This article was downloaded by: [Akdeniz Universitesi]On: 21 December 2014, At: 20:43Publisher: Taylor & FrancisInforma Ltd Registered in England and Wales Registered Number: 1072954 Registeredoffice: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK

Biological Rhythm ResearchPublication details, including instructions for authors andsubscription information:http://www.tandfonline.com/loi/nbrr20

Epigenetic analysis of mPer1 promoterin peripheral tissuesYanning Cai a , Shu Liu a , Robert B. Sothern b , Ning Li c d ,Yunqian Guan c & Piu Chan aa Department of Neurology and Neurobiology ,b The Rhythmometry Laboratory , College of Biological Sciences,Biological Sciences Center, University of Minnesota , St. Paul,Minnesota, USAc Cell Therapy Center , Xuanwu Hospital of Capital MedicalUniversity, Key Laboratory for Neurodegenerative Diseases ofMinistry of Education , Beijing, P. R. Chinad Laboratory of Cell and Development , College of Life Sciences,Capital Normal University , Beijing, P. R. ChinaPublished online: 23 Oct 2009.

To cite this article: Yanning Cai , Shu Liu , Robert B. Sothern , Ning Li , Yunqian Guan & Piu Chan(2009) Epigenetic analysis of mPer1 promoter in peripheral tissues, Biological Rhythm Research,40:6, 445-453, DOI: 10.1080/09291010802568822

To link to this article: http://dx.doi.org/10.1080/09291010802568822

PLEASE SCROLL DOWN FOR ARTICLE

Taylor & Francis makes every effort to ensure the accuracy of all the information (the“Content”) contained in the publications on our platform. However, Taylor & Francis,our agents, and our licensors make no representations or warranties whatsoever as tothe accuracy, completeness, or suitability for any purpose of the Content. Any opinionsand views expressed in this publication are the opinions and views of the authors,and are not the views of or endorsed by Taylor & Francis. The accuracy of the Contentshould not be relied upon and should be independently verified with primary sourcesof information. Taylor and Francis shall not be liable for any losses, actions, claims,proceedings, demands, costs, expenses, damages, and other liabilities whatsoever orhowsoever caused arising directly or indirectly in connection with, in relation to or arisingout of the use of the Content.

This article may be used for research, teaching, and private study purposes. Anysubstantial or systematic reproduction, redistribution, reselling, loan, sub-licensing,systematic supply, or distribution in any form to anyone is expressly forbidden. Terms &

Conditions of access and use can be found at http://www.tandfonline.com/page/terms-and-conditions

Dow

nloa

ded

by [

Akd

eniz

Uni

vers

itesi

] at

20:

43 2

1 D

ecem

ber

2014

Epigenetic analysis of mPer1 promoter in peripheral tissues

Yanning Caia, Shu Liua, Robert B. Sothernb, Ning Lic,d, Yunqian Guanc andPiu Chana*

aDepartment of Neurology and Neurobiology, and bThe Rhythmometry Laboratory, College ofBiological Sciences, Biological Sciences Center, University of Minnesota, St. Paul, Minnesota,USA; cCell Therapy Center, Xuanwu Hospital of Capital Medical University, Key Laboratoryfor Neurodegenerative Diseases of Ministry of Education, Beijing P. R. China; dLaboratory ofCell and Development, College of Life Sciences, Capital Normal University, Beijing P. R. China

(Received 25 September 2008; final version received 20 October 2008)

E-boxes targeted by BMAL1-CLOCK dimers are crucial for the rhythmicexpression of mPer1. We investigated whether DNA methylation, especiallyE-box CpG methylation, plays a role in the regulation of mPer1 oscillations inmice. E-box-containing amplicons were examined in liver, thymus and testisaround-the-clock using bisulfite sequencing, combined bisulfite restrictionanalysis (COBRA) and bisulfite pyrosequencing. Results indicated that mPer1E-boxes were only hypomethylated in all tissues at all circadian stages, suggestingthat E-boxes are open to BMAL1-CLOCK dimers at all times, and thus E-boxmethylation is most likely not involved in global regulation of the mPer1 rhythm.In addition, low but noticeable methylation of E-box 3 and/or 4 and a sub-groupof CpGs nearby were identified in all three tissues, indicating this region as area ofpreferred methylation, and may have a role in silencing mPer1 transcription.

Keywords: mPer1; promoter; methylation; E-box; peripheral tissues; rhythm

Introduction

Period 1 (Per1) is a key molecular component of circadian clock machinery, whosedaily oscillations have been identified in both central (suprachiasmatic nucleus,SCN) and many peripheral oscillators, including liver, heart, kidney, etc. (Ko andTakahashi 2006; Liu et al. 2007). Constitutive expression of the Per1 gene impairsboth behavioral and molecular circadian rhythms in rats (Numano et al. 2006),suggesting that the daily fluctuation of Per1 is crucial for the generation andmaintenance of the molecular clock.

In the last decade, the transcriptional regulation of Per1 has been elucidatedgradually. It indicates that E-boxes (5’-CACGTG-3’) in regulatory regions are themost crucial cis-acting element (Hida et al. 2000; Yoo et al. 2005), which seems toconcern recruitment of transactivators (i.e. heterodimer of BMAL1/CLOCK),histone chromatin acetylation and deacetylation (Etchegaray et al. 2003; Naruseet al. 2004). Since CpG dinucleotides within E-boxes are potential targets for DNAmethylation, some chronobiologists have speculated that E-box methylation may be

*Corresponding author. Email: pbchan@bjsap.orgThe first two authors contributed equally to this work.

Biological Rhythm Research

Vol. 40, No. 6, December 2009, 445–453

ISSN 0929-1016 print/ISSN 1744-4179 online

� 2009 Taylor & Francis

DOI: 10.1080/09291010802568822

http://www.informaworld.com

Dow

nloa

ded

by [

Akd

eniz

Uni

vers

itesi

] at

20:

43 2

1 D

ecem

ber

2014

involved in the regulation of rhythms at the molecular level (Munoz and Baler 2003).This speculation seems to be further strengthened when E-box methylation wasreported to control the transcriptional regulation of USF and N-Myc (other HLHproteins comparable to BMAL and CLOCK) (Perini et al. 2005; Fujii et al. 2006).Moreover, epigenetic regulation of Per1 studied extensively in cancer tissues and celllines revealed that DNA methylation indeed plays a role in silencing Per1transcription and triggering tumorgenesis (Chen et al. 2005; Yeh et al. 2005; Geryet al. 2007; Hsu et al. 2007). However, it is still unknown whether DNA methylationalso underlies the basis of Per1 regulation in normal tissues.

To understand whether DNA methylation, especially E-box methylation, plays arole in regulating mPer1 expression, methylation patterns of five E-box-containingregions within mPer1 promoter in both homogeneous (liver, a canonical rhythmictissue primarily containing hepatocytes) and heterogeneous tissues (thymus andtestis, arrhythmic or ultradian rhythmic tissues (Alvarez et al. 2003; Alvarez andSehgal 2005; Liu et al. 2007) containing many cell types as well as cells at variousstages of differentiation) were examined using bisulfite genomic sequencing,combined bisulfite restriction analysis (COBRA), and pyrosequencing. Our resultsindicate: (1) E-box methylation does not regulate the mPer1 circadian expression inliver nor underlie the basis of mPer1 ultradian expression in thymus and testis; (2) asub-group of CpGs around E-boxes 3 and 4 appears to be preferentially methylated,and likely mediates mPer1 repression.

Materials and methods

Animals

Eight-week-old C57BL/6 male mice were housed individually in a 12L:12D light–dark cycle (lights-on at 08:00 h; lights-off at 20:00 h) and allowed to feed ad libitumfor two weeks after arrival at the animal facility. Care of mice was in accordancewith the National Institute of Health Guide for the Care and Use of LaboratoryAnimals. Three mice were sacrificed at each timepoint as follows: at 4-h intervalsbeginning at 09:00 h (¼ 01 HALO ¼ Hours After Light Onset) (Sothern 1995).

Genomic DNA preparations and bisulfite treatment

Genomic DNA was prepared using the QIAamp DNA mini kit (Qiagen, CA, USA).For bisulfite reaction, in which cytosine is converted to uracil and 5’-methylcytosineremains non-reactive, genomic DNAs were initially denatured with 0.3 M NaOH.Sodium metabisulfite solution (pH 5.0) and hydroquinone were then added at a finalconcentration of 3.0 M and 0.5 mM, respectively. The reaction mixtures wereincubated under mineral oil in the dark at 508C for 16 h. The denatured DNA waspurified with Wizard DNA purification resin (Promega, CA, USA), and modifica-tion was then terminated by treatment with 0.3 M NaOH at 378C for 15 min,followed by ethanol precipitation.

Bisulfite sequencing

The bisulfite treated genomic DNA were amplified with HS taq (Takara, Japan)using the external primer sets for 5 E-boxes respectively (listed in Table 1). For

446 Y. Cai et al.

Dow

nloa

ded

by [

Akd

eniz

Uni

vers

itesi

] at

20:

43 2

1 D

ecem

ber

2014

screening the methylation status of initial five amplicons in liver, thymus and testis,equal amounts of three PCR products from the same tissue at the same timepointwere pooled from three mice and cloned into pGEMT vector and 9–15 clones werecommercially sequenced for each sample by the Beijing Genomics Institute (Beijing,P.R. China).

Combined Bisulfite Restriction Analysis (COBRA) assay

The bisulfite treated genomic DNA was amplified with internal PCR primercombinations (Table 1), which produce short E-boxes containing amplicons (1s to5s) with only one potential HpyCH4IV site inside (E-box). Equal amounts of threePCR products from the same tissue, representing three mice at the same timepoint,were pooled and purified using the QIAquick PCR purification kit (Qiagen, CA,USA) and quantified using a UV spectrometer (Phamacia, Sweden). 200 ng of eachpurified PCR product was digested with HpyCH4IV at 378C for 4 hours. DNA wasthen separated on 2.5% of agarose gels and stained with GelRed (Biotium, CA,USA).

Bisulfite pyrosequencing

To quantify methylation levels of E-box 3 and 4 for each sample, the bisulfite treatedgenomic DNA were amplified with internal PCR primer sets. The reverse primer forE-box 3 and forward primer for E-box 4 were biotinlated, respectively. The PCRproducts were sequenced according to the manufacturer’s protocol (Biotage,Kungsgatan, Sweden) by Genetech Inc (Shanghai, P.R. China). The sequencingprimers were 5’-ATTGTTAAG GAAAGTTTTAG-3’ for E-box 3 and 5’-AAAACAATTAAAAACCCAC-3’ for E-box 4.

Table 1. Primer sequences used in bisulfite PCR.

LocusForward/Reverse

External primers for amplicons1 to 5

Internal primers for amplicons1s to 5s

E-box 1 F GTTTAGATTTTTAAGTTTTGGGG

TTAGTTTTTGGGTAAATAAGTTG

R ACCCACTCTCAACATTTTTACTA

ACCCACTCTCAACATTTTTACTA

E-box 2 F GGGGTTGTTTTTGTAGTTAGTAA

GGGGTTGTTTTTGTAGTTAGTAA

R TAAAACTCCTCCACAAAATCC

CAACCATTAACATTTCAAAACTC

E-box 3 F GGGAAATATTATTGTTAAGGA

GGGAAATATTATTGTTAAGGA

R AAACCCATCTATCTCATTTACTATA

TAACAAATAAAAAAACCAACAC

E-box 4 F TAGTTTTAAATGTGGGTGGTTGTA

GGAGATTTTTTTTTTGATTGGT

R TCCTCTAACCCTTCAAATCCTA

TCCTCTAACCCTTCAAATCCTA

E-box 5 F GGAGAGGTTAGGGAATGTTA

GTTAAGTTGGTTAGTTTAGGAAG

R CCCACTAAAATCAAAACTATATC

CCCACTAAAATCAAAACTATATC

Biological Rhythm Research 447

Dow

nloa

ded

by [

Akd

eniz

Uni

vers

itesi

] at

20:

43 2

1 D

ecem

ber

2014

Results

The mPer1 locus (Genbank accession no. AB030818) spans 15.76 kb in size (Hidaet al. 2000). So far, five functional important E-boxes have been identified in thisregion. Using the translation start site (ATG) as þ1, five E-boxes locate at 75754 to75749; 75570 to 75565; 72968 to 72963; 72222 to 72217 and 71859 to71854, respectively. As shown in Figure 1, the initial 5 amplicons (1 to 5) encompass14, 14, 9, 4 and 5 CpGs, respectively, and contain E-boxes 1 to 5 in order. Overall,these 46 CpGs, including 5 CpGs within E-boxes, were examined using bisulfitesequencing. The subsequent five short amplicons (1s to 5s) were used to examine themethylation level of each E-box by COBRA and pyrosequencing.

The methylation status of the initial five E-box-containing amplicons was firstexamined using bisulfite genomic sequencing at both early light and early dark (01 and13HALO). Both individual and overall E-box CpGs showed a low level of methylation(0–16.7% and 0–3.7%, respectively, Figure 2). In the liver and thymus, only methylatedE-box 4 was observed, while in testis, methylation regulation was noted in E-boxes 1, 3and 4, although at low levels. Based on the five amplicons examined,mPer1 promoter islargely hypomethylated in all three tissues, with the overall percentage of methylationvarying from 2% to 8%. However, methylation frequencies were far from equalbetween amplicons. Amplicons 1, 2 and 5 were only sparsely methylated or virtuallyfree from methylation, while amplicons 3 and 4 appeared to be areas of preferredmethylation in all three tissues.

Bisulfite sequencing seems to suggest that all five E-boxes were onlyhypomethylated. To verify and extend this finding to six circadian stages, combinedbisulfite restriction analysis (COBRA) was performed. During the standard sodiumbisulfite treatment, methylated E-boxes (CACGTG) are converted to TACGTGwhich can be digested by HpyCH4IV, while unmethylated E-boxes are converted toTATGTG which cannot be recognized by the same enzyme. The converted genomicDNA was then amplified with internal primer sets, which produced short amplicons

Figure 1. E-boxes containing amplicons examined in mPer1 locus. Five vertical lines indicateE-boxes 1–5, respectively. Separate horizontal lines indicate amplicons covering E-boxes,either with external primer sets generating amplicon 1 to 5 or with internal primer setsgenerating amplicon 1s to 5s. The location of each amplicon and number of CpGs inside arenoted below each horizontal line. Two short arrows indicate translational start site ‘ATG’ andtranscriptional start site ‘TSS’.

448 Y. Cai et al.

Dow

nloa

ded

by [

Akd

eniz

Uni

vers

itesi

] at

20:

43 2

1 D

ecem

ber

2014

containing only one potential HpyCH4IV site (E-box). The short amplicons 1s to 5sare 169 bp, 169 bp, 104 bp, 172 bp and 228 bp in size, respectively. If the E-boxcontents are methylated and recognized by HpyCHIV, the digestion fragment ofeach amplicon would be 127 bp, 97 bp, 71 bp, 125 bp and 188 bp respectively, andcan be separated and visualized in agarose gel. Our UV transilluminator (300 nm,EB filter) can detect as low as 4 ng of dsDNA stained with GelRed (data not shown).Given that 200 ng of each short amplicons were fully digested, our system can detectan E-box with methylation levels around 5%.

COBRA revealed that methylation was noted in E-box 4 for liver, thymus andtestis and in E-box 3 for testis at each timepoint (Figure 3). Furthermore,methylation levels of E-box 3 and 4 were quantified for each sample usingpyrosequencing, which indicated that around 10% of E-box 3 was methylated in

Figure 2. Methylation status of E-box and Global CpGs in mPer1 promoter at two circadianstages 01 and 13 HALO (hours after lights-on). (A) Methylation status of five E-boxescontaining amplicons in mPer1 promoter determined by bisulfite genomic sequencing. Eachrow of circles and triangles represents a single cloned allele, and each circle indicates a singleCpG site at a specific location. Filled circles correspond to methylated cytosines and opencircles to unmethylated cytosines. Filled triangles correspond to methylated cytosines withinE-boxes and open triangles to unmethylated cytosines inside E-boxes. The numbers inparentheses indicate the numbers of identical clones sequenced. (B) Percentage of E-box CpGmethylation at each timepoint in each tissue. (C) Percentage of global and each amplicon CpGmethylation at each timepoint in each tissue.

Biological Rhythm Research 449

Dow

nloa

ded

by [

Akd

eniz

Uni

vers

itesi

] at

20:

43 2

1 D

ecem

ber

2014

testis (mean+SE ¼ 10.6 + 0.4, range: 6.4–14.8%), while both thymus (mean+SE0.5 + 0.3, range: 0–3.7%) and liver (mean+SE¼ 0.2 + 0.2, range: 0–3.2%) E-box3 were more or less free from methylation (Figure 4 left). On the other hand,methylated E-box 4 was noted in all tissues examined, with the highest levels in thethymus (mean+SE ¼ 20.4 + 0.5, range: 14.8–23.4%), lowest in the testis(mean+SE ¼ 6.6 + 0.3, range: 3.1–8.6%) and intermediate in the liver (mean+SE¼11.5 + 0.5, range: 8.1–14.8%) (Figure 4 right).

Figure 3. Examination of methylation status of mPer1 E-boxes in liver, thymus and testis atsix circadian stages. Methylation status of each E-box was examined by COBRA at eachindicated timepoint. Amplicon for each tissue at each timepoint was a pooled PCR product ofthree mice. Methylated E-box can be recognized by HpyCHIV and generate a digestionfragment smaller in size. For E-boxes 1, 2 and 5, no digestion fragment can be visualized. ForE-box 3, digestion fragment (71 bp) was detected only in testis. For E-box 4, digestionfragment (125 bp) was detected in liver, thymus and testis.

Figure 4. Quantification of methylation levels of mPer1 E-box 3 and 4 in liver, thymus andtestis at six circadian stages. Methylation level was determined by pyrosequencing for E-box 3(left panel) and E-box 4 (right panel). Percentage E-box methylation was expressed asmean + SE from mice studied in LD12:12 (3 mice/timepoint, 18 total).

450 Y. Cai et al.

Dow

nloa

ded

by [

Akd

eniz

Uni

vers

itesi

] at

20:

43 2

1 D

ecem

ber

2014

Discussion

E-boxes are the sites that CLOCK/BMAL1 exert their transcriptional activities, andcrucial for the rhythmic transcription of many clock genes. Since E-boxes almostalways contain CpG, no matter whether in a canonical (e.g., E-box in mPer1promoter) or non-canonical form (e.g., E-box in mPer2 promoter), it is reasonable tohypothesize that the DNA methylation status of E-boxes may modulate clockgene expression. Indeed, E-box methylation has been reported to control thetranscriptional regulation of USF and N-Myc, other HLH transcription factorsdistinct from Bmal1 and Clock (Perini et al. 2005; Fujii et al. 2006). Nevertheless, ourmethylation analyses did not convincingly support the aforesaid assumption inmPer1 locus.

In all tissues examined, the methylation was noted only at E-box 3 and/or E-box4 with relatively low levels, while other E-boxes appeared more or less free frommethylation. It is reasonable to speculate that the open E-boxes have enoughcapacities to mediate the molecular rhythm. Indeed, some early reports (Gekakiset al. 1998; Hida et al. 2000) indicated that individual E-boxes can more or lessrespond to BMAL1/CLOCK induction. Moreover, even E-box 3 and 4 are onlyhypomethylated, suggesting that these two E-boxes are also open to the CLOCK/BMAL1 complex in most cases, and thus it is most likely that methylation regulationdoes not play a major role in the transcriptional regulation of mPer1.

E-boxes 3 and 4 as well as a sub-group of CpGs nearby appear to bepreferentially methylated in all tissues examined. This finding is in agreement with arecent report analyzing cancer cell lines of human species, which indicated CpGswithin and around E-box 4 of hPer1 promoter were methylated, while that aroundE-box 5 were free from methylation (Hsu et al. 2007). DNA methylation has beenreported to silence hPer1 expression in human cervical and non-small cell lungcancer cells (Gery et al. 2007; Hsu et al. 2007). Our results seem to suggest that thearea around E-boxes 3 and 4 are potential regions that mediate the repression.

It has been reported that low-density methylation could be associated with densemethylation in a fraction of cells (Ushijima et al. 2005; Bredberg and Bodmer 2007).In the present study, low, but noticeable, methylated levels in E-boxes 3 and 4 wereobserved, suggesting that a fraction of cells are epigenetically different in mPer1locus, in which methylated E-boxes may have a direct consequence on mPer1transcription. Knowing that both thymus and testis are heterogeneous, it would beof interest to characterize the methylation patterns in subgroups of cells therein, anddetermine whether and which fraction of cells are more heavily methylated. Inaddition, although liver is primarily composed of hepatocytes, our results suggestthat it is not homogeneous in the circadian regulation, since at least a fraction ofhepatocytes are methylated at E-box 4. So far, it is still not clear whether this site-specific methylation is functionally important and warrants further studies.

In conclusion, our findings indicate that E-box CpGs methylation may notcontribute globally to mPer1 expression in peripheral tissues. On the other hand, asubgroup of CpGs near E-boxes 3 and 4 may be preferentially methylated in afraction of cells and have a role in mPer1 regulation. These results, therefore, shouldshed some light on the association between circadian rhythms in clock geneexpression and DNA methylation and demethylation. Although methylationregulation may not govern the global mPer1 transcription, their influences in cellswith dense methylation are still worthy of further study in order to discover their

Biological Rhythm Research 451

Dow

nloa

ded

by [

Akd

eniz

Uni

vers

itesi

] at

20:

43 2

1 D

ecem

ber

2014

biological relevance with regard to influencing certain aspects of gene expressionover 24 h.

Acknowledgements

We thank Jingyan Song for helpful discussions. Research support for YC, SL, NL, YG andPC was provided by the National Natural Science Foundation of China (30400148, 30430280);The National Basic Research Program of China (2006CB500701, 2006CB943703); TheNational 863 Project grant of China (2006AA02A408); Scientific project of Beijing municipalscience and technology commission (D07050701350703); The Natural Sciences Foundation ofBeijing (5063042); and New Century Excellent Talents in University (2007), and for RBS, inpart, by financial support from Jane and Mike Popovich.

References

Alvarez JD, Chen D, Storer E, Sehgal A. 2003. Non-cyclic and developmental stage-specificexpression of circadian clock proteins during murine spermatogenesis. Biol Reprod.69(1):81–91.

Alvarez JD, Sehgal A. 2005. The thymus is similar to the testis in its pattern of circadian clockgene expression. J Biol Rhythms. 20(2):111–121.

Bredberg A, Bodmer W. 2007. Cytostatic drug treatment causes seeding of gene promotermethylation. Eur J Cancer. 43(5):947–954.

Chen ST, Choo KB, Hou MF, Yeh KT, Kuo SJ, Chang JG. 2005. Deregulated expression ofthe PER1, PER2 and PER3 genes in breast cancers. Carcinogenesis. 26(7):1241–1246.

Etchegaray JP, Lee C, Wade PA, Reppert SM. 2003. Rhythmic histone acetylation underliestranscription in the mammalian circadian clock. Nature. 421:177–182.

Fujii G, Nakamura Y, Tsukamoto D, Ito M, Shiba T, Takamatsu N. 2006. CpG methylationat the USF-binding site is important for the liver-specific transcription of the chipmunkHP-27 gene. Biochem J. 395(1):203–209.

Gekakis N, Staknis D, Nguyen HB, Davis FC, Wilsbacher LD, King DP, Takahashi JS, WeitzCJ. 1998. Role of the CLOCK protein in the mammalian circadian mechanism. Science.280:1564–1569.

Gery S, Komatsu N, Kawamata N, Miller CW, Desmond J, Virk RK, Marchevsky A,Mckenna R, Taguchi H, Koeffler HP. 2007. Epigenetic silencing of the candidate tumorsuppressor gene Per1 in non-small cell lung cancer. Clin Cancer Res. 13(5):1399–1404.

Hida A, Koike N, Hirose M, Hattori M, Sakaki Y, Tei H. 2000. The human and mousePeriod1 genes: five well-conserved E-boxes additively contribute to the enhancement ofmPer1 transcription. Genomics. 65(3):224–233.

Hsu MS, Huang CC, Choo KB, Huang CJ. 2007. Uncoupling of promoter methylation andexpression of Period1 in cervical cancer cells. Biochem Biophys Res Commun. 360(1):257–262.

Ko CH, Takahashi JS. 2006. Molecular components of the mammalian circadian clock. HumMol Genet. 15:R271–277.

Liu S, Cai Y, Sothern RB, Guan Y, Chan P. 2007. Chronobiological analysis of circadianpatterns in transcription of seven key clock genes in six peripheral tissues in mice.Chronobiol Int. 24(5):793–820.

Munoz E, Baler R. 2003. The circadian E-box: when perfect is not good enough. ChronobiolInt. 20(3):371–388.

Naruse Y, Oh-hashi K, Iijima N, Naruse M, Yoshioka H, Tanaka M. 2004. Circadian andlight-induced transcription of clock gene Per1 depends on histone acetylation anddeacetylation. Mol Cell Biol. 24(14):6278–6287.

Numano R, Yamazaki S, Umeda N, Samura T, Sujino M, Takahashi R, Ueda M, Mori A,Yamada K, Sakaki Y, Inouye ST, Menaker M, Tei H. 2006. Constitutive expression of thePeriod1 gene impairs behavioral and molecular circadian rhythms. Proc Natl Acad SciUSA. 103(10):3716–3721.

Perini G, Diolaiti D, Porro A, Valle GD. 2005. In vivo transcriptional regulation of N-Myctarget genes is controlled by E-box methylation. Proc Natl Acad Sci USA. 102(34):12117–12122.

452 Y. Cai et al.

Dow

nloa

ded

by [

Akd

eniz

Uni

vers

itesi

] at

20:

43 2

1 D

ecem

ber

2014

Sothern RB. 1995. Time of day versus internal circadian timing references. J Infus Chemother.5(1):24–30.

Ushijima T, Watanabe N, Shimizu K. 2005. Decreased fidelity in replicating CpG methylationpatterns in cancer cells. Cancer Res. 65(1):11–17.

Yeh KT, Yang MY, Liu TC, Chen JC, Chan WL, Lin SF, Chang JG. 2005. Abnormalexpression of period 1 (PER1) in endometrial carcinoma. J Pathol. 206(1):111–120.

Yoo SH, Ko CH, Lowrey PL, Buhr ED, Song EJ, Chang S, Yoo OJ, Yamazaki S, Lee C,Takahashi JS. 2005. A noncanonical E-box enhancer drives mouse Period2 circadianoscillations in vivo. Proc Natl Acad Sci USA. 102(7):2608–2613.

Biological Rhythm Research 453

Dow

nloa

ded

by [

Akd

eniz

Uni

vers

itesi

] at

20:

43 2

1 D

ecem

ber

2014