Ethylene- and shade-induced hypocotyl elongation share transcriptome patterns and functional...

1

Short title: Ethylene- and shade-induced stress escape 1

Corresponding authors: Rashmi Sasidharan, Ronald Pierik 2

Address: Padualaan 8, 3584 CH, Utrecht, The Netherlands 3

Telephone number: +31 30 2536838 4

Email: [email protected], [email protected] 5

6

Ethylene- and shade-induced hypocotyl elongation share transcriptome 7

patterns and functional regulators 8

Das D.1, St. Onge K.R.1,2, Voesenek L.A.C.J.1, Pierik R.1* and Sasidharan R.1* 9

*shared senior and corresponding authors 10 1Plant Ecophysiology, Institute of Environmental Biology, Utrecht University, 3584CH Utrecht, The 11 Netherlands 12 2 Department of Biological Sciences, CW405 BioSci Building, University of Alberta, T6J2E9, Canada 13

14

Summary: Ethylene and shade share a conserved set of molecular regulators to 15

control plasticity of hypocotyl elongation in Arabidopsis. 16

17

AUTHOR CONTRIBUTIONS 18

R.P., R.S and L.A.C.J.V. conceived the original research plans and project. R.S., 19

R.P, L.A.C.J.V., K.R.S. supervised the experiments. D.D. performed most of the 20

experiments. D.D., K.R.S., R.P. and R.S. designed the experiments. D.D. and 21

K.R.S. analyzed the data. D.D. wrote the article with contributions of all the authors. 22

FUNDING INFORMATION 23

This research was supported by the Netherlands Organisation for Scientific 24

Research (grant nos. ALW Ecogenomics 84410004 to L.A.C.J.V., ALW VENI 25

86312013 and ALW 82201007 to R.S., ALW VIDI 86412003 to R.P.) and a Utrecht 26

University Scholarship to D.D. 27

28

CORRESPONDING AUTHOR EMAIL: [email protected], [email protected] 29

30

31

32

Plant Physiology Preview. Published on June 21, 2016, as DOI:10.1104/pp.16.00725

Copyright 2016 by the American Society of Plant Biologists

www.plantphysiol.org on July 4, 2016 - Published by www.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org/

http://www.plantphysiol.org

2

ABSTRACT 33

Plants have evolved shoot elongation mechanisms to escape from diverse 34

environmental stresses such as flooding and vegetative shade. The apparent 35

similarity in growth responses suggests possible convergence of the signalling 36

pathways. Shoot elongation is mediated by passive ethylene accumulating to high 37

concentrations in flooded plant organs and by changes in light quality and quantity 38

under vegetation shade. Here we study hypocotyl elongation as a proxy for shoot 39

elongation and delineated Arabidopsis hypocotyl length kinetics in response to 40

ethylene and shade. Based on these kinetics, we further investigated ethylene and 41

shade-induced genome-wide gene expression changes in hypocotyls and cotyledons 42

separately. Both treatments induced a more extensive transcriptome reconfiguration 43

in the hypocotyls compared to the cotyledons. Bioinformatics analyses suggested 44

contrasting regulation of growth promotion- and photosynthesis-related genes. 45

These analyses also suggested an induction of auxin, brassinosteroid and gibberellin 46

signatures and the involvement of several candidate regulators in the elongating 47

hypocotyls. Pharmacological and mutant analyses confirmed the functional 48

involvement of several of these candidate genes and physiological control points in 49

regulating stress-escape responses to different environmental stimuli. We discuss 50

how these signaling networks might be integrated and conclude that plants, when 51

facing different stresses, utilise a conserved set of transcriptionally regulated genes 52

to modulate and fine tune growth. 53

54

INTRODUCTION 55

All organisms, including plants, assess and respond to both biotic and abiotic factors 56

in their environments (Pierik and De Wit, 2014; Pierik and Testerink, 2014; Franklin 57

et al., 2011; Quint et al., 2016; Osakabe et al., 2014; Voesenek and Bailey-Serres, 58

2015). However, unlike animals, plants, cannot move away from extremes in their 59

surrounding environment but rather rely on various plastic morphological and 60

metabolic responses. Such response traits include changes in plant architecture to 61

escape the stress and optimize resource capture (Pierik and Testerink, 2014; 62

Mickelbart et al., 2015). With energy reserves being invested in escape traits, plants 63

often have lower plant biomass and crop yield (Casal, 2013). Molecular investigation 64




3

of the different signalling pathways controlling these traits along with the 65

characterization of underlying molecular components would not only enhance 66

fundamental knowledge of stress-induced plasticity but also benefit crop 67

improvement. 68

Plants are highly sensitive to changes in their light environment. Young plants 69

growing in a canopy experience changes in light quality and quantity due to 70

neighbouring plants and compete to harvest optimum light (Pierik and De Wit, 2014; 71

Casal et al., 2013). When a plant cannot outgrow its neighbours, it experiences 72

complete vegetation shade (hereafter termed as “shade”) which, in addition to low 73

red: far-red (R:FR), is marked by a significant decline in blue light and overall light 74

quantity. These changes initiate so-called Shade Avoidance Syndrome (SAS) 75

responses consisting of petiole, hypocotyl and stem elongation; reduction of 76

cotyledon and leaf expansion; upward movement of leaves (hyponasty), decreased 77

branching and increased apical dominance (Vandenbussche et al., 2005; Franklin, 78

2008; Casal, 2012; Pierik and De Wit, 2014). Shade-induced elongation comprises a 79

complex network of photoreceptor-regulated transcriptional and protein-level 80

regulation involving BASIC HELIX LOOP HELIX (BHLH) and HOMEODOMAIN-81

LEUCINE ZIPPER, (HD-ZIP) transcription factors and auxin, gibberellin and 82

brassinosteroid hormone genes (Casal, 2012; 2013). Flooding often leads to partial 83

or complete submergence of plants. Water severely restricts gas diffusion and the 84

consequent limited exchange of O2 and CO2 restricts respiration and photosynthesis. 85

Another consequence is the rapid accumulation of the volatile hormone ethylene. 86

Ethylene is considered an important regulator of adaptive responses to flooding, 87

including accelerated shoot elongation responses that bring leaf tips from the water 88

layer into the air (Sasidharan and Voesenek, 2015; Voesenek and Bailey-Serres, 89

2015). In deepwater rice, this flooding-induced elongation response involves 90

ethylene-mediated induction of members of the group VII Ethylene Response 91

Factors (ERF-VII) family, a decline in active abscisic acid (ABA) and consequent 92

increase in gibberellic acid (GA) responsiveness and promotion of GA biosynthesis 93

(Hattori et al., 2009). In submerged Rumex palustris petioles, ethylene also rapidly 94

stimulates cell wall acidification and transcriptional induction of cell wall modification 95

proteins to facilitate rapid elongation (Voesenek and Bailey-Serres, 2015). Shade 96

cues are reported to enhance ethylene production resulting in shade avoidance 97




4

phenotypes (Pierik et al., 2004). However, these responses are mediated by 98

ethylene concentrations of a much lower magnitude than that occuring in flooded 99

plant organs (1µl L-1) (Sasidharan and Voesenek, 2015). 100

So far, it is largely unknown to what extent these growth responses to such highly 101

diverse environmental stimuli, share physiological and molecular components 102

through time. A preliminary study in R. palustris showed that GA is a common 103

regulator of responses to both submergence and shade (Pierik et al. 2005). Although 104

submergence is a compound stress, rapid ethylene accumulation is considered an 105

early and reliable flooding signal triggering plant adaptive responses. High ethylene 106

concentrations as occur within submerged plant organs, promote rapid shoot 107

elongation (Voesenek and Bailey-Serres, 2015). This submergence response, which 108

has been extensively characterised in rice and Rumex (Hattori et al. 2009; van Veen 109

et al., 2013), can be almost completely mimicked by the application of saturating (1µl 110

L-1) ethylene concentrations (Sasidharan and Voesenek, 2015). Saturating ethylene 111

concentrations were therefore used here as a submergence mimic. Shade was given 112

as true shade which combines the three known key signals that trigger elongation 113

(red and blue light depletion with relative far-red enrichment). 114

A hypocotyl elongation assay in Arabidopsis thaliana (Col-0) was used as a proxy for 115

shoot elongation under ethylene and shade in order to study to what extent ethylene 116

and shade responses share molecular signalling components. Although ethylene 117

suppresses Arabidopsis hypocotyl elongation in dark, high ethylene concentrations 118

in light (as occurs during submergence) stimulate hypocotyl elongation in 119

Arabidopsis (Smalle et al., 1997; Zhong et al., 2012). Also upon simulated shade, 120

Arabidopsis demonstrates pronounced hypocotyl elongation (Morelli and Ruberti, 121

2000). To capture early physiological responses and gene expression changes in 122

response to ethylene and shade, Arabidopsis seedling hypocotyl elongation and 123

cotyledon expansion were examined over time. The two treatments elicited 124

characteristic hypocotyl growth kinetics. To uncover the transcriptomic changes 125

regulating the elongation response to these signals, an organ-specific genome-wide 126

investigation was carried out on hypocotyls and cotyledons separately at three time-127

points corresponding to distinct hypocotyl elongation phases. Clustering analyses in 128

combination with biological-enrichment tests allowed identification of gene clusters 129

with expression patterns matching the hypocotyl growth trends across the three time-130




5

points in both the treatments. Correlation of genome-wide hypocotyl and cotyledon-131

specific transcriptomic changes to publicly available microarray data on hormone 132

treatments identified enriched hormonal signatures of auxin, brassinosteroid and 133

gibberellin in hypocotyl tissues and several potential growth regulatory candidate 134

genes. Using hormone mutants and chemical inhibitors, we confirmed the combined 135

involvement of these hormones and candidate regulators in the hypocotyl elongation 136

response to ethylene and shade. We suggest that growth responses to diverse 137

environmental stimuli like ethylene and shade converge on a common regulatory 138

module consisting of both positive and negative regulatory proteins that interact with 139

a hormonal triad to achieve a controlled fine-tuned growth response. 140

141

142

RESULTS 143

Delineation of hypocotyl elongation kinetics under ethylene and shade in 144

Arabidopsis seedlings 145

Exogenous application of ethylene (1 µl L-1) in light-grown seedlings resulted in thick, 146

yet elongated hypocotyls and smaller cotyledons as compared to untreated controls. 147

Shade, achieved by the use of a green filter, stimulated strong hypocotyl elongation 148

in seedlings but resulted in mildly smaller cotyledons compared to controls (Fig. 1A). 149

Hypocotyl length increments in the two treatments relative to control were around 2-150

fold under ethylene and greater than 3-fold under shade (Figs. 1, A and B). For both 151

treatments growth stimulation was strongest in the first two days of treatment (Fig. 152

1C) and faded out in the subsequent days. When combined, shade and ethylene 153

exposure resulted in hypocotyl lengths that were intermediate to the individual 154

treatments (Supplemental Fig. S1). 155

To get a more detailed time-line of the early elongation kinetics, we performed a 156

follow-up experiment with 3 h measurement intervals for the first 33 h (Fig. 1D). 157

Ethylene-mediated stimulation of hypocotyl elongation started only in the middle of 158

the dark period after 15 h. However, under shade, longer hypocotyls were recorded 159

already after 3 h and this rapid stimulation continued until the start of the dark period. 160

Interestingly, accelerated elongation was again observed at around 24 h after the 161

start of the treatments (when the lights were switched on). Based on this time-line, 162

we determined epidermal cell lengths at time-points 0, 3, 7.5, 15 and 27 h (Gendreau 163




6

et al., 1997; Fig. 1E), the latter four of which are either prior to start of accelerated 164

growth or during it in response to ethylene and shade. The rapid stimulation of 165

elongation under shade starts at the base of the hypocotyl (3 h) and then progresses 166

all along the hypocotyl with maximum elongation occurring in the middle segment 167

while under ethylene accelerated elongation is observed at the middle-bottom of 168

hypocotyl (27 h). 169

170 Organ-specific transcriptomics in hypocotyl and cotyledon under ethylene and 171

shade 172

The transcriptome response to ethylene and shade in hypocotyl and cotyledon 173

tissues was characterised using Affymetrix Arabidopsis Gene 1.1 ST arrays at three 174

time points of hypocotyl length kinetics (1.5 h, 13.5 h and 25.5 h) (Fig. 1D). Principal 175

component analysis (PCA) (Abdi and Williams, 2010) of all replicate samples for 176

hypocotyl and cotyledon exposed to control, ethylene or shade conditions showed 177

that replicate samples generally clustered together (Fig. 2A). The first principal 178

component (34.2%) separates tissue-specific samples, whereas the second principal 179

component (13.0%) showed separate clustering of the 13.5h samples which falls 180

during the dark period. 181

Hierarchical clustering (HC) (Eisen et al., 1998) of mean absolute expression 182

intensities for the different main samples (combination of 3 replicates) revealed 183

similar trends (Fig. 2B). Fig. 2C shows the distribution of up- and down-regulated 184

differentially expressed genes (DEGs) (genes with adjusted p-value ≤ 0.01) in 185

hypocotyl and cotyledon for ethylene and shade at the three harvest time points 1.5 186

h, 13.5 h, 25.5 h respectively. In both the conditions and tissues, the number of both 187

up- and down-regulated DEGs increased with time. Ethylene regulated substantially 188

more DEGs in the hypocotyl as compared to shade at all harvest time points (Fig. 189

2C). Data analysis identified 6668 and 4741 genes (hereafter termed as “total 190

DEGs”) that were differentially expressed in hypocotyl at one or more of the three 191

tissue harvest time points by ethylene and shade respectively. Interestingly, in the 192

cotyledon, at 1.5 h, the number of significant DEGs under ethylene was higher than 193

under shade but at the subsequent two time points, shade regulated more genes. In 194

the cotyledon, 1197 and 2173 DEGs were identified that were differentially 195

expressed at one or more of the three tissue harvest time points by ethylene and 196

shade respectively. 197




7

Interestingly, at 1.5 h, there was more transcriptional regulation in ethylene- than 198

shade-exposed hypocotyls even though subsequent hypocotyl elongation was much 199

more rapid in shade (Figs. 2C and 1D). For ethylene-specific downregulated DEGs 200

at 1.5 h, the topmost enriched GO term was cell wall organization (containing 30 201

genes), which suggested a repression of growth-promoting genes and possible lack 202

of ethylene-mediated elongation at 1.5 h (Supplemental Fig. S2). We also found 6 203

genes (AT1G65310, XYLOGLUCAN ENDOTRANSGLUCOSYLASE / HYDROLASE 204

17 (XTH17); AT5G23870, pectin acetyl esterase; AT3G06770, glycoside hydrolase; 205

AT5G46240, POTASSIUM CHANNEL IN ARABIDOPSIS THALIANA 1 (KAT1); 206

AT1G29460, SMALL AUXIN UPREGULATED RNA 65 (SAUR65) and AT3G02170, 207

LONGIFOLIA 2 (LNG2)) in the shade-specific upregulated 32 genes at 1.5 h, with 208

implied cell expansion roles and could possibly be associated with the rapid 209

elongation response (Sasidharan et al., 2010; Philippar et al., 2004; Nozue et al., 210

2015; Chae et al., 2012; Lee et al., 2006). 211

212

Different gene expression clusters contributing to hypocotyl growth in 213

ethylene and shade 214

In order to find specific genes regulating the elongation phenotype under both 215

treatments, we used temporal clustering of DEGs based on expression values. Due 216

to distinct hypocotyl length kinetics in response to ethylene and shade (Fig. 1D), we 217

searched for a set of temporally co-expressed genes that could potentially contribute 218

to this treatment-specific kinetics. Time-point based clustering was performed for the 219

6668 ethylene and 4741 shade total DEGs based on the positive or negative 220

magnitude of log2FC for DEGs at the three time points (Fig. 3, A and D). The gene 221

expression patterns in clusters-1 and 5 across the three time points matched the 222

ethylene hypocotyl growth kinetics closely (Fig. 3, B and C). Similarly, gene 223

expression kinetics in clusters-1 and 3 matched the hypocotyl length kinetics in 224

shade (Fig. 3, E and F). These growth pattern matching clusters were termed 225

“positive”. All the clusters with mirror image of gene expression profiles to that of the 226

positive clusters (clusters-8 and 4 in ethylene and clusters-8 and 6 in shade) were 227

termed as “negative” clusters. 228




8

Next, a hypergeometric over-representation test for selected MapMan bins (“stress”, 229

“hormone”, “signalling”, “RNA.Regulation of transcription” and “cell wall”) was carried 230

out for the temporal gene clusters (Fig. 3G). Interestingly, “cell wall”, “hormone” and 231

“signalling” were highly co-enriched in positive clusters (cluster-1 and 5 for ethylene 232

and cluster-1 for shade) which hints at co-regulation of genes mapped to these terms 233

during transcriptomic response to ethylene and shade in the hypocotyl. 234

To identify growth promotion related DEGs, we identified DEGs common to both the 235

treatments in the clusters previously designated as ‘positive’ and ‘negative’ clusters 236

(Fig. 3, H and I). 997 DEGs were obtained from a venn diagram between the 237

treatment-specific positive clusters, upregulated at atleast two time-points, and 238

hereafter called “Common Up”. Similarly, 824 DEGs were shared between ethylene 239

and shade negative clusters, were downregulated at atleast two time points and 240

hereafter called “Common Down”. 241

Enriched functional categories in the different gene sets from Venn diagrams of 242

positive and negative clusters, were identified using the GeneCodis tool (Tabas-243

Madrid et al., 2012) (Fig. 4). In the Common Up set, we found a variety of growth 244

associated GO categories including cell wall modification, hormone (auxin and 245

brassinosteroid) signaling and metabolism, transport processes, tropisms, response 246

to abiotic stimuli and signal transduction. The ethylene-specific set for positive 247

clusters was enriched for ethylene-associated terms as expected, but also for 248

various sugar metabolic, endoplasmic reticulum (ER)-related and protein post-249

translational modification-related processes. Some of the enriched GO terms in the 250

ethylene-specific set for positive clusters were also found in the Common Up set, but 251

caused by different genes in the same GO category, including those associated with 252

growth, hormones and transport processes. The shade-specific set for positive 253

clusters showed only few clear GO enrichments such as trehalose metabolism, 254

secondary cell wall biogenesis and amino acid metabolism, but also shared some 255

with the Common Up set like shade avoidance and protein phosphorylation and with 256

both Common Up and ethylene-specific set for positive clusters, such as response to 257

auxin and unidimensional growth. 258

In the Common Down set, GO terms associated with photosynthesis, primary and 259

secondary metabolism, response to biotic and abiotic stress, as well as 260




9

photomorphogenesis were enriched. The latter is striking given that ethylene does 261

not alter the light environment. The ethylene-specific set for negative clusters 262

included strong enrichment of circadian rhythm and a variety of photosynthesis-and 263

chloroplast-associated GO terms, partially shared with the Common Down set. In the 264

shade-specific set for negative clusters, flavonoid/anthocyanin biosynthesis and 265

response to UV-B and heat were enriched. The shade-specific set for negative 266

clusters shared terms from defence-associated GO categories and cadmium, karrikin 267

response with Common Down set. Terms common to all three sets of negative 268

clusters were related to photomorphogenesis and metabolic process. 269

270

Functional characterization: shared components in ethylene -and shade-271

mediated regulation of hypocotyl length 272

We classified Common Up and Down set genes into transcriptional regulators, 273

hormone metabolism genes, signalling genes and cell wall genes and also applied a 274

logFC filter (see “Materials and Methods” sub-section “LogFC Filter and Gene 275

Classification”) to obtain a final list of 53 and 8 genes in the two sets respectively 276

(Fig. 5, A and B). We selected a subset of candidate regulators for functional testing 277

and made sure to include two transcription factors since these may be relatively 278

upstream in the convergence of signaling pathways. Obvious targets for these 279

regulators would be different plant hormones, and before zooming in on these, we 280

ran a hormonometer analysis with our transcriptome data to further subset our 281

candidate regulators. 282

283

Transcription factor candidates: 284

ARABIDOPSIS THALIANA HOMEOBOX PROTEIN 28 (ATHB28) is a zinc-finger 285

homeodomain (ZF-HD) transcription factor that showed upto 2-fold induction in the 286

hypocotyls in ethylene and shade respectively. A homozygous null mutant 287

(Supplemental Fig. S3, A-D), “athb28”, showed a significant reduction in hypocotyl 288

lengths under both ethylene and shade (Fig. 6A), consistent with its induction upon 289

both the treatments. 290




10

Both shade and ethylene also significantly induced transcript levels of the bHLH 291

transcription factor INCREASED LEAF INCLINATION1 BINDING bHLH1 like-1 292

(IBL1) Arabidopsis hypocotyls. However, the ibl1 (SALK T-DNA insertion line) 293

showed wild-type responses to the treatments (Fig. 6B). The bHLH transcription 294

factors IBL1 and its homolog IBH1 have been implicated in repressing BR-mediated 295

cellular elongation. In an ibl1 mutant, IBH1 is still present and may negatively 296

regulate cell elongation independently of IBL1. The 35S overexpression line, IBL1OE 297

(Zhiponova et al., 2014), had shorter hypocotyls than the wild-type under control 298

conditions. IBL1OE also lacked ethylene and shade-induced hypocotyl elongation 299

implying an inhibitory role for IBL1 (Fig. 6C). 300

301

Hormone candidates: auxin, brassinosteroid and gibberellin 302

To further investigate the significant hormone related changes amongst the growth 303

related DEGs we analysed our data using Hormonometer (Volodarsky et al., 2009). 304

For both treatments, the hormonal signatures across the three time-points for BR 305

and GA most closely matched the hypocotyl elongation kinetics (Figs. 1D and 7A). 306

The analysis also showed significant correlations with auxin responses for all data 307

sets. 308

In the Common Up set 49 genes were present that were all also auxin-regulated, 309

whereas there were 14 that were also BR-regulated. In the Common Down set 16 310

genes were present that can be regulated by auxin, 16 that can also be ABA-311

regulated and 13 genes that are also JA-regulated. Interestingly, there were no 312

genes for BR in the Common Down set. In addition, genes involved in auxin-313

conjugation genes (GRETCHEN HAGEN 3 FAMILY PROTEIN 3.17 (GH3.17) and 314

AT5G13370), GA catabolising genes (GIBBERELLIN 2 OXIDASE (GA2OX) 2, 315

GA2OX4 and GA2OX7) and JA augmenting genes (LIPOXYGENASE (LOX) 1, 316

LOX2 and LOX3) were down-regulated. 317

In order to test the possible role of auxin, GA and BR, in mediating shade and 318

ethylene-induced hypocotyl elongation, we first tested the effects of pharmacological 319

inhibitors of these hormones on shade and ethylene-induced hypocotyl elongation. 320

To visualize the auxin effect we treated the pIAA19:GUS auxin response marker line 321

with the auxin transport inhibitor, 1-N-Naphthylphthalamic acid (NPA). As shown in 322




11

Fig. 7B, application of NPA (25 µM) inhibited hypocotyl elongation and also strongly 323

reduced staining in the hypocotyl region. This inhibition was rescued by IAA (10 µM). 324

The auxin perception inhibitor, α-(phenylethyl-2-one)-indole-3-acetic acid, PEO-IAA 325

(100 µM), strongly reduced staining in the whole pIAA19:GUS seedling and inhibited 326

elongation in response to both treatments. The significant inhibition of ethylene and 327

shade-induced hypocotyl elongation by the different auxin inhibitors is quantitated in 328

Fig. 7,C-E. The addition of NPA, yucasin (auxin biosynthesis inhibitor) and α-329

(phenylethyl-2-one)-indole-3-acetic acid (PEO-IAA; auxin antagonist) inhibited 330

hypocotyl elongation under both the treatments confirming that all three aspects of 331

auxin are required for ethylene- and shade-induced hypocotyl elongation. BR 332

biosynthesis inhibitor brassinazole (BRZ) and GA biosynthesis inhibitor paclobutrazol 333

(PBZ) fully inhibited these elongation responses as well (Fig. 7, F and G). 334

To further validate the involvement of auxin, BR and GA in ethylene and shade-335

induced hypocotyl elongation we tested hypocotyl elongation responses in a variety 336

of hormone mutants, including mutants for candidate genes from Figure 5. 337

Both the auxin receptor (tir1-1) and biosynthesis (wei8-1) mutants showed 338

significantly impaired hypocotyl elongation responses compared to the wild type 339

ethylene and shade response (Fig. 8, A and B). A similar effect was seen in the 340

auxin transport mutant pin3pin4pin7 which had severely reduced hypocotyl 341

elongation in both treatments (Fig. 8C). 342

The GA biosynthesis (ga1-3) and insensitive (gai) mutant both showed a complete 343

lack of hypocotyl elongation in both treatments (Fig. 8, D and E). We also tested the 344

GA biosynthesis mutant ga20ox1-3, since it was identified as a ‘common Up’ gene, 345

induced in response to both treatments (Fig. 5A). The ga20ox1-3 mutant showed a 346

significantly reduced elongation phenotype in both treatments compared to the wild 347

type response (Fig. 8F). 348

The BR receptor (bri1-116) and biosynthesis (dwf4-1) mutants both showed severe 349

hypocotyl elongation phenotypes, and did not respond to either treatment (Fig. 8, G 350

and I). In another biosynthesis mutant, rot3-1, while the ethylene elongation 351

response was absent there was a severely reduced shade response (Fig. 8H). Two 352

BR-metabolism related genes were identified in the common Up set (Fig. 5A): 353

BR6OX1 and BAS1. The bas1-2 mutant showed constitutive elongation in all 354

treatments ((Fig. 8J) confirming a negative role of BR catabolism through BAS1 in 355




12

hypocotyl elongation control. Although the BR biosynthetic mutant br6ox1 (cyp85a1-356

2) mutant did not show any phenotypic alteration (Fig. 8K), a double mutant of 357

BR6OX1 and BR6OX2 (cyp85a1cyp85a2) showed a complete lack of elongation in 358

response to both ethylene and shade (Fig. 8L). 359

360 361

Discussion 362

Accelerated shoot elongation is a common mode of stress escape that allows plants 363

to grow away from stressful conditions (Pierik and Testerink, 2014). Stress escape 364

does, however, come at an energetic cost and is only beneficial if improved 365

conditions are achieved. Here our goal was to establish to what extent shade and 366

ethylene elicit similar responses through shared or distinct molecular pathways. In 367

our study we found distinct elongation kinetics in ethylene and shade for Arabidopsis 368

hypocotyls, differing in both temporal regulation and the degree of response. Shade 369

treatment evoked a rapid, strong and persisting hypocotyl elongation, whereas 370

ethylene initially inhibited elongation and only in the first night period started to 371

promote hypocotyl length (Fig. 1). In both treatments, hypocotyl growth involved 372

enhanced epidermal cell elongation. Previous studies have shown that low R:FR 373

induces ethylene biosynthesis in Arabidopsis (Pierik et al., 2009) and it could be 374

argued that the shade response might act through ethylene. However, ethylene 375

marker genes were not induced in shade, and the ethylene-insensitive ein3eil1 376

mutant retained a full response to shade (Supplemental Fig. S4), ruling out a role for 377

ethylene in the shade response. Interestingly, combining shade and ethylene 378

treatments did not lead to an additive response and instead dampened shade-379

induced hypocotyl elongation (Supplemental Fig. S1). The growth inhibitory effect of 380

ethylene under shaded conditions could function similar to its effects in limiting 381

hypocotyl elongation in the dark i.e. via induction of negative growth regulators such 382

as ERF1 (Zhong et al., 2012). Transcriptome characterisation of the elongating 383

hypocotyl upon exposure to single shade and ethylene stresses indicated 384

considerable overlap between the two treatments. Thus, a large portion of DEGs 385

under both treatments may contribute to similar processes implying that they target 386

shared genetic components but have treatment-specific upstream regulatory factors. 387

388




13

Hypocotyl growth promotion and photosynthesis repression occur 389

concurrently under ethylene and shade 390

By identifying gene clusters with expression patterns closely matching the distinct 391

ethylene and shade growth kinetics, we identified positive and negative clusters for 392

the respective treatments. These clusters were also among the bigger clusters that 393

contributed to most of the transcriptomic changes, suggesting that a large part of 394

transcriptomic response are associated with the hypocotyl growth and concurrent 395

biological processes. Functional enrichment analysis for the Common Up set (shared 396

between positive clusters of ethylene and shade) (Fig. 4), suggested an involvement 397

of growth promoting genes. Cell wall genes are all involved in mediating cellular 398

expansion in growing hypocotyls. However, they need to be controlled by either the 399

environmental signal directly or by upstream factors in the signal transduction 400

pathway. The Common Down set (shared between negative clusters of ethylene and 401

shade) (Fig. 4), was highly enriched in photosynthesis-related terms and proteins. 402

The effects of ethylene on photosynthesis can be positive or negative depending on 403

the context (Iqbal et al., 2012; Tholen et al., 2007). Low R:FR treated stems of 404

tomato showed reduced expression of photosynthetic genes (Cagnola et al., 2012). 405

This reduction was mainly due to a decrease in expression of Calvin cycle genes, 406

which we also observed for our Common Down set (Supplemental Table S1). In 407

addition, under ethylene specifically, Photosystem II and I genes were mostly 408

repressed. Thus acceleration of hypocotyl elongation is accompanied by repression 409

of genes associated with non-elongation processes like metabolism and 410

photosynthesis. This was also shown to be true for low R:FR treated elongating 411

stems of tomato (Cagnola et al., 2012). Light capture and carbon fixation are 412

minimized and energy is apparently invested in stimulating growth (Sulpice et al., 413

2014; Henriques et al., 2014; Lilley et al., 2012). It would be interesting to investigate 414

how photomorphogenic responses are associated with and influence photosynthesis 415

and growth promotion. 416

417

Convergence of signaling pathways in response to ethylene and shade in 418

control of hypocotyl elongation 419

In shade avoidance responses, photoreceptors like phyB and cry1/2 would regulate 420

the elongation phenotype via control of Phytochrome Interacting Factor (PIF) levels. 421

However, since these are photoreceptors, it seems unlikely that these proteins 422




14

themselves would integrate information from the ethylene pathway as well (Park et 423

al., 2012; Li et al., 2012). It was shown by van Veen et al. (2013), that in the 424

submerged petioles of R. palustris (which displays petiole elongation under complete 425

submergence), early molecular components of light signalling (KIDARI, COP1, PIFs, 426

HD-ZIP IIs) are induced by ethylene independently of any change in light quality. 427

Over expression of PIF5 on the other hand leads to increased ethylene production in 428

etiolated Arabidopsis seedlings, causing inhibition of hypocotyl length (Khanna et al., 429

2007). Interestingly, the downstream ethylene signal transduction protein EIN3 was 430

shown to physically interact with PIF3 (Zhong et al., 2012). We, therefore, suggest 431

that ethylene and shade might both induce this shared gene pool by, for example, 432

targeting (different) members of the PIF family of transcription factors. Since different 433

PIFs likely regulate the expression of at least partly shared target genes (Leivar and 434

Monte, 2014), this would explain our observed partial overlap in the transcriptional 435

response to shade and ethylene. PIFs are also known to directly bind and regulate 436

expression of other transcription factors like homeodomain (HD) TFs (Capella et al., 437

2015; Kunihiro et al. 2011) in the control of shade avoidance responses. Indeed, our 438

TAIR motif analysis hinted towards the presence of significantly enriched binding 439

signatures of PIF/MYC proteins (CACATG) as well as HD proteins (TAATTA) in the 440

upstream promoter sequences of the Common Up set genes (Pfeiffer et al., 2014; 441

Kazan and Manners, 2013; Supplemental Fig. S5). 442

Several potential transcriptional regulators were identified in the narrowed down 443

Common Up gene set. A growth-promoting role of KIDARI in regulating elongation in 444

response to shade and ethylene was suggested previously (Hyun and Lee 2006; van 445

Veen et al., 2013). Upregulation of another bHLH encoding gene and a negative 446

regulator of elongation, IBL1 was observed for both treatments (Fig. 6C)). While 447

PIF4 induces IBH1 and IBL1, IBH1 represses PIF4 targets (Zhiponova et al., 2014). 448

IBH1 and its homolog IBL1 collectively regulate expression of a large number of BR-, 449

GA- and PIF4-regulated genes and this might their mode of action in shade- and 450

ethylene-induced hypocotyl elongation. In addition to these bHLH proteins, we show 451

that the ZF-HD transcription factor ATHB28 is also involved in regulating hypocotyl 452

elongation under ethylene and shade (Fig. 6A). Hong et al. (2011) showed that 453

another ZF-HD protein, MIF1 interacts strongly with four other ZF-HD proteins 454

including ATHB33 and ATHB28. This leads to non-functional MIF1-ATHB 455

heterodimers and inhibition of e.g. ATHB33-regulated expression and growth 456




15

promotion. Transcriptomics data for 35S:MIF1 (displaying short hypocotyl 457

phenotype), shows downregulation of auxin, BR and GA responsive genes and 458

upregulation of ABA genes (Hu and Ma, 2006). We can speculate that MIF1 on one 459

hand and ATHB33 and ATHB28 on the other hand, might target the same set of 460

hormone genes, but in an opposite manner, to control growth. What remains to be 461

studied is how ethylene and shade regulate ZF-HD transcription factors and this will 462

be an important topic for future studies. 463

Well-established targets for above-mentioned PIFs and HD TFs are various aspects 464

of auxin signalling and homeostasis, such as YUCCA biosynthetic enzymes and 465

AUX/IAA proteins for signalling (Kunihiro et al. 2011; Li et al., 2012; Sun et al., 2012; 466

De Smet et al., 2013). Our list of candidate genes (Fig. 5) contained auxin-467

responsive transcriptional regulator IAA3 and many of the auxin-responsive SAUR 468

genes which have been shown to positively modulate hypocotyl elongation (Kim et 469

al., 1998; Sun et al., 2012; Chae et al., 2012; Spartz et al., 2012) and may act 470

individually or in concert to regulate the phenotype. With reference to elongation 471

responses under shade in Arabidopsis seedlings, auxin seems to play a major role. 472

An increase in free auxin levels and its transport towards epidermal cells in hypocotyl 473

is necessary for low R:FR-mediated hypocotyl elongation (Tao et al., 2008; 474

Keuskamp et al., 2010; Zheng et al., 2016). The importance of YUCCAs and TAA1 in 475

low R:FR responses has been previously demonstrated (Li et al., 2012). It is 476

generally assumed that auxin synthesized in the cotyledons is required to regulate 477

hypocotyl elongation in response to e.g. low R:FR light conditions (Procko et al. 478

2014). Indeed, cotyledons are key regulators of hypocotyl elongation in a 479

phytochrome-dependent way (Endo et al., 2005; Warnasooriya and Montgomery, 480

2009; Estelle, 1998; Tanaka et al., 2002). In our data, hormonometer analysis 481

identified strong induction of auxin-associated genes in the cotyledons in both 482

treatments (Fig. 7). We speculate that the physiological regulation of hypocotyl 483

elongation in our study depends on cotyledons via auxin dynamics. However, we 484

also show that auxin is certainly not the only shared physiological regulator between 485

the ethylene and shade response. 486

GA20OX1 and BR6OX1 expression were up-regulated in patterns that closely 487

matched the hypocotyl elongation profiles (Fig. 5A), and hormonometer analysis also 488

revealed enrichment of GA and BR hormonal signatures in ethylene and shade 489




16

exposed hypocotyls. (Fig. 7). The positive role of GA in flooding-associated shoot 490

elongation (Voesenek and Bailey-Serres, 2015) and shade avoidance (Djakovic-491

Petrovic et al., 2007) is well established. It is well known that GA20OX1 specifically 492

affects plant height without having any other major phenotypic effects (Barboza et 493

al., 2013; Rieu et al., 2008), and it has been shown to be involved in shade 494

avoidance (Nozue et al. 2015; Hisamatsu et al. 2005). In our data, ga20ox1 knockout 495

showed reduced elongation to shade as well as ethylene, extending its function from 496

controlling shade avoidance to ethylene mediated elongation responses (Fig. 8F). 497

GA biosynthesis via GA20OX1 can be induced by brassinosteroids, suggesting a 498

possible cross-talk between the two growth-promoting hormones (Unterholzner et 499

al., 2015). Although future studies are needed to establish if this crosstalk occurs 500

under the conditions tested here, we do confirm that BR is an important hormone 501

involved in both the responses since several BR mutants showed disturbed 502

elongation responses to ethylene and shade (Fig. 8G-8L). Interestingly, also auxin 503

and brassinosteroids have partially overlapping roles in hypocotyl elongation control 504

(Chapman et al., 2012; Nemhauser et al., 2004), further extending the crosstalk 505

towards a tripartite network. Among the BR mutants tested is the cyp85a1cyp85a2 506

mutant, encoding a double mutant for BR6OX2 and BR6OX1 which showed a 507

complete lack of elongation to both treatments (Fig. 8L) similar to a BRZ treatment 508

(Figs. 7F). BR6OX1 was one of the direct candidate genes identified from the 509

transcriptomics analysis (Figure 5A). A tripartite bHLH transcription factor module 510

consisting of IBH1, PRE and HBI1, has been previously implicated in regulating cell 511

elongation in response to hormonal and environmental signals (Bai et al., 2012). 512

Several BR biosynthesis and signaling genes are direct targets of HBI1, including 513

BR6OX1 (Fan et al. 2014), indicating the possible involvement of this bHLH 514

regulatory module in promoting BR responses during shade and ethylene exposure. 515

Why is there be such an elaborate network of regulators and even hormones 516

involved in controlling unidrectional cell expansion in hypocotyl growth responses? 517

To achieve a controlled growth, feedback loops are likely required, and crosstalk 518

between different routes are probably a necessity to deal with multiple environmental 519

inputs simultaneously. We found BAS1 transcriptional upregulation in hypocotyls in 520

response to ethylene and shade. BAS1 may act to balance the hypocotyl growth 521

promotion mediated by brassinosteroids (castasterone (CS) and brassinolide (BL)) 522




17

as it inactivates both CS and BL (Neff et al., 1999; Turk et al., 2005). In shade 523

avoidance research, likewise, HFR1 is induced by PIFs to suppress the growth 524

promotion induced the same PIF proteins, and putative control of DELLAs would 525

modulate GA responses. 526

Conclusion 527

Hypocotyl elongation in response to ethylene and shade treatments is likely 528

regulated at the upstream level by (a) a bHLH module consisting of positive growth 529

regulators, PIFs (PIF3 in ethylene and PIF4 and PIF5 in shade) and inhibitory factors 530

like IBL1 and (b) a homeodomain module, where ZF-HD TFs like ATHB28 may 531

either act in parallel to the bHLH TFs or are regulated by PIFs (similar to induction of 532

HD-ZIP TFs) to transcriptionally target genes related to the growth promoting 533

hormone module (auxin, BR and GA), as hinted by promoter motif analysis. We 534

hypothesize that in Arabidopsis seedlings, shade and ethylene stimulate auxin 535

synthesis in the cotyledons, which is then transported to the hypocotyl to epidermal 536

cell layers where it interacts with both GA and BR to co-ordinately induce hypocotyl 537

elongation. This increased auxin response, indicated by elevated SAUR levels, and 538

likely increased levels of GA and BR as indicated by increased GA20OX1 and 539

BR6OX expression in the hypocotyl, likely act to induce unidirectional epidermal cell 540

wall elongation via upregulation of genes encoding cell-wall modifying proteins, 541

which promote cellular expansion leading to hypocotyl elongation. 542

543

MATERIALS AND METHODS 544

Plant Material and Growth Conditions 545

Around 30 Arabidopsis thaliana (Col-0) and mutant seeds were sown per agar plate 546

containing 1.1 g L-1 Murashige-Skoog (1/4 MS) and 8 g L-1 Plant-agar (0.8%w/v) 547

(both Duchefa Biochemie, The Netherlands). Mutants or overexpression lines used 548

in this work were: pin3pin4pin7 (Blilou et al., 2005); wei8-1 (Stepanova et al., 2008), 549

tir1-1 (Ruegger et al., 1998), dwf4-1 (Azpiroz et al., 1998), rot3-1 (Kim et al., 1998), 550

ga1-3 (Wilson et al., 1992), gai (Talon et al., 1990), ein3eil1 (Binder et al., 2004); 551

bri1-116 (van Esse et al., 2012); ibl1 and IBL1OE (Zhiponova et al., 2014); 552

cyp85a1/cyp85a2 and cyp85a1-2 (Nomura et al., 2005); bas1-2 (Turk et al., 2005); 553

ga20ox1-3 (Hisamatsu et al., 2005). 554




18

ibl1 (N657437), cyp85a1 (N681535), wei8-1 (N16407) and ga20ox1-3 (N669422) 555

were obtained from NASC seed-stock centre; bri1-116 was kindly provided by Sacco 556

de Vries Lab, Wageningen University while cyp85a1/cyp85a2 and dwf4-1 were 557

kindly provided by Sunghwa Choe Lab, Seoul National University. IBL1OE 558

overexpression lines were kindly provided by the Jenny Russinova lab (VIB Ghent, 559

Belgium). bas1-2 mutant was kindly provided by Michael Neff lab (Washington State 560

University, USA). Some GA mutants used were in the Ler background. All other 561

mutants were in the Col-0 background. After stratification at 4°C for 3 d in the dark, 562

seeds were transferred for 2 h to control light conditions (see below) and then kept in 563

dark (at 20°C) again for another 15 h. Subsequently seedlings were allowed a period 564

of 24 h growth under control light conditions in Short-Day photoperiod conditions (15 565

h dark/9h light) before being transferred to 22.4 L glass desiccators with air-tight lids 566

for specific treatments. Col-0 genotypes were grown at 21 ± 1 °C. Ler genotypes 567

were grown at 19 ± 1 °C (Supplemental Figure S6). 568

For athb28 (GK-326G12), lines were obtained from NASC (UK). Genotyping was 569

performed using the following primers: for athb28, athb28_fwd 570

(CTAAGTACCGGGAATGTCAGAAG); athb28_rev (TAACCAACTGAGCTATTCC 571

AGCTA) and LB primer o8474: (ATAATAACGCTG CGGA CATCTACATTTT). For 572

verifying transcript levels, ATHB28_fwd (GGAGAAGATGAAGGAATTTGCA) and 573

ATHB28_rev (TGTTTCTCTTCA TTGCTTGCT) were used. 574

575

Treatments 576

Control and ethylene desiccators were kept in control light conditions 577

(Photosynthetically Active Radiation, PAR = 140 μmol m-2 s-1, blue light (400 nm-500 578

nm) = 29 μmol m-2 s-1 and R:FR = 2.1). Ethylene treatments were started by injecting 579

ethylene into the desiccators (with 1 µl L-1 final concentration in the dessicator) and 580

levels were verified with a Gas Chromatograph (GC955; Synspec, The Netherlands). 581

Shade treatment was started by putting desiccators under a single layer of Lee Fern 582

Green Filter (Lee Hampshire, UK) (PAR = 40 μmol m-2s-1, blue light (400 nm-500 583

nm) = 3 μmol m-2 s-1 and R:FR = 0.45). For growth curve experiments, two plates 584

with 15 seedlings per treatment per genotype distributed over two desiccators were 585

used. For mutant analyses, one plate with 15 seedlings per treatment per genotype 586

was used. 587

588




19

Imaging and Hypocotyl Length Measurements 589

For hypocotyl elongation assays, experiments were replicated twice. Seedling plates 590

were collected from the dessicators. Seedlings were flattened on the agar plates to 591

reveal the full extent of their hypocotyl, and images of the seedlings were obtained 592

by scanning the plates using EPSON Perfection v370 Photo scanner (Epson Europe 593

BV, The Netherlands). Hypocotyl lengths were measured from these images using 594

ImageJ (http://rsbweb.nih.gov/ij/) and values (per data point) were obtained for n ≥ 595

30-60 seedlings. Final values for the data was obtained by taking mean ± S.E. for 596

values from the two independent experiments. 597

598

Epidermal Cell Length Measurements 599

Seedlings were mounted on microscopic slides and covered with a cover slip. 600

Hypocotyl epidermal cells were imaged using Olympus AX70 (20x objective, Nikon 601

DXM1200 camera), after which cell lengths were measured using ImageJ software 602

tool (http://rsbweb.nih.gov/ij/). 603

604

Microarray Tissue Harvest, RNA Isolation and Array Hybridization 605

Seedlings were dissected using BD PrecisionGlide Hypodermic 27 Gauge 1 1/4" 606

Grey Needle with outer diameter = 0.41 mm (Becton Dickinson B.V., The 607

Netherlands) to separately harvest the hypocotyl and cotyledon + shoot apical 608

meristem (hereafter termed “cotyledon”). The roots were discarded. Samples were 609

harvested at 1.5 h, 13.5 h and 25.5 h after the start of the treatments. For 13.5 h time 610

point, which occurs during the dark period, dissection was carried out under low 611

intensity green safelight (≈ 5 μmol m-2 s-1). For minimizing the effects of green light 612

on gene expression, seedlings were kept in the dark until dissected and dissection 613

was carried out in several rounds with each round involving maximum 2-3 seedlings. 614

In total, 3 replicate experiments were carried out. In each replicate experiment, 615

tissues were harvested from two independent technical replicates (each with 25 616

seedlings from the two technical replicate plates as mentioned in “Treatments” 617

section above). Harvested material was immediately frozen in liquid nitrogen and 618

stored at -80°C until further use. 619

Frozen tissue was ground using tissue lyser and total RNA was isolated using 620

RNeasy Mini Kit (QIAGEN, Germany). QIAGEN RNase-Free DNase set was used to 621

eliminate Genomic DNA contamination by performing on-column DNase digestion. 622




20

Extracted RNA was verified (for quality check) and quantified using NanoDropTM ND-623

1000 Spectrophotometer (Isogen Life Science, De Meern, The Netherlands). 624

RNA samples were sent to AROS (AROS Applied Biotechnology A/S, Aarhus, 625

Denmark). RNA was repurified on low-elution QIAGEN RNeasy columns, re-626

quantified with NanoDropTM 8000 UV-Vis Spectrophotometer and checked for quality 627

with Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). RNA samples 628

with RNA Integrity Number (RIN) value of > 7.5 were considered for further use. 50 629

ng RNA from each of the two independent technical replicates was mixed in the ratio 630

1:1 and the pooled sample was considered as one biological replicate for 631

hybridization experiments. Thus, 3 biological replicates were obtained for the 3 632

replicate experiments. 100 ng of RNA sample was processed for cDNA synthesis, 633

fragmentation and labelling was carried out for the RNA samples. The samples were 634

hybridized to the Affymetrix Gene 1.1 ST Arabidopsis Array Plate and washed on an 635

Affymetrix GeneAtlas system followed by scanning of arrays at AROS Applied 636

Biotechnology (http://arosab.com/services/microarrays/gene-expression/). 637

638

Microarray Data Analysis 639

Scanned arrays in the form of .cel files (provided by AROS) were checked for quality 640

control using Affymetrix Expression Console Software and an in-house script in R 641

and Bioconductor (http://www.r-project.org./; http://www.bioconductor.org/) 642

(Bioconductor “oligo” and “pd.aragene.1.1.st” ). Bioconductor was used for Robust 643

Multi-array Average (RMA) normalization of raw data at Gene level to obtain 644

summarized signal intensity values for all genes present on the array (log2 format). 645

Principal component analysis was carried out using Affymetrix Expression Console 646

Software (http://www.affymetrix.com/) and dendrogram of all microarray samples 647

according to the mean signal intensity values was generated using R (“plot” 648

package). Bioconductor (“Limma” package) was used for carrying out differential 649

expression analysis. 650

651

Temporal Clustering And Bioinformatics Analysis 652

We clustered the list of total DEGs (defined as number of DEGs that were regulated 653

at atleast one of the three time points) under ethylene and shade based on positive 654

or negative regulation at each of the three time-points. With three time-points and 655

two directions of expression (positive or negative), 23 = 8 possible trends can occur 656




21

and accordingly as many clusters were obtained. DEGs were clustered temporally 657

based on log2FC. 658

659

MapMan bin overrepresentation using hypergeometric test was done using R (“stats” 660

package) and adjusted p-values for the statistical significance of enrichment were 661

converted into negative logarithm score and plotted as a heatmap. A score above 662

1.3 for this score was considered significant. 663

GeneCodis (http://genecodis.cnb.csic.es/compareanalysis) webtool was used for GO 664

analysis of different sets obtained from venn of Positive clusters and of Negative 665

Clusters. A score above 1.3 for negative log of adjusted p-values was considered 666

significant. 667

668

LogFC Filter and Gene Classification 669

In order to narrow down the genes for functional characterization (from the list of 670

classified genes), we utilised a logFC filter. To narrow down the Common Up set, a 671

filter of log2FC < 0.5 at 1.5 h and log2FC ≥ 0.5 at both 13.5 h and 25.5 h for ethylene 672

and log2FC ≥ 0.5 at both 1.5 h and 25.5 h for shade was applied. To narrow down 673

the Common Down set, we applied a filter of log2FC > - 0.5 at 1.5 h and log2FC ≤ - 674

0.5 at both 13.5 h and 25.5 h under ethylene and of log2FC ≤ - 0.5 at both 1.5 h and 675

25.5 h under shade. These resulting group of genes were then classified based on 676

MapMan based classification for the terms: “RNA.regulation of transcription”, “Cell 677

wall”, “Signalling” and “Hormone metabolism”. Genes from Plant TFDB 678

(http://planttfdb.cbi.pku.edu.cn/index.php?sp=Ath) and Potsdam TFDB 679

(http://plntfdb.bio.uni-potsdam.de/v3.0/index.php?sp_id=ATH) were also included as 680

a source for gene-classification to select for additional transcriptional regulators. 681

682

Hormone Correlational Analysis 683

Hormonometer software (http://genome.weizmann.ac.il/hormonometer/) was used to 684

evaluate transcriptional similarities between the transcriptome data obtained here 685

and the published, indexed list of those elicited by exogenous application of plant 686

hormones. Arabidopsis gene locus IDs were converted to Affymetrix GeneChip 687

identifiers using the “at to AGI converter” tool (The Bio-Analytic Resource for Plant 688

Biology, http://bar.utoronto.ca/). We used the new Affymetrix aragen1.1st arrays (28k 689

genes) for transcriptomics but the hormonometer data is based on 3’ ATH1 arrays 690




22

(22k genes). Accordingly, many locus IDs could not be included (those which were 691

newly incorporated in the aragene1.1st arrays) in this analysis. In few other cases 692

where multiple ATH1 GeneChip IDs for one locus ID was obtained, all IDs were 693

retained. 694

695

Pharmacological Treatments 696

Auxin transport was inhibited by use of 25 µM NPA (Duchefa Biochemie, The 697

Netherlands) (Petrásek et al., 2003). Auxin perception was blocked by use of 100 µM 698

PEO-IAA (Hayashi et al., 2008). Auxin biosynthesis was blocked by use of 50 µM 699

yucasin (Nishimura et al., 2014). 2 µM brassinazole (TCI Europe, Japan) was used 700

to inhibit BR biosynthesis (Asami et al., 2000). 2 µM paclobutrazol (Duchefa 701

Biochemie, The Netherlands) was used to inhibit GA biosynthesis (Rademacher, 702

2000). All chemicals were dissolved in respective solvents (DMSO or ETOH) with 703

final solvent concentration in media < 0.1% to prevent toxicity due to solvents. All 704

chemicals were applied by pipetting 150 µl of chemical solutions or mock solvents as 705

a thin film over the MS-agar media in the petri plates and then allowing the solution 706

to diffuse through the medium before starting the treatments. 707

708

GUS Staining and Imaging 709

For GUS assays, seedlings were transferred immediately from treatments to a GUS 710

staining solution (1 mM X-Gluc (5-bromo-4-chloro-3-indolyl-D-glucoronide) (Duchefa 711

Biochem, The Netherlands) in 100 mM Sodium phosphate buffer (pH=7.0) along with 712

0.1 % Triton X-100, 0.5 mM each of Potassium ferrocyanide (K4Fe(CN)6 and 713

Potassium ferricyanide (K3Fe(CN)6 and 10 mM of EDTA (Merck Darmstadt, 714

Germany)) and kept at 37°C overnight. Seedlings were bleached in 70% ethanol for 715

1 day before capturing images. 716

717

Statistical Analysis and Graphing 718

1-way ANOVAs followed by Tukey's HSD Post-Hoc tests were performed on the 719

measurements obtained in hypocotyl length/cotyledon area kinetics to assess 720

statistically significant differences between mean hypocotyl length/cotyledon area 721

under ethylene or shade relative to control at the same time point. 722

A two-way ANOVA followed by a Tukey's HSD Post-Hoc test was used for pairwise 723

multiple comparison. For hypocotyl elongation assays, statistical significance was 724




23

indicated by the use of different letters. All statistical analyses were done in the R 725

software environment. Graphs were plotted using Prism 6 software (GraphPad 726

Software, USA). 727

728

Accession numbers 729

.CEL files utilised in the organ-specific transcriptomics for hypocotyl and cotyledon 730

tissues are posted with the GEO accession series GSE83212. 731

732

Supplemental data 733

The following materials are available in the online version of this article. 734

Supplemental Figure S1. Hypocotyl elongation response in wild-type Col-0 under 735

control, ethylene, shade and combination (ethylene + shade) treatments. 736

Supplemental Figure S2. Venn diagram of gene intersection between up- and 737

down- regulated DEGs of ethylene and shade separately at 1.5 h. 738

Supplemental Figure S3. Genotyping and transcript level verification for (A)-(D) 739

athb28. 740

Supplemental Figure S4. Hypocotyl elongation response in ethylene signalling 741

mutant, ein3eil1 under ethylene and shade. 742

Supplemental Figure S5. TAIR motif analysis for Common Up and Down genesets. 743

Supplemental Figure S6. Hypocotyl length of Ler under control and ethylene 744

conditions when grown at 220 C day / 200 C night and 200 C day / 180 C night 745

temperature regime. 746

Supplemental Table S1. Photosynthesis gene proportion in genesets from Venn of 747

negative clusters. 748

ACKNOWLEDGMENTS 749

We would like to thank all the group members of Plant Ecophysiology, Utrecht 750

University, The Netherlands for their help in the harvest for the transcriptomics 751

experiment. 752




24

753

FIGURE LEGENDS 754

Figure 1. Physiological responses, hypocotyl length and epidermal cell length 755

kinetics under ethylene and shade in Arabidopsis (Col-0) seedlings. 1-day old 756

seedlings were exposed to control conditions (PAR = 140 μmol m-2 s-1, blue light = 757

29 μmol m-2 s-1and R:FR = 2.1), elevated ethylene (1 µl L-1, PAR = 140 μmol m-2 s-1, 758

blue light = 29 μmol m-2 s-1 and R:FR = 2.1) or shade (PAR = 40 μmol m-2 s-1, blue 759

light = 3 μmol m-2 s-1 and R:FR = 0.45). A, Figure shows representative seedlings 760

displaying typical phenotypes after 96 h of exposure to control, ethylene or shade 761

conditions. B, Mean hypocotyl lengths at 0 h, 24 h, 48 h, 72 h and 96 h under control 762

(open circle), ethylene (closed circle) and shade (open triangle) are shown. C, Rate 763

of increase in hypocotyl length. Differences between mean hypocotyl lengths of 764

subsequent time points averaged over 1 d time interval for control, ethylene and 765

shade are shown. D, Detailed hypocotyl length kinetics. 1-day old seedlings were 766

exposed to control (open circle), ethylene (closed circle) and shade (open triangle) 767

and measured at 3 h time intervals (s, e: first time point at which shade (s) or 768

ethylene (e) treatment lead to significantly longer hypocotyls). Data are mean ± S.E. 769

(n=60) for (A)-(D). Shaded area denotes the 15 h dark period in the 15 h dark/9 h 770

light photoperiodic growth condition. e and s denote the first point of statistically 771

significant differences in hypocotyl length or cotyledon area relative to control for 772

ethylene and shade respectively. E, Epidermal cell length kinetics. 1-day old 773

seedlings were exposed to control, ethylene or shade. Mean cell length ± S.E. (n ≥ 774

10) for epidermal cells of the Arabidopsis hypocotyl at 0 h control (black line) and at 775

3 h, 7.5 h, 15 h and 27 h control (orange line), ethylene (blue line) and shade (green 776

line) is shown. Apex denotes the hypocotyl-cotyledon junction and base denotes the 777

hypocotyl-root junction. 778

Figure 2. Overall description of microarray data. A, Principal component analysis 779

(PCA) and hierarchical clustering (HC) was used to describe the structure in the 780

microarray data. Expression intensities for all genes on the array for all 54 hypocotyl 781

and cotyledon samples (3 time points, 3 treatments and 3 replicates) were projected 782

onto the first three principal components. B, Hierarchical clustering was used to 783

group 18 main samples (according to mean expression intensity of 3 replicates for 784




25

each main sample) into a dendrogram. C, Distribution of differentially expressed 785

genes (DEGs) in hypocotyl and cotyledon samples at three time-points in response 786

to ethylene and shade. DEGs obtained for each time-point were plotted separately 787

as up-regulated, down-regulated (adjusted p-value ≤ 0.01 and log2FC > or < 0) or 788

non-significant (adjusted p-value > 0.01). Bar length denotes total DEGs obtained 789

after combining DEGs from all 3 time points. 790

Figure 3. Temporal gene expression clusters for ethylene (A) and shade (D); 791

hypocotyl growth curve for ethylene (B) and shade (E); clusters with gene expression 792

matching hypocotyl growth kinetics in ethylene (C) and shade (F). Heatmap for 793

temporal clusters (A, D) based on the log2FC at the three microarray time points 794

(grey box represents dark; arrows indicate heatmap time-points and treatments 795

include control (open circle), ethylene (closed circle), shade (open triangle)). Yellow 796

denotes up-regulation and blue denotes down-regulation. Two gene expression 797

clusters (C, F) with mean log2FC temporal pattern resembling the hypocotyl length 798

kinetics (B, E) were named positive clusters. G, Heatmap for hypergeometric 799

enrichment of selected MapMan bins for temporal clusters under ethylene and 800

shade. Horizontal-axis denotes the cluster number. More intense colours indicate 801

higher statistical significance. Grey color indicates non-significant score or absence 802

of genes in the bin. H, Venn intersection for positive clusters (clusters with gene 803

expression pattern matching the hypocotyl length kinetics) from ethylene and shade 804

to obtain “Common Up” genes. I, Venn intersection for negative clusters (mirror 805

image to Positive clusters) from ethylene and shade to obtain “Common Down” 806

genes. 807

Figure 4. Gene Ontology (GO) enrichment analysis using GeneCodis for positive 808

and negative clusters. Adjusted p-values for statistical significance of GO enrichment 809

were converted into negative logarithm score (base10) (> 1.3 are considered 810

significant). Heatmap colours denote this score and more intense colours indicate 811

higher statistical significance. White color indicates non-significant score or absence 812

of genes in the GO terms. 813

814

Figure 5. Heatmap of (A) Common Up and (B) Common Down set of genes 815

classified into the categories: transcriptional regulator, hormone metabolism, 816




26

signalling and cell wall genes after application of a log2fold-change (log2FC) filter. 817

Log2FC at the three time-points 1.5 h, 13.5 h, 25.5 h for ethylene and shade 818

microarray dataset identified in the color scheme of the heatmap. Genes were 819

categorized according to Mapman bin gene classification (shown on left side). 820

821

Figure 6. Hypocotyl length measurements for (A) athb28 (B) ibl1 (C) IBL1-OE 822

following 96 h of control, ethylene and shade treatments. Data represents mean ± 823

S.E. (n=30 seedlings). Different letters above the bars indicate significant differences 824

(2-way ANOVA followed by Tukey’s HSD Post-Hoc pairwise comparison). 825

826

Figure 7. A, Identification of enriched hormonal signatures in the ethylene- and 827

shade-induced Arabidopsis transcriptome. Ethylene and shade-induced hypocotyl 828

and cotyledon transcriptomes were analyzed for hormonal signatures using the tool 829

Hormonometer (Valdorsky et al., 2009) to establish correlations with expression data 830

in an established hormonal transcriptome database. Positive correlations were 831

colored yellow and negative correlations blue. Significant correlations were identified 832

with absolute correlation values of 0.3 and higher. Numbers in the cells represent the 833

exact correlation values. Rows denote hormone treatments that are indicated by the 834

name of the hormone and the duration of hormone treatment. Columns denote 835

ethylene and shade transcriptome in the hypocotyl and cotyledon at the three time-836

points of tissue harvest. The magnitude of correlation in gene expression is indicated 837

by the color scale at top right side. B, Effect of auxin transport inhibitor NPA (25 µM), 838

IAA (10 µM), NPA (25 µM) + IAA (10 µM) and auxin perception inhibitor PEO-IAA 839

(100 µM) on GUS staining of the pIAA19:GUS lines. For NPA and PEO-IAA effect in 840

GUS assay, seedlings were exposed to 2 days of treatment conditions. Arabidopsis 841

(Col-0) seedlings were treated with chemical inhibitors for (C) auxin transport (NPA), 842

(D) auxin biosynthesis (Yucasin), (E) auxin perception (PEO-IAA), (F) 843

brassinosteroid biosynthesis (BRZ) and (G) gibberellin biosynthesis (PBZ) at the 844

indicated concentrations in the legend and length was measured following 96h of 845

ethylene and shade. Hypocotyl length was measured following 96 h of ethylene and 846

shade. Mean ± S.E. was calculated for 30 seedlings. Different letters above the bars 847

indicate significant differences from a 2-way ANOVA followed by Tukey’s HSD Post-848

Hoc pairwise comparison. Abbreviations: PEO-IAA is α-(phenylethyl-2-one)-indole-3-849




27

acetic acid; NPA is 1-N-Naphthylphthalamic acid; BRZ is Brassinazole; PBZ is 850

Paclobutrazol. 851

852

Figure 8. Hypocotyl elongation response in response to ethylene and shade in (B)–853

(D) auxin, (E)–(G) gibberellin (GA) and (H)–(J) brassinosteroid (BR) mutants. Mean 854

± S.E. was calculated for 30 seedlings. Different letters above the bars indicate 855

significant differences from a 2-way ANOVA followed by Tukey’s HSD Post-Hoc 856

pairwise comparison. 857

858

LITERATURE CITED 859 860 Abdi, H., and Williams, L. J. (2010). Principal component analysis. Wiley 861

Interdisciplinary Reviews: Computational Statistics, 2(4), 433-459. 862 Achard, P., Cheng, H., Grauwe, L. De, Decat, J., Schoutteten, H., Moritz, T., 863

Straeten, D. Van Der, Peng, J., and Harberd, N.P. (2006). Integration of Plant 864 Responses to Environmentally Activated Phytohormonal Signals. Science 311: 865 91–94. 866

Asami, T., Min, Y.K., Nagata, N., Yamagishi, K., Takatsuto, S., Fujioka, S., 867 Murofushi, N., Yamaguchi, I., and Yoshida, S. (2000). Characterization of 868 brassinazole, a triazole-type brassinosteroid biosynthesis inhibitor. Plant 869 Physiol. 123: 93–100. 870

Azpiroz, R., Wu, Y., LoCascio, J.C., and Feldmann, K.A. (1998). An Arabidopsis 871 brassinosteroid-dependent mutant is blocked in cell elongation. The Plant Cell 872 10: 219–230. 873

Bai, M.Y., Fan, M., Oh, E., and Wang, Z.Y. (2012) A triple helix-loop-helix/basic 874 helix-loop-helix cascade controls cell elongation downstream of multiple 875 hormonal and environmental signaling pathways in Arabidopsis. Plant Cell. 24: 876 4917-4929 877

Barboza, L., Effgen, S., Alonso-blanco, C., Kooke, R., Keurentjes, J.J.B., and 878 Koornneef, M. (2013). Arabidopsis semidwarfs evolved from independent 879 mutations in GA20ox1, ortholog to green revolution dwarf alleles in rice and 880 barley. Proc. Natl. Acad. Sci. U. S. A. 110: 15818–15823. 881

Binder, B.M., Mortimore, L.A., Stepanova, A.N., Ecker, J.R., and Bleecker, A.B. 882 (2004). Short-Term Growth Responses to Ethylene in Arabidopsis. Plant 883 Physiol. 136: 2921–2927. 884

Blilou, I., Xu, J., Wildwater, M., Willemsen, V., Paponov, I., Friml J, Heidstra R., 885 Aida M., Palme K. & Scheres, B. (2005). The PIN auxin efflux facilitator 886 network controls growth and patterning in Arabidopsis roots. Nature, 433(7021), 887 39-44. 888

Cagnola, J. I., Ploschuk, E., Benech-Arnold, T., Finlayson, S. A., and Casal, J. 889 J. (2012). Stem transcriptome reveals mechanisms to reduce the energetic cost 890 of shade-avoidance responses in tomato. Plant Physiol., 160(2), 1110-1119. 891

Capella, M., Ribone, P. A., Arce, A. L., and Chan, R. L. (2015). Arabidopsis 892 thaliana HomeoBox 1 (AtHB1), a Homedomain‐Leucine Zipper I (HD‐Zip I) 893




28

transcription factor, is regulated by PHYTOCHROME‐INTERACTING FACTOR 894 1 to promote hypocotyl elongation. New Phytologist, 207, 669-682. 895

Casal, J.J. (2013). Photoreceptor signaling networks in plant responses to shade. 896 Annu. Rev. Plant Biol. 64: 403–27. 897

Casal, J.J. (2012). Shade avoidance. Arabidopsis Book 10: e0157. 898 Chae, K., Isaacs, C.G., Reeves, P.H., Maloney, G.S., Muday, G.K., Nagpal, P., 899

and Reed, J.W. (2012). Arabidopsis SMALL AUXIN UP RNA63 promotes 900 hypocotyl and stamen filament elongation. Plant J. 71: 684–697. 901

Chapman, E.J., Greenham, K., Castillejo, C., Sartor, R., Bialy, A., Sun, T.P., and 902 Estelle, M. (2012). Hypocotyl transcriptome reveals auxin regulation of growth-903 promoting genes through GA-dependent and -independent pathways. PLoS 904 One 7: e36210. 905

De Smet, I., Lau, S., Ehrismann, J.S., Axiotis, I., Kolb, M., Kientz, M., Weijers, 906 D., and Jurgens, G. (2013). Transcriptional repression of BODENLOS by HD-907 ZIP transcription factor HB5 in Arabidopsis thaliana. J. Exp. Bot. 64: 3009–3019. 908

Djakovic-Petrovic, T., Wit, M. De, Voesenek, L.A.C.J., and Pierik, R. (2007). 909 DELLA protein function in growth responses to canopy signals. Plant J. 51: 117–910 126. 911

Eisen, M.B., Spellman, P.T., Brown, P.O., and Botstein, D. (1998). Cluster 912 analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci. 913 U. S. A. 95: 14863–14868. 914

Endo, M., Nakamura, S., Araki, T., Mochizuki, N., and Nagatani, A. (2005). 915 Phytochrome B in the Mesophyll Delays Flowering by Suppressing 916 FLOWERING LOCUS T Expression in Arabidopsis Vascular Bundles. The Plant 917 Cell 17: 1941–1952. 918

Estelle, M. (1998). Polar Auxin Transport: New Support for an Old Model. The Plant 919 Cell 10: 1775–1778. 920

Fan, M., Bai, M. Y., Kim, J. G., Wang, T., Oh, E., Chen, L., Park, C.H., Son S., 921 Kim S., Mudgett M.B. and Wang, Z. Y. (2014). The bHLH transcription factor 922 HBI1 mediates the trade-off between growth and pathogen-associated 923 molecular pattern–triggered immunity in Arabidopsis. The Plant Cell Online, 924 26(2), 828-841. 925

Franklin, K. A., Lee, S.H., Patel, D., Kumar, S.V., Spartz, A.K., Gu, C., Ye, S., Yu, 926 P., Breen, G., Cohen, J.D., Wigge, P.A., and Gray, W.M. (2011). 927 Phytochrome-interacting factor 4 (PIF4) regulates auxin biosynthesis at high 928 temperature. Proc. Natl. Acad. Sci. U. S. A. 108: 20231–5. 929

Franklin, K. A. (2008). Shade avoidance. New Phytol. 179: 930–944. 930 Gendreau, E., Traas, J., Desnos, T., Grandjean, O., Caboche, M., and Höfte, H. 931

(1997). Cellular basis of hypocotyl growth in Arabidopsis thaliana. Plant Physiol. 932 114: 295–305. 933

Hattori, Y., Nagai, K., Furukawa, S., Song, X., Kawano, R., Sakakibara, H., Wu, 934 J., Matsumoto, T., Yoshimura, A., Kitano, H., Matsuoka, M., Mori, H., 935 Ashikari, M. (2009). The ethylene response factors SNORKEL1 and 936 SNORKEL2 allow rice to adapt to deep water. Nature 460: 1026–1030. 937

Hayashi, K., Tan, X., Zheng, N., Hatate, T., Kimura, Y., Kepinski, S., and Nozaki, 938 H. (2008). Small-molecule agonists and antagonists of F-box protein-substrate 939 interactions in auxin perception and signaling. Proc. Natl. Acad. Sci. U. S. A. 940 105: 5632–5637. 941




29

Henriques, R., Bögre, L., Horváth, B., and Magyar, Z. (2014). Balancing act: 942 Matching growth with environment by the TOR signalling pathway. J. Exp. Bot. 943 65: 2691–2701. 944

Hisamatsu, T., King, R.W., Helliwell, C. a, and Koshioka, M. (2005). The 945 involvement of Gibberellin 20-Oxidase genes in phytochrome-regulated petiole 946 elongation of Arabidopsis. Plant Physiol. 138: 1106–1116. 947

Hong, S.Y., Kim, O.K., Kim, S.G., Yang, M.S., and Park, C.M. (2011). Nuclear 948 import and DNA binding of the ZHD5 transcription factor is modulated by a 949 competitive peptide inhibitor in Arabidopsis. J. Biol. Chem. 286: 1659–1668. 950

Hu, W. and Ma, H. (2006). Characterization of a novel putative zinc finger gene 951 MIF1: Involvement in multiple hormonal regulation of Arabidopsis development. 952 Plant J. 45: 399–422. 953

Hyun, Y. and Lee, I. (2006). KIDARI, encoding a non-DNA Binding bHLH protein, 954 represses light signal transduction in Arabidopsis thaliana. Plant Mol. Biol. 61: 955 283–96. 956

Iqbal, N., Khan, N. A., Nazar, R., and da Silva, J. A. T. (2012). Ethylene-stimulated 957 photosynthesis results from increased nitrogen and sulfur assimilation in 958 mustard types that differ in photosynthetic capacity. Environ. Exp. Bot. 78: 84–959 90. 960

Kazan, K. and Manners, J.M. (2013). MYC2: The master in action. Mol. Plant 6: 961 686–703. 962

Keuskamp, D.H., Pollmann, S., Voesenek, L.A.C.J., Peeters, A.J.M., and Pierik, 963 R. (2010). Auxin transport through PIN-FORMED 3 (PIN3) controls shade 964 avoidance and fitness during competition. Proc. Natl. Acad. Sci. U. S. A. 107: 965 22740–22744. 966

Keuskamp, D.H., Sasidharan, R., Vos, I., Peeters, A.J.M., Voesenek, L.A.C.J., 967 and Pierik, R. (2011). Blue-light-mediated shade avoidance requires combined 968 auxin and brassinosteroid action in Arabidopsis seedlings. Plant J. 67: 208–217. 969

Khanna, R., Shen, Y., Marion, C.M., Tsuchisaka, A., Theologis, A., Schafer, E., 970 and Quail, P.H. (2007). The basic helix-loop-helix transcription factor PIF5 acts 971 on ethylene biosynthesis and phytochrome signaling by distinct mechanisms. 972 Plant Cell. 19: 3915-3929. 973

Kim, B.C., Soh, M.S., Hong, S.H., Furuya, M., and Nam, H.G. (1998). 974 Photomorphogenic development of the Arabidopsis shy2-1D mutation and its 975 interaction with phytochromes in darkness. Plant J. 15: 61–68. 976

Kunihiro, A., Yamashino, T., Nakamichi, N., Niwa, Y., Nakanishi, H., and 977 Mizuno, T. (2011). PHYTOCHROME-INTERACTING FACTOR 4 and 5 (PIF4 978 and PIF5) activate the Homeobox ATHB2 and auxin-inducible IAA29 genes in 979 the coincidence mechanism underlying photoperiodic control of plant growth of 980 Arabidopsis thaliana. The Plant Cell Physiol. 52: 1315–1329. 981

Lee, Y.K., Kim, G., Kim, I., Park, J., Kwak, S., Choi, G., and Chung, W. (2006). 982 LONGIFOLIA1 and LONGIFOLIA2, two homologous genes, regulate 983 longitudinal cell elongation in Arabidopsis. Development 133: 4305–4314. 984

Leivar, P. and Monte, E. (2014). PIFs: systems integrators in plant development. 985 The Plant Cell 26: 56–78. 986

Li, L. et al. (2012). Linking photoreceptor excitation to changes in plant architecture. 987 Genes Dev. 26: 785–790. 988

Lilley, J.L.S., Gee, C.W., Sairanen, I., Ljung, K., and Nemhauser, J.L. (2012). An 989 Endogenous Carbon-Sensing Pathway Triggers Increased Auxin Flux and 990 Hypocotyl Elongation. Plant Physiol. 160: 2261–2270. 991




30

Mickelbart, M. V., Hasegawa, P.M., and Bailey-Serres, J. (2015). Genetic 992 mechanisms of abiotic stress tolerance that translate to crop yield stability. Nat. 993 Rev. Genet. 16: 237–251. 994

Morelli, G., Ruberti, I., Molecolare, B., Sapienza, L., and Moro, P.A. (2000). 995 Update on Light Signaling Shade Avoidance Responses. Driving Auxin along 996 Lateral Routes. Plant Physiol. 122: 621–626. 997

Neff, M.M., Nguyen, S.M., Malancharuvil, E.J., Fujioka, S., Noguchi, T., Seto, H., 998 Tsubuki, M., Honda, T., Takatsuto, S., Yoshida, S., and Chory, J. (1999). 999 BAS1: A gene regulating brassinosteroid levels and light responsiveness in 1000 Arabidopsis. Proc. Natl. Acad. Sci. 96: 15316–15323. 1001

Nemhauser, J.L., Mockler, T.C., and Chory, J. (2004). Interdependency of 1002 brassinosteroid and auxin signaling in Arabidopsis. PLoS Biol. 2: E258. 1003

Nishimura, T., Hayashi, K.I., Suzuki, H., Gyohda, A., Takaoka, C., Sakaguchi, Y., 1004 Matsumoto, S., Kasahara, H., Sakai, T., Kato, J.I., Kamiya, Y., and Koshiba, 1005 T. (2014). Yucasin is a potent inhibitor of YUCCA, a key enzyme in auxin 1006 biosynthesis. Plant J. 77: 352–366. 1007

Nomura, T., Kushiro, T., Yokota, T., Kamiya, Y., Bishop, G.J., and Yamaguchi, 1008 S. (2005). The last reaction producing brassinolide is catalyzed by cytochrome 1009 P-450s, CYP85A3 in tomato and CYP85A2 in Arabidopsis. J. Biol. Chem. 280: 1010 17873–17879. 1011

Nozue, K., Tat, A. V., Kumar Devisetty, U., Robinson, M., Mumbach, M.R., 1012 Ichihashi, Y., Lekkala, S., and Maloof, J.N. (2015). Shade Avoidance 1013 Components and Pathways in Adult Plants Revealed by Phenotypic Profiling. 1014 PLOS Genet. 11: e1004953. 1015

Osakabe, Y., Osakabe, K., Shinozaki, K., and Tran, L. S. P. (2014). Response of 1016 plants to water stress. Front. Plant Sci. 5(86): 10-3389. 1017

Park, E., Park, J., Kim, J., Nagatani, A., Lagarias, J.C., and Choi, G. (2012). 1018 Phytochrome B inhibits binding of phytochrome-interacting factors to their target 1019 promoters. Plant J. 72: 537–546. 1020

Petrásek, J., Cerná, A., Schwarzerová, K., Elckner, M., Morris, D. A., and 1021 Zazímalová, E. (2003). Do phytotropins inhibit auxin efflux by impairing vesicle 1022 traffic? Plant Physiol. 131: 254–263. 1023

Pfeiffer, A., Shi, H., Tepperman, J.M., Zhang, Y., and Quail, P.H. (2014). 1024 Combinatorial Complexity in a Transcriptionally Centered Signaling Hub in 1025 Arabidopsis. Mol. Plant 7: 1598–1618. 1026

Philippar, K., Ivashikina, N., Ache, P., Christian, M., Lüthen, H., Palme, K., and 1027 Hedrich, R. (2004). Auxin activates KAT1 and KAT2, two K+-channel genes 1028 expressed in seedlings of Arabidopsis thaliana. Plant J. 37: 815–827. 1029

Pierik, R., Cuppens, M.L., Voesenek, L.A.C.J. and Visser, E.J. (2004) Interactions 1030 between ethylene and gibberellins in phytochrome-mediated shade avoidance 1031 responses in tobacco. Plant Physiol. 136: 2928-2936. 1032

Pierik, R., Djakovic-Petrovic, T., Keuskamp, D.H., de Wit, M., and Voesenek, 1033 L.A.C.J. (2009). Auxin and ethylene regulate elongation responses to neighbor 1034 proximity signals independent of gibberellin and DELLA proteins in Arabidopsis. 1035 Plant Physiol. 149: 1701–1712. 1036

Pierik, R., Millenaar, F.F., Peeters, A. J.M., and Voesenek, L.A.C.J. (2005). New 1037 perspectives in flooding research: The use of shade avoidance and Arabidopsis 1038 thaliana. Ann. Bot. 96: 533–540. 1039

Pierik, R. and Testerink, C. (2014). The art of being flexible: how to escape from 1040 shade, salt and drought. Plant Physiol. 166: 5–22. 1041




31

Pierik, R. and De Wit, M. (2014). Shade avoidance: Phytochrome signalling and 1042 other aboveground neighbour detection cues. J. Exp. Bot. 65: 2815–2824. 1043

Procko, C., Crenshaw, C.M., Ljung, K., Noel, J.P., and Chory, J. (2014). 1044 Cotyledon-Generated Auxin Is Required for Shade-Induced Hypocotyl Growth in 1045 Brassica rapa. Plant Physiol. 165: 1285–1301. 1046

Quint, M., Delker, C., Franklin, K. A., Wigge, P. A., Halliday, K. J., and van 1047 Zanten, M. (2016). Molecular and genetic control of plant 1048 thermomorphogenesis. Nature Plants. 2: 15190. 1049

Rademacher, W. (2000). GROWTH RETARDANTS: Effects on Gibberellin 1050 Biosynthesis and Other Metabolic Pathways. Annu. Rev. Plant Physiol. Plant 1051 Mol. Biol. 51: 501–531. 1052

Rieu, I., Ruiz-Rivero, O., Fernandez-Garcia, N., Griffiths, J., Powers, S.J., Gong, 1053 F., Linhartova, T., Eriksson, S., Nilsson, O., Thomas, S.G., Phillips, A.L., 1054 and Hedden, P. (2008). The gibberellin biosynthetic genes AtGA20ox1 and 1055 AtGA20ox2 act, partially redundantly, to promote growth and development 1056 throughout the Arabidopsis life cycle. Plant J. 53: 488–504. 1057

Ruegger, M., Dewey, E., Gray, W.M., Hobbie, L., Turner, J., and Estelle, M. 1058 (1998). The TIR1 protein of Arabidopsis functions in auxin response and is 1059 related to human SKP2 and yeast Grr1p. Genes Dev. 12: 198–207. 1060

Sasidharan, R., Chinnappa, C.C., Staal, M., Elzenga, J.T.M., Yokoyama, R., 1061 Nishitani, K., Voesenek, L.A.C.J., and Pierik, R. (2010). Light quality-1062 mediated petiole elongation in Arabidopsis during shade avoidance involves cell 1063 wall modification by xyloglucan endotransglucosylase/hydrolases. Plant Physiol. 1064 154: 978–990. 1065

Sasidharan, R. and Voesenek, L.A.C.J. (2015). Ethylene-mediated acclimations to 1066 flooding stress. Plant Physiol.: pp.00387. 1067

Smalle, J., Haegman, M., Kurepa, J., Van Montagu M, and Straeten, D. V (1997). 1068 Ethylene can stimulate Arabidopsis hypocotyl elongation in the light. Proc. Natl. 1069 Acad. Sci. U. S. A. 94: 2756–2761. 1070

Spartz, A.K., Lee, S.H., Wenger, J.P., Gonzalez, N., Itoh, H., Inzé, D., Peer, W.A., 1071 Murphy, A.S., Overvoorde, P.J., and Gray, W.M. (2012). The SAUR19 1072 subfamily of SMALL AUXIN UP RNA genes promote cell expansion. Plant J. 70: 1073 978–990. 1074

Stepanova, A.N., Robertson-Hoyt, J., Yun, J., Benavente, L.M., Xie, D.Y., 1075 Doležal, K., Schlereth, A., Jürgens, G., and Alonso, J.M. (2008). TAA1-1076 Mediated Auxin Biosynthesis Is Essential for Hormone Crosstalk and Plant 1077 Development. Cell 133: 177–191. 1078

Sulpice, R., Flis, A., Ivakov, A. A., Apelt, F., Krohn, N., Encke, B., Abel, C., Feil, 1079 R., Lunn, J.E., and Stitt, M. (2014). Arabidopsis coordinates the diurnal 1080 regulation of carbon allocation and growth across a wide range of Photoperiods. 1081 Mol. Plant 7: 137–155. 1082

Sun, J., Qi, L., Li, Y., Chu, J., and Li, C. (2012). PIF4-mediated activation of 1083 YUCCA8 expression integrates temperature into the auxin pathway in regulating 1084 Arabidopsis hypocotyl growth. PLoS Genet. 8: e1002594. 1085

Tabas-Madrid, D., Nogales-Cadenas, R., and Pascual-Montano, A. (2012). 1086 GeneCodis 3: a non-redundant and modular enrichment analysis tool for 1087 functional genomics. Nucleic Acids Res. 40: W478–W483. 1088

Talon, M., Koornneef, M., and Zeevaart, J. A. D. (1990). Accumulation of C19-1089 gibberellins in the gibberellin-insensitive dwarf mutant gai of Arabidopsis 1090 thaliana (L.) Heynh. Planta 182: 501–505. 1091




32

Tanaka, S., Nakamura, S., Mochizuki, N., and Nagatani, A. (2002). Phytochrome 1092 in cotyledons regulates the expression of genes in the hypocotyl through auxin-1093 dependent and -independent pathways. The Plant Cell Physiol. 43: 1171–1181. 1094

Tao, Y., Ferrer, J.L., Ljung, K., Pojer, F., Hong, F., Long, J.A., Li, L., Moreno, 1095 J.E., Bowman, M.E., Ivans, L.J., Cheng, Y., Lim, J., Zhao, Y., Ballaré, C.L., 1096 Sandberg, G., Noel, J.P. and Chory, J. (2008). Rapid Synthesis of Auxin via a 1097 New Tryptophan-Dependent Pathway Is Required for Shade Avoidance in 1098 Plants. Cell 133: 164–176. 1099

Tholen, D., Pons, T.L., Voesenek, L.A.C.J., and Poorter, H. (2007). Ethylene 1100 insensitivity results in down-regulation of rubisco expression and photosynthetic 1101 capacity in tobacco. Plant Physiol. 144: 1305–1315. 1102

Turk, E.M. et al. (2005). BAS1 and SOB7 act redundantly to modulate Arabidopsis 1103 photomorphogenesis via unique brassinosteroid inactivation mechanisms. Plant 1104 J. 42: 23–34. 1105

Unterholzner, S.J., Rozhon, W., Papacek, M., Ciomas, J., Lange, T., Kugler, 1106 K.G., Mayer, K.F., Sieberer, T., and Poppenberger, B. (2015). 1107 Brassinosteroids Are Master Regulators of Gibberellin Biosynthesis in 1108 Arabidopsis. The Plant Cell 27: 2261–2272. 1109

Van Esse, G.W., van Mourik, S., Stigter, H., ten Hove, C. a., Molenaar, J., and de 1110 Vries, S.C. (2012). A Mathematical Model for BRASSINOSTEROID 1111 INSENSITIVE1-Mediated Signaling in Root Growth and Hypocotyl Elongation. 1112 Plant Physiol. 160: 523–532. 1113

Vandenbussche, F., Pierik, R., Millenaar, F.F., Voesenek, L.A.C.J., and Van Der 1114 Straeten, D. (2005). Reaching out of the shade. Curr. Opin. Plant Biol. 8: 462–1115 468. 1116

van Veen, H., Mustroph, A., Barding, G.A., Vergeer-van Eijk, M., Welschen-1117 Evertman, R.A.M., Pedersen, O., Visser, E.J.W., Larive, C.K., Pierik, R., 1118 Bailey-Serres, J., Voesenek, L.A.C.J., and Sasidharan, R. (2013). Two 1119 Rumex species from contrasting hydrological niches regulate flooding tolerance 1120 through distinct mechanisms. The Plant Cell 25: 4691–707. 1121

Voesenek L.A.C.J.; and Bailey-serres, J. (2015). Flood adaptive traits and 1122 processes : an overview. New Phytol. 206: 57–73. 1123

Volodarsky, D., Leviatan, N., Otcheretianski, A., and Fluhr, R. (2009). 1124 HORMONOMETER: a tool for discerning transcript signatures of hormone 1125 action in the Arabidopsis transcriptome. Plant Physiol. 150: 1796–1805. 1126

Warnasooriya, S.N. and Montgomery, B.L. (2009). Detection of spatial-specific 1127 phytochrome responses using targeted expression of biliverdin reductase in 1128 Arabidopsis. Plant Physiol. 149: 424–33. 1129

Wilson, R.N., Heckman, J.W., and Somerville, C.R. (1992). Gibberellin Is Required 1130 for Flowering in Arabidopsis thaliana under Short Days. Plant Physiol. 100: 403–1131 408. 1132

Zhiponova, M.K., Morohashi, K., Vanhoutte, I., Machemer-Noonan, K., 1133 Revalska, M., Van Montagu, M., Grotewold, E., and Russinova, E. (2014). 1134 Helix-loop-helix/basic helix-loop-helix transcription factor network represses cell 1135 elongation in Arabidopsis through an apparent incoherent feed-forward loop. 1136 Proc. Natl. Acad. Sci. U. S. A. 111: 2824–9. 1137

Zheng, Z., Guo, Y., Novak, O., Chen, W., Ljung, K., Noel, J.P., and Chory, J. 1138 (2016). Local auxin metabolism regulates environment-induced hypocotyl 1139 elongation. Nat. Plants. 21: 16025. doi: 10.1038/nplants.2016.25 1140




33

Zhong, S., Shi, H., Xue, C., Wang, L., Xi, Y., Li, J., Quail, P.H., Deng, X.W., and 1141 Guo, H. (2012). A molecular framework of light-controlled phytohormone action 1142 in Arabidopsis. Curr. Biol. 22: 1530–1535. 1143

1144 1145 1146 1147 1148 1149




Parsed CitationsAbdi, H., and Williams, L. J. (2010). Principal component analysis. Wiley Interdisciplinary Reviews: Computational Statistics, 2(4),433-459.

Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Achard, P., Cheng, H., Grauwe, L. De, Decat, J., Schoutteten, H., Moritz, T., Straeten, D. Van Der, Peng, J., and Harberd, N.P.(2006). Integration of Plant Responses to Environmentally Activated Phytohormonal Signals. Science 311: 91-94.


Asami, T., Min, Y.K., Nagata, N., Yamagishi, K., Takatsuto, S., Fujioka, S., Murofushi, N., Yamaguchi, I., and Yoshida, S. (2000).Characterization of brassinazole, a triazole-type brassinosteroid biosynthesis inhibitor. Plant Physiol. 123: 93-100.


Azpiroz, R., Wu, Y., LoCascio, J.C., and Feldmann, K.A. (1998). An Arabidopsis brassinosteroid-dependent mutant is blocked in cellelongation. The Plant Cell 10: 219-230.


Bai, M.Y., Fan, M., Oh, E., and Wang, Z.Y. (2012) A triple helix-loop-helix/basic helix-loop-helix cascade controls cell elongationdownstream of multiple hormonal and environmental signaling pathways in Arabidopsis. Plant Cell. 24: 4917-4929


Barboza, L., Effgen, S., Alonso-blanco, C., Kooke, R., Keurentjes, J.J.B., and Koornneef, M. (2013). Arabidopsis semidwarfsevolved from independent mutations in GA20ox1, ortholog to green revolution dwarf alleles in rice and barley. Proc. Natl. Acad.Sci. U. S. A. 110: 15818-15823.


Binder, B.M., Mortimore, L.A., Stepanova, A.N., Ecker, J.R., and Bleecker, A.B. (2004). Short-Term Growth Responses to Ethylenein Arabidopsis. Plant Physiol. 136: 2921-2927.


Blilou, I., Xu, J., Wildwater, M., Willemsen, V., Paponov, I., Friml J, Heidstra R., Aida M., Palme K. & Scheres, B. (2005). The PINauxin efflux facilitator network controls growth and patterning in Arabidopsis roots. Nature, 433(7021), 39-44.


Cagnola, J. I., Ploschuk, E., Benech-Arnold, T., Finlayson, S. A., and Casal, J. J. (2012). Stem transcriptome reveals mechanisms toreduce the energetic cost of shade-avoidance responses in tomato. Plant Physiol., 160(2), 1110-1119.


Capella, M., Ribone, P. A., Arce, A. L., and Chan, R. L. (2015). Arabidopsis thaliana HomeoBox 1 (AtHB1), a Homedomain-LeucineZipper I (HD-Zip I) transcription factor, is regulated by PHYTOCHROME-INTERACTING FACTOR 1 to promote hypocotylelongation. New Phytologist, 207, 669-682.


Casal, J.J. (2013). Photoreceptor signaling networks in plant responses to shade. Annu. Rev. Plant Biol. 64: 403-27.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Casal, J.J. (2012). Shade avoidance. Arabidopsis Book 10: e0157.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Chae, K., Isaacs, C.G., Reeves, P.H., Maloney, G.S., Muday, G.K., Nagpal, P., and Reed, J.W. (2012). Arabidopsis SMALL AUXIN UPRNA63 promotes hypocotyl and stamen filament elongation. Plant J. 71: 684-697.



http://www.ncbi.nlm.nih.gov/pubmed?term=%28Wiley Interdisciplinary Reviews%3A Computational Statistics%5BTitle%5D%29 AND 2%5BVolume%5D AND 433%5BPagination%5D AND Abdi%2C H%2E%2C and Williams%2C L%2E J%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Abdi, H., and Williams, L. J. (2010). Principal component analysis. Wiley Interdisciplinary Reviews: Computational Statistics, 2(4), 433-459.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Abdi,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Principal component analysis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Principal component analysis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Abdi,&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Science%5BTitle%5D%29 AND 311%5BVolume%5D AND 91%5BPagination%5D AND Achard%2C P%2E%2C Cheng%2C H%2E%2C Grauwe%2C L%2E De%2C Decat%2C J%2E%2C Schoutteten%2C H%2E%2C Moritz%2C T%2E%2C Straeten%2C D%2E Van Der%2C Peng%2C J%2E%2C and Harberd%2C N%2EP%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Achard, P., Cheng, H., Grauwe, L. De, Decat, J., Schoutteten, H., Moritz, T., Straeten, D. Van Der, Peng, J., and Harberd, N.P. (2006). Integration of Plant Responses to Environmentally Activated Phytohormonal Signals. Science 311: 91-94.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Achard,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Integration of Plant Responses to Environmentally Activated Phytohormonal Signals&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Integration of Plant Responses to Environmentally Activated Phytohormonal Signals&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Achard,&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 123%5BVolume%5D AND 93%5BPagination%5D AND Asami%2C T%2E%2C Min%2C Y%2EK%2E%2C Nagata%2C N%2E%2C Yamagishi%2C K%2E%2C Takatsuto%2C S%2E%2C Fujioka%2C S%2E%2C Murofushi%2C N%2E%2C Yamaguchi%2C I%2E%2C and Yoshida%2C S%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Asami, T., Min, Y.K., Nagata, N., Yamagishi, K., Takatsuto, S., Fujioka, S., Murofushi, N., Yamaguchi, I., and Yoshida, S. (2000). Characterization of brassinazole, a triazole-type brassinosteroid biosynthesis inhibitor. Plant Physiol. 123: 93-100.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Asami,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Characterization of brassinazole, a triazole-type brassinosteroid biosynthesis inhibitor&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Characterization of brassinazole, a triazole-type brassinosteroid biosynthesis inhibitor&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Asami,&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28The Plant Cell%5BTitle%5D%29 AND 10%5BVolume%5D AND 219%5BPagination%5D AND Azpiroz%2C R%2E%2C Wu%2C Y%2E%2C LoCascio%2C J%2EC%2E%2C and Feldmann%2C K%2EA%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Azpiroz, R., Wu, Y., LoCascio, J.C., and Feldmann, K.A. (1998). An Arabidopsis brassinosteroid-dependent mutant is blocked in cell elongation. The Plant Cell 10: 219-230.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Azpiroz,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=An Arabidopsis brassinosteroid-dependent mutant is blocked in cell elongation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=An Arabidopsis brassinosteroid-dependent mutant is blocked in cell elongation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Azpiroz,&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 24%5BVolume%5D AND 4917%5BPagination%5D AND Bai%2C M%2EY%2E%2C Fan%2C M%2E%2C Oh%2C E%2E%2C and Wang%2C Z%2EY%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bai, M.Y., Fan, M., Oh, E., and Wang, Z.Y. (2012) A triple helix-loop-helix/basic helix-loop-helix cascade controls cell elongation downstream of multiple hormonal and environmental signaling pathways in Arabidopsis. Plant Cell. 24: 4917-4929

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bai,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A triple helix-loop-helix/basic helix-loop-helix cascade controls cell elongation downstream of multiple hormonal and environmental signaling pathways in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A triple helix-loop-helix/basic helix-loop-helix cascade controls cell elongation downstream of multiple hormonal and environmental signaling pathways in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bai,&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Arabidopsis%5BTitle%5D%29 AND 1%5BVolume%5D AND ortholog to green revolution dwarf alleles in rice and barley%2E Proc%2E Natl%2E Acad%2E Sci%2E U%2E S%2E A%2E 110%3A 15818%5BPagination%5D AND Barboza%2C L%2E%2C Effgen%2C S%2E%2C Alonso%2Dblanco%2C C%2E%2C Kooke%2C R%2E%2C Keurentjes%2C J%2EJ%2EB%2E%2C and Koornneef%2C M%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Barboza, L., Effgen, S., Alonso-blanco, C., Kooke, R., Keurentjes, J.J.B., and Koornneef, M. (2013). Arabidopsis semidwarfs evolved from independent mutations in GA20ox1, ortholog to green revolution dwarf alleles in rice and barley. Proc. Natl. Acad. Sci. U. S. A. 110: 15818-15823.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Barboza,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Barboza,&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 136%5BVolume%5D AND 2921%5BPagination%5D AND Binder%2C B%2EM%2E%2C Mortimore%2C L%2EA%2E%2C Stepanova%2C A%2EN%2E%2C Ecker%2C J%2ER%2E%2C and Bleecker%2C A%2EB%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Binder, B.M., Mortimore, L.A., Stepanova, A.N., Ecker, J.R., and Bleecker, A.B. (2004). Short-Term Growth Responses to Ethylene in Arabidopsis. Plant Physiol. 136: 2921-2927.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Binder,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Short-Term Growth Responses to Ethylene in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Short-Term Growth Responses to Ethylene in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Binder,&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature%5BTitle%5D%29 AND 433%5BVolume%5D AND 39%5BPagination%5D AND Blilou%2C I%2E%2C Xu%2C J%2E%2C Wildwater%2C M%2E%2C Willemsen%2C V%2E%2C Paponov%2C I%2E%2C Friml J%2C Heidstra R%2E%2C Aida M%2E%2C Palme K%2E %26 Scheres%2C B%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Blilou, I., Xu, J., Wildwater, M., Willemsen, V., Paponov, I., Friml J, Heidstra R., Aida M., Palme K. & Scheres, B. (2005). The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots. Nature, 433(7021), 39-44.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Blilou,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Blilou,&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 160%5BVolume%5D AND 1110%5BPagination%5D AND Cagnola%2C J%2E I%2E%2C Ploschuk%2C E%2E%2C Benech%2DArnold%2C T%2E%2C Finlayson%2C S%2E A%2E%2C and Casal%2C J%2E J%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Cagnola, J. I., Ploschuk, E., Benech-Arnold, T., Finlayson, S. A., and Casal, J. J. (2012). Stem transcriptome reveals mechanisms to reduce the energetic cost of shade-avoidance responses in tomato. Plant Physiol., 160(2), 1110-1119.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cagnola,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Stem transcriptome reveals mechanisms to reduce the energetic cost of shade-avoidance responses in tomato&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Stem transcriptome reveals mechanisms to reduce the energetic cost of shade-avoidance responses in tomato&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cagnola,&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28New Phytologist%5BTitle%5D%29 AND 207%5BVolume%5D AND 669%5BPagination%5D AND Capella%2C M%2E%2C Ribone%2C P%2E A%2E%2C Arce%2C A%2E L%2E%2C and Chan%2C R%2E L%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Capella, M., Ribone, P. A., Arce, A. L., and Chan, R. L. (2015). Arabidopsis thaliana HomeoBox 1 (AtHB1), a Homedomain-Leucine Zipper I (HD-Zip I) transcription factor, is regulated by PHYTOCHROME-INTERACTING FACTOR 1 to promote hypocotyl elongation. New Phytologist, 207, 669-682.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Capella,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis thaliana HomeoBox 1 (AtHB1), a Homedomain-Leucine Zipper I (HD-Zip I) transcription factor, is regulated by PHYTOCHROME-INTERACTING FACTOR 1 to promote hypocotyl elongation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis thaliana HomeoBox 1 (AtHB1), a Homedomain-Leucine Zipper I (HD-Zip I) transcription factor, is regulated by PHYTOCHROME-INTERACTING FACTOR 1 to promote hypocotyl elongation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Capella,&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Annu%2E Rev%2E Plant Biol%5BTitle%5D%29 AND 64%5BVolume%5D AND 403%5BPagination%5D AND Casal%2C J%2EJ%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Casal, J.J. (2013). Photoreceptor signaling networks in plant responses to shade. Annu. Rev. Plant Biol. 64: 403-27.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Casal,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Photoreceptor signaling networks in plant responses to shade&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Photoreceptor signaling networks in plant responses to shade&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Casal,&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Arabidopsis Book%5BTitle%5D%29 AND 10%5BVolume%5D AND 0157%5BPagination%5D AND Casal%2C J%2EJ%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Casal, J.J. (2012). Shade avoidance. Arabidopsis Book 10: e0157.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Casal,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Shade avoidance&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Shade avoidance&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Casal,&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 71%5BVolume%5D AND 684%5BPagination%5D AND Chae%2C K%2E%2C Isaacs%2C C%2EG%2E%2C Reeves%2C P%2EH%2E%2C Maloney%2C G%2ES%2E%2C Muday%2C G%2EK%2E%2C Nagpal%2C P%2E%2C and Reed%2C J%2EW%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Chae, K., Isaacs, C.G., Reeves, P.H., Maloney, G.S., Muday, G.K., Nagpal, P., and Reed, J.W. (2012). Arabidopsis SMALL AUXIN UP RNA63 promotes hypocotyl and stamen filament elongation. Plant J. 71: 684-697.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chae,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis SMALL AUXIN UP RNA63 promotes hypocotyl and stamen filament elongation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis SMALL AUXIN UP RNA63 promotes hypocotyl and stamen filament elongation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chae,&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1



Chapman, E.J., Greenham, K., Castillejo, C., Sartor, R., Bialy, A., Sun, T.P., and Estelle, M. (2012). Hypocotyl transcriptome revealsauxin regulation of growth-promoting genes through GA-dependent and -independent pathways. PLoS One 7: e36210.


De Smet, I., Lau, S., Ehrismann, J.S., Axiotis, I., Kolb, M., Kientz, M., Weijers, D., and Jurgens, G. (2013). Transcriptional repressionof BODENLOS by HD-ZIP transcription factor HB5 in Arabidopsis thaliana. J. Exp. Bot. 64: 3009-3019.


Djakovic-Petrovic, T., Wit, M. De, Voesenek, L.A.C.J., and Pierik, R. (2007). DELLA protein function in growth responses to canopysignals. Plant J. 51: 117-126.


Eisen, M.B., Spellman, P.T., Brown, P.O., and Botstein, D. (1998). Cluster analysis and display of genome-wide expression patterns.Proc. Natl. Acad. Sci. U. S. A. 95: 14863-14868.


Endo, M., Nakamura, S., Araki, T., Mochizuki, N., and Nagatani, A. (2005). Phytochrome B in the Mesophyll Delays Flowering bySuppressing FLOWERING LOCUS T Expression in Arabidopsis Vascular Bundles. The Plant Cell 17: 1941-1952.


Estelle, M. (1998). Polar Auxin Transport: New Support for an Old Model. The Plant Cell 10: 1775-1778.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Fan, M., Bai, M. Y., Kim, J. G., Wang, T., Oh, E., Chen, L., Park, C.H., Son S., Kim S., Mudgett M.B. and Wang, Z. Y. (2014). The bHLHtranscription factor HBI1 mediates the trade-off between growth and pathogen-associated molecular pattern-triggered immunity inArabidopsis. The Plant Cell Online, 26(2), 828-841.


Franklin, K. A., Lee, S.H., Patel, D., Kumar, S.V., Spartz, A.K., Gu, C., Ye, S., Yu, P., Breen, G., Cohen, J.D., Wigge, P.A., and Gray,W.M. (2011). Phytochrome-interacting factor 4 (PIF4) regulates auxin biosynthesis at high temperature. Proc. Natl. Acad. Sci. U. S.A. 108: 20231-5.


Franklin, K. A. (2008). Shade avoidance. New Phytol. 179: 930-944.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Gendreau, E., Traas, J., Desnos, T., Grandjean, O., Caboche, M., and Höfte, H. (1997). Cellular basis of hypocotyl growth inArabidopsis thaliana. Plant Physiol. 114: 295-305.


Hattori, Y., Nagai, K., Furukawa, S., Song, X., Kawano, R., Sakakibara, H., Wu, J., Matsumoto, T., Yoshimura, A., Kitano, H.,Matsuoka, M., Mori, H., Ashikari, M. (2009). The ethylene response factors SNORKEL1 and SNORKEL2 allow rice to adapt to deepwater. Nature 460: 1026-1030.


Hayashi, K., Tan, X., Zheng, N., Hatate, T., Kimura, Y., Kepinski, S., and Nozaki, H. (2008). Small-molecule agonists and antagonistsof F-box protein-substrate interactions in auxin perception and signaling. Proc. Natl. Acad. Sci. U. S. A. 105: 5632-5637.


Henriques, R., Bögre, L., Horváth, B., and Magyar, Z. (2014). Balancing act: Matching growth with environment by the TORsignalling pathway. J. Exp. Bot. 65: 2691-2701.


Hisamatsu, T., King, R.W., Helliwell, C. a, and Koshioka, M. (2005). The involvement of Gibberellin 20-Oxidase genes in www.plantphysiol.org on July 4, 2016 - Published by www.plantphysiol.orgDownloaded from

Copyright © 2016 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=%28PLoS One%5BTitle%5D%29 AND 7%5BVolume%5D AND 36210%5BPagination%5D AND Chapman%2C E%2EJ%2E%2C Greenham%2C K%2E%2C Castillejo%2C C%2E%2C Sartor%2C R%2E%2C Bialy%2C A%2E%2C Sun%2C T%2EP%2E%2C and Estelle%2C M%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Chapman, E.J., Greenham, K., Castillejo, C., Sartor, R., Bialy, A., Sun, T.P., and Estelle, M. (2012). Hypocotyl transcriptome reveals auxin regulation of growth-promoting genes through GA-dependent and -independent pathways. PLoS One 7: e36210.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chapman,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Hypocotyl transcriptome reveals auxin regulation of growth-promoting genes through GA-dependent and -independent pathways&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Hypocotyl transcriptome reveals auxin regulation of growth-promoting genes through GA-dependent and -independent pathways&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chapman,&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J%2E Exp%2E Bot%5BTitle%5D%29 AND 64%5BVolume%5D AND 3009%5BPagination%5D AND De Smet%2C I%2E%2C Lau%2C S%2E%2C Ehrismann%2C J%2ES%2E%2C Axiotis%2C I%2E%2C Kolb%2C M%2E%2C Kientz%2C M%2E%2C Weijers%2C D%2E%2C and Jurgens%2C G%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=De Smet, I., Lau, S., Ehrismann, J.S., Axiotis, I., Kolb, M., Kientz, M., Weijers, D., and Jurgens, G. (2013). Transcriptional repression of BODENLOS by HD-ZIP transcription factor HB5 in Arabidopsis thaliana. J. Exp. Bot. 64: 3009-3019.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=De&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptional repression of BODENLOS by HD-ZIP transcription factor HB5 in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptional repression of BODENLOS by HD-ZIP transcription factor HB5 in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=De&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 51%5BVolume%5D AND 117%5BPagination%5D AND Djakovic%2DPetrovic%2C T%2E%2C Wit%2C M%2E De%2C Voesenek%2C L%2EA%2EC%2EJ%2E%2C and Pierik%2C R%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Djakovic-Petrovic, T., Wit, M. De, Voesenek, L.A.C.J., and Pierik, R. (2007). DELLA protein function in growth responses to canopy signals. Plant J. 51: 117-126.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Djakovic-Petrovic,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=DELLA protein function in growth responses to canopy signals&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=DELLA protein function in growth responses to canopy signals&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Djakovic-Petrovic,&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc%2E Natl%2E Acad%2E Sci%2E U%2E S%2E A%5BTitle%5D%29 AND 95%5BVolume%5D AND 14863%5BPagination%5D AND Eisen%2C M%2EB%2E%2C Spellman%2C P%2ET%2E%2C Brown%2C P%2EO%2E%2C and Botstein%2C D%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Eisen, M.B., Spellman, P.T., Brown, P.O., and Botstein, D. (1998). Cluster analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci. U. S. A. 95: 14863-14868.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Eisen,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Cluster analysis and display of genome-wide expression patterns&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Cluster analysis and display of genome-wide expression patterns&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Eisen,&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28The Plant Cell%5BTitle%5D%29 AND 17%5BVolume%5D AND 1941%5BPagination%5D AND Endo%2C M%2E%2C Nakamura%2C S%2E%2C Araki%2C T%2E%2C Mochizuki%2C N%2E%2C and Nagatani%2C A%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Endo, M., Nakamura, S., Araki, T., Mochizuki, N., and Nagatani, A. (2005). Phytochrome B in the Mesophyll Delays Flowering by Suppressing FLOWERING LOCUS T Expression in Arabidopsis Vascular Bundles. The Plant Cell 17: 1941-1952.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Endo,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Phytochrome B in the Mesophyll Delays Flowering by Suppressing FLOWERING LOCUS T Expression in Arabidopsis Vascular Bundles&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Phytochrome B in the Mesophyll Delays Flowering by Suppressing FLOWERING LOCUS T Expression in Arabidopsis Vascular Bundles&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Endo,&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28The Plant Cell%5BTitle%5D%29 AND 10%5BVolume%5D AND 1775%5BPagination%5D AND Estelle%2C M%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Estelle, M. (1998). Polar Auxin Transport: New Support for an Old Model. The Plant Cell 10: 1775-1778.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Estelle,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Polar Auxin Transport: New Support for an Old Model&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Polar Auxin Transport: New Support for an Old Model&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Estelle,&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28The Plant Cell Online%5BTitle%5D%29 AND 26%5BVolume%5D AND 828%5BPagination%5D AND Fan%2C M%2E%2C Bai%2C M%2E Y%2E%2C Kim%2C J%2E G%2E%2C Wang%2C T%2E%2C Oh%2C E%2E%2C Chen%2C L%2E%2C Park%2C C%2EH%2E%2C Son S%2E%2C Kim S%2E%2C Mudgett M%2EB%2E and Wang%2C Z%2E Y%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Fan, M., Bai, M. Y., Kim, J. G., Wang, T., Oh, E., Chen, L., Park, C.H., Son S., Kim S., Mudgett M.B. and Wang, Z. Y. (2014). The bHLH transcription factor HBI1 mediates the trade-off between growth and pathogen-associated molecular pattern-triggered immunity in Arabidopsis. The Plant Cell Online, 26(2), 828-841.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fan,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The bHLH transcription factor HBI1 mediates the trade-off between growth and pathogen-associated molecular pattern-triggered immunity in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The bHLH transcription factor HBI1 mediates the trade-off between growth and pathogen-associated molecular pattern-triggered immunity in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fan,&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc%2E Natl%2E Acad%2E Sci%2E U%2E S%2E A%5BTitle%5D%29 AND 108%5BVolume%5D AND 20231%5BPagination%5D AND Franklin%2C K%2E A%2E%2C Lee%2C S%2EH%2E%2C Patel%2C D%2E%2C Kumar%2C S%2EV%2E%2C Spartz%2C A%2EK%2E%2C Gu%2C C%2E%2C Ye%2C S%2E%2C Yu%2C P%2E%2C Breen%2C G%2E%2C Cohen%2C J%2ED%2E%2C Wigge%2C P%2EA%2E%2C and Gray%2C W%2EM%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Franklin, K. A., Lee, S.H., Patel, D., Kumar, S.V., Spartz, A.K., Gu, C., Ye, S., Yu, P., Breen, G., Cohen, J.D., Wigge, P.A., and Gray, W.M. (2011). Phytochrome-interacting factor 4 (PIF4) regulates auxin biosynthesis at high temperature. Proc. Natl. Acad. Sci. U. S. A. 108: 20231-5.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Franklin,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Phytochrome-interacting factor 4 (PIF4) regulates auxin biosynthesis at high temperature&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Phytochrome-interacting factor 4 (PIF4) regulates auxin biosynthesis at high temperature&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Franklin,&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28New Phytol%5BTitle%5D%29 AND 179%5BVolume%5D AND 930%5BPagination%5D AND Franklin%2C K%2E A%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Franklin, K. A. (2008). Shade avoidance. New Phytol. 179: 930-944.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Franklin,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Shade avoidance&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Shade avoidance&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Franklin,&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 114%5BVolume%5D AND 295%5BPagination%5D AND Gendreau%2C E%2E%2C Traas%2C J%2E%2C Desnos%2C T%2E%2C Grandjean%2C O%2E%2C Caboche%2C M%2E%2C and H�fte%2C H%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gendreau, E., Traas, J., Desnos, T., Grandjean, O., Caboche, M., and H�fte, H. (1997). Cellular basis of hypocotyl growth in Arabidopsis thaliana. Plant Physiol. 114: 295-305.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gendreau,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Cellular basis of hypocotyl growth in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Cellular basis of hypocotyl growth in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gendreau,&as_ylo=1997&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature%5BTitle%5D%29 AND 460%5BVolume%5D AND 1026%5BPagination%5D AND Hattori%2C Y%2E%2C Nagai%2C K%2E%2C Furukawa%2C S%2E%2C Song%2C X%2E%2C Kawano%2C R%2E%2C Sakakibara%2C H%2E%2C Wu%2C J%2E%2C Matsumoto%2C T%2E%2C Yoshimura%2C A%2E%2C Kitano%2C H%2E%2C Matsuoka%2C M%2E%2C Mori%2C H%2E%2C Ashikari%2C M%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hattori, Y., Nagai, K., Furukawa, S., Song, X., Kawano, R., Sakakibara, H., Wu, J., Matsumoto, T., Yoshimura, A., Kitano, H., Matsuoka, M., Mori, H., Ashikari, M. (2009). The ethylene response factors SNORKEL1 and SNORKEL2 allow rice to adapt to deep water. Nature 460: 1026-1030.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hattori,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The ethylene response factors SNORKEL1 and SNORKEL2 allow rice to adapt to deep water&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The ethylene response factors SNORKEL1 and SNORKEL2 allow rice to adapt to deep water&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hattori,&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc%2E Natl%2E Acad%2E Sci%2E U%2E S%2E A%5BTitle%5D%29 AND 105%5BVolume%5D AND 5632%5BPagination%5D AND Hayashi%2C K%2E%2C Tan%2C X%2E%2C Zheng%2C N%2E%2C Hatate%2C T%2E%2C Kimura%2C Y%2E%2C Kepinski%2C S%2E%2C and Nozaki%2C H%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hayashi, K., Tan, X., Zheng, N., Hatate, T., Kimura, Y., Kepinski, S., and Nozaki, H. (2008). Small-molecule agonists and antagonists of F-box protein-substrate interactions in auxin perception and signaling. Proc. Natl. Acad. Sci. U. S. A. 105: 5632-5637.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hayashi,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Small-molecule agonists and antagonists of F-box protein-substrate interactions in auxin perception and signaling&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Small-molecule agonists and antagonists of F-box protein-substrate interactions in auxin perception and signaling&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hayashi,&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J%2E Exp%2E Bot%5BTitle%5D%29 AND 65%5BVolume%5D AND 2691%5BPagination%5D AND Henriques%2C R%2E%2C B�gre%2C L%2E%2C Horv�th%2C B%2E%2C and Magyar%2C Z%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Henriques, R., B�gre, L., Horv�th, B., and Magyar, Z. (2014). Balancing act: Matching growth with environment by the TOR signalling pathway. J. Exp. Bot. 65: 2691-2701.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Henriques,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Balancing act: Matching growth with environment by the TOR signalling pathway&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Balancing act: Matching growth with environment by the TOR signalling pathway&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Henriques,&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1



phytochrome-regulated petiole elongation of Arabidopsis. Plant Physiol. 138: 1106-1116.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Hong, S.Y., Kim, O.K., Kim, S.G., Yang, M.S., and Park, C.M. (2011). Nuclear import and DNA binding of the ZHD5 transcriptionfactor is modulated by a competitive peptide inhibitor in Arabidopsis. J. Biol. Chem. 286: 1659-1668.


Hu, W. and Ma, H. (2006). Characterization of a novel putative zinc finger gene MIF1: Involvement in multiple hormonal regulationof Arabidopsis development. Plant J. 45: 399-422.


Hyun, Y. and Lee, I. (2006). KIDARI, encoding a non-DNA Binding bHLH protein, represses light signal transduction in Arabidopsisthaliana. Plant Mol. Biol. 61: 283-96.


Iqbal, N., Khan, N. A., Nazar, R., and da Silva, J. A. T. (2012). Ethylene-stimulated photosynthesis results from increased nitrogenand sulfur assimilation in mustard types that differ in photosynthetic capacity. Environ. Exp. Bot. 78: 84-90.


Kazan, K. and Manners, J.M. (2013). MYC2: The master in action. Mol. Plant 6: 686-703.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Keuskamp, D.H., Pollmann, S., Voesenek, L.A.C.J., Peeters, A.J.M., and Pierik, R. (2010). Auxin transport through PIN-FORMED 3(PIN3) controls shade avoidance and fitness during competition. Proc. Natl. Acad. Sci. U. S. A. 107: 22740-22744.


Keuskamp, D.H., Sasidharan, R., Vos, I., Peeters, A.J.M., Voesenek, L.A.C.J., and Pierik, R. (2011). Blue-light-mediated shadeavoidance requires combined auxin and brassinosteroid action in Arabidopsis seedlings. Plant J. 67: 208-217.


Khanna, R., Shen, Y., Marion, C.M., Tsuchisaka, A., Theologis, A., Schafer, E., and Quail, P.H. (2007). The basic helix-loop-helixtranscription factor PIF5 acts on ethylene biosynthesis and phytochrome signaling by distinct mechanisms. Plant Cell. 19: 3915-3929.


Kim, B.C., Soh, M.S., Hong, S.H., Furuya, M., and Nam, H.G. (1998). Photomorphogenic development of the Arabidopsis shy2-1Dmutation and its interaction with phytochromes in darkness. Plant J. 15: 61-68.


Kunihiro, A., Yamashino, T., Nakamichi, N., Niwa, Y., Nakanishi, H., and Mizuno, T. (2011). PHYTOCHROME-INTERACTING FACTOR4 and 5 (PIF4 and PIF5) activate the Homeobox ATHB2 and auxin-inducible IAA29 genes in the coincidence mechanism underlyingphotoperiodic control of plant growth of Arabidopsis thaliana. The Plant Cell Physiol. 52: 1315-1329.


Lee, Y.K., Kim, G., Kim, I., Park, J., Kwak, S., Choi, G., and Chung, W. (2006). LONGIFOLIA1 and LONGIFOLIA2, two homologousgenes, regulate longitudinal cell elongation in Arabidopsis. Development 133: 4305-4314.


Leivar, P. and Monte, E. (2014). PIFs: systems integrators in plant development. The Plant Cell 26: 56-78.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Li, L. et al. (2012). Linking photoreceptor excitation to changes in plant architecture. Genes Dev. 26: 785-790.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title www.plantphysiol.org on July 4, 2016 - Published by www.plantphysiol.orgDownloaded from


http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 138%5BVolume%5D AND 1106%5BPagination%5D AND Hisamatsu%2C T%2E%2C King%2C R%2EW%2E%2C Helliwell%2C C%2E a%2C and Koshioka%2C M%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hisamatsu, T., King, R.W., Helliwell, C. a, and Koshioka, M. (2005). The involvement of Gibberellin 20-Oxidase genes in phytochrome-regulated petiole elongation of Arabidopsis. Plant Physiol. 138: 1106-1116.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hisamatsu,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The involvement of Gibberellin 20-Oxidase genes in phytochrome-regulated petiole elongation of Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The involvement of Gibberellin 20-Oxidase genes in phytochrome-regulated petiole elongation of Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hisamatsu,&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J%2E Biol%2E Chem%5BTitle%5D%29 AND 286%5BVolume%5D AND 1659%5BPagination%5D AND Hong%2C S%2EY%2E%2C Kim%2C O%2EK%2E%2C Kim%2C S%2EG%2E%2C Yang%2C M%2ES%2E%2C and Park%2C C%2EM%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hong, S.Y., Kim, O.K., Kim, S.G., Yang, M.S., and Park, C.M. (2011). Nuclear import and DNA binding of the ZHD5 transcription factor is modulated by a competitive peptide inhibitor in Arabidopsis. J. Biol. Chem. 286: 1659-1668.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hong,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Nuclear import and DNA binding of the ZHD5 transcription factor is modulated by a competitive peptide inhibitor in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Nuclear import and DNA binding of the ZHD5 transcription factor is modulated by a competitive peptide inhibitor in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hong,&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Characterization%5BTitle%5D%29 AND 1%5BVolume%5D AND Involvement in multiple hormonal regulation of Arabidopsis development%2E Plant J%2E 45%3A 399%5BPagination%5D AND Hu%2C W%2E and Ma%2C H%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hu, W. and Ma, H. (2006). Characterization of a novel putative zinc finger gene MIF1: Involvement in multiple hormonal regulation of Arabidopsis development. Plant J. 45: 399-422.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hu,&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hu,&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Mol%2E Biol%5BTitle%5D%29 AND 61%5BVolume%5D AND 283%5BPagination%5D AND Hyun%2C Y%2E and Lee%2C I%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hyun, Y. and Lee, I. (2006). KIDARI, encoding a non-DNA Binding bHLH protein, represses light signal transduction in Arabidopsis thaliana. Plant Mol. Biol. 61: 283-96.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hyun,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=KIDARI, encoding a non-DNA Binding bHLH protein, represses light signal transduction in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=KIDARI, encoding a non-DNA Binding bHLH protein, represses light signal transduction in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hyun,&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Environ%2E Exp%2E Bot%5BTitle%5D%29 AND 78%5BVolume%5D AND 84%5BPagination%5D AND Iqbal%2C N%2E%2C Khan%2C N%2E A%2E%2C Nazar%2C R%2E%2C and da Silva%2C J%2E A%2E T%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Iqbal, N., Khan, N. A., Nazar, R., and da Silva, J. A. T. (2012). Ethylene-stimulated photosynthesis results from increased nitrogen and sulfur assimilation in mustard types that differ in photosynthetic capacity. Environ. Exp. Bot. 78: 84-90.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Iqbal,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene-stimulated photosynthesis results from increased nitrogen and sulfur assimilation in mustard types that differ in photosynthetic capacity&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene-stimulated photosynthesis results from increased nitrogen and sulfur assimilation in mustard types that differ in photosynthetic capacity&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Iqbal,&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28MYC%5BTitle%5D%29 AND 2%5BVolume%5D AND The master in action%2E Mol%2E Plant 6%3A 686%5BPagination%5D AND Kazan%2C K%2E and Manners%2C J%2EM%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kazan, K. and Manners, J.M. (2013). MYC2: The master in action. Mol. Plant 6: 686-703.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kazan,&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kazan,&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc%2E Natl%2E Acad%2E Sci%2E U%2E S%2E A%5BTitle%5D%29 AND 107%5BVolume%5D AND 22740%5BPagination%5D AND Keuskamp%2C D%2EH%2E%2C Pollmann%2C S%2E%2C Voesenek%2C L%2EA%2EC%2EJ%2E%2C Peeters%2C A%2EJ%2EM%2E%2C and Pierik%2C R%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Keuskamp, D.H., Pollmann, S., Voesenek, L.A.C.J., Peeters, A.J.M., and Pierik, R. (2010). Auxin transport through PIN-FORMED 3 (PIN3) controls shade avoidance and fitness during competition. Proc. Natl. Acad. Sci. U. S. A. 107: 22740-22744.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Keuskamp,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Auxin transport through PIN-FORMED 3 (PIN3) controls shade avoidance and fitness during competition&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Auxin transport through PIN-FORMED 3 (PIN3) controls shade avoidance and fitness during competition&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Keuskamp,&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 67%5BVolume%5D AND 208%5BPagination%5D AND Keuskamp%2C D%2EH%2E%2C Sasidharan%2C R%2E%2C Vos%2C I%2E%2C Peeters%2C A%2EJ%2EM%2E%2C Voesenek%2C L%2EA%2EC%2EJ%2E%2C and Pierik%2C R%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Keuskamp, D.H., Sasidharan, R., Vos, I., Peeters, A.J.M., Voesenek, L.A.C.J., and Pierik, R. (2011). Blue-light-mediated shade avoidance requires combined auxin and brassinosteroid action in Arabidopsis seedlings. Plant J. 67: 208-217.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Keuskamp,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Blue-light-mediated shade avoidance requires combined auxin and brassinosteroid action in Arabidopsis seedlings&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Blue-light-mediated shade avoidance requires combined auxin and brassinosteroid action in Arabidopsis seedlings&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Keuskamp,&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 19%5BVolume%5D AND 3915%5BPagination%5D AND Khanna%2C R%2E%2C Shen%2C Y%2E%2C Marion%2C C%2EM%2E%2C Tsuchisaka%2C A%2E%2C Theologis%2C A%2E%2C Schafer%2C E%2E%2C and Quail%2C P%2EH%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Khanna, R., Shen, Y., Marion, C.M., Tsuchisaka, A., Theologis, A., Schafer, E., and Quail, P.H. (2007). The basic helix-loop-helix transcription factor PIF5 acts on ethylene biosynthesis and phytochrome signaling by distinct mechanisms. Plant Cell. 19: 3915-3929.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Khanna,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The basic helix-loop-helix transcription factor PIF5 acts on ethylene biosynthesis and phytochrome signaling by distinct mechanisms&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The basic helix-loop-helix transcription factor PIF5 acts on ethylene biosynthesis and phytochrome signaling by distinct mechanisms&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Khanna,&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 15%5BVolume%5D AND 61%5BPagination%5D AND Kim%2C B%2EC%2E%2C Soh%2C M%2ES%2E%2C Hong%2C S%2EH%2E%2C Furuya%2C M%2E%2C and Nam%2C H%2EG%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kim, B.C., Soh, M.S., Hong, S.H., Furuya, M., and Nam, H.G. (1998). Photomorphogenic development of the Arabidopsis shy2-1D mutation and its interaction with phytochromes in darkness. Plant J. 15: 61-68.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kim,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Photomorphogenic development of the Arabidopsis shy2-1D mutation and its interaction with phytochromes in darkness&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Photomorphogenic development of the Arabidopsis shy2-1D mutation and its interaction with phytochromes in darkness&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kim,&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28The Plant Cell Physiol%5BTitle%5D%29 AND 52%5BVolume%5D AND 1315%5BPagination%5D AND Kunihiro%2C A%2E%2C Yamashino%2C T%2E%2C Nakamichi%2C N%2E%2C Niwa%2C Y%2E%2C Nakanishi%2C H%2E%2C and Mizuno%2C T%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kunihiro, A., Yamashino, T., Nakamichi, N., Niwa, Y., Nakanishi, H., and Mizuno, T. (2011). PHYTOCHROME-INTERACTING FACTOR 4 and 5 (PIF4 and PIF5) activate the Homeobox ATHB2 and auxin-inducible IAA29 genes in the coincidence mechanism underlying photoperiodic control of plant growth of Arabidopsis thaliana. The Plant Cell Physiol. 52: 1315-1329.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kunihiro,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=PHYTOCHROME-INTERACTING FACTOR 4 and 5 (PIF4 and PIF5) activate the Homeobox ATHB2 and auxin-inducible IAA29 genes in the coincidence mechanism underlying photoperiodic control of plant growth of Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=PHYTOCHROME-INTERACTING FACTOR 4 and 5 (PIF4 and PIF5) activate the Homeobox ATHB2 and auxin-inducible IAA29 genes in the coincidence mechanism underlying photoperiodic control of plant growth of Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kunihiro,&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28LONGIFOLIA%5BTitle%5D%29 AND 2%5BVolume%5D AND two homologous genes%2C regulate longitudinal cell elongation in Arabidopsis%2E Development 133%3A 4305%5BPagination%5D AND Lee%2C Y%2EK%2E%2C Kim%2C G%2E%2C Kim%2C I%2E%2C Park%2C J%2E%2C Kwak%2C S%2E%2C Choi%2C G%2E%2C and Chung%2C W%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lee, Y.K., Kim, G., Kim, I., Park, J., Kwak, S., Choi, G., and Chung, W. (2006). LONGIFOLIA1 and LONGIFOLIA2, two homologous genes, regulate longitudinal cell elongation in Arabidopsis. Development 133: 4305-4314.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lee,&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee,&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28The Plant Cell%5BTitle%5D%29 AND 26%5BVolume%5D AND 56%5BPagination%5D AND Leivar%2C P%2E and Monte%2C E%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Leivar, P. and Monte, E. (2014). PIFs: systems integrators in plant development. The Plant Cell 26: 56-78.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Leivar,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=PIFs: systems integrators in plant development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=PIFs: systems integrators in plant development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Leivar,&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Genes Dev%5BTitle%5D%29 AND 26%5BVolume%5D AND 785%5BPagination%5D AND Li%2C L%2E et al%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li, L. et al. (2012). Linking photoreceptor excitation to changes in plant architecture. Genes Dev. 26: 785-790.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Li,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Linking photoreceptor excitation to changes in plant architecture&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Linking photoreceptor excitation to changes in plant architecture&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li,&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1



Lilley, J.L.S., Gee, C.W., Sairanen, I., Ljung, K., and Nemhauser, J.L. (2012). An Endogenous Carbon-Sensing Pathway TriggersIncreased Auxin Flux and Hypocotyl Elongation. Plant Physiol. 160: 2261-2270.


Mickelbart, M. V., Hasegawa, P.M., and Bailey-Serres, J. (2015). Genetic mechanisms of abiotic stress tolerance that translate tocrop yield stability. Nat. Rev. Genet. 16: 237-251.


Morelli, G., Ruberti, I., Molecolare, B., Sapienza, L., and Moro, P.A. (2000). Update on Light Signaling Shade Avoidance Responses.Driving Auxin along Lateral Routes. Plant Physiol. 122: 621-626.


Neff, M.M., Nguyen, S.M., Malancharuvil, E.J., Fujioka, S., Noguchi, T., Seto, H., Tsubuki, M., Honda, T., Takatsuto, S., Yoshida, S.,and Chory, J. (1999). BAS1: A gene regulating brassinosteroid levels and light responsiveness in Arabidopsis. Proc. Natl. Acad.Sci. 96: 15316-15323.


Nemhauser, J.L., Mockler, T.C., and Chory, J. (2004). Interdependency of brassinosteroid and auxin signaling in Arabidopsis. PLoSBiol. 2: E258.


Nishimura, T., Hayashi, K.I., Suzuki, H., Gyohda, A., Takaoka, C., Sakaguchi, Y., Matsumoto, S., Kasahara, H., Sakai, T., Kato, J.I.,Kamiya, Y., and Koshiba, T. (2014). Yucasin is a potent inhibitor of YUCCA, a key enzyme in auxin biosynthesis. Plant J. 77: 352-366.


Nomura, T., Kushiro, T., Yokota, T., Kamiya, Y., Bishop, G.J., and Yamaguchi, S. (2005). The last reaction producing brassinolide iscatalyzed by cytochrome P-450s, CYP85A3 in tomato and CYP85A2 in Arabidopsis. J. Biol. Chem. 280: 17873-17879.


Nozue, K., Tat, A. V., Kumar Devisetty, U., Robinson, M., Mumbach, M.R., Ichihashi, Y., Lekkala, S., and Maloof, J.N. (2015). ShadeAvoidance Components and Pathways in Adult Plants Revealed by Phenotypic Profiling. PLOS Genet. 11: e1004953.


Osakabe, Y., Osakabe, K., Shinozaki, K., and Tran, L. S. P. (2014). Response of plants to water stress. Front. Plant Sci. 5(86): 10-3389.


Park, E., Park, J., Kim, J., Nagatani, A., Lagarias, J.C., and Choi, G. (2012). Phytochrome B inhibits binding of phytochrome-interacting factors to their target promoters. Plant J. 72: 537-546.


Petrásek, J., Cerná, A., Schwarzerová, K., Elckner, M., Morris, D. A., and Zazímalová, E. (2003). Do phytotropins inhibit auxin effluxby impairing vesicle traffic? Plant Physiol. 131: 254-263.


Pfeiffer, A., Shi, H., Tepperman, J.M., Zhang, Y., and Quail, P.H. (2014). Combinatorial Complexity in a Transcriptionally CenteredSignaling Hub in Arabidopsis. Mol. Plant 7: 1598-1618.


Philippar, K., Ivashikina, N., Ache, P., Christian, M., Lüthen, H., Palme, K., and Hedrich, R. (2004). Auxin activates KAT1 and KAT2,two K+-channel genes expressed in seedlings of Arabidopsis thaliana. Plant J. 37: 815-827.



http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 160%5BVolume%5D AND 2261%5BPagination%5D AND Lilley%2C J%2EL%2ES%2E%2C Gee%2C C%2EW%2E%2C Sairanen%2C I%2E%2C Ljung%2C K%2E%2C and Nemhauser%2C J%2EL%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lilley, J.L.S., Gee, C.W., Sairanen, I., Ljung, K., and Nemhauser, J.L. (2012). An Endogenous Carbon-Sensing Pathway Triggers Increased Auxin Flux and Hypocotyl Elongation. Plant Physiol. 160: 2261-2270.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lilley,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=An Endogenous Carbon-Sensing Pathway Triggers Increased Auxin Flux and Hypocotyl Elongation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=An Endogenous Carbon-Sensing Pathway Triggers Increased Auxin Flux and Hypocotyl Elongation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lilley,&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nat%2E Rev%2E Genet%5BTitle%5D%29 AND 16%5BVolume%5D AND 237%5BPagination%5D AND Mickelbart%2C M%2E V%2E%2C Hasegawa%2C P%2EM%2E%2C and Bailey%2DSerres%2C J%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mickelbart, M. V., Hasegawa, P.M., and Bailey-Serres, J. (2015). Genetic mechanisms of abiotic stress tolerance that translate to crop yield stability. Nat. Rev. Genet. 16: 237-251.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mickelbart,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Genetic mechanisms of abiotic stress tolerance that translate to crop yield stability&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Genetic mechanisms of abiotic stress tolerance that translate to crop yield stability&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mickelbart,&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Driving Auxin along Lateral Routes%2E Plant Physiol%5BTitle%5D%29 AND 122%5BVolume%5D AND 621%5BPagination%5D AND Morelli%2C G%2E%2C Ruberti%2C I%2E%2C Molecolare%2C B%2E%2C Sapienza%2C L%2E%2C and Moro%2C P%2EA%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Morelli, G., Ruberti, I., Molecolare, B., Sapienza, L., and Moro, P.A. (2000). Update on Light Signaling Shade Avoidance Responses. Driving Auxin along Lateral Routes. Plant Physiol. 122: 621-626.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Morelli,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Update on Light Signaling Shade Avoidance Responses&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Update on Light Signaling Shade Avoidance Responses&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Morelli,&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28BAS%5BTitle%5D%29 AND 1%5BVolume%5D AND A gene regulating brassinosteroid levels and light responsiveness in Arabidopsis%2E Proc%2E Natl%2E Acad%2E Sci%2E 96%3A 15316%5BPagination%5D AND Neff%2C M%2EM%2E%2C Nguyen%2C S%2EM%2E%2C Malancharuvil%2C E%2EJ%2E%2C Fujioka%2C S%2E%2C Noguchi%2C T%2E%2C Seto%2C H%2E%2C Tsubuki%2C M%2E%2C Honda%2C T%2E%2C Takatsuto%2C S%2E%2C Yoshida%2C S%2E%2C and Chory%2C J%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Neff, M.M., Nguyen, S.M., Malancharuvil, E.J., Fujioka, S., Noguchi, T., Seto, H., Tsubuki, M., Honda, T., Takatsuto, S., Yoshida, S., and Chory, J. (1999). BAS1: A gene regulating brassinosteroid levels and light responsiveness in Arabidopsis. Proc. Natl. Acad. Sci. 96: 15316-15323.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Neff,&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Neff,&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28PLoS Biol%5BTitle%5D%29 AND 2%5BVolume%5D AND 258%5BPagination%5D AND Nemhauser%2C J%2EL%2E%2C Mockler%2C T%2EC%2E%2C and Chory%2C J%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Nemhauser, J.L., Mockler, T.C., and Chory, J. (2004). Interdependency of brassinosteroid and auxin signaling in Arabidopsis. PLoS Biol. 2: E258.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nemhauser,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Interdependency of brassinosteroid and auxin signaling in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Interdependency of brassinosteroid and auxin signaling in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nemhauser,&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 77%5BVolume%5D AND 352%5BPagination%5D AND Nishimura%2C T%2E%2C Hayashi%2C K%2EI%2E%2C Suzuki%2C H%2E%2C Gyohda%2C A%2E%2C Takaoka%2C C%2E%2C Sakaguchi%2C Y%2E%2C Matsumoto%2C S%2E%2C Kasahara%2C H%2E%2C Sakai%2C T%2E%2C Kato%2C J%2EI%2E%2C Kamiya%2C Y%2E%2C and Koshiba%2C T%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Nishimura, T., Hayashi, K.I., Suzuki, H., Gyohda, A., Takaoka, C., Sakaguchi, Y., Matsumoto, S., Kasahara, H., Sakai, T., Kato, J.I., Kamiya, Y., and Koshiba, T. (2014). Yucasin is a potent inhibitor of YUCCA, a key enzyme in auxin biosynthesis. Plant J. 77: 352-366.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nishimura,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Yucasin is a potent inhibitor of YUCCA, a key enzyme in auxin biosynthesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Yucasin is a potent inhibitor of YUCCA, a key enzyme in auxin biosynthesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nishimura,&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J%2E Biol%2E Chem%5BTitle%5D%29 AND 280%5BVolume%5D AND 17873%5BPagination%5D AND Nomura%2C T%2E%2C Kushiro%2C T%2E%2C Yokota%2C T%2E%2C Kamiya%2C Y%2E%2C Bishop%2C G%2EJ%2E%2C and Yamaguchi%2C S%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Nomura, T., Kushiro, T., Yokota, T., Kamiya, Y., Bishop, G.J., and Yamaguchi, S. (2005). The last reaction producing brassinolide is catalyzed by cytochrome P-450s, CYP85A3 in tomato and CYP85A2 in Arabidopsis. J. Biol. Chem. 280: 17873-17879.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nomura,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The last reaction producing brassinolide is catalyzed by cytochrome P-450s, CYP85A3 in tomato and CYP85A2 in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The last reaction producing brassinolide is catalyzed by cytochrome P-450s, CYP85A3 in tomato and CYP85A2 in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nomura,&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28PLOS Genet%5BTitle%5D%29 AND 11%5BVolume%5D AND 1004953%5BPagination%5D AND Nozue%2C K%2E%2C Tat%2C A%2E V%2E%2C Kumar Devisetty%2C U%2E%2C Robinson%2C M%2E%2C Mumbach%2C M%2ER%2E%2C Ichihashi%2C Y%2E%2C Lekkala%2C S%2E%2C and Maloof%2C J%2EN%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Nozue, K., Tat, A. V., Kumar Devisetty, U., Robinson, M., Mumbach, M.R., Ichihashi, Y., Lekkala, S., and Maloof, J.N. (2015). Shade Avoidance Components and Pathways in Adult Plants Revealed by Phenotypic Profiling. PLOS Genet. 11: e1004953.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nozue,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Shade Avoidance Components and Pathways in Adult Plants Revealed by Phenotypic Profiling&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Shade Avoidance Components and Pathways in Adult Plants Revealed by Phenotypic Profiling&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nozue,&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Front%2E Plant Sci%5BTitle%5D%29 AND 5%5BVolume%5D AND 10%5BPagination%5D AND Osakabe%2C Y%2E%2C Osakabe%2C K%2E%2C Shinozaki%2C K%2E%2C and Tran%2C L%2E S%2E P%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Osakabe, Y., Osakabe, K., Shinozaki, K., and Tran, L. S. P. (2014). Response of plants to water stress. Front. Plant Sci. 5(86): 10-3389.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Osakabe,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Response of plants to water stress&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Response of plants to water stress&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Osakabe,&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 72%5BVolume%5D AND 537%5BPagination%5D AND Park%2C E%2E%2C Park%2C J%2E%2C Kim%2C J%2E%2C Nagatani%2C A%2E%2C Lagarias%2C J%2EC%2E%2C and Choi%2C G%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Park, E., Park, J., Kim, J., Nagatani, A., Lagarias, J.C., and Choi, G. (2012). Phytochrome B inhibits binding of phytochrome-interacting factors to their target promoters. Plant J. 72: 537-546.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Park,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Phytochrome B inhibits binding of phytochrome-interacting factors to their target promoters&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Phytochrome B inhibits binding of phytochrome-interacting factors to their target promoters&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Park,&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 131%5BVolume%5D AND 254%5BPagination%5D AND Petr�sek%2C J%2E%2C Cern�%2C A%2E%2C Schwarzerov�%2C K%2E%2C Elckner%2C M%2E%2C Morris%2C D%2E A%2E%2C and Zaz�malov�%2C E%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Petr�sek, J., Cern�, A., Schwarzerov�, K., Elckner, M., Morris, D. A., and Zaz�malov�, E. (2003). Do phytotropins inhibit auxin efflux by impairing vesicle traffic? Plant Physiol. 131: 254-263.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Petr�sek,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Do phytotropins inhibit auxin efflux by impairing vesicle traffic&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Do phytotropins inhibit auxin efflux by impairing vesicle traffic&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Petr�sek,&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol%2E Plant%5BTitle%5D%29 AND 7%5BVolume%5D AND 1598%5BPagination%5D AND Pfeiffer%2C A%2E%2C Shi%2C H%2E%2C Tepperman%2C J%2EM%2E%2C Zhang%2C Y%2E%2C and Quail%2C P%2EH%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Pfeiffer, A., Shi, H., Tepperman, J.M., Zhang, Y., and Quail, P.H. (2014). Combinatorial Complexity in a Transcriptionally Centered Signaling Hub in Arabidopsis. Mol. Plant 7: 1598-1618.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pfeiffer,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Combinatorial Complexity in a Transcriptionally Centered Signaling Hub in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Combinatorial Complexity in a Transcriptionally Centered Signaling Hub in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pfeiffer,&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Auxin%5BTitle%5D%29 AND 2%5BVolume%5D AND Philippar%2C K%2E%2C Ivashikina%2C N%2E%2C Ache%2C P%2E%2C Christian%2C M%2E%2C L�then%2C H%2E%2C Palme%2C K%2E%2C and Hedrich%2C R%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Philippar, K., Ivashikina, N., Ache, P., Christian, M., L�then, H., Palme, K., and Hedrich, R. (2004). Auxin activates KAT1 and KAT2, two K+-channel genes expressed in seedlings of Arabidopsis thaliana. Plant J. 37: 815-827.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Philippar,&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Philippar,&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1



Pierik, R., Cuppens, M.L., Voesenek, L.A.C.J. and Visser, E.J. (2004) Interactions between ethylene and gibberellins inphytochrome-mediated shade avoidance responses in tobacco. Plant Physiol. 136: 2928-2936.


Pierik, R., Djakovic-Petrovic, T., Keuskamp, D.H., de Wit, M., and Voesenek, L.A.C.J. (2009). Auxin and ethylene regulate elongationresponses to neighbor proximity signals independent of gibberellin and DELLA proteins in Arabidopsis. Plant Physiol. 149: 1701-1712.


Pierik, R., Millenaar, F.F., Peeters, A. J.M., and Voesenek, L.A.C.J. (2005). New perspectives in flooding research: The use of shadeavoidance and Arabidopsis thaliana. Ann. Bot. 96: 533-540.


Pierik, R. and Testerink, C. (2014). The art of being flexible: how to escape from shade, salt and drought. Plant Physiol. 166: 5-22.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Pierik, R. and De Wit, M. (2014). Shade avoidance: Phytochrome signalling and other aboveground neighbour detection cues. J.Exp. Bot. 65: 2815-2824.


Procko, C., Crenshaw, C.M., Ljung, K., Noel, J.P., and Chory, J. (2014). Cotyledon-Generated Auxin Is Required for Shade-InducedHypocotyl Growth in Brassica rapa. Plant Physiol. 165: 1285-1301.


Quint, M., Delker, C., Franklin, K. A., Wigge, P. A., Halliday, K. J., and van Zanten, M. (2016). Molecular and genetic control of plantthermomorphogenesis. Nature Plants. 2: 15190.


Rademacher, W. (2000). GROWTH RETARDANTS: Effects on Gibberellin Biosynthesis and Other Metabolic Pathways. Annu. Rev.Plant Physiol. Plant Mol. Biol. 51: 501-531.


Rieu, I., Ruiz-Rivero, O., Fernandez-Garcia, N., Griffiths, J., Powers, S.J., Gong, F., Linhartova, T., Eriksson, S., Nilsson, O.,Thomas, S.G., Phillips, A.L., and Hedden, P. (2008). The gibberellin biosynthetic genes AtGA20ox1 and AtGA20ox2 act, partiallyredundantly, to promote growth and development throughout the Arabidopsis life cycle. Plant J. 53: 488-504.


Ruegger, M., Dewey, E., Gray, W.M., Hobbie, L., Turner, J., and Estelle, M. (1998). The TIR1 protein of Arabidopsis functions inauxin response and is related to human SKP2 and yeast Grr1p. Genes Dev. 12: 198-207.


Sasidharan, R., Chinnappa, C.C., Staal, M., Elzenga, J.T.M., Yokoyama, R., Nishitani, K., Voesenek, L.A.C.J., and Pierik, R. (2010).Light quality-mediated petiole elongation in Arabidopsis during shade avoidance involves cell wall modification by xyloglucanendotransglucosylase/hydrolases. Plant Physiol. 154: 978-990.


Sasidharan, R. and Voesenek, L.A.C.J. (2015). Ethylene-mediated acclimations to flooding stress. Plant Physiol.: pp.00387.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Smalle, J., Haegman, M., Kurepa, J., Van Montagu M, and Straeten, D. V (1997). Ethylene can stimulate Arabidopsis hypocotylelongation in the light. Proc. Natl. Acad. Sci. U. S. A. 94: 2756-2761.


Spartz, A.K., Lee, S.H., Wenger, J.P., Gonzalez, N., Itoh, H., Inzé, D., Peer, W.A., Murphy, A.S., Overvoorde, P.J., and Gray, W.M. www.plantphysiol.org on July 4, 2016 - Published by www.plantphysiol.orgDownloaded from


http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 136%5BVolume%5D AND 2928%5BPagination%5D AND Pierik%2C R%2E%2C Cuppens%2C M%2EL%2E%2C Voesenek%2C L%2EA%2EC%2EJ%2E and Visser%2C E%2EJ%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Pierik, R., Cuppens, M.L., Voesenek, L.A.C.J. and Visser, E.J. (2004) Interactions between ethylene and gibberellins in phytochrome-mediated shade avoidance responses in tobacco. Plant Physiol. 136: 2928-2936.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pierik,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Interactions between ethylene and gibberellins in phytochrome-mediated shade avoidance responses in tobacco&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Interactions between ethylene and gibberellins in phytochrome-mediated shade avoidance responses in tobacco&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pierik,&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 149%5BVolume%5D AND 1701%5BPagination%5D AND Pierik%2C R%2E%2C Djakovic%2DPetrovic%2C T%2E%2C Keuskamp%2C D%2EH%2E%2C de Wit%2C M%2E%2C and Voesenek%2C L%2EA%2EC%2EJ%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Pierik, R., Djakovic-Petrovic, T., Keuskamp, D.H., de Wit, M., and Voesenek, L.A.C.J. (2009). Auxin and ethylene regulate elongation responses to neighbor proximity signals independent of gibberellin and DELLA proteins in Arabidopsis. Plant Physiol. 149: 1701-1712.


http://scholar.google.com/scholar?as_q=Auxin and ethylene regulate elongation responses to neighbor proximity signals independent of gibberellin and DELLA proteins in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Auxin and ethylene regulate elongation responses to neighbor proximity signals independent of gibberellin and DELLA proteins in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pierik,&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Ann%2E Bot%5BTitle%5D%29 AND 96%5BVolume%5D AND 533%5BPagination%5D AND Pierik%2C R%2E%2C Millenaar%2C F%2EF%2E%2C Peeters%2C A%2E J%2EM%2E%2C and Voesenek%2C L%2EA%2EC%2EJ%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Pierik, R., Millenaar, F.F., Peeters, A. J.M., and Voesenek, L.A.C.J. (2005). New perspectives in flooding research: The use of shade avoidance and Arabidopsis thaliana. Ann. Bot. 96: 533-540.


http://scholar.google.com/scholar?as_q=New perspectives in flooding research: The use of shade avoidance and Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=New perspectives in flooding research: The use of shade avoidance and Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pierik,&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 166%5BVolume%5D AND 5%5BPagination%5D AND Pierik%2C R%2E and Testerink%2C C%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Pierik, R. and Testerink, C. (2014). The art of being flexible: how to escape from shade, salt and drought. Plant Physiol. 166: 5-22.


http://scholar.google.com/scholar?as_q=The art of being flexible: how to escape from shade, salt and drought&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The art of being flexible: how to escape from shade, salt and drought&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pierik,&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J%2E Exp%2E Bot%5BTitle%5D%29 AND 65%5BVolume%5D AND 2815%5BPagination%5D AND Pierik%2C R%2E and De Wit%2C M%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Pierik, R. and De Wit, M. (2014). Shade avoidance: Phytochrome signalling and other aboveground neighbour detection cues. J. Exp. Bot. 65: 2815-2824.


http://scholar.google.com/scholar?as_q=Shade avoidance: Phytochrome signalling and other aboveground neighbour detection cues&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Shade avoidance: Phytochrome signalling and other aboveground neighbour detection cues&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pierik,&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 165%5BVolume%5D AND 1285%5BPagination%5D AND Procko%2C C%2E%2C Crenshaw%2C C%2EM%2E%2C Ljung%2C K%2E%2C Noel%2C J%2EP%2E%2C and Chory%2C J%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Procko, C., Crenshaw, C.M., Ljung, K., Noel, J.P., and Chory, J. (2014). Cotyledon-Generated Auxin Is Required for Shade-Induced Hypocotyl Growth in Brassica rapa. Plant Physiol. 165: 1285-1301.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Procko,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Cotyledon-Generated Auxin Is Required for Shade-Induced Hypocotyl Growth in Brassica rapa&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Cotyledon-Generated Auxin Is Required for Shade-Induced Hypocotyl Growth in Brassica rapa&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Procko,&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nature Plants%5BTitle%5D%29 AND 2%5BVolume%5D AND 15190%5BPagination%5D AND Quint%2C M%2E%2C Delker%2C C%2E%2C Franklin%2C K%2E A%2E%2C Wigge%2C P%2E A%2E%2C Halliday%2C K%2E J%2E%2C and van Zanten%2C M%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Quint, M., Delker, C., Franklin, K. A., Wigge, P. A., Halliday, K. J., and van Zanten, M. (2016). Molecular and genetic control of plant thermomorphogenesis. Nature Plants. 2: 15190.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Quint,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular and genetic control of plant thermomorphogenesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular and genetic control of plant thermomorphogenesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Quint,&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Annu%2E Rev%2E Plant Physiol%2E Plant Mol%2E Biol%5BTitle%5D%29 AND 51%5BVolume%5D AND 501%5BPagination%5D AND Rademacher%2C W%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Rademacher, W. (2000). GROWTH RETARDANTS: Effects on Gibberellin Biosynthesis and Other Metabolic Pathways. Annu. Rev. Plant Physiol. Plant Mol. Biol. 51: 501-531.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Rademacher,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=GROWTH RETARDANTS: Effects on Gibberellin Biosynthesis and Other Metabolic Pathways&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=GROWTH RETARDANTS: Effects on Gibberellin Biosynthesis and Other Metabolic Pathways&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Rademacher,&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 53%5BVolume%5D AND 488%5BPagination%5D AND Rieu%2C I%2E%2C Ruiz%2DRivero%2C O%2E%2C Fernandez%2DGarcia%2C N%2E%2C Griffiths%2C J%2E%2C Powers%2C S%2EJ%2E%2C Gong%2C F%2E%2C Linhartova%2C T%2E%2C Eriksson%2C S%2E%2C Nilsson%2C O%2E%2C Thomas%2C S%2EG%2E%2C Phillips%2C A%2EL%2E%2C and Hedden%2C P%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Rieu, I., Ruiz-Rivero, O., Fernandez-Garcia, N., Griffiths, J., Powers, S.J., Gong, F., Linhartova, T., Eriksson, S., Nilsson, O., Thomas, S.G., Phillips, A.L., and Hedden, P. (2008). The gibberellin biosynthetic genes AtGA20ox1 and AtGA20ox2 act, partially redundantly, to promote growth and development throughout the Arabidopsis life cycle. Plant J. 53: 488-504.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Rieu,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The gibberellin biosynthetic genes AtGA20ox1 and AtGA20ox2 act, partially redundantly, to promote growth and development throughout the Arabidopsis life cycle&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The gibberellin biosynthetic genes AtGA20ox1 and AtGA20ox2 act, partially redundantly, to promote growth and development throughout the Arabidopsis life cycle&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Rieu,&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Genes Dev%5BTitle%5D%29 AND 12%5BVolume%5D AND 198%5BPagination%5D AND Ruegger%2C M%2E%2C Dewey%2C E%2E%2C Gray%2C W%2EM%2E%2C Hobbie%2C L%2E%2C Turner%2C J%2E%2C and Estelle%2C M%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ruegger, M., Dewey, E., Gray, W.M., Hobbie, L., Turner, J., and Estelle, M. (1998). The TIR1 protein of Arabidopsis functions in auxin response and is related to human SKP2 and yeast Grr1p. Genes Dev. 12: 198-207.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ruegger,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The TIR1 protein of Arabidopsis functions in auxin response and is related to human SKP2 and yeast Grr1p&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The TIR1 protein of Arabidopsis functions in auxin response and is related to human SKP2 and yeast Grr1p&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ruegger,&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 154%5BVolume%5D AND 978%5BPagination%5D AND Sasidharan%2C R%2E%2C Chinnappa%2C C%2EC%2E%2C Staal%2C M%2E%2C Elzenga%2C J%2ET%2EM%2E%2C Yokoyama%2C R%2E%2C Nishitani%2C K%2E%2C Voesenek%2C L%2EA%2EC%2EJ%2E%2C and Pierik%2C R%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sasidharan, R., Chinnappa, C.C., Staal, M., Elzenga, J.T.M., Yokoyama, R., Nishitani, K., Voesenek, L.A.C.J., and Pierik, R. (2010). Light quality-mediated petiole elongation in Arabidopsis during shade avoidance involves cell wall modification by xyloglucan endotransglucosylase/hydrolases. Plant Physiol. 154: 978-990.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sasidharan,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Light quality-mediated petiole elongation in Arabidopsis during shade avoidance involves cell wall modification by xyloglucan endotransglucosylase/hydrolases&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Light quality-mediated petiole elongation in Arabidopsis during shade avoidance involves cell wall modification by xyloglucan endotransglucosylase/hydrolases&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sasidharan,&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Ethylene%2Dmediated acclimations to flooding stress%2E%5BTitle%5D%29 AND Sasidharan%2C R%2E and Voesenek%2C L%2EA%2EC%2EJ%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sasidharan, R. and Voesenek, L.A.C.J. (2015). Ethylene-mediated acclimations to flooding stress. Plant Physiol.: pp.00387.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sasidharan,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene-mediated acclimations to flooding stress.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene-mediated acclimations to flooding stress.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sasidharan,&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc%2E Natl%2E Acad%2E Sci%2E U%2E S%2E A%5BTitle%5D%29 AND 94%5BVolume%5D AND 2756%5BPagination%5D AND Smalle%2C J%2E%2C Haegman%2C M%2E%2C Kurepa%2C J%2E%2C Van Montagu M%2C and Straeten%2C D%2E V%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Smalle, J., Haegman, M., Kurepa, J., Van Montagu M, and Straeten, D. V (1997). Ethylene can stimulate Arabidopsis hypocotyl elongation in the light. Proc. Natl. Acad. Sci. U. S. A. 94: 2756-2761.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Smalle,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene can stimulate Arabidopsis hypocotyl elongation in the light&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene can stimulate Arabidopsis hypocotyl elongation in the light&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Smalle,&as_ylo=1997&as_allsubj=all&hl=en&c2coff=1



(2012). The SAUR19 subfamily of SMALL AUXIN UP RNA genes promote cell expansion. Plant J. 70: 978-990.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Stepanova, A.N., Robertson-Hoyt, J., Yun, J., Benavente, L.M., Xie, D.Y., Doležal, K., Schlereth, A., Jürgens, G., and Alonso, J.M.(2008). TAA1-Mediated Auxin Biosynthesis Is Essential for Hormone Crosstalk and Plant Development. Cell 133: 177-191.


Sulpice, R., Flis, A., Ivakov, A. A., Apelt, F., Krohn, N., Encke, B., Abel, C., Feil, R., Lunn, J.E., and Stitt, M. (2014). Arabidopsiscoordinates the diurnal regulation of carbon allocation and growth across a wide range of Photoperiods. Mol. Plant 7: 137-155.


Sun, J., Qi, L., Li, Y., Chu, J., and Li, C. (2012). PIF4-mediated activation of YUCCA8 expression integrates temperature into theauxin pathway in regulating Arabidopsis hypocotyl growth. PLoS Genet. 8: e1002594.


Tabas-Madrid, D., Nogales-Cadenas, R., and Pascual-Montano, A. (2012). GeneCodis 3: a non-redundant and modular enrichmentanalysis tool for functional genomics. Nucleic Acids Res. 40: W478-W483.


Talon, M., Koornneef, M., and Zeevaart, J. A. D. (1990). Accumulation of C19-gibberellins in the gibberellin-insensitive dwarf mutantgai of Arabidopsis thaliana (L.) Heynh. Planta 182: 501-505.


Tanaka, S., Nakamura, S., Mochizuki, N., and Nagatani, A. (2002). Phytochrome in cotyledons regulates the expression of genes inthe hypocotyl through auxin-dependent and -independent pathways. The Plant Cell Physiol. 43: 1171-1181.


Tao, Y., Ferrer, J.L., Ljung, K., Pojer, F., Hong, F., Long, J.A., Li, L., Moreno, J.E., Bowman, M.E., Ivans, L.J., Cheng, Y., Lim, J., Zhao,Y., Ballaré, C.L., Sandberg, G., Noel, J.P. and Chory, J. (2008). Rapid Synthesis of Auxin via a New Tryptophan-Dependent PathwayIs Required for Shade Avoidance in Plants. Cell 133: 164-176.


Tholen, D., Pons, T.L., Voesenek, L.A.C.J., and Poorter, H. (2007). Ethylene insensitivity results in down-regulation of rubiscoexpression and photosynthetic capacity in tobacco. Plant Physiol. 144: 1305-1315.


Turk, E.M. et al. (2005). BAS1 and SOB7 act redundantly to modulate Arabidopsis photomorphogenesis via unique brassinosteroidinactivation mechanisms. Plant J. 42: 23-34.


Unterholzner, S.J., Rozhon, W., Papacek, M., Ciomas, J., Lange, T., Kugler, K.G., Mayer, K.F., Sieberer, T., and Poppenberger, B.(2015). Brassinosteroids Are Master Regulators of Gibberellin Biosynthesis in Arabidopsis. The Plant Cell 27: 2261-2272.


Van Esse, G.W., van Mourik, S., Stigter, H., ten Hove, C. a., Molenaar, J., and de Vries, S.C. (2012). A Mathematical Model forBRASSINOSTEROID INSENSITIVE1-Mediated Signaling in Root Growth and Hypocotyl Elongation. Plant Physiol. 160: 523-532.


Vandenbussche, F., Pierik, R., Millenaar, F.F., Voesenek, L.A.C.J., and Van Der Straeten, D. (2005). Reaching out of the shade. Curr.Opin. Plant Biol. 8: 462-468.


van Veen, H., Mustroph, A., Barding, G.A., Vergeer-van Eijk, M., Welschen-Evertman, R.A.M., Pedersen, O., Visser, E.J.W., Larive,C.K., Pierik, R., Bailey-Serres, J., Voesenek, L.A.C.J., and Sasidharan, R. (2013). Two Rumex species from contrasting hydrological


http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 70%5BVolume%5D AND 978%5BPagination%5D AND Spartz%2C A%2EK%2E%2C Lee%2C S%2EH%2E%2C Wenger%2C J%2EP%2E%2C Gonzalez%2C N%2E%2C Itoh%2C H%2E%2C Inz�%2C D%2E%2C Peer%2C W%2EA%2E%2C Murphy%2C A%2ES%2E%2C Overvoorde%2C P%2EJ%2E%2C and Gray%2C W%2EM%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Spartz, A.K., Lee, S.H., Wenger, J.P., Gonzalez, N., Itoh, H., Inz�, D., Peer, W.A., Murphy, A.S., Overvoorde, P.J., and Gray, W.M. (2012). The SAUR19 subfamily of SMALL AUXIN UP RNA genes promote cell expansion. Plant J. 70: 978-990.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Spartz,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The SAUR19 subfamily of SMALL AUXIN UP RNA genes promote cell expansion&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The SAUR19 subfamily of SMALL AUXIN UP RNA genes promote cell expansion&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Spartz,&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Cell%5BTitle%5D%29 AND 133%5BVolume%5D AND 177%5BPagination%5D AND Stepanova%2C A%2EN%2E%2C Robertson%2DHoyt%2C J%2E%2C Yun%2C J%2E%2C Benavente%2C L%2EM%2E%2C Xie%2C D%2EY%2E%2C Dole?al%2C K%2E%2C Schlereth%2C A%2E%2C J�rgens%2C G%2E%2C and Alonso%2C J%2EM%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Stepanova, A.N., Robertson-Hoyt, J., Yun, J., Benavente, L.M., Xie, D.Y., Dole?al, K., Schlereth, A., J�rgens, G., and Alonso, J.M. (2008). TAA1-Mediated Auxin Biosynthesis Is Essential for Hormone Crosstalk and Plant Development. Cell 133: 177-191.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Stepanova,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=TAA1-Mediated Auxin Biosynthesis Is Essential for Hormone Crosstalk and Plant Development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=TAA1-Mediated Auxin Biosynthesis Is Essential for Hormone Crosstalk and Plant Development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Stepanova,&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol%2E Plant%5BTitle%5D%29 AND 7%5BVolume%5D AND 137%5BPagination%5D AND Sulpice%2C R%2E%2C Flis%2C A%2E%2C Ivakov%2C A%2E A%2E%2C Apelt%2C F%2E%2C Krohn%2C N%2E%2C Encke%2C B%2E%2C Abel%2C C%2E%2C Feil%2C R%2E%2C Lunn%2C J%2EE%2E%2C and Stitt%2C M%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sulpice, R., Flis, A., Ivakov, A. A., Apelt, F., Krohn, N., Encke, B., Abel, C., Feil, R., Lunn, J.E., and Stitt, M. (2014). Arabidopsis coordinates the diurnal regulation of carbon allocation and growth across a wide range of Photoperiods. Mol. Plant 7: 137-155.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sulpice,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis coordinates the diurnal regulation of carbon allocation and growth across a wide range of Photoperiods&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Arabidopsis coordinates the diurnal regulation of carbon allocation and growth across a wide range of Photoperiods&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sulpice,&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28PLoS Genet%5BTitle%5D%29 AND 8%5BVolume%5D AND 1002594%5BPagination%5D AND Sun%2C J%2E%2C Qi%2C L%2E%2C Li%2C Y%2E%2C Chu%2C J%2E%2C and Li%2C C%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sun, J., Qi, L., Li, Y., Chu, J., and Li, C. (2012). PIF4-mediated activation of YUCCA8 expression integrates temperature into the auxin pathway in regulating Arabidopsis hypocotyl growth. PLoS Genet. 8: e1002594.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sun,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=PIF4-mediated activation of YUCCA8 expression integrates temperature into the auxin pathway in regulating Arabidopsis hypocotyl growth&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=PIF4-mediated activation of YUCCA8 expression integrates temperature into the auxin pathway in regulating Arabidopsis hypocotyl growth&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sun,&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28GeneCodis%5BTitle%5D%29 AND 3%5BVolume%5D AND Tabas%2DMadrid%2C D%2E%2C Nogales%2DCadenas%2C R%2E%2C and Pascual%2DMontano%2C A%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tabas-Madrid, D., Nogales-Cadenas, R., and Pascual-Montano, A. (2012). GeneCodis 3: a non-redundant and modular enrichment analysis tool for functional genomics. Nucleic Acids Res. 40: W478-W483.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tabas-Madrid,&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tabas-Madrid,&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28 Heynh%2E Planta%5BTitle%5D%29 AND 182%5BVolume%5D AND 501%5BPagination%5D AND Talon%2C M%2E%2C Koornneef%2C M%2E%2C and Zeevaart%2C J%2E A%2E D%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Talon, M., Koornneef, M., and Zeevaart, J. A. D. (1990). Accumulation of C19-gibberellins in the gibberellin-insensitive dwarf mutant gai of Arabidopsis thaliana (L.) Heynh. Planta 182: 501-505.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Talon,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Accumulation of C19-gibberellins in the gibberellin-insensitive dwarf mutant gai of Arabidopsis thaliana (L&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Accumulation of C19-gibberellins in the gibberellin-insensitive dwarf mutant gai of Arabidopsis thaliana (L&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Talon,&as_ylo=1990&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28The Plant Cell Physiol%5BTitle%5D%29 AND 43%5BVolume%5D AND 1171%5BPagination%5D AND Tanaka%2C S%2E%2C Nakamura%2C S%2E%2C Mochizuki%2C N%2E%2C and Nagatani%2C A%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tanaka, S., Nakamura, S., Mochizuki, N., and Nagatani, A. (2002). Phytochrome in cotyledons regulates the expression of genes in the hypocotyl through auxin-dependent and -independent pathways. The Plant Cell Physiol. 43: 1171-1181.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tanaka,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Phytochrome in cotyledons regulates the expression of genes in the hypocotyl through auxin-dependent and -independent pathways&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Phytochrome in cotyledons regulates the expression of genes in the hypocotyl through auxin-dependent and -independent pathways&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tanaka,&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Cell%5BTitle%5D%29 AND 133%5BVolume%5D AND 164%5BPagination%5D AND Tao%2C Y%2E%2C Ferrer%2C J%2EL%2E%2C Ljung%2C K%2E%2C Pojer%2C F%2E%2C Hong%2C F%2E%2C Long%2C J%2EA%2E%2C Li%2C L%2E%2C Moreno%2C J%2EE%2E%2C Bowman%2C M%2EE%2E%2C Ivans%2C L%2EJ%2E%2C Cheng%2C Y%2E%2C Lim%2C J%2E%2C Zhao%2C Y%2E%2C Ballar�%2C C%2EL%2E%2C Sandberg%2C G%2E%2C Noel%2C J%2EP%2E and Chory%2C J%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tao, Y., Ferrer, J.L., Ljung, K., Pojer, F., Hong, F., Long, J.A., Li, L., Moreno, J.E., Bowman, M.E., Ivans, L.J., Cheng, Y., Lim, J., Zhao, Y., Ballar�, C.L., Sandberg, G., Noel, J.P. and Chory, J. (2008). Rapid Synthesis of Auxin via a New Tryptophan-Dependent Pathway Is Required for Shade Avoidance in Plants. Cell 133: 164-176.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tao,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Rapid Synthesis of Auxin via a New Tryptophan-Dependent Pathway Is Required for Shade Avoidance in Plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Rapid Synthesis of Auxin via a New Tryptophan-Dependent Pathway Is Required for Shade Avoidance in Plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tao,&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 144%5BVolume%5D AND 1305%5BPagination%5D AND Tholen%2C D%2E%2C Pons%2C T%2EL%2E%2C Voesenek%2C L%2EA%2EC%2EJ%2E%2C and Poorter%2C H%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Tholen, D., Pons, T.L., Voesenek, L.A.C.J., and Poorter, H. (2007). Ethylene insensitivity results in down-regulation of rubisco expression and photosynthetic capacity in tobacco. Plant Physiol. 144: 1305-1315.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tholen,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene insensitivity results in down-regulation of rubisco expression and photosynthetic capacity in tobacco&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene insensitivity results in down-regulation of rubisco expression and photosynthetic capacity in tobacco&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tholen,&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 42%5BVolume%5D AND 23%5BPagination%5D AND Turk%2C E%2EM%2E et al%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Turk, E.M. et al. (2005). BAS1 and SOB7 act redundantly to modulate Arabidopsis photomorphogenesis via unique brassinosteroid inactivation mechanisms. Plant J. 42: 23-34.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Turk,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=BAS1 and SOB7 act redundantly to modulate Arabidopsis photomorphogenesis via unique brassinosteroid inactivation mechanisms&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=BAS1 and SOB7 act redundantly to modulate Arabidopsis photomorphogenesis via unique brassinosteroid inactivation mechanisms&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Turk,&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28The Plant Cell%5BTitle%5D%29 AND 27%5BVolume%5D AND 2261%5BPagination%5D AND Unterholzner%2C S%2EJ%2E%2C Rozhon%2C W%2E%2C Papacek%2C M%2E%2C Ciomas%2C J%2E%2C Lange%2C T%2E%2C Kugler%2C K%2EG%2E%2C Mayer%2C K%2EF%2E%2C Sieberer%2C T%2E%2C and Poppenberger%2C B%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Unterholzner, S.J., Rozhon, W., Papacek, M., Ciomas, J., Lange, T., Kugler, K.G., Mayer, K.F., Sieberer, T., and Poppenberger, B. (2015). Brassinosteroids Are Master Regulators of Gibberellin Biosynthesis in Arabidopsis. The Plant Cell 27: 2261-2272.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Unterholzner,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Brassinosteroids Are Master Regulators of Gibberellin Biosynthesis in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Brassinosteroids Are Master Regulators of Gibberellin Biosynthesis in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Unterholzner,&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 160%5BVolume%5D AND 523%5BPagination%5D AND Van Esse%2C G%2EW%2E%2C van Mourik%2C S%2E%2C Stigter%2C H%2E%2C ten Hove%2C C%2E a%2E%2C Molenaar%2C J%2E%2C and de Vries%2C S%2EC%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Van Esse, G.W., van Mourik, S., Stigter, H., ten Hove, C. a., Molenaar, J., and de Vries, S.C. (2012). A Mathematical Model for BRASSINOSTEROID INSENSITIVE1-Mediated Signaling in Root Growth and Hypocotyl Elongation. Plant Physiol. 160: 523-532.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Van&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A Mathematical Model for BRASSINOSTEROID INSENSITIVE1-Mediated Signaling in Root Growth and Hypocotyl Elongation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A Mathematical Model for BRASSINOSTEROID INSENSITIVE1-Mediated Signaling in Root Growth and Hypocotyl Elongation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Van&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Curr%2E Opin%2E Plant Biol%5BTitle%5D%29 AND 8%5BVolume%5D AND 462%5BPagination%5D AND Vandenbussche%2C F%2E%2C Pierik%2C R%2E%2C Millenaar%2C F%2EF%2E%2C Voesenek%2C L%2EA%2EC%2EJ%2E%2C and Van Der Straeten%2C D%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Vandenbussche, F., Pierik, R., Millenaar, F.F., Voesenek, L.A.C.J., and Van Der Straeten, D. (2005). Reaching out of the shade. Curr. Opin. Plant Biol. 8: 462-468.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Vandenbussche,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Reaching out of the shade&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Reaching out of the shade&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Vandenbussche,&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1



niches regulate flooding tolerance through distinct mechanisms. The Plant Cell 25: 4691-707.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Voesenek L.A.C.J.; and Bailey-serres, J. (2015). Flood adaptive traits and processes?: an overview. New Phytol. 206: 57-73.Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Volodarsky, D., Leviatan, N., Otcheretianski, A., and Fluhr, R. (2009). HORMONOMETER: a tool for discerning transcript signaturesof hormone action in the Arabidopsis transcriptome. Plant Physiol. 150: 1796-1805.


Warnasooriya, S.N. and Montgomery, B.L. (2009). Detection of spatial-specific phytochrome responses using targeted expressionof biliverdin reductase in Arabidopsis. Plant Physiol. 149: 424-33.


Wilson, R.N., Heckman, J.W., and Somerville, C.R. (1992). Gibberellin Is Required for Flowering in Arabidopsis thaliana under ShortDays. Plant Physiol. 100: 403-408.


Zhiponova, M.K., Morohashi, K., Vanhoutte, I., Machemer-Noonan, K., Revalska, M., Van Montagu, M., Grotewold, E., andRussinova, E. (2014). Helix-loop-helix/basic helix-loop-helix transcription factor network represses cell elongation in Arabidopsisthrough an apparent incoherent feed-forward loop. Proc. Natl. Acad. Sci. U. S. A. 111: 2824-9.


Zheng, Z., Guo, Y., Novak, O., Chen, W., Ljung, K., Noel, J.P., and Chory, J. (2016). Local auxin metabolism regulates environment-induced hypocotyl elongation. Nat. Plants. 21: 16025. doi: 10.1038/nplants.2016.25


Zhong, S., Shi, H., Xue, C., Wang, L., Xi, Y., Li, J., Quail, P.H., Deng, X.W., and Guo, H. (2012). A molecular framework of light-controlled phytohormone action in Arabidopsis. Curr. Biol. 22: 1530-1535.



http://www.ncbi.nlm.nih.gov/pubmed?term=%28The Plant Cell%5BTitle%5D%29 AND 25%5BVolume%5D AND 4691%5BPagination%5D AND van Veen%2C H%2E%2C Mustroph%2C A%2E%2C Barding%2C G%2EA%2E%2C Vergeer%2Dvan Eijk%2C M%2E%2C Welschen%2DEvertman%2C R%2EA%2EM%2E%2C Pedersen%2C O%2E%2C Visser%2C E%2EJ%2EW%2E%2C Larive%2C C%2EK%2E%2C Pierik%2C R%2E%2C Bailey%2DSerres%2C J%2E%2C Voesenek%2C L%2EA%2EC%2EJ%2E%2C and Sasidharan%2C R%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=van Veen, H., Mustroph, A., Barding, G.A., Vergeer-van Eijk, M., Welschen-Evertman, R.A.M., Pedersen, O., Visser, E.J.W., Larive, C.K., Pierik, R., Bailey-Serres, J., Voesenek, L.A.C.J., and Sasidharan, R. (2013). Two Rumex species from contrasting hydrological niches regulate flooding tolerance through distinct mechanisms. The Plant Cell 25: 4691-707.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=van&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Two Rumex species from contrasting hydrological niches regulate flooding tolerance through distinct mechanisms&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Two Rumex species from contrasting hydrological niches regulate flooding tolerance through distinct mechanisms&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=van&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28an overview%2E New Phytol%5BTitle%5D%29 AND 206%5BVolume%5D AND 57%5BPagination%5D AND Voesenek L%2EA%2EC%2EJ%2E%3B and Bailey%2Dserres%2C J%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Voesenek L.A.C.J.; and Bailey-serres, J. (2015). Flood adaptive traits and processes?: an overview. New Phytol. 206: 57-73.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Voesenek&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Flood adaptive traits and processes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Flood adaptive traits and processes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Voesenek&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 150%5BVolume%5D AND 1796%5BPagination%5D AND Volodarsky%2C D%2E%2C Leviatan%2C N%2E%2C Otcheretianski%2C A%2E%2C and Fluhr%2C R%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Volodarsky, D., Leviatan, N., Otcheretianski, A., and Fluhr, R. (2009). HORMONOMETER: a tool for discerning transcript signatures of hormone action in the Arabidopsis transcriptome. Plant Physiol. 150: 1796-1805.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Volodarsky,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=HORMONOMETER: a tool for discerning transcript signatures of hormone action in the Arabidopsis transcriptome&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=HORMONOMETER: a tool for discerning transcript signatures of hormone action in the Arabidopsis transcriptome&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Volodarsky,&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 149%5BVolume%5D AND 424%5BPagination%5D AND Warnasooriya%2C S%2EN%2E and Montgomery%2C B%2EL%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Warnasooriya, S.N. and Montgomery, B.L. (2009). Detection of spatial-specific phytochrome responses using targeted expression of biliverdin reductase in Arabidopsis. Plant Physiol. 149: 424-33.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Warnasooriya,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Detection of spatial-specific phytochrome responses using targeted expression of biliverdin reductase in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Detection of spatial-specific phytochrome responses using targeted expression of biliverdin reductase in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Warnasooriya,&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 100%5BVolume%5D AND 403%5BPagination%5D AND Wilson%2C R%2EN%2E%2C Heckman%2C J%2EW%2E%2C and Somerville%2C C%2ER%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wilson, R.N., Heckman, J.W., and Somerville, C.R. (1992). Gibberellin Is Required for Flowering in Arabidopsis thaliana under Short Days. Plant Physiol. 100: 403-408.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wilson,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Gibberellin Is Required for Flowering in Arabidopsis thaliana under Short Days&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Gibberellin Is Required for Flowering in Arabidopsis thaliana under Short Days&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wilson,&as_ylo=1992&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Proc%2E Natl%2E Acad%2E Sci%2E U%2E S%2E A%5BTitle%5D%29 AND 111%5BVolume%5D AND 2824%5BPagination%5D AND Zhiponova%2C M%2EK%2E%2C Morohashi%2C K%2E%2C Vanhoutte%2C I%2E%2C Machemer%2DNoonan%2C K%2E%2C Revalska%2C M%2E%2C Van Montagu%2C M%2E%2C Grotewold%2C E%2E%2C and Russinova%2C E%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhiponova, M.K., Morohashi, K., Vanhoutte, I., Machemer-Noonan, K., Revalska, M., Van Montagu, M., Grotewold, E., and Russinova, E. (2014). Helix-loop-helix/basic helix-loop-helix transcription factor network represses cell elongation in Arabidopsis through an apparent incoherent feed-forward loop. Proc. Natl. Acad. Sci. U. S. A. 111: 2824-9.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhiponova,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Helix-loop-helix/basic helix-loop-helix transcription factor network represses cell elongation in Arabidopsis through an apparent incoherent feed-forward loop&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Helix-loop-helix/basic helix-loop-helix transcription factor network represses cell elongation in Arabidopsis through an apparent incoherent feed-forward loop&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhiponova,&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Local auxin metabolism regulates environment%2Dinduced hypocotyl elongation%2E%5BTitle%5D%29 AND Zheng%2C Z%2E%2C Guo%2C Y%2E%2C Novak%2C O%2E%2C Chen%2C W%2E%2C Ljung%2C K%2E%2C Noel%2C J%2EP%2E%2C and Chory%2C J%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zheng, Z., Guo, Y., Novak, O., Chen, W., Ljung, K., Noel, J.P., and Chory, J. (2016). Local auxin metabolism regulates environment-induced hypocotyl elongation. Nat. Plants. 21: 16025. doi: 10.1038/nplants.2016.25

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zheng,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Local auxin metabolism regulates environment-induced hypocotyl elongation.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Local auxin metabolism regulates environment-induced hypocotyl elongation.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zheng,&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Curr%2E Biol%5BTitle%5D%29 AND 22%5BVolume%5D AND 1530%5BPagination%5D AND Zhong%2C S%2E%2C Shi%2C H%2E%2C Xue%2C C%2E%2C Wang%2C L%2E%2C Xi%2C Y%2E%2C Li%2C J%2E%2C Quail%2C P%2EH%2E%2C Deng%2C X%2EW%2E%2C and Guo%2C H%2E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhong, S., Shi, H., Xue, C., Wang, L., Xi, Y., Li, J., Quail, P.H., Deng, X.W., and Guo, H. (2012). A molecular framework of light-controlled phytohormone action in Arabidopsis. Curr. Biol. 22: 1530-1535.

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhong,&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A molecular framework of light-controlled phytohormone action in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A molecular framework of light-controlled phytohormone action in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhong,&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1



Ethylene- and shade-induced hypocotyl elongation share transcriptome patterns and functional...

Science

Transcript of Ethylene- and shade-induced hypocotyl elongation share transcriptome patterns and functional...