Ets-1 Activates the DRA Promoter in B Cells

MOLECULAR AND CELLULAR BIOLOGY, Nov. 1994, p. 7314-73210270-7306/94/$04.00+0Copyright (C 1994, American Society for Microbiology

Ets-1 Activates the DRA Promoter in B CellsNABILA JABRANE-FERRAT AND B. MATIJA PETERLIN*

Howard Hughes Medical Institute and Departments of Medicine, Microbiology, and Immunology,University of Califomia at San Francisco, San Francisco, Califomia 94143-0724

Received 27 June 1994/Returned for modification 8 August 1994/Accepted 11 August 1994

The X box in promoters of class II major histocompatibility complex genes plays a crucial role in theB-cell-specific and gamma interferon-inducible expression of these genes. The sequence TTCC is located in thepyrimidine tract which extends 5' to and partially overlaps the X box of the DRA promoter. This sequence

resembles the core binding site for the Ets family of DNA-binding proteins. In this study, we demonstrate thatmutations within the pyrimidine tract which change the TTCC motif, but do not affect the binding of regulatoryfactor X to the X box, decrease the activity of the DRA promoter in B cells. Furthermore, using electrophoreticmobility shift assays and cotransfection experiments, we demonstrate that Ets-1, but not Ets-2 or PU.1,functionally interacts with the pyrimidine tract and activates the DRA promoter.

Proteins encoded by the class II major histocompatibilitycomplex (class II) play important roles in the regulation of theimmune response. Class II ot/, heterodimers are expressed on

the cell surface of B and activated T lymphocytes, thymicepithelial and dendritic cells, and other antigen-presentingcells (2, 11, 32, 37). They are important for the development ofthe T-cell repertoire, antigen presentation, and subsequentT-cell activation (10). Moreover, inappropriate expression ofclass II proteins in tissues has been correlated with autoimmu-nity (4), and their congenital absence on B lymphocytes leadsto severe combined immunodeficiency or agammaglobuline-mia (bare lymphocyte syndrome II) (12).

Class II genes arose from duplications of an ancestral gene(20). Expression of their protein products is regulated bytrans-acting factors that bind to conserved upstream sequencesin their promoters called Z (S), X, and Y boxes (2, 11, 32, 37).The X box has been studied most extensively because it isrequired for the B-cell-specific and gamma interferon-induc-ible expression of class II genes. In the DRA promoter, theextended X box, from positions -116 to -86, has been furthersubdivided into the pyrimidine tract and Xl, X3, and X2 boxes(1, 39, 42). Clustered point mutations in the pyrimidine tract,the X3 or Xl box, but not the X2 box resulted in greatlydecreased activities of the DRA promoter in B cells andgamma interferon-induced cells (39, 41, 42). These DNAsequences interact with multiple nuclear proteins in vitro. Theregulatory factor X (RF-X) proteins, or nuclear factor Xcomplex (NF-Xc), bind to Xl (26, 34, 38) and Z (S) boxes (17).Both AP-1 and hXBP-1 bind to the X2 box (1, 26), andB-cell-specific factor 1 (BCF-1) binds to the X3 box (42).The pyrimidine sequence CCCTTCCCC, which overlaps

and flanks the binding site for RF-X/NF-Xc in the DRApromoter, has sequence identity with the core binding motif, 5'A/1TCC 3', for the Ets family of DNA-binding proteins (19,29, 44). Previous clustered point mutations of eight nucleotidesin this region resulted in decreased expression from the DRApromoter (39). In this study, we created smaller mutationswithin the Ets site, which behaved similarly. A specific nuclearprotein from Raji cells bound to the pyrimidine tract, andmutations of the TTCC sequence abolished this binding.Monoclonal antibodies (MAbs) identified this protein as Ets-1.

* Corresponding author. Phone: (415) 476-1291. Fax: (415) 566-4969.

We also cotransfected several Ets proteins with the DRApromoter into Raji cells. Only Ets-1, but not Ets-2 or PU.1,trans activated the DRA promoter.

MATERIALS AND METHODS

Cell culture. The Raji cell line (ATCC CCL86), which is ahuman Epstein Barr virus-positive Burkitt's lymphoma thatexpresses high levels of class II antigens, was maintained inRPMI 1640 supplemented with 10% heat-inactivated bovineserum and antibiotics.

Plasmid constructions. pDRASCAT, which contains theDRA promoter from positions -150 to +31 upstream of thechloramphenicol acetyltransferase (CAT) reporter gene, wasused as the parental plasmid for the construction of pointmutations in the pyrimidine tract. pPXm(-110/-109) andpPXm(-113/-112) were constructed by using unique restric-tion sites flanking the X box and oligonucleotides listed in Fig.1B. pBCAT, which contains no DRA sequences, was used as a

negative control. CE1 (7) and CE2 (5) contain the chickenets-1 and the human ets-2 cDNAs under the control of thesimian virus 40 early promoter. PUpECE contains the mousePU.1 cDNA under the control of the cytomegalovirus pro-moter (21). Plasmid pBLCAT (36), which contains the longterminal repeat (LTR) of human T-cell leukemia virus type I(HTLV-I), was included as the positive control for the cotrans-fections with CE1 and CE2. Plasmid pACTHCG contains thehuman growth hormone gene under the control of the actinpromoter (13).

Transfections and CAT assays. Raji cells (107) were trans-fected with 40 ,ug of plasmid DNA, using electroporation at300 V and 960 ,uF. Each transfection was done in triplicate andrepeated with two separate preparations of plasmid DNA.Each transfection also included 5 ,ug of pACTHCG, whichexpresses human growth hormone, in order to normalizetransfection efficiencies. After 40 to 48 h in culture, cells wereharvested and lysed. Cell lysates were assayed for CAT activityand supernatants were assayed for human growth hormonelevels as previously described (42).

In transient cotransfection assays with pDRASCAT,pPXm(-110/-109), pPXm(-113/-112), and CE1, CE2, andPUpECE, which direct the synthesis of Ets-1, Ets-2, and PU.1,respectively, 10 ,ug of target and 50 ,ug of effector plasmidswere cotransfected by electroporation. Total amounts of DNAwere kept constant (60 ,ug) by the addition of the expression

7314

Vol. 14, No. 11

Ets-1 ACTIVATES THE DRA PROMOTER IN B CELLS 7315

A

B

Z pyr Xl X3X21

-116 -87

pDRASCAT

pPXm (-110/-109)

GCC4TTCC CCTAGCAACAGATGCGTCATCTCGG AGGGATCGTTGTCTACGCAGTAGA

GCC

pPXm (-113/-112)

Cpx

p

PEA3

Pul

E74

SC2

(GATC)ACC

TTg CTAGCAACAGATGCGTCATCT

ZTTCCCCT

(GATC) TCGA*TTCCITGCTCGA(GATC) TACCTAACCAAjSTTCCITCTTTCAGA

(GATC) TGAGTTA TTCCGGTTATCAGCTAAGA

(GATC) AT ZTTCCGGT

FIG. 1. Map of the DRA promoter and sequences of wild-type and mutated plasmids and oligonucleotides. (A) Schematic representation ofthe DRA promoter from positions -150 to +31. Conserved upstream sequences are represented by the Z box, which includes the S box, pyrimidinetract, X box, X2 box, Y box, octamer (0), and TATA (T) sequences. The X box was divided into Xl, X3, and X2 boxes on the basis of the presenceof consensus binding sequences of known trans-acting factors. (B) Double-stranded sequence from nucleotides -116 to -87 in the DRA promoterlinked to the CAT reporter gene (pDRASCAT). The pyrimidine tract sequence is boxed. Sequences from positions -116 to -87 of plasmidspPXm(-110/-109) and pPXm(-113/-112), which contain point mutations (lowercase letters) in the pyrimidine tract, are also presented. (C)Sequences of oligonucleotides px, p, PEA3, PUl, E74, and SC2, which were used in EMSA. Since the Ets motif is on the noncoding strand in theDRA promoter, all other sequences are given in their antisense orientation. Restriction sites are indicated by parentheses.

vector alone. Cells were harvested 40 to 48 h posttransfection.Protein concentrations were determined by the Bradford assay(Bio-Rad, Hercules, Calif.).

Oligonucleotides. The sequences of oligonucleotides used inthis study are listed in Fig. 1C. The nucleotide sequences forthe PEA3 (Ets-1-binding motif from the polyomavirus en-hancer activator motif 3), PUl (PU.1-binding motif from thesimian virus 40 enhancer, positions -304 to 330), and E74(E74 protein-binding site located within an E74 intron) oligo-nucleotides were derived from Wasylyk et al. (43), Klemsz etal. (21), and Urness and Thummel (40), respectively. Theselected consensus (SC2) sequence was derived from Nye et al.(29) and contains an amplified consensus sequence that bindEts-1 with a Kdof 4.9 x 10-1.DNA-binding assay and electrophoretic mobility shift assay

(EMSA). Nuclear extracts from Raji cells were prepared aspreviously described (39). Amounts of nuclear protein werequantified by the Bradford assay (Bio-Rad).DNA-binding assays were performed with 10 ,ug of nuclear

extract or 3 ,ul of rabbit reticulocyte lysates (RRL) withtranslated proteins, 20 fmol (20,000 cpm) of -y-32P-end-labeledoligonucleotides, and 0.3 to 3 ,ug of poly(dI-dC) - poly(dI-dC)in the binding buffer as described by Ohlsson et al. (30).Reaction mixtures were incubated with unlabeled compe-titor oligonucleotides at 4°C for 10 min prior to the addi-tion of the radiolabeled probe for an additional 10 min.Samples were electrophoresed on a 5% nondenaturing poly-acrylamide gel in Tris-glycine-EDTA buffer at 15 mA for 2 hat 4°C for NF-P and Ets-1 or in 0.25 x Tris-borate-EDTAbuffer at 9 mA for 3 h at room temperature for RF-X1. For

competition experiments, unlabeled oligonucleotides wereadded at 50-, 500-, or 1,000-fold molar excess. An oligonucle-otide of an irrelevant sequence was used as the control fornonspecific binding.

In the supershift experiments, an affinity chromatography-purified Ets-1- or Ets-2-specific mouse MAb was added (1 ,ug)to the binding reaction mixture prior to the addition of thelabeled probe. Extracts were preincubated with antibodiesalone for 10 min prior to the addition of the probe for anadditional 10 min at 4°C. The mouse MAbs against Ets-1 andEts-2 have been described previously (8).

In vitro transcription and translation assays. The full-length murine ets-1 cDNA was cloned into the Bluescript SK+vector, and the full length RF-X1 cDNA was cloned into thepGEM4 vector. Plasmids were linearized and transcribed invitro as described by the manufacturer (Promega, Madison,Wis.). RNA was transcribed by using either T7 (ets-1 or ets-2)or Sp6 (RFX1) RNA polymerase. After purification, RNAtranscripts (1 ,ug) were used as mRNA templates for the invitro translation with nuclease-treated RRL (Promega) in thepresence of [35S]methionine (NEN) in a 50-,ul reaction volumefor 1 h at 30°C. The 35S-labeled proteins were analyzed on asodium dodecyl sulfate (SDS)-10% polyacrylamide gel beforeEMSA. EMSA was performed as described above, using 3 RIof the RRL. Gels were run in Tris-glycine-EDTA buffer at 4°Cfor Ets proteins or at room temperature in 0.25x Tris-borate-EDTA for RF-X1.UV cross-linking. After electrophoresis, gels were subjected

to UV light (254 nm) for 20 min to cross-link DNA-polypep-tide complexes and then autoradiographed (15). Specific bands

VOL. 14, 1994

'TTCdCCCTAGCAACAGATGCGTCATCT

7316 JABRANE-FERRAT AND PETERLIN

pDRASCAT

pPXm(-110/-109)

pPXm(-113/-112)

CAT ACTIVITY

0 100 200

197

46

52

.~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

(0 p pxtii Ipxm2 irr1 2 3 4 5 6

E...

% WT

100%

competitor

NF-NP-1

23%

26%

FIG. 2. Point mutations in the pyrimidine tract decrease expressionfrom the DRA promoter in Raji cells. Raji cells were transfected witheither pDRASCAT, pPXm(-110/-109), or pPXm(- 113/-112).pPXm(-110/-109) and pPXm(-113/-112) contain point mutationsin the pyrimidine tract of the DRA promoter (Fig. 1B). CAT activitiesand percentages of wild-type (wt) levels are given at left and right,respectively. Absolute CAT values were derived as described inMaterials and Methods. Absolute values and standard errors of themean (presented as error bars) were calculated from two differentexperiments performed in triplicate with two different plasmid prepa-rations.

were excised from the gel, boiled in Laemmli buffer, andresolved on an SDS-10% polyacrylamide gel.

_- free probe

FIG. 3. A nuclear protein from Raji cells interacts with the pyrim-idine tract, as determined by EMSA with labeled p oligonucleotide andRaji nuclear extracts. NF-P binds to the p oligonucleotide (lane 2). A1,000-fold molar excess of unlabeled p (lane 3) but not pxml (lane 4),pxm2 (lane 5), or an irrelevant oligonucleotide (irr; lane 6) competedfor this binding. Whereas p contains sequences from positions -116 to-105 from the DRA promoter, pxml and pxm2 contain additionalpoint mutations at positions -110 and -109 and positions -113 and-112, respectively (Fig. 1B).

RESULTSIdentification of the Ets-binding site in the DRA promoter.

Recent studies of Ets proteins have defined the minimalconsensus binding sequence for these proteins (29, 44). Uponvisual inspection of the DRA promoter, the sequence frompositions -116 to -108 in the pyrimidine tract contains thisTTCC motif. Indeed, previous clustered point mutationswithin the pyrimidine tract resulted in a four- to fivefolddecrease in expression from the DRA promoter in Raji cells(39). Interestingly, only the complete scrambling of the se-quence had this effect, whereas standard transversions had nophenotype. Upon further examination, we noted that thesetransversions recreated the TTCC sequence on the noncodingstrand.

Point mutations in the pyrimidine tract decrease expressionfrom the DRA promoter in Raji cells. To determine whetherthe putative Ets site plays a role in the transcriptional activityof the DRA promoter, we introduced smaller mutations intothe pyrimidine tract of a synthetic DRA promoter (pDRASCAT; Fig. 1B) and transfected these plasmids into Raji cells.As demonstrated in Fig. 2, mutations in the Ets site in pPXm(-110/-109) (CT7lCC to CTTGG) and pPXm(-113/-112)(CTICC to TGTCC) (Fig. 1B) resulted in approximatelyfourfold reductions of DRA expression (23 and 26%, respec-tively, of the wild-type CAT activity) (Fig. 2). Thus, thepyrimidine tract is important for high levels of expression fromthe DRA promoter in B cells.A nuclear protein(s) interacts with the pyrimidine tract.

Proteins which might interact with the pyrimidine tract (p site,positions -116 to -105) were examined by EMSA using the poligonucleotide and nuclear extracts from Raji cells. As pre-sented in Fig. 3, lane 2, nuclear extracts from Raji cells formeda specific complex, called NF-P, with the p probe, and excessunlabeled p oligonucleotide competed for this binding (Fig.3, lane 3). The binding of NF-P was not disrupted by thepreincubation of Raji nuclear extracts with an excess ofunlabeled pxml, pxm2, or unrelated irrelevant oligonucleotide

(Fig. 3, lanes 4 to 6). pxml and pxm2 contain mutations inpositions -110 and -109 and positions -113 and -112 of theDRA promoter, respectively (Fig. 1B). Thus, NF-P bindsspecifically to the p site of the DRA promoter.

Characterization of NF-P. To characterize NF-P and deter-mine whether any known Ets sites could compete for thisbinding (Fig. 1C), further EMSAs were performed. To thisend, excess unlabeled p (Fig. 4A, lane 2), PEA3 (Fig. 4A, lane3), PUl (Fig. 4A, lane 4), E74 (Fig. 4A, lane 5), px (Fig. 4A,lane 6), and irrelevant (Fig. 4A, lane 7) oligonucleotides wereused. All except the irrelevant oligonucleotide competed effi-ciently for the binding of NF-P. PEA3 is the polyomavirusenhancer activator 3 site which binds multiple Ets proteins (25,43, 45), PUl binds the macrophage- and B-cell-specific tran-scription factor PU.1 (21), and E74 binds the Drosophilamelanogaster factor E74 (40). Thus, NF-P binds to the pyrim-idine tract of the DRA promoter and recognizes several otherEts sites bound by PEA3, PU.1, or E74.To examine the size of the protein(s) in NF-P, we UV

cross-linked the NF-P complex to the p oligonucleotide in situ.The resulting complex was resolved by SDS-polyacrylamide gelelectrophoresis (PAGE). A single band with an approximatemolecular mass of 60 kDa was observed (Fig. 4B). SinceDNase I treatment was not performed, the size of the freeNF-P should be slightly less. The molecular mass of several Etsproteins range from 55 to 64 kDa. Thus, NF-P could be an Etsprotein.NF-P binds to a selected Ets-l consensus site. Binding

competition assays demonstrated that excess unlabeled Etssites competed with NF-P for binding to the pyrimidine tract(Fig. 5A). To determine whether NF-P was related to Ets-1, weused SC2, which is a selected consensus sequence that bindsEts-1 with strong affinity (Kd = 4.9 x 10-") (29). Figure 5Ademonstrates that the gel retardation patterns observed withSC2 and nuclear extracts from Raji cells are identical to thosefor NF-P (Fig. 5A; compare lanes 1 to 5 to lanes 6 to 10). Only

MOL. CELL. BIOL.


A

0 p PEA3 PU1 E74 px irr1 2 3 4 5 6 7w _E

B

competitor

M (kDa)

- 116.2

<- NF-P > sL_ ~~~~~~1,l

- 72.5

ASC2 p

o) p .s /, irr irr' P 0

1 2 3 4 5 6 7 8 9 10

.

I

, U.

.4

48.5

free probe _

FIG. 4. Ets sites compete for the binding of NF-P. (A) EMSA withlabeled p oligonucleotide and Raji nuclear extracts. NF-P binds to thep oligonucleotide (lane 1). A 1,000-fold molar excess of unlabeled p(lane 2), PEA3 (lane 3), PUl (lane 4), E74 (lane 5), and px (lane 6) butnot an irrelevant oligonucleotide (irr; lane 7) competed for thisbinding. The px oligonucleotide contains the sequence from positions-116 to -87 of the DRA promoter; PEA3, PUl, and E74 containsequences which bind Ets-1/2, PU.1, and the D. melanogaster factorE74, respectively. Arrows indicate the position of the NF-P complex.Free probe was run off the gel. (B) UV cross-linking of NF-P. NF-Pfrom panel A was exposed to UV light and resolved by SDS-PAGE as

described in Materials and Methods. Positions of molecular weightstandards (M) are shown at the right. Arrows point to the cross-linkedprotein and the free probe.

excess unlabeled p (Fig. 5A, lanes 2 and 9) but not pxml (Fig.5A, lanes 3 and 8), pxm2 (Fig. 5A, lanes 4 and 7), or an

irrelevant (lanes 5 and 6) oligonucleotide competed for thisbinding.

That these complexes contain Ets-1 was confirmed by an

antibody supershift assay (Fig. SB). The SC2 and NF-P com-plexes were supershifted with an anti-Ets-1 MAb (Fig. SB,lanes 2 and 5) but not an anti-Ets-2 MAb (Fig. SB, lanes 3 and6). We conclude that the SC2 complex is identical to NF-P andis Ets-1.

Ets proteins bind specifically to the pyrimidine tract. Toconfirm that NF-P is Ets-1, we used v-Ets and murine Ets-1,transcribed in vitro and translated in the RRL, in EMSAs.v-Ets was used because it does not contain the C-terminaldomain of Ets-1, which interferes with the binding of Ets-1 toDNA in vitro. As expected, v-Ets and Ets-1 bound to thepyrimidine tract (Fig. 6A and B). Figure 6A also demonstratesthat v-Ets and NF-P have similar electrophoretic mobilities.Not only did v-Ets bind strongly to the p oligonucleotide, butas for NF-P, only unlabeled p (Fig. 6A, lanes 1 and 7) but notmutated pxml (Fig. 6A, lanes 2 and 8), pmx2 (Fig. 6A, lanes 3and 9), or an irrelevant (Fig. 6A, lanes 4 and 10) oligonucle-otide competed for this binding.We then tested the ability of Ets-1 to bind to the p site (Fig.

6B). As expected, the binding with Ets-1 translated in the RRLwas weaker than that observed with v-Ets (compare Fig. 6Aand B). However, its interaction was specific, since p but not anirrelevant oligonucleotide competed for this binding (Fig. 6B,lanes 1, 4, 3, and 6). Figure 6C demonstrates that both NF-Pand Ets-1 expressed in the RRL were specifically supershiftedwith the anti-Ets-1 MAb but not with the anti-Ets-2 MAb (Fig.6C; compare lanes 3 and 4). Thus, NF-P is Ets-1.

Point mutations in the Ets site do not affect the binding ofRF-X1 to the X box. The regulatory factor RF-X1/NF-Xc,which binds to the X box of major histocompatibility complex

.A __ A. v _- tree priobliM

ACCCGGAAGCA; AGGGIGA.ACGGG

BSC2

.2oll;ar a

I11

3

p., ,.,

4 6

f:

probe

antibody

* I super- sllift

< N-F-P

FIG. 5. NF-P binds to Ets-1 SC2. (A) EMSA with labeled SC2(lanes 1 to 5) or p oligonucleotide and Raji nuclear extracts (lanes 6 to10). A 1,000-fold molar excess of unlabeled p (lanes 2 and 9) but notpxml (lanes 3 and 8), pmx2 (lanes 4 and 7), or an irrelevantoligonucleotide (irr; lanes 5 and 6) competed for this binding. Arrowspoint to the positions of NF-P and the free probe; nucleotide se-

quences of SC2 and p are given at the bottom. (B) Immunologicalcharacterization of NF-P. Raji nuclear extracts were preincubated withan anti-Ets-1 MAb (lanes 2 and 5) or anti-Ets-2 MAb (lanes 3 and 6)before the addition of the labeled probe. Control Raji nuclear extractswere preincubated without antibodies before the addition of the probe(lanes 1 and 4). Arrows indicate the positions of NF-P and supershiftedcomplexes.

class II promoters, has been studied extensively (for reviews,see references 11 and 32). RF-X1/NF-Xc is a ubiquitousnuclear protein of 140 kDa which binds tightly to the Xl boxand weakly to the Z box (17). To date, only mutations in the Xlbox, which abolished the binding of RF-X1, abolished tran-scription from the DRA promoter. However, cotransfectionsof plasmids which directed the expression of sense and anti-sense RF-X1 sequences with class II promoters revealed nophenotype for RF-X1 in B cells. Furthermore, no complemen-tation group of bare lymphocyte syndrome II has been mappedto the RF-X1 gene.The exact contact points between RF-X1 and the Xl box

were defined by clustered point mutations, methylation inter-ference, and DNase I footprinting (16, 18, 23). Althoughmutations in neither pxml nor pxm2 affected the Xl box,mutations at positions -110 and -109 altered nucleotides nextto contact points for RF-X1 in the Xl box (16). To determinewhether these mutations interfered with the binding of RF-X1to the X box, we performed competition assays with Raji

!t

probe

comiipelitor

o * Np-P

VOL. 14, 1994


ARaji____________________ v-Ets

p 8 0 (1 p

I 2 3 4 5 6 7 8 9 10, ,. y ... ..

NF- ->

cxtractRRl,

comiipetitor

BRaji

p 0 .1 2 3

Ets-I

p 0 ,4-4 5 6

-9 '-F-ts N F; X)

.1. l,2.' .-

CRaji

Ets- I

Ets-2 Ets-I Ets-2mAb 0 mAb () imAb1 2 3 4 5 6

S .*# box0

*-'fee probe

NFP

FIG. 6. NF-P, v-Ets, and Ets-1 have similar mobilities. (A) EMSAs with labeled p oligonucleotide, Raji nuclear extracts (lanes 1 to 5), and v-Etstranslated in the RRL (lanes 6 to 10). Unlabeled competing oligonucleotides are identified above the lanes. Arrows point to the positions of theNF-P or v-Ets complexes and the free probe. A 1,000-fold molar excess of unlabeled p (lanes 1 and 7) but not pxml (lanes 2 and 9), pmx2 (lanes3 and 10), or an irrelevant oligonucleotide (irr; lanes 4 and 8) competed for the binding of NF-P or v-Ets. (B) EMSA with nuclear extracts fromRaji cells (lanes 1 to 3) and Ets-1 translated in the RRL (lanes 4 to 6). A 1,000-fold molar excess of unlabeled p (lanes 1 and 4) but not an irrelevantoligonucleotide (irr; lanes 3 and 6) competed for this binding. Arrows point to the positions of NF-P and v-Ets. (C) The anti-Ets-1 but not anti-Ets-2MAb supershifts NF-P and Ets-1 translated in the RRL. Shown are EMSAs with 3 pg of Raji nuclear extracts (lanes 1 to 3) and Ets-1 translatedin the RRL (lanes 4 to 6). Extracts and the RRL were preincubated with the anti-Ets-2 MAb (lanes 1 and 6) or anti-Ets-1 MAb (lanes 3 and 4)before the addition of the labeled probe as in Fig. SB. Control extracts were preincubated without antibodies (lanes 2 and 5). Arrows indicate thepositions of NF-P, Ets-1, and supershifted complexes.

nuclear extracts or in vitro-translated RF-X1 with the pxmland pxm2 oligonucleotides (Fig. 7).

Radiolabeled px oligonucleotide, which contains the pyrim-idine tract and Xl sequences, was incubated with Raji nuclearextracts. Two major complexes, which are characteristic forRF-X1/NF-Xc, were observed (Fig. 7A, lane 2). Specificcompetition was obtained with an excess of unlabeled px

(Fig. 7A, lane 1), pxml [p(PXm(-110/-109)] (Fig. 6A, lanes3 and 4), and pxm2 [pPXm(-113/-112)] (Fig. 7A, lanes 5and 6) but not with an irrelevant oligonucleotide (Fig. 7A, lane7).Our analysis was extended with RF-X1 translated in the

RRL (Fig. 7B). Specific binding of RF-X1 was observed withpxml and pxm2 (Fig. 7B, lanes 1 and 6). Not only did a 50-foldmolar excess of unlabeled px oligonucleotide compete com-

pletely for the binding of RF-X1 to pxml or pxm2 (Fig. 7B;compare lanes 2 and 1 or lanes 7 and 6), but unlabeled pxmlor pxm2 had the same effect (Fig. 7B; compare lanes 3 and1 or 8 and 6). However, a 500-fold molar excess of an irrele-vant oligonucleotide did not compete for this binding (Fig.7B, lanes 5 and 10). The higher-mobility complexes observedin these EMSAs likely represent degradation products ofRF-X1 (Fig. 7B) which were observed previously (23). SinceRF-X1/NF-Xc from Raji nuclear extracts and the in vitro-translated RF-X1 bound specifically to pxml and pxm2 oligo-nucleotides, we conclude that mutations in the Ets site do notaffect the binding of RF-X1 to the Xl box in the DRApromoter.

Ets-1 but not Ets-2 or PU.1 trans activates the DRA pro-moter. Since Ets sites competed for the binding of NF-P to theDRA promoter and NF-P was identified as Ets-1 by EMSAs,

we tested the ability of several Ets proteins to trans activateexpression from the DRA promoter. We cotransfected pDRASCAT, pPXm(-110/-109), pPXm(-113/-112), and pBLCATwith expression plasmids CE1, CE2, and PUpECE, whichcontain cDNAs for chicken ets-1, human ets-2, and murinePU.1, respectively, into Raji cells. As negative controls, re-

porter plasmids were cotransfected with pKCR3 and pECEexpression vectors, which are parental plasmids for CE1, CE2,and PUpECE. Transfected cells were incubated for 48 h, andcell lysates were assayed for CAT activities as described inMaterials and Methods.

Figure 8 demonstrates that cotransfection of Ets-1 withpDRASCAT resulted in an 8.8-fold increased CAT activityover that observed with pDRASCAT and the parental ex-

pression vectors alone. However, cotransfections with CE2or PUpECE had no effect on the DRA promoter (Fig. 8).Importantly, cotransfections of pPXm(-110/-109) or pPXm(-113/-112) with CE1, CE2, or PUpECE did not increaseCAT activities over those with the parental plasmid vectors.Thus, mutations which abolished the binding activity of NF-Pin vitro were not activated by overexpression of Ets-1. Asexpected, cotransfection of pBLCAT, which contains theHTLV-I LTR linked to the CAT reporter gene, with CE1 andCE2 but not PUpECE resulted in CAT activities 7.6- and6-fold-greater than those observed with pBLCAT and theparental expression vectors. Moreover, PUpECE, which con-

tained PU.1, increased the expression of the immunoglobulin,u heavy-chain enhancer in B cells (35). We conclude that Ets-1binds to the pyrimidine tract of the DRA promoter and playsa major role in its trans activation.

extractRRL

competitor

*- Ets-I

extraictRRL

antiboclv

Supershlift

< -EtS-I

MOL. CELL. BIOL.


A

px pxm l pxm2 irr50 0 150 500 TO0515001 2 3 4 5 6 7

probecompetitormolar excess

t RFX =*

.n I

Bpxm 1 (2)

I px pxml(2) irr

0 50 50 5001 5001 2 3 4 5

6 7 8

S. .,

"

:Im.iRFX =t s,.

_.;::.:,z--,

CAT ACrIVrTY

0 200

pDRASCAT

pPXm(-110/-109)

pxml

9 10

owl', mmmM;W

pPXm(-113/-112)

pBLCAT

pxm2

FIG. 7. Point mutations in the Ets site do not affect the binding ofRF-X1 to the X box. (A) EMSA with labeled px oligonucleotide andRaji nuclear extracts. Unlabeled competing oligonucleotides and theirfold molar excesses are presented above the lanes. px contains thesequence from positions -116 to -87 in the DRA promoter. pxmland pxm2 contain mutations at positions -110 and -109 and positions-113 and -112, respectively (Fig. 1B). An irrelevant oligonucleotide(irr) was also used. Arrows point to the position of RF-X1. (B) EMSAswith labeled pxml or pxm2 oligonucleotide. RF-X1 was translated inthe RRL. Unlabeled competiting oligonucleotides and their fold molarexcesses are presented above the lanes. Unlabeled px (lanes 2 and 7),pxml (lanes 3 and 4), and pxm2 (lanes 8 and 9) but not an irrelevantoligonucleotide (irr; lanes 5 and 10) competed for the binding ofRF-X1. Arrows point to the position of RF-X1.

DISCUSSION

The pyrimidine tract of the DRA promoter contains theTTCC motif which is present in the consensus binding site forEts proteins (Fig. 1). In this study, we demonstrated that thisEts site not only is required for high levels of DRA expressionin B cells but also binds a nuclear protein which we namedNF-P. The identity of NF-P as Ets-1 unfolded as follows: (i)several different Ets sites competed for the binding of NF-P(Fig. 3), (ii) NF-P was similar in size to other Ets proteins (Fig.4), (iii) NF-P bound to the amplified consensus sequence SC2(Fig. 5), (iv) NF-P was recognized by the mouse anti-Ets-1 butnot anti-Ets-2 MAb, and (v) the in vitro-translated Ets-1 boundto the pyrimidine tract (Fig. 6). The functional relevance of thisinteraction was assayed in Raji cells, in which only Ets-1 butnot Ets-2, PU.1, or Elf-1 (data not presented) trans activatedthe DRA promoter. Activated transcription was dependent onan intact pyrimidine tract. Thus, Ets-1 is a trans activator whichbinds to the pyrimidine tract of the DRA promoter in B cells.

Mutations at position -110 and -109 and positions -113and -112 destroyed the core Ets site (TTCC), which isessential for the binding of all Ets proteins. Both mutations notonly abolished the binding of Ets-1 to the pyrimidine tract butalso reduced the transcriptional activity of the DRA promoter.This observation is in agreement with previous data showingthat similar mutations resulted in a fivefold reduction in thetrans activation of PEA3 by p68c"ts- in fibroblasts (43).The identity of NF-P as Ets-1 was established primarily by

EMSAs, binding competition studies, supershifts with themouse anti-Ets-1 but not Ets-2 MAb, and functional studies inB cells. Furthermore, the supershifts were identical betweennuclear extracts and Ets-1 translated in the RRL (Fig. 6). The

FIG. 8. Ets-1 but not Ets-2 or PU.1 trans activates the DRApromoter in Raji cells. CAT enzymatic activities were assayed in Rajicells cotransfected with pDRASCAT, pPXm(-110/-109), or pPXm(-113/-112) together with CE1, CE2, or PUpECE, which expressesEts-1, Ets-2, or PU.1 protein, respectively. As controls, cotransfectionswere also performed with pKCR3 and pECE, which are parentalplasmids of CE1, CE2, and PUpECE. The pBLCAT reporter plasmid,which contains the HTLV-I LTR, was used to control for the expres-sion of Ets-1 and Ets-2 in Raji cells. Cotransfections are as follows:open bars, control plasmids; black bars, CE1; gray bars, CE2; stripedbars, PUpECE. Values represent experiments done in triplicate withtwo sets of DNA preparations. Standard errors of the mean are

denoted by error bars.

weaker binding of Ets-1 translated in the RRL could be due tothe presence of its C-terminal domain. Thus, v-Ets, which doesnot contain these sequences, bound better to our site (Fig. 6).Similar C-terminal truncations of Ets-1 also improved itsbinding to the mbl promoter (14) and PEA3 oligonucleotide(25). Finally, in cotransfection studies, only Ets-1 trans acti-vated the DRA promoter in Raji cells. However, all threeproteins, namely, Ets-1, Ets-2, and PU.1, were expressed as

assayed by their activities on the HTLV-I LTR (Ets-1 and -2[pBLCAT]; Fig. 8) and immunoglobulin ,u heavy-chain en-hancer (35).

Several other trans-acting factors also bind to the extendedX box in the DRA promoter. These include RF-Xl, hXBP-1,AP-1, and BCF-1. So far, their functional correlations with theexpression of class II have been indirect. Antisense RF-Xlinhibited the gamma interferon inducibility of the DRA pro-moter in 143B cells but had no effect in B cells (33). Whereasantisense hXBP-1 decreased expression of HLA-DR and -DPantigens (31), Id, which is a helix-loop-helix protein that lacksthe basic domain and interacts with BCF-1, decreased theexpression from the DRA promoter in Raji cells (42). Thus,Ets-1 is the first protein which interacts with the extended Xbox and increases directly the expression from the DRApromoter in B cells.

Ets-1 may also interact with other proteins that bind to theextended X box. Such protein-protein interactions on the DNAare a hallmark of Ets proteins. For example, Ets-1 and Spi actcooperatively on the HTLV-I LTR (9), and Elk-1, a related Etsprotein, and serum response factor are essential for the serumresponse of the c-fos promoter (27). Since the Ets site in theDRA promoter is upstream of the Xi box, it is possible thatEts-1 potentiates the activity of, or acts cooperatively with,RF-X proteins. In addition, Ets proteins can also interact

400

39436

25

454

CEI12 miCE213 PU PECE1614

380w- 4 310

VOL. 14, 1994

I


productively with each other (28), with E12/47 on the immu-noglobulin ,u heavy-chain enhancer (35), and with c-Fos andc-Jun on the polyomavirus enhancer (43). Since BCF-1 con-tains E47 and binds to the X3 box (42) and c-Jun, c-Fos (1),and hXBP-1 bind to the X2 box (26), Ets-1 could potentiatethe activity of these DNA-binding proteins. The identificationof Ets-1 as a positive activator on the extended X box of theDRA promoter now makes the study of such protein-proteininteractions possible.

Expression of class II is developmentally regulated. Class IIdeterminants are observed on B cells, activated T cells, andantigen-presenting cells (2, 11, 32, 37). The expression of Etsproteins is also restricted to certain tissues (3, 6). Ets-1 isexpressed predominantly in lymphoid cells, brain, and lung(22) and is correlated with the activation of the immunoglob-ulin p. heavy-chain gene enhancer during B-cell ontogeny (24,35). Thus, the identification of Ets-1 as a trans-acting factor ofthe DRA promoter may represent an important step towardour understanding the developmental regulation of class II.

ACKNOWLEDGMENTS

We acknowledge Michael Armanini for expert secretarial assistance,Charles Voliva, Jim Hagman, and Rudi Grosschedl for many helpfulsuggestions, Joseph Fontes for comments on the manuscript, and KiraHenriksen for technical help. We also acknowledge J. Ghysdael, B. J.Graves, and T. S. Papas for sharing reagents.

This work was supported by grant ROI A129954 from the NIH andby the Treadwell Foundation.

REFERENCES1. Andersson, G., and B. M. Peterlin. 1990. NF-X2 that binds to theDRA X2-box is activator protein 1. J. Immunol. 145:3456-3462.

2. Benoist, C., and D. Mathis. 1990. Regulation of major histocom-patibility complex class-II gene expression: X, Y and other lettersof the alphabet. Annu. Rev. Immunol. 8:681-715.

3. Bhat, N. K., K. L. Komschlies, S. Fujiwara, R. J. Fisher, B. J.Mathieson, H. A. Gregorio, J. W. Young, K. Kasik, K. Ozato, andT. S. Papas. 1989. Expression of ets genes in mouse thymocytesubsets and T cells. J. Immunol. 142:672-678.

4. Botazzo, G. F., I. Todd, R. Mirakian, A. Belfiore, and R. Pujol-Borrel. 1986. Organ-specific autoimmunity: a 1986 overview. Im-munol. Rev. 94:137-169.

5. Boulukos, K. E., P. Pognonec, A. Begue, F. Galibert, J. C.Gesquiere, D. Stehelin, and J. Ghysdael. 1988. Identification inchickens of an evolutionarily conserved cellular ets-2 gene (c-ets-2)encoding nuclear proteins related to the products of the c-etsproto-oncogene. EMBO J. 7:697-705.

6. Boulukos, K. E., P. Pognonec, E. Sariban, M. Bailly, C. Lagrou,and J. Ghysdael. 1990. Rapid and transient expression of Ets2 inmature macrophages following stimulation with cMGF, LPS, andPKC activators. Genes Dev. 4:401-409.

7. Duterque-Coquillaud, M., D. Leprince, A. Flourens, C. Henry, J.Ghysdael, B. Debuire, and D. Stehelin. 1988. Cloning and expres-sion of chicken p54c-ets cDNAs: the first pS4c-ets coding exon islocated in the 40.0 kbp genomic domain unrelated to v-ets.Oncogene Res. 2:335-344.

8. Fisher, R J., S. Koizumi, A. Kondoh, J. M. Mariono, G. Mavro-thalassitis, N. K. Bhat, and T. S. Papas. 1992. Human Etsloncoprotein. J. Biol. Chem. 267:17957-17965.

9. Gegonne, A., R. Bosselut, R A. Bailly, and J. Ghysdael. 1993.Synergistic activation of the HTLV-I LTR Ets-responsive regionby transcription factors Etsl and Spl. EMBO J. 12:1169-1178.

10. Germain, R N., and D. H. Margulies. 1993. The biochemistry andcell biology of antigen processing and presentation. Annu. Rev.Immunol. 11:403-450.

11. Glimcher, L. H., and C. J. Kara. 1992. Sequences and factors: aguide to MHC class-II transcription. Annu. Rev. Immunol. 10:13-49.

12. Griscelli, C., B. Liowska-Grospierre, and B. Mach. 1989. Com-bined immunodeficiency with defective expression in MHC class II

genes. Immunodefic. Rev. 1:135-153.13. Gunning, K. E., J. Leavitt, G. Muscat, S.-Y. Ng, and L. Kedes.

1987. A human ,3-actin expression vector system directs high-levelaccumulation of antisense transcripts. Proc. Natl. Acad. Sci. USA84:4831-4835.

14. Hagman, J., and R Grosschedl. 1992. An inhibitory carboxyl-terminal domain in Ets-1 and Ets-2 mediates differential bindingof ETS family factors to promoter sequences of the mb-1 gene.Proc. Natl. Acad. Sci. USA 89:8889-8893.

15. Hagman, J., A. Travis, and R. Grosschedl. 1991. A novel lineage-specific nuclear factor regulates mb-1 gene transcription at theearly stages of B cell differentiation. EMBO J. 10:3409-3417.

16. Hasegawa, S. L., J. H. Sloan, W. Reith, B. Mach, and J. M. Boss.1991. Regulatory factor-X binding to mutant HLA-DRA pro-moter sequences. Nucleic Acids Res. 19:1243-1249.

17. Jabrane-Ferrat, N., M. Nakanishi, and B. M. Peterlin. Unpub-lished data.

18. Kara, C. J., and L. H. Glimcher. 1991. In vivo footprinting ofMHC class II genes: bare promoters in the bare lymphocytesyndrome. Science 252:709-712.

19. Karim, F. D., L. D. Urness, C. S. Thummel, M. J. Klemsz, S. RMcKercher, A. Celada, C. Van Beveren, R A. Maki, C. V.Gunther, J. A. Nye, and B. J. Graves. 1990. The Ets-domain: a newDNA-binding motif that recognizes a purine-rich core DNAsequence. Genes Dev. 4:1451-1453.

20. Klein, J., Y. Satta, C. O'hUigin, and N. Takahata. 1993. Themolecular descent of the major histocompatibility complex. Annu.Rev. Immunol. 11:269-295.

21. Klemsz, M. J., S. R. McKercher, A. Celada, C. Van Beveren, andR. A. Maki. 1990. The macrophage and B cell-specific transcrip-tion factor PU.1 is related to the ets oncogene. Cell 61:113-124.

22. Kola, I., S. Brookes, A. R. Green, R. Garber, M. Tymms, T. S.Papas, and A. Seth. 1993. The Ets-1 transcription factor is widelyexpressed during murine embryo development and is associatedwith mesodermal cells involved in morphogenetic processes suchas organ formation. Proc. Natl. Acad. Sci. USA 90:7588-7592.

23. Kouskoff, V., R. M. Mantovani, S. M. Candeias, A. Dorn, A. Staub,B. Lisowska-Grospierre, C. Griscelli, C. 0. Benoist, and D. J.Mathis. 1991. NF-X, a transcription factor implicated in MHCclass II gene regulation. J. Immunol. 146:3197-3204.

24. Leiden, J. M. 1992. Transcriptional regulation during T-cell devel-opment: the at TCR gene as a molecular model. Immunol. Today13:22-30.

25. Lim, F., N. Kraut, J. Frampton, and T. Graf. 1992. DNA bindingby c-Ets-1, but not v-Ets, is repressed by an intramolecularmechanism. EMBO J. 11:643-652.

26. Liou, H. C., M. R Boothby, and L. H. Glimcher. 1988. Distinctcloned class II MHC DNA binding proteins recognize the X boxtranscription element. Science 242:69-71.

27. Marais, R., J. Wynne, and R. Treisman. 1993. The SRF accessoryprotein Elk-1 contains a growth factor-regulated transcriptionalactivation domain. Cell 73:381-393.

28. Nelson, B., G. Tian, B. Erman, J. Gregoire, R Maki, B. Graves,and R. Sen. 1993. Regulation of lymphoid-specific immunoglobu-lin p. heavy chain gene enhancer by ETS-domain proteins. Science261:82-86.

29. Nye, J. A., J. M. Petersen, C. V. Gunther, M. D. Jonsen, and B. J.Graves. 1992. Interaction of murine Ets-1 with GGA-binding sitesestablishes the ETS domain as a new DNA-binding motif. GenesDev. 6:975-990.

30. Ohlsson, H., 0. Karlsson, and T. Edlund. 1988. A beta-cell-specific protein binds to the two major regulatory sequences of theinsulin gene enhancer. Proc. Natl. Acad. Sci. USA 85:4228-4231.

31. Ono, S. J., H. C. Liou, R. Davidon, J. L. Strominger, and L. H.Glimcher. 1991. Human X-box-binding protein 1 is required forthe transcription of a subset of human class II major histocompat-ibility genes and forms a heterodimer with c-Fos. Proc. Natl. Acad.Sci. USA 88:4309-4312.

32. Peterlin, B. M., G. Andersson, E. Lotscher, and S. Y. Tsang. 1990.Transcriptional regulation of HLA class-II genes. Immunol. Res.9:164-177.

33. Reith, W., C. Herrero-Sanchez, M. Kobr, P. Silacci, C. Berte, E.Barras, S. Fey, and B. Mach. 1990. MHC class II regulatory factor

MOL. CELL. BIOL.

Ets-1 ACTFIVATES THE DRA PROMOTER IN B CELLS 7321

RF-X has a novel DNA-binding domain and a functionallyindependent dimerization domain. Genes Dev. 4:1528-1540.

34. Reith, W., S. Satola, C. Herrero Sanchez, I. Amaldi, B. Lisowska-Grospierre, C. Griscelli, M. R. Hadam, and B. Mach. 1988.Congenital immunodeficiency with a regulatory defect in MHCclass II gene expression lacks of specific HLA-DRA promoterbinding protein, RF-X. Cell 53:897-906.

35. Rivera, R. R., M. H. Stuiver, R. Steenbergen, and C. Murre. 1993.Ets proteins: new factors that regulate immunoglobulin heavy-chain gene expression. Mol. Cell. Biol. 13:7163-7169.

36. Sodroski, J. G., C. A. Rosen, and W. A. Haseltine. 1984. Trans-acting transcriptional activation of the long terminal repeat ofhuman T lymphotropic viruses in infected cells. Science 225:381-385.

37. Ting, J. P.-Y., and A. S. Baldwin. 1993. Regulation of MHC geneexpression. Curr. Opin. Immunol. 5:8-16.

38. Tsang, S. Y., M. Nakanishi, and B. M. Peterlin. 1988. B cell-specific and interferon--y-inducible regulation of the HLA-DRagene. Proc. Natl. Acad. Sci. USA 85:8598-8602.

39. Tsang, S. Y., M. Nakanishi, and B. M. Peterlin. 1990. Mutationalanalysis of the DRA promoter: cis-acting sequences and trans-acting factors. Mol. Cell. Biol. 10:711-719.

40. Urness, L. D., and C. S. Thummel. 1990. Molecular interactionswith the ecdysone regulatory hierarchy: DNA-binding proprietiesof the Drosophila ecdysone-inducible E74A protein. Cell 63:47-61.

41. Viville, S., V. Jongeneel, W. Koch, R. Mantovani, C. Benoist, andD. Mathis. 1991. The Ea promoter: a linker-scanning analysis. J.Immunol. 146:3211-3217.

42. Voliva, C. F., A. Aronheim, M. D. Walker, and B. M. Peterlin.1992. B-cell factor 1 is required for optimal expression of the DRApromoter in B cells. Mol. Cell. Biol. 12:2383-2390.

43. Wasylyk, B., C. Wasylyk, P. Flores, A. Begue, D. Leprince, and D.Stehelin. 1990. The c-ats proto-oncogenes encode transcriptionfactors that cooperate with c-Fos and c-Jun for transcriptionalactivation. Nature (London) 346:191-193.

44. Woods, D. B., J. Ghysdael, and M. J. Owen. 1992. Identification ofnucleotide preferences in DNA sequences recognized specificallyby c-Ets-1 protein. Nucleic Acids Res. 20:699-704.

45. Xin, J.-H., A. Cowie, P. Lachance, and J. A. Hassell. 1992.Molecular cloning and characterization of PEA3, a new memberof the Ets oncogene family that is differentially expressed in mouseembryonic cells. Genes Dev. 6:481-496.

VOL. 14, 1994

Ets-1 Activates the DRA Promoter in B Cells

Documents

Transcript of Ets-1 Activates the DRA Promoter in B Cells