trehalase, and NTH2 is a predicted secreted 299

trehalase (Figure 1C). The presence of NTH2 may account for the lack of phenotypes in NTH1 300

deletion strains in previous studies and opens the possibility that the degradation of trehalose 301

could play key roles in C. neoformans biology. 302

303

on Decem


.org/D

ownloaded from

http://ec.asm.org/

12

NTH1 and NTH2 are differentially regulated under sexual development conditions 304

To determine the expression profiles of NTH1 and NTH2 under different conditions, we 305

carried out RNA blot hybridization using RNA from wild type strains grown in rich medium (YPD 306

broth, mid-log phase), from a cross (a x on V8 pH 7.0 for 72 hours), and from purified spores. 307

As suspected based on previous reports, NTH1 transcript was abundant in cells grown in rich 308

medium, cross conditions, and in spores, suggesting that this trehalase is expressed 309

constitutively (25). In contrast, expression of NTH2 was differentially regulated. While NTH2 310

transcript was abundant in both crosses and purified spores, none was detected from cells 311

grown in rich medium (Figure 2A). 312

To determine the extent to which NTH2 expression was dependent on signals from V8 313

agar medium vs. the process of sexual development, we analyzed RNA from yeast propagated 314

on V8 agar in the absence or presence of a mating partner for 48 hours. NTH2 transcript levels 315

increased on V8 medium both in the absence and presence of a mating partner. This finding 316

indicates that NTH2 is induced largely by V8 medium alone (the same condition that promotes 317

sexual development). (Figure 2B). In contrast to the constitutive expression of NTH1, NTH2 318

expression is responsive to changes in metabolic conditions. 319

320

NTH1 and NTH2 are required for trehalose metabolism 321

To determine the functions of NTH1 and NTH2, we created single and double deletion 322

strains and evaluated them for discernable phenotypes, including the ability to use trehalose as 323

a sole carbon source. Wild type and mutant strains (nth1∆, nth2∆, and nth1∆nth2∆) were grown 324

on solid synthetic medium containing 2% glucose or 2% trehalose as the sole carbon source 325

(Figure 3A). Wild type and all of the trehalase deletion strains (nth1, nth2, and nth1 nth2) 326

grew similarly on medium containing glucose. However, on medium containing trehalose as the 327

sole carbon source, nth1 strains grew more slowly and to a lower density than 328

on Decem


.org/D

ownloaded from

http://ec.asm.org/

13

wild type strains, nth2 strains showed no difference in growth compared to wild type, and 329

nth1∆ nth2∆ double mutants showed severe growth defects with little or no growth on trehalose-330

containing medium. Together with the observation that NTH1 and NTH2 contain the only 331

identifiable trehalase domains in the C. neoformans genome, these results indicate that both 332

NTH1 and NTH2 encode functional trehalases and provide compelling evidence that these are 333

the only trehalases in C. neoformans. Furthermore, given that NTH2 can partially compensate 334

for the loss of NTH1, these trehalases harbor overlapping (redundant) functions in trehalose 335

catabolism in vegetatively growing cells. 336

Given this relationship during vegetative growth, we hypothesized that the contributions 337

of NTH1 and NTH2 during sexual development would also be at least partially redundant. In the 338

absence of NTH1 and NTH2, we predicted that trehalose would accumulate and that this 339

accumulation would be additive in the double mutant. To test this hypothesis trehalose levels 340

were quantified from wild type and mutant crosses after 5 days on V8 medium. In contrast to our 341

expectations, we observed that deletion of NTH1 and NTH2 had opposing effects on trehalose 342

accumulation: nth1 crosses accumulated significantly more trehalose than wild type crosses, 343

whereas nth2 crosses harbored significantly less trehalose than wild type (p < 0.05 in both 344

cases). The double mutant crosses (nth1 nth2) produced levels of trehalose similar to wild 345

type (Figure 3B). These data indicate a complex relationship between NTH1 and NTH2 in 346

trehalose homeostasis during development that may be due (at least in part) to the predicted 347

differences in localization between Nth1 and Nth2 (Nth1 cytoplasmic and Nth2 secreted). The 348

levels of intracellular trehalose and glucose are likely influenced by both external and internal 349

sources, and the activities of Nth1 and Nth2 on different pools of trehalose could have 350

significant effects on the outcome of overall trehalose levels. It is also possible that differences 351

in localization of trehalase activity among specific cell types (e.g. yeast vs. basidia) that control 352

local trehalose levels were not detected using this assay due to homogenization of trehalose 353

on Decem


.org/D

ownloaded from

http://ec.asm.org/

14

levels across the entire population of developing cells (yeast, filaments, basidia, and spores). 354

355

Deletion of NTH1 and NTH2 leads to a defect in sporulation 356

To investigate the role of trehalases in sexual development, nth1∆, nth2∆, and 357

nth1∆nth2∆ mutant strains were crossed with wild type strains and with each other under sexual 358

development conditions. Crosses between wild type strains and all of the mutants (nth1∆, 359

nth2∆, and nth1∆nth2∆) were indistinguishable from wild type a x crosses as were nth1∆ x 360

nth1∆ and nth2∆ x nth2∆ crosses (Figure 4). In stark contrast, however, crosses between 361

nth1nth2 mutants (nth1nth2 x nth1nth2) led to severe defects in spore formation, 362

indicating that both genes have redundant functions in this process. 363

At low microscopic resolution, nth1nth2 x nth1nth2 crosses were observed to be 364

similar to wild type crosses with abundant filaments radiating from the periphery of cells 365

undergoing sexual development (Figure 4A). However, under careful examination at higher 366

magnification it is clear that the majority of basidia in nth1nth2 crosses did not develop spore 367

chains, and strikingly, these sporeless basidia appeared extremely enlarged compared to wild 368

type basidia (Figure 4B). In addition, nth1nth2 crosses exhibited the production of an 369

unusually high number of large, ball-like structures, giving the developing filaments a "beads-on-370

a-string" appearance (Figure 4C). Structures like these have been described previously and 371

referred to as chlamydospores (26). The purpose of this cell type is poorly understood; however, 372

they have been observed to be metabolically active, to harbor glycogen, and to be capable of 373

budding off new yeast. It has been hypothesized that C. neoformans chlamydospores are an 374

alternative fate for sexually developing cells and a means of producing new satellite colonies 375

independent of sporulation (26). The structures produced in abundance by nth1∆nth2∆ crosses 376

were also capable of budding off yeast, were found to harbor glycogen via iodine staining (data 377

not shown), and were morphologically indistinguishable from the previous description of 378

on Decem


.org/D

ownloaded from

http://ec.asm.org/

15

chlamydospores. These features led us to conclude that the nth1∆nth2∆ structures were very 379

likely to be the same type of cells as those previously designated as chlamydospores in C. 380

neoformans. (26). Given the phenotypes of nth1∆nth2∆ mutant strains, we posit that the ratio of 381

trehalose to glucose in basidia is a determinant of cell fate: The cleavage of trehalose by NTH1 382

and NTH2 drives spore formation, whereas the accumulation of trehalose in the nth1∆nth2∆ 383

strain shifts the developmental path, resulting in a marked increase in an alternate cell type 384

(chlamydospore) production. 385

386

Spores harboring trehalase deletions show defects in germination 387

Given the enrichment of NTH2 transcripts in spores and the importance of trehalase 388

function in sporulation, we hypothesized that trehalases could also be important for germination. 389

Despite the observation that nth1 nth2 x nth1 nth2∆ crosses show a marked decrease in 390

spore numbers, these crosses still produced a limited number of spores that were 391

morphologically indistinguishable from wild type spores by light microscopy (data not shown). 392

To test whether spores from trehalase-deficient crosses were viable, spores were isolated from 393

wild type, nth1, nth2, and nth1 nth2 crosses, counted, and grown on rich medium. As 394

expected, nearly 100% of wild type spores germinated and grew into colonies (Figure 5). 395

Similarly, spores from nth1∆ and nth2∆ crosses also germinated at wild type frequencies. In 396

contrast, however, spores from nth1nth2 crosses showed significant decreases in 397

germination frequency, with only 33% of spores forming colonies (Figure 5). These data indicate 398

that not only do nth1 nth2 crosses lead to aberrant basidium formation and a decrease in 399

spore formation, but they also result in substantial numbers of spores that are unable to grow in 400

response to germination conditions. These findings again indicate overlapping functions of 401

NTH1 and NTH2. 402

403

on Decem


.org/D

ownloaded from

http://ec.asm.org/

16

The nth2∆ deletion strain is hypervirulent in a mouse model of cryptococcosis 404

To evaluate the roles of trehalase function in pathogenesis, we assessed virulence of 405

the trehalase mutant strains in a mouse tail vein model of infection. It had been shown 406

previously that deletion of NTH1 alone had no effect on virulence (25). This result was initially 407

surprising because of the predicted important roles for trehalose in stress tolerance and the 408

apparent absence of other trehalases in the genome (17). However, our identification of NTH2, 409

and the obviously redundant roles of these genes described above, raised the possibility that 410

deletion of NTH1 resulted in no phenotype due to the presence of NTH2-derived trehalase 411

activity (Figure 3A). 412

Wild type, nth1, nth2, or nth1 nth2 strains were inoculated into mice via tail vein at 413

1x106 yeast cells/mouse. As expected, the effects of wild type and nth1∆ strains were 414

indistinguishable from one another, causing mean times to death of 34 and 35 days respectively 415

(Figure 6). In contrast, however, the nth2 and nth1 nth2 strains both caused morbidity in 416

mice significantly faster (p<0.05)(average time to death 27 and 28 days respectively) than wild 417

type and nth1∆ strains, indicating increased virulence in the absence of nth2∆. This result is 418

consistent with the previous findings that strains harboring deletions of the trehalose 419

biosynthesis genes TPS1 and TPS2 are less virulent. It seems likely that deletion of the 420

biosynthesis genes would decrease the abundance of trehalose, while deletion of the NTH2 421

trehalase would increase overall abundance. Together, these results would support the 422

hypothesis that the level of trehalose, which has been linked to environmental stress resistance 423

in other organisms, may be important for survival against stressors in the host as well. 424

To test this hypothesis, we evaluated the ability of the strains to resist heat shock (at 425

temperatures 37°C, 42°C, and 50°C) and survive exposure to reactive oxygen species (in an 426

H2O2 disk diffusion assay). We also tested capsule inducing conditions (RPMI + 5% CO2 at 427

37°C), melanizing medium (L-DOPA agar), and cell wall stressing agents (1.5 mg/mL calcofluor 428

on Decem


.org/D

ownloaded from

http://ec.asm.org/

17

white, 0.5 mg/mL caffeine) (54). In no case did the nth1, nth2, or nth1 nth2 mutant strains 429

respond differently than the wild type strain (data not shown). The trehalase mutants were not 430

intrinsically more resistant to global stressors than their wild type counterparts, suggesting that 431

changes in trehalose levels alone were not responsible for the hypervirulence of nth2∆ strains. 432

A surprising aspect of the virulence data was that that the functions of NTH1 and NTH2 433

were not overlapping. In the absence of NTH2 alone, there was a hypervirulence phenotype, 434

indicating that NTH1 was not compensating for the loss of NTH2 activity. Furthermore, there 435

was no change in the phenotype in absence of both NTH1 and NTH2. While the NTH1 and 436

NTH2 activities were largely redundant outside of the host, it appeared that their functions 437

diverge within the host, implicating an NTH2-specific function or feature in modulating virulence. 438

439

Discussion 440

Using transcriptional profiling, we discovered that spores of the human fungal pathogen 441

C. neoformans contain high levels of transcripts associated with the synthesis and breakdown of 442

the disaccharide trehalose, including a previously unrecognized trehalase, NTH2. Through 443

molecular and genetic analyses we revealed that NTH2 and a previously characterized 444

trehalase, NTH1, are fully responsible for trehalose utilization in C. neoformans and have largely 445

overlapping trehalase functions, even though Nth1 is predicted to be cytosolic and Nth2 446

secreted. Significantly, we show for the first time that trehalose degradation is a key function in 447

C. neoformans important for fruiting body formation, spore biogenesis, and germination. 448

Trehalases play a critical role in signaling cell fate decisions: In the absence of trehalases very 449

few spores are produced during sexual development, and instead, development shifts to the 450

formation of chlamydospores. The phenotypes of NTH1 and NTH2 diverge in a mouse model of 451

infection where the deletion of NTH2 results in hypervirulence. 452

453

Trehalose homeostasis determines cell fate during sexual development 454

on Decem


.org/D

ownloaded from

http://ec.asm.org/

18

Trehalose has been shown to play two primary roles within microbes: First, trehalose is 455

a reserve carbohydrate that can be accumulated and cleaved into two glucose molecules when 456

external carbon sources are scarce, and second, trehalose acts as an osmostabilizer and stress 457

protectant (17). In C. neoformans trehalose biosynthesis is required for initiating sexual 458

development, but roles for trehalose degradation in sexual development have not been 459

documented in any system (23, 55). Our data now bring the full trehalose pathway to light and 460

show that trehalose degradation influences many aspects of C. neoformans biology and is 461

critical for complete sexual development. Notably, in the absence of trehalase genes, 462

development shifts from the formation of fruiting bodies and spores to the formation of what 463

appears to be an alternate cell type known as chlamydospores (26). While little is known about 464

the properties of chlamydospores in C. neoformans, they have been postulated to be structures 465

from which yeast can bud off and establish new colonies (26). Lin and Heitman propose that 466

nutrient sensing through the accumulation of carbohydrate storage molecules, particularly 467

glycogen, may drive cell fate decisions between chlamydospore formation and sporulation. 468

However, glycogen biosynthesis genes, whose transcripts are also highly enriched in spores, 469

are dispensable for both chlamydospore formation and sporulation (26), implicating signaling 470

roles for other carbohydrates. Our findings indicate that trehalose functions as a metabolic 471

signal for determining whether filamentous growth should be terminated with spore production, 472

or whether conditions are sufficiently favorable to continue proliferating (via chlamydospores) 473

and return to vegetative growth. 474

Based on these findings, we propose a model in which trehalose levels are a readout for 475

glucose availability (refer to Figure 1B). In this model as glucose becomes limiting, sexual 476

development can initiate, and spore formation is favored; trehalose levels remain low because 477

of limited substrates for its production, indicating the metabolic need to differentiate into spores. 478

Spores are the terminal consequence of development under these conditions, and the current 479

colony is thus abandoned by dispersed spores for growth in a more favorable environment 480

on Decem


.org/D

ownloaded from

http://ec.asm.org/

19

elsewhere. However, if nutrient stores are replenished at any point during filamentation, 481

trehalose levels rise (as glucose-derived substrates become plentiful), indicating a change in 482

nutrient availability, and normal growth and colony expansion can be restored through 483

chlamydospore production. 484

This model is consistent with the seemingly paradoxical result that deletion of trehalose 485

synthase (TPS1) and deletion of the trehalases (NTH1 and NTH2) both result in severe defects 486

in sporulation. In both cases the substrates derived from glucose to make trehalose (i.e. 487

glucose-6-phosphate and UDP-glucose) are not used (as in tps1∆) or needed (as in 488

nth1∆nth2∆), resulting in a change in metabolic flux toward carbohydrate storage as glycogen. 489

Given that chlamydospores are hypothesized carbohydrate storage structures, a shift toward 490

glycogen storage could result in a shift in development. In this way trehalose concentration acts 491

as a sensor of metabolic conditions to toggle between two different developmental pathways, 492

thus controlling a critical cell fate decision by playing a novel signaling role, rather than simply 493

functioning only as a fuel source or osmoprotectant. This is akin to the role of trehalose 494

signaling in plants that serves to regulate development and plant physiology. However, plants 495

do not accumulate trehalose to the high levels typical of fungi, and thus, the contribution of 496

trehalose metabolism to signaling vs. stress responses and nutrition is not well understood in 497

plants. The increased development of chlamydospores in trehalase deficient C. neoformans 498

may serve as a platform to dissect the different contributions of trehalose metabolism on the 499

physiology of fungal pathogens. 500

501

Metabolic adaptation, differentiation, and consequences for virulence 502

In this work, we discovered that trehalose degradation affects spore germination, which 503

is critical for the long-term survival of the organism in both the natural environment and a host 504

lung. In the absence of NTH1 and NTH2 spore germination drops three-fold, suggesting that 505

trehalase function could be important for stabilizing dormant spores, cleaving trehalose into 506

on Decem


.org/D

ownloaded from

http://ec.asm.org/

20

glucose for fuel during germination, or both. The fact that both rich media conditions and the 507

mammalian lung are germination-inducing (3, 11, 12) underscores a characteristic feature of C. 508

neoformans - the ability to survive and grow in rapidly changing, environmental conditions. The 509

tissues of a mammalian host are an unusual environment for C. neoformans to inhabit, and 510

thus, the ability to respond to these conditions is likely shaped by the selection pressures of its 511

typical environmental niches (56, 57). The advantages potentially conferred by this relationship 512

have been proposed to explain many of the survival behaviors exhibited by C. neoformans in 513

the host. For example, Steenbergen et al. posit that the unusual ability of C. neoformans to 514

survive and grow within macrophages may result from adaptive strategies developed in the 515

natural environment in response to soil amoeba (58). 516

In the same vein, it would seem likely that adaptations to efficiently access internal 517

stores of energy (e.g. trehalase activity to cleave accumulated trehalose) and scavenge 518

trehalose from the environment would enhance survival in the host. Surprisingly, however, we 519

discovered that an nth2∆ strain is hypervirulent in a mouse model of infection, indicating a 520

negative correlation between trehalase function and virulence in the mouse host. That is, the 521

presence of an intact trehalose-degrading pathway confers a disadvantage in disease-causing 522

ability. On possible explanation for this finding may lie in the fact that Nth2 is predicted to be 523

secreted. Perhaps Nth2 is an antigen that can be recognized by the adaptive immune system, 524

allowing the host immune response more opportunity to inhibit C. neoformans growth. 525

Altering trehalose metabolism in other fungal pathogens has been shown to both 526

positively and negatively affect virulence in murine models of infection. Broadly, trehalose 527

accumulation has been associated with increased stress-resistance that typically results in 528

increased infectivity or virulence (17). However, changes in trehalose accumulation can result in 529

changes in cell wall structure and morphogenesis that may also affect the ability of fungal 530

pathogens to cause disease (20, 21, 23). There may be changes that occur in trehalase 531

deficient C. neoformans yeast inside of a mammalian host, such as cell wall polysaccharide 532

on Decem


.org/D

ownloaded from

http://ec.asm.org/

21

composition or titan cell formation (enlarged yeast cells associated with virulence), that can be 533

elucidated in future studies of the interaction of trehalase deficient C. neoformans and the host. 534

535

Intersections among sexual development, metabolism, and pathogenesis 536

Spores as infectious particles form an obvious connection between the processes of 537

sexual development and mammalian pathogenesis, but the full relationship is more complex. In 538

this work, we reveal a link between the processes of spore production and virulence in a 539

mammalian host through the actions of trehalose-degrading enzymes. This unexpected 540

connection underscores the emerging relationships between sexual development and virulence 541

among human fungal pathogens in general and the role of metabolic acclimation in C. 542

neoformans in particular. Responses in C. neoformans to the extreme conditions between 543

natural environment and human host are of particular interest because understanding metabolic 544

adaptations promises to reveal pathways that influence pathogenesis. 545

The importance of these relationships is underscored by recent studies of C. 546

neoformans morphology in which filamentous growth of C. neoformans results in a loss of 547

virulence in mice, implying that the yeast morphology plays a role in pathogenesis. A coincident 548

possibility, however, is that morphology is secondary to changes in metabolic gene expression 549

between yeast responding to environmental signals (such as those that initiate developmental 550

changes) and yeast responding to host conditions. The resulting metabolic acclimation results in 551

both positive and negative effects on pathogen survival in the host and could help to explain 552

differences in virulence properties observed between clinical and environmental isolates. One 553

possibility is that gene expression patterns that would normally be advantageous in an 554

environmental niche but disadvantageous within a host are modified, thus making the host a 555

selective environment for cells that have the capacity to rapidly modulate expression of 556

metabolic or stress response pathways. Discovering these pathways provides another route 557

toward understanding how host resources may be enhanced to prevent fungal infection and/or 558

on Decem


.org/D

ownloaded from

http://ec.asm.org/

22

disease. 559

560

Acknowledgements 561

Thank you to A. Adams, L. Ekena, S. Peters, and J. Kusiak for laboratory support and N. Walsh, 562

M. Mead, and C. Fox for comments on the manuscript. Thank you to the University of Wisconsin 563

Laboratory Animal Resource Staff for the care of animals used in this study. This work was 564

supported by NIH R01 AI064287, NIH R01 AI059370, and a Burroughs Wellcome Fund Career 565

Award in Biomedical Sciences, all to CMH. MRB was supported by the University of Wisconsin 566

Molecular Biosciences Training Grant NIH T3GM07215. 567

568

on Decem


.org/D

ownloaded from

http://ec.asm.org/

23

Figure Legends 569

Figure 1. Trehalose metabolism gene transcripts are overrepresented in spores. A. Heat 570

map of genes in the KEGG starch and sucrose metabolism pathway that were spore-enriched. 571

Relative fold change is represented from -4 (blue) to +4 (yellow). Each column represents a 572

time point of germination in hours. Dormant spore transcripts are represented in "0." Yeast 573

transcripts are represented in "10." Each row represents a gene. B. A schematic of genes 574

predicted to act in the trehalose and glycogen metabolic pathway with those found to be spore-575

enriched in red. Only one gene, NTH1, was not found to be spore-enriched. C. A schematic of 576

predicted C. neoformans trehalases, Nth1 and Nth2, and their functional domain content, 577

including family 37 glycosyl hydrolase ,-trehalase domain (GH37, Blue) calcium binding 578

regulatory domain (Ca, green), and predicted signal peptide (purple). 579

580

Figure 2. NTH1 and NTH2 are differentially expressed. A. NTH2 is induced during sexual 581

development. Lanes 1 and 2: a and yeast grown in rich medium (YPD liquid), respectively. 582

Lane 3: a and yeast mixed under cross conditions (V8 agar pH 7 at 22°C for 72 hours). Lane 583

4: spores from a cross after 72 hours. Top, middle, and bottom panels reflect probes to the 584

transcripts of interest: NTH2, NTH1, and GPD1, respectively. B. NTH2 is induced on V8 agar. 585

Lanes 1 and 2: a and yeast grown on rich medium (YPD agar), respectively. Lanes 3 and 4: a 586

and yeast grown individually on V8 agar for 48 hours. Lane 5: a and yeast grown in mixed 587

culture on V8 agar for 48 hours. Probes used were to NTH2 and GPD1. GPD1 was used as a 588

loading and hybridization control. 589

590

Figure 3. Deletion of NTH1 and NTH2 causes a severe synthetic defect in trehalose 591

utilization. A. Wild type a, wild type , a nth1∆, nth1∆, a nth2∆, nth2∆, a nth1∆nth2∆ and 592

nth1∆nth2∆ strains (left) were struck onto synthetic defined media containing either 2% glucose 593

on Decem


.org/D

ownloaded from

http://ec.asm.org/

24

(middle) or 2% trehalose (right) as a sole carbon source and grown for 2 days at 30°C. B. 594

Trehalose was quantified in wild type and mutant crosses after 5 days on V8 pH 7.0. Mean 595

trehalose values from three biological replicates were compared using one-way ANOVA 596

statistics, and those crosses that differed significantly (p < 0.05) from wild type (a x ) are 597

marked with an asterisk. 598

599

Figure 4. Deletion of NTH1 and NTH2 leads to aberrant sexual development. A. Wild type, 600

nth1∆, nth2∆, and nth1 nth2 crosses after five days all show normal filament formation. 100X 601

magnification; bar = 100 µm. B. nth1∆nth2∆ crosses form large, ball-like structures in place of 602

basidia and do not produce spore chains. 400X magnification; Bar = 10 µm. C. After seven days 603

of development nth1 nth2∆ crosses produced numerous large, swollen nodules on filaments 604

giving them beads-on-a-string appearance (black arrows), consistent with previous descriptions 605

of chlamydospores. 200X magnification; bar = 50 µm. 606

607

Figure 5. Trehalase deficient spores are defective for growth. Spores from wild type, nth1, 608

nth2, and nth1nth2 crosses were isolated, counted, and cultured on rich medium for 3 days 609

at 30°C. X-axis represents genotype of spores. Y-axis represents percent of spores plated that 610

produced a colony. Resulting mean germination frequencies for three independent biological 611

replicates were compared using ANOVA, with only nth1Δnth2Δ spores having a significant 612

reduction (p<0.05) in germination. 613

614

Figure 6. Strains harboring nth2∆ are hypervirulent in mice. X-axis shows time in days after 615

tail vein infection with 1 x 106 wild type (diamonds), nth1 (squares), nth2∆ (triangles), or 616

nth1nth2∆ (cross-hatches) yeast. Y-axis shows percent survival of five Balb/c mice per 617

strain. The difference in average time to death between nth2 and nth1nth2 strains vs. wild 618

on Decem


.org/D

ownloaded from

http://ec.asm.org/

25

type and nth1∆ strains is 7 days and is both statistically significant (Wilcoxon rank-sum test, 619

p<0.05) and reproducible between experiments. 620

621

622

on Decem


.org/D

ownloaded from

http://ec.asm.org/

26

References 623

1. Harder W, Dijkhuizen L. 1983. Physiological responses to nutrient limitation. Annu. 624 Rev. Microbiol. 37:1–23. 625

2. Setlow P. 2006. Spores of Bacillus subtilis: their resistance to and killing by radiation, 626 heat and chemicals. J Appl Microbiol 101:514–25. 627

3. Botts MR, Giles SS, Gates MA, Kozel TR, Hull CM. 2009. Isolation and 628 characterization of Cryptococcus neoformans spores reveal a critical role for capsule 629 biosynthesis genes in spore biogenesis. Eukaryot Cell 8:595–605. 630

4. Briza P, Breitenbach M, Ellinger A, Segall J. 1990. Isolation of two developmentally 631 regulated genes involved in spore wall maturation in Saccharomyces cerevisiae. Genes 632 Dev. 4:1775–1789. 633

5. Haber JE, Halvorson HO. 1975. Methods in sporulation and germination of yeasts. 634 Methods Cell Biol 11:45–69. 635

6. Converse JL, Reed RE. 1966. Experimental epidemiology of coccidioidomycosis. 636 Bacteriol Rev 30:678–695. 637

7. Klein BS, Vergeront JM, Davis JP. 1986. Epidemiologic aspects of blastomycosis, the 638 enigmatic systemic mycosis. Semin Respir Infect 1:29–39. 639

8. Latgé JP. 1999. Aspergillus fumigatus and aspergillosis. Clin. Microbiol. Rev. 12:310–640 350. 641

9. Aimanianda V, Bayry J, Bozza S, Kniemeyer O, Perruccio K, Elluru SR, Clavaud C, 642 Paris S, Brakhage AA, Kaveri SV, Romani L, Latgé JP. 2009. Surface hydrophobin 643 prevents immune recognition of airborne fungal spores. Nature 460:1117–1121. 644

10. Ellis DH, Pfeiffer TJ. 1990. Ecology, life cycle, and infectious propagule of 645 Cryptococcus neoformans. Lancet. 336:923–925. 646

11. Velagapudi R, Hsueh YP, GeunesBoyer S, Wright JR, Heitman J. 2009. Spores as 647 infectious propagules of Cryptococcus neoformans. Infect Immun. 648

12. Giles SS, Dagenais TR, Botts MR, Keller NP, Hull CM. 2009. Elucidating the 649 pathogenesis of spores from the human fungal pathogen Cryptococcus neoformans. 650 Infect Immun 77:3491–500. 651

13. Mitchell TG, Perfect JR. 1995. Cryptococcosis in the era of AIDS ‐ 100 years after the 652 discovery of Cryptococcus neoformans. Clinical Microbiol. Rev. 8:515–548. 653

14. Mackenzie KF, Singh KK, Brown AD. 1988. Water stress plating hypersensitivity of 654 yeasts: protective role of trehalose in Saccharomyces cerevisiae. J. Gen. Microbiol. 655 134:1661–1666. 656

15. Mitsumasu K, Kanamori Y, Fujita M, Iwata K, Tanaka D, Kikuta S, Watanabe M, 657 Cornette R, Okuda T, Kikawada T. 2010. Enzymatic control of anhydrobiosis‐related 658 accumulation of trehalose in the sleeping chironomid, Polypedilum vanderplanki. FEBS 659 J. 277:4215–4228. 660

16. Nwaka S, Holzer H. 1998. Molecular biology of trehalose and the trehalases in the 661 yeast Saccharomyces cerevisiae. Prog. Nucleic Acid Res. Mol. Biol. 58:197–237. 662

17. Tournu H, Fiori A, Van Dijck P. 2013. Relevance of Trehalose in Pathogenicity: Some 663 General Rules, Yet Many Exceptions. PLoS Pathogens 9:e1003447. 664

18. Elbein AD, Pan YT, Pastuszak I, Carroll D. 2003. New insights on trehalose: a 665 multifunctional molecule. Glycobiology 13:17R–27R. 666

on Decem


.org/D

ownloaded from

http://ec.asm.org/

27

19. SánchezFresneda R, GuiraoAbad JP, Argüelles A, GonzálezPárraga P, Valentín 667 E, Argüelles JC. 2013. Specific stress‐induced storage of trehalose, glycerol and D‐668 arabitol in response to oxidative and osmotic stress in Candida albicans. Biochem. 669 Biophys. Res. Commun. 430:1334–1339. 670

20. Pedreño Y, GonzálezPárraga P, MartínezEsparza M, Sentandreu R, Valentín E, 671 Argüelles JC. 2007. Disruption of the Candida albicans ATC1 gene encoding a cell‐672 linked acid trehalase decreases hypha formation and infectivity without affecting 673 resistance to oxidative stress. Microbiology (Reading, Engl.) 153:1372–1381. 674

21. Serneels J, Tournu H, Van Dijck P. 2012. Tight control of trehalose content is 675 required for efficient heat‐induced cell elongation in Candida albicans. J. Biol. Chem. 676 287:36873–36882. 677

22. Zaragoza O, Blazquez MA, Gancedo C. 1998. Disruption of the Candida albicans TPS1 678 gene encoding trehalose‐6‐phosphate synthase impairs formation of hyphae and 679 decreases infectivity. J. Bacteriol. 180:3809–3815. 680

23. AlBader N, Vanier G, Liu H, Gravelat FN, Urb M, Hoareau CMQ, Campoli P, 681 Chabot J, Filler SG, Sheppard DC. 2010. Role of trehalose biosynthesis in Aspergillus 682 fumigatus development, stress response, and virulence. Infect. Immun. 78:3007–3018. 683

24. Petzold EW, Himmelreich U, Mylonakis E, Rude T, Toffaletti D, Cox GM, Miller JL, 684 Perfect JR. 2006. Characterization and regulation of the trehalose synthesis pathway 685 and its importance in the pathogenicity of Cryptococcus neoformans. Infect. Immun. 686 74:5877–5887. 687

25. Ngamskulrungroj P, Himmelreich U, Breger JA, Wilson C, Chayakulkeeree M, 688 Krockenberger MB, Malik R, Daniel HM, Toffaletti D, Djordjevic JT, Mylonakis E, 689 Meyer W, Perfect JR. 2009. The trehalose synthesis pathway is an integral part of the 690 virulence composite for Cryptococcus gattii. Infect. Immun. 77:4584–4596. 691

26. Lin X, Heitman J. 2005. Chlamydospore formation during hyphal growth in 692 Cryptococcus neoformans. Eukaryotic Cell 4:1746–1754. 693

27. KwonChung KJ, Edman JC, Wickes BL. 1992. Genetic association of mating types 694 and virulence in Cryptococcus neoformans. Infect. Immun. 60:602–605. 695

28. Sherman F. 1991. Getting started with yeast. Methods Enzymol 194:3–21. 696 29. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA. 1988. Current 697

Protocols in Molecular BiologyCurrent Protocols. 698 30. Kruzel EK, Giles SS, Hull CM. 2012. Analysis of Cryptococcus neoformans sexual 699

development reveals rewiring of the pheromone‐response network by a change in 700 transcription factor identity. Genetics 191:435–449. 701

31. Kerr MK, Churchill GA. 2001. Statistical design and the analysis of gene expression 702 microarray data. Genet. Res. 77:123–128. 703

32. Quackenbush J. 2001. Computational analysis of microarray data. Nat. Rev. Genet. 704 2:418–427. 705

33. Kanehisa M. 2000. KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids 706 Research 28:27–30. 707

34. Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP, 708 Dolinski K, Dwight SS, Eppig JT, Harris MA, Hill DP, IsselTarver L, Kasarskis A, 709 Lewis S, Matese JC, Richardson JE, Ringwald M, Rubin GM, Sherlock G. 2000. Gene 710 ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat. 711 Genet. 25:25–29. 712

on Decem


.org/D

ownloaded from

http://ec.asm.org/

28

35. Huang DW, Sherman BT, Lempicki RA. 2008. Systematic and integrative analysis of 713 large gene lists using DAVID bioinformatics resources. Nature Protocols 4:44–57. 714

36. Edgar R, Domrachev M, Lash AE. 2002. Gene Expression Omnibus: NCBI gene 715 expression and hybridization array data repository. Nucleic Acids Res. 30:207–210. 716

37. Davidson RC, Blankenship JR, Kraus PR, de Jesus Berrios M, Hull CM, D’Souza C, 717 Wang P, Heitman J. 2002. A PCR‐based strategy to generate integrative targeting 718 alleles with large regions of homology. Microbiology 148:2607–15. 719

38. Toffaletti DL, Rude TH, Johnston SA, Durack DT, Perfect JR. 1993. Gene transfer in 720 Cryptococcus neoformans by use of biolistic delivery of DNA. J. Bacteriol. 175:1405–721 1411. 722

39. Sherman F, Fink GR, Hicks JB. 1986. Laboratory Course Manual for Methods in Yeast 723 Genetics. Cold Spring Harbor Laboratory. 724

40. Parrou JL, François J. 1997. A simplified procedure for a rapid and reliable assay of 725 both glycogen and trehalose in whole yeast cells. Anal. Biochem. 248:186–188. 726

41. Zaragoza O, Fries BC, Casadevall A. 2003. Induction of capsule growth in 727 Cryptococcus neoformans by mammalian serum and CO2. Infect. Immun. 71:6155–728 6164. 729

42. McFadden D, Zaragoza O, Casadevall A. 2006. The capsular dynamics of 730 Cryptococcus neoformans. Trends Microbiol. 14:497–505. 731

43. Hu G, Steen BR, Lian T, Sham AP, Tam N, Tangen KL, Kronstad JW. 2007. 732 Transcriptional regulation by protein kinase A in Cryptococcus neoformans. PLoS 733 Pathog. 3:e42. 734

44. Giles SS, Stajich JE, Nichols C, Gerrald QD, Alspaugh JA, Dietrich F, Perfect JR. 735 2006. The Cryptococcus neoformans catalase gene family and its role in antioxidant 736 defense. Eukaryotic Cell 5:1447–1459. 737

45. Casadevall A, Perfect JR. 1998. Cryptococcus neoformans. ASM Press, Washington. 738 46. Yamashita I, Fukui S. 1985. Transcriptional control of the sporulation‐specific 739

glucoamylase gene in the yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 5:3069–3073. 740 47. Muthukumar G, Suhng SH, Magee PT, Jewell RD, Primerano DA. 1993. The 741

Saccharomyces cerevisiae SPR1 gene encodes a sporulation‐specific exo‐1,3‐ ‐742 glucanase which contributes to ascospore thermoresistance. J. Bacteriol. 175:386–743 394. 744

48. Ramalingam R, Blume JE, Ennis HL. 1992. The Dictyostelium discoideum spore 745 germination‐specific cellulase is organized into functional domains. J. Bacteriol. 746 174:7834–7837. 747

49. Garre E, Matallana E. 2009. The three trehalases Nth1p, Nth2p and Ath1p participate 748 in the mobilization of intracellular trehalose required for recovery from saline stress 749 in Saccharomyces cerevisiae. Microbiology (Reading, Engl.) 155:3092–3099. 750

50. Jules M, Beltran G, François J, Parrou JL. 2008. New insights into trehalose 751 metabolism by Saccharomyces cerevisiae: NTH2 encodes a functional cytosolic 752 trehalase, and deletion of TPS1 reveals Ath1p‐dependent trehalose mobilization. Appl. 753 Environ. Microbiol. 74:605–614. 754

51. Hirimburegama K, Durnez P, Keleman J, Oris E, Vergauwen R, Mergelsberg H, 755 Thevelein JM. 1992. Nutrient‐induced activation of trehalase in nutrient‐starved cells 756 of the yeast Saccharomyces cerevisiae: cAMP is not involved as a second messenger. J. 757 General Microbiology 138:2035–2043. 758

on Decem


.org/D

ownloaded from

http://ec.asm.org/

29

52. Parrou JL, Jules M, Beltran G, François J. 2005. Acid trehalase in yeasts and 759 filamentous fungi: localization, regulation and physiological function. FEMS Yeast Res. 760 5:503–511. 761

53. He S, Bystricky K, Leon S, François JM, Parrou JL. 2009. The Saccharomyces 762 cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological 763 function. FEBS J. 276:5432–5446. 764

54. Panepinto JC, Komperda KW, Hacham M, Shin S, Liu X, Williamson PR. 2007. 765 Binding of serum mannan binding lectin to a cell integrity‐defective Cryptococcus 766 neoformans ccr4 mutant. Infect. Immun. 75:4769–4779. 767

55. Ni M, Yu JH. 2007. A novel regulator couples sporogenesis and trehalose biogenesis 768 in Aspergillus nidulans. PLoS ONE 2:e970. 769

56. Kronstad J, Saikia S, Nielson ED, Kretschmer M, Jung W, Hu G, Geddes JMH, 770 Griffiths EJ, Choi J, Cadieux B, Caza M, Attarian R. 2012. Adaptation of Cryptococcus 771 neoformans to mammalian hosts: integrated regulation of metabolism and virulence. 772 Eukaryotic Cell 11:109–118. 773

57. Hu G, Cheng PY, Sham A, Perfect JR, Kronstad JW. 2008. Metabolic adaptation in 774 Cryptococcus neoformans during early murine pulmonary infection. Mol. Microbiol. 775 69:1456–1475. 776

58. Steenbergen JN, Shuman HA, Casadevall A. 2001. Cryptococcus neoformans 777 interactions with amoebae suggest an explanation for its virulence and intracellular 778 pathogenic strategy in macrophages. Proc. Natl. Acad. Sci. U.S.A. 98:15245–15250. 779

780

on Decem


.org/D

ownloaded from

http://ec.asm.org/

on Decem


.org/D

ownloaded from

http://ec.asm.org/

Table I. Strains and Oligonucleotides Used in This Study

Strain Genotype Reference

C. neoformans var. neoformans serotype D

JEC20 MATa Kwon-Chung et al, 1992

JEC21 MAT Kwon-Chung et al, 1992

CHY2083-2085 MATa nth2::NEOR This study

CHY2089-2091 MAT nth2::NEOR This study

CHY1705-1707 MATa nth1::NATR This study

CHY1711-1713 MAT nth1::NATR This study

CHY2182-2183, 2188 MATa nth1::NATR

nth2::NEOR This study

CHY2180-2181, 2184 MAT nth1::NATR

nth2::NEOR This study

Oligos used in cloning and PCR

CHO1565 TAATCAGTGGGTGAGGTGTG NTH1 5' Flank FWD

CHO1566 GCTCACATCCTCGCAGCCTCGAAGTTGGAGTGAAGGAGA NTH1 5' Flank REV

CHO1567 CTAGTTTCTACATCTCTTCCCTGGAAACATTCTTGATGG NTH1 3' Flank FWD

CHO1568 TCTCGCCCCTCCTAAACTAT NTH1 3' Flank REV

CHO1569 TCTCCTTCACTCCAACTTCGAGGCTGCGAGGATGTGAGC NATR cassette

FWD

CHO1570 CCATCAAGAATGTTTCCAGGGAAGAGATGTAGAAACTAG NATR cassette

REV

CHO2636 GTGTATCCAATCCAAGCACT NTH2 5' Flank FWD

CHO2637 GTCATAGCTGTTTCCTGGAGCTTTCGTTCATCAAGTC NTH2 5' Flank REV

CHO2764 CATCCTCGCAGCAAGGGCGTTTTGAGGTTCGAGGGTGAG NTH2 3' Flank FWD

CHO2765 CCCATACTACCGCAGCAATC NTH2 3' Flank REV

CHO2640 GACTTGATGAACGAAAGCTCCAGGAAACAGCTATGAC NEOR

cassette FWD

CHO2641 GGCTATGTTCAATGGGTATCCGCCCTTGCTGCGAGGATG NEOR

cassette REV

CHO2979 GCCTTCTCGAGGGGCTGGGA NTH1 northern probe FWD

CHO2980 CGTGGGCTTCGCCAGTCGTT NTH1 northern probe REV

CHO2938 GCCGCCCCATGCGTGTAAGT NTH2 northern probe FWD

CHO2939 CTCACCACCTCCTCCAGCGG NTH2 northern probe REV

on Decem


.org/D

ownloaded from

http://ec.asm.org/

on Decem


.org/D

ownloaded from

http://ec.asm.org/

Eukaryotic Cell doi:10.1128/EC.00152-14 Copyright © 2014 ... · 7/4/2014 · zs undergo another...

Documents

Transcript of Eukaryotic Cell doi:10.1128/EC.00152-14 Copyright © 2014 ... · 7/4/2014 · zs undergo another...