Experimental Parasitology 110 (2005) 214–219

www.elsevier.com/locate/yexpr

Entamoeba histolytica: Characterization of human collagen type I and Ca2+ activated diVerentially expressed genes �

Anjan Debnath 1, Md. Ali Akbar, Arindam Mazumder, Sudeep Kumar, Pradeep Das ¤

Department of Microbiology, National Institute of Cholera and Enteric Diseases, ICMR, Kolkata, West Bengal, India

Received 21 January 2005; received in revised form 1 March 2005; accepted 1 March 2005Available online 8 April 2005

Abstract

Earlier it was demonstrated that the Entamoeba histolytica trophozoites, when incubated with human collagen and Ca2+,expressed and released the collagenolytic activity [Munoz, M.L., Calderon, J., Rojkind, M., 1982. The collagenase of Entamoeba his-tolytica. Journal of Experimental Medicine 155, 42–51], a virulence factor involved in the pathogenesis of amoebiasis. In this study,attempts have been made to identify and characterize the gene(s) that are upregulated by the human collagen type I and Ca2+ inter-action. A comparative evaluation of gene expression pattern of the parasite before and after treatment with human collagen type Iwas done using the diVerential display reverse transcription-PCR technique. The cDNA fragments that were overexpressed in colla-gen treated trophozoites compared to collagen untreated trophozoites were characterized. Northern blot hybridization and RT-PCRampliWcation using gene-speciWc primers validated the diVerential expression. Sequence analyses and database searches revealedhomology with known virulence factor genes of E. histolytica such as amoebapore C and cysteine proteinase 5, along with stress-induced protein HSP70, and ribosomal protein L27a (known to be involved in protein synthesis). The study provides the experimen-tal evidence that interaction of E. histolytica with human collagen type I and Ca2+ triggers the transcriptional activation of at leasttwo important genes responsible for pathogenesis of amoebiasis. 2005 Elsevier Inc. All rights reserved.

Keywords: Amoebiasis; Entamoeba histolytica; Pathogenesis; DiVerential display

1. Introduction

Amoebiasis, the fourth leading cause of death due to aprotozoan infection after malaria, Chagas’ disease, andleishmaniasis and the third cause of morbidity aftermalaria and trichomoniasis, is responsible for approxi-mately 70 thousand deaths annually (WHO, 1998). Thisinvasive illness is associated with capability of Entamoeba

� Part of this work was presented in EMBO workshop on “Patho-genesis of Amoebiasis: From Genomics to Disease” held at Ein Gedi,Israel (November 16–20, 2004).

* Corresponding author. Fax: +91 33 2350 5066.E-mail address: dasp@cal2.vsnl.net.in (P. Das).

1 Present address: Sandler Center for Basic Research in ParasiticDiseases, University of California, San Francisco, USA.

0014-4894/$ - see front matter 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.exppara.2005.03.007

histolytica trophozoites to destroy human tissues by pene-trating the mucosa and submucosa of large intestine. Themechanism of tissue damage in amoebiasis is currentlyattributed in part to the activity of various moleculespresent in the parasite: viz (a) the amoebapore, (b) phos-pholipases, (c) collagenase, (d) adhesins, and (e) cysteineproteases (Stanley and Reed, 2001). In human colon, thebasement lamina underlying the epithelium consists ofcollagen, laminin, Wbronectin, proteoglycans, and a num-ber of basement lamina-associated molecules such as ten-ascin C, entactin, etc. (Perreault et al., 1998). It has beenspeculated that during colonic invasion, interaction ofE. histolytica trophozoites with extracellular matrix acti-vates the synthesis and release of lytic factors and prote-ases. It is demonstrated in vitro that if E. histolytica andhuman collagen type I were incubated in the presence of

A. Debnath et al. / Experimental Parasitology 110 (2005) 214–219 215

Ca2+ at neutral pH, the amoebae released electron-densegranules that contained collagenolytic activity (Munozet al., 1982). In further analysis it was demonstrated thatprotease of electron dense granule was a metalloproteaseand was overexpressive in virulent strains than non-viru-lent strains of amoeba (Munoz et al., 1984). Interaction oftrophozoites with human collagen type I triggers bio-chemical cascade (Perez et al., 1996). But the metallopro-tease was never puriWed and the exact mechanism ofcollagen activation of amoebae as well as its mode of col-lagen degradation is unknown. Similarly, information ongenes that are speciWcally activated by collagen interac-tion, are not available. Preliminary work on early geneexpression during this interaction revealed no speciWccorrelates (Salazar et al., 1997).

In the last decade, PCR-based methods includingRNA Wngerprinting, arbitrarily primed PCR (AP-PCR)and diVerential-display reverse transcription-PCR(DDRT-PCR) have been developed to study the changesin gene expression pattern in diVerent cell populationsunder diVerent physiological conditions, that allow theidentiWcation of diVerentially expressed genes in a lesslabor-intensive fashion than other methods (Sturtevant,2000). This approach had been used successfully for theidentiWcation of stress inducible genes in E. histolyticadue to iron limitation (Park et al., 2001) and in compar-ing RNA expression between E. histolytica trophozoitesisolated from liver abscesses of infected gerbils withrespect to those grown under normal culture conditions(Bruchhaus et al., 2002).

In the present investigation, utilizing the mRNAdiVerential display technique (Liang and Pardee, 1992)collagen induced genes of E. histolytica have been identi-Wed. The results indicate overexpression of four cDNAfragments representing two virulence factor genes ofE. histolytica. Expression studies using gene speciWcprimers in reverse transcription-PCR and Northernhybridization also conWrmed the Wndings.

2. Materials and methods

2.1. Maintenance of E. histolytica culture

Axenic E. histolytica trophozoites (HM1: IMSSstrain) were maintained in TYI-S-33 medium supple-mented with penicillin (100 U/ml), streptomycin (100�g/ml), and 10% heat inactivated bovine serum (Diamondet al., 1978). All the experiments were conducted withtrophozoites harvested from logarithmic phase ofgrowth.

2.2. Activation of E. histolytica

Approximately 5 £ 107 trophozoites in modiWedTYI-S-33 medium (Leon et al., 1997) were incubated

with human collagen type I (0.3 mg human collagentype I/106 trophozoites) and Ca2+ (1 mM Wnal concen-tration) (Leon et al., 1997). After incubation for 2 h at37 °C, the cells were chilled (4 °C) and collected by cen-trifugation (230g for 5 min). In another set, same num-ber of trophozoites were incubated in the samemedium, without human collagen type I and Ca2+ for2 h at 37 °C. The cells were harvested as describedearlier.

2.3. RNA extraction and DNase I treatment of RNA

Total RNA was isolated from human collagen type Itreated and untreated trophozoites using TRIzol kit(Invitrogen, USA), as directed by the manufacturer. ForDNase treatment, 50 �g of RNA was incubated with10 U of RNase-free DNase I in 10 mM Tris–HCl, pH8.3; 50 mM KCl, 1.5 mM MgCl2 for 30 min at 37 °C.RNA was precipitated with 3 vol. of ethanol in the pres-ence of 0.3 M sodium acetate, pH 5.2, rinsed with 70%ethanol, and redissolved in 20 �l of DEPC-treatedwater. OD readings were taken at 260/280 and integrityof total RNA was checked in denaturing polyacryl-amide gel.

2.4. mRNA diVerential display

2.4.1. Reverse transcriptionFor the synthesis of Wrst strand cDNA, DNA-free

0.2�g of total RNA isolated from collagen-treated anduntreated trophozoites were reverse transcribed in fourindependent reactions, using diVerent anchoredoligo(dT) (GenHunter, USA; H-T11V and T12VA) asdescribed earlier ( Liang and Pardee, 1992). BrieXy, thereaction was carried out in 20�l reactions containing 1£RT buVer, 10 mM DTT, 20�M dNTPs, either 0.2 �M ofone H-T11V or 1 �M of T12VA, 1 �l RNasin, and 1 �lexpand reverse transcriptase. Reverse transcription wascarried out for 60 min at 42 °C with a Wnal denaturationat 95 °C for 2 min.

2.4.2. Polymerase chain reactionTwo microlitres of cDNA was subjected to PCR

employing the one base (0.2�M) or two base anchoredoligonucleotide (1�M) along with either one of the ran-dom primers (0.2�M), 1£ PCR buVer, 2 �M dNTPs, 1 UTaq polymerase and 60 nM [�-33P]dATP (2500 Ci/mmol)in a 20�l reaction mixture. Subsequent to an initial 30 sdenaturation at 94 °C, 40 ampliWcation cycles were per-formed as follows: 30 s at 94 °C, 2 min at 40 °C, 30 s at72 °C, then a Wnal 5 min at 72 °C and a 4 °C hold. Sam-ples were frozen at ¡20 °C if not immediately used. Twocontrols (RNA instead of cDNA and in another tubeneither DNA nor RNA) were included in the experimentfor both untreated and collagen-treated E. histolyticatrophozoites.

216 A. Debnath et al. / Experimental Parasitology 110 (2005) 214–219

2.4.3. Gel electrophoresis, excision, and reampliWcation of cDNA fragments

Following PCR, 3.5�l of each sample was mixed with2 �l of dye, heated for 2 min at 95 °C and loaded onto a6% polyacrylamide-sequencing gel containing 50% ureamade in 1£ TBE. Electrophoresis was carried out at60 W constant power for 3.5 h. The gel was transferredonto a piece of 3 MM Whatman Wlter paper, dried at80 °C for 1 h, and exposed to X-ray Wlm (Kodak, Japan).Fragments of interest were excised from the gel, soakedin 100�l sterile water for 10 min, and precipitated with10 �l of 3 M sodium acetate, pH 5.2. Pellets were resus-pended in 10�l sterile water. Eluted DNA (4 �l) was thenreampliWed directly under the same conditions used fordiVerential display.

2.5. Northern analysis of diVerentially expressed bands

DNA fragments were radiolabeled using RandomPrimer DNA Labeling Kit (Roche, Germany), followingthe manufacturer’s protocol. Twenty micrograms oftotal RNA from collagen-activated and non-activatedE. histolytica trophozoites was Wrst separated on agarosegel and transferred to nylon membranes following stan-dard procedure (Sambrook and Russell, 2001). Mem-branes were prehybridized and hybridized at 42 °C,washed twice with 1£ SSC, 0.1% SDS for 15 min atroom temperature and once with 0.25£ SSC, 0.1% SDSfor 20 min at 55 °C. After images were obtained, mem-branes were incubated at 95 °C for 1 h in 0.1% SDS toremove the bound probe. They were once again hybrid-ized with a 32P-labeled E. histolytica actin probe, whichserved as a loading control.

2.6. Expression analysis by RT-PCR

To conWrm the diVerential expression, the transcriptsof diVerential display were once again tested by RT-PCR, using gene-speciWc primers and actin as loadingcontrol. The Wrst-strand synthesized cDNA was ampli-Wed by PCR using same master mix. All PCRs were per-formed within the linear range of ampliWcation of thecorresponding mRNA species. The linear range ofthe PCR ampliWcation was veriWed by quantifying thecDNA-PCR product obtained after ampliWcations for15–30 cycles (data not shown). In all PCR, after initialdenaturation at 94 °C for 5 min, targeted genes wereampliWed by 25 cycles (94 °C for 30 s, 55 or 50 °C for30 s, and 72 °C for 1 min) followed by Wnal extension at72 °C for 5 min. The products were analyzed on 1% aga-rose gel. The ampliWed RT-PCR products were quanti-tated and normalized to ampliWed actin RT-PCRproducts. The primer sequences used viz. ApC F andApC R; CP5 F and CP5 R; HSP70 F and HSP70 R;RPL27a-1 F and RPL27a-1 R; and Act F and Act R areshown in Table 1.

2.7. Cloning, sequencing, and homology analysis

The diVerentially expressed reampliWed cDNA frag-ments were cloned into the TOPO TA vector using TA-TOPO cloning kit (Invitrogen). Plasmid DNA fromrecombinant clones were isolated and sequenced usingM13 forward and reverse primers and in an ABI 310automated sequencer (PE Applied Biosystems, UK).Homology analysis of nucleotide sequences was carriedout using sequence databases at NCBI (NIH, Bethesda,MD, USA). GenBank searches were done by BLAST.

2.8. Densitometric analysis

All the northern Wlms and RT-PCR gels were photo-graphed and analyzed using Quantity One software(Bio-Rad, USA).

3. Results and discussion

It has been suggested that during invasion E. histoly-tica adheres and binds to extracellular matrix (includingcollagen) via an ‘integrin-like’ collagen receptor (Perezet al., 1998). It is also shown that host tissue destructiondepends on the cytotoxic, cytopathic, contact-dependentcytolysis (McCoy et al., 1994) and collagenolytic activity(Munoz et al., 1982) of the parasite. It is clearly demon-strated that E. histolytica destroys the human collagen

Table 1Primers, which showed diVerential expression in DDRT-PCR andoligonucleotides used to verify the diVerential expression by RT-PCR

V represents equimolar mixture of dA, dC, and dG; H representsAAGC. ApC represents amoebapore C; CP5 represents cysteineproteinase 5 of E. histolytica; HSP70 represents heat-shock protein 70of E. histolytica; RPL27a-1 represents ribosomal protein L27a-1 ofE. histolytica; and Act represents actin of E. histolytica. F representsforward and R for reverse.

Primer name Sequence

T12VA 5� TTTTTTTTTTTTVA 3�

H-T11G 5� AAGCTTTTTTTTTTTG 3�

PD1 5� GATCGCATTG 3�

PD2 5� GGTACTAAGA 3�

H-AP37 5� AAGCTTGGGCCTA 3�

ApC F 5� CAACAAGACAGAGAAATTCC 3�

ApC R 5� ATGCATGAATCAACCCACA 3�

CP5 F 5� GTTGATGAACATTCTTTACTATT 3�

CP5 R 5�GTTGATGAACATTCTTTACTATT 3�

HSP70 F 5� ACGGTCAACTTGCATTGG 3�

HSP70 R 5� CTAATGCTGCTGCTGTTG 3�

RPL27a-1 F 5� ACTCGTAGAAGAAGAGGACA 3�

RPL27a-1 R 5� TAAGCAGTAAGTTCGCAAGC 3�

Act F 5� GAGGATATGCTTTCACCACT 3�

Act R 5� ATAGCTGGTCCAGATTCATC 3�

A. Debnath et al. / Experimental Parasitology 110 (2005) 214–219 217

due to synthesis of collagenolytic activity. Collagenolyticactivity of E. histolytica has been well characterized andis shown to be associated with amoebic pathogenicity(Leon et al., 1997; Munoz et al., 1984). However, knowl-edge on gene(s) that are diVerentially expressed duringthis interaction is not known. So, we attempted to iden-tify and characterize the gene(s) that were diVerentiallyoverexpressed in E. histolytica during human collagentype I and Ca2+ interaction. To achieve this, diVerentialdisplay reverse transcription PCR approach was under-taken. The technique had been used successfully to com-pare diVerential RNA expression in stress inducedversus non-induced trophozoites, and trophzoites recov-ered from acute liver abscess versus normal trophozo-ites. However, the amoeba genes identiWed in the presentstudy were diVerent from those identiWed in E. histoly-tica trophozoites under iron-limitation and in abscessrecovered amoebae. The level of expression was con-Wrmed by RT-PCR using four speciWc primers andNorthern blot assay. Knowledge of this response willhelp us our understanding of molecular pathogenicity ofE. histolytica.

During initial standardization 2-h interaction ofE. histolytica with human collagen type I and Ca2+ wasfound optimal for maximum RNA synthesis, thereforeall experiments were performed with RNA isolated after2 h incubation of E. histolytica with human collagen typeI and Ca2+. Among the arbitrary primers used in diVer-ential display, good ampliWcation, and clear diVerencesbetween autoradiogram of collagen treated anduntreated cells were observed with T12VA, H-T11G, PD1,PD2, and H-AP37 primers (Table 1). To avoid the possi-bility of losing rare mRNA species and to minimize

errors in the PCR, all reactions were carried out in dupli-cate and with the same lot of reagents (Liang et al.,1993). Four cDNA bands in the range of 400–500 bpwere observed to be diVerentially overexpressed in colla-gen type I and Ca2+ activated E. histolytica compared tonon-activated E. histolytica by T12VA, PD1, and PD2(Figs. 1A and B), and H-T11G and H-AP37 oligos (Fig.1C).

Northern analysis also substantiated above results(Fig. 2) and these observations were further conWrmedby same level of expression of housekeeping gene, i.e.,E. histolytica actin. Though downregulation of somecDNA fragments in collagen treated E. histolytica wasalso observed they were not considered for further anal-ysis because our main interest was to Wnd out gene(s)that were upregulated by collagen interaction. BLASTsearches in EMBL and GenBank revealed that thediVerentially expressed amplicons belonged to amoebagenome and homology with E. histolytica DNAsequences. The nucleotide and amino acid sequences ofcDNA fragment AD1 showed 100% identity withamoebapore C gene and its encoded protein, respec-tively. Clone AD2 showed 97 and 93% similarity atnucleotide and amino acid level, respectively, to E. his-tolytica cysteine proteinase 5 protein. Nucleotidesequence of cDNA fragment AD3 showed 97% similar-ity to E. histolytica heat shock protein 70 gene andcDNA fragment AD4 showed 97% nucleotide similarityand 68% similarity at amino acid level, to E. histolyticaribosomal protein L27a.

It is well established that the critical eVector mole-cules for E. histolytica-mediated cytolysis includeamoebapores, a family of three 77-amino acid peptides

Fig. 1. DiVerential display patterns of RNA from human collagen type I and Ca2+ activated and non-activated E. histolytica trophozoites. TotalRNA isolated from non-activated E. histolytica (N) and collagen-activated E. histolytica (A) were reverse transcribed with oligo(dT) (as indicated)and PCR ampliWed by arbitrary primers (as indicated) in the presence of [�-33P]dATP, as described in text (A–C). The cDNA products were resolvedon a 6% polyacrylamide/50% urea/1£ TBE gel and visualized by autoradiography. Arrows indicate a portion of the gel where RNA species of twoconditions showed major diVerences.

218 A. Debnath et al. / Experimental Parasitology 110 (2005) 214–219

capable of forming pores in lipid bilayers (Leippe et al.,1991). Although both pathogenic E. histolytica and non-pathogenic E. dispar possess pore-forming proteins,diVerences in content, structure, and activity may berelated to their diVerent pathogenic behavior (Nickel et al.,1999). The upregulation of E. histolytica amoebapore Cdue to collagen activation might result in enhancedrelease of amoebapore from cytoplasmic granules com-pared to non-pathogenic E. dispar, which is believed tocontribute to E. histolytica pathogenicity.

Cysteine proteinases that are released by E. histolyticatrophozoites play a key role in the invasion and inXam-mation of the gut. The diVerential display results fromthe present study show an overexpression of gene encod-

Fig. 2. Northern hybridization pattern of E. histolytica RNA fromnon-activated (lane 1) and collagen type I and Ca2+ activated tropho-zoites (lane 2). (A) Northern blot analysis. Probes used for hybridiza-tion were labeled with 32P. The data shown are representatives of threeindependent experiments. (B) Densitometric analysis of relative inten-sity of the induced mRNA.

ing for CP5 protein due to collagen interaction, suggest-ing its role in gut invasion as well as inXammation.

Another diVerentially expressed transcript showedhomology to a heat-shock 70-kDa protein. Cells synthe-size heat shock proteins not only in response to heat, butalso to various other stressful stimuli. The cytoprotectivecapacity of heat shock proteins has been attributed, totheir ability to recognize proteins that are not yet in theirnative conformation or that are denatured.

The sequences of clone AD4 resemble with ribosomalprotein L27a, a multi-copy gene family. Earlier studyhad shown that it is the most abundantly transcribed

Fig. 3. RT-PCR ampliWcation of RNA from non-activated E. histoly-tica (lane 1) and collagen-activated E. histolytica (lane 2). (A) PCRproducts as seen on agarose gel. The data shown here are representa-tives of three independent experiments. Internal primers were used toamplify designated fragments showing homology to amoebapore C(clone AD1), cysteine proteinase 5 (clone AD2), HSP70 (clone AD3),and RPL27a-1 (clone AD4). Actin fragment was used as loading con-trol. (B) Ethidium bromide-stained PCR products were photographedand then images were analyzed.

A. Debnath et al. / Experimental Parasitology 110 (2005) 214–219 219

protein-coding genes in E. histolytica. These genes are ofconsiderable interest due to the presence of introns,which were assumed to be rare in E. histolytica (Will-hoeft et al., 2001). The overexpression of ribosomal pro-tein L27a by collagen interaction suggests the generalactivation of protein synthesis.

The results of expression by RT-PCR using amoeba-pore C, cysteine proteinase 5, heat-shock protein 70, andribosomal protein large subunit 27a primers are shownin Fig. 3. No ampliWcation was observed in control reac-tions where reverse transcriptase was omitted, butdiVerent levels of expression were observed in collagen-activated cell with speciWc primers, thereby conWrmingthe outcomes of diVerential display results. RT-PCR wasfound more useful during expression study, e.g., cloneAD2 showed very little or almost no expression of cys-teine proteinase 5 in non-activated cells during northernhybridization (Fig. 2), but when clone-speciWc primerwas used in RT-PCR, there was an obvious expressionof cysteine proteinase 5 in non-activated cells (Fig. 3).This might explain the diVerences of the increase of AD2transcript due to collagen interaction in Northernhybridization and RT-PCR.

In conclusion, the data clearly highlight the molecularconsequences of collagen treatment on E. histolytica andprovide the conWdence that the collagen-responsivegenes encode proteins that might be relevant to the viru-lence and stress response of the parasite. This also sup-ports the hypothesis that a genetic program is stimulatedby interaction with extracellular matrix. The identiWca-tion of diVerential expression patterns of collagen-acti-vated and non-activated E. histolytica trophozoites isnot only important for understanding the mechanismsof virulence and pathogenesis in amoebiasis, but couldlead to the development of eVective vaccines, diagnosticapplications, and drug treatments.

Acknowledgments

We thank Dr. James H. McKerrow for critical read-ing of the manuscript. This study was supported by aresearch grant from the Indian Council of MedicalResearch [No. 5/8-1(142)/TF/NICED/99-ECD-II] andDepartment of Science and Technology, Govt. of India[No. DST SP/SO/ D-82/98].

References

Bruchhaus, I., Roeder, T., Lotter, H., Schwerdtfeger, M., Tannich, E.,2002. DiVerential gene expression in Entamoeba histolytica isolatedfrom amoebic liver abscess. Molecular Microbiology 44, 1063–1072.

Diamond, L.S., Harlow, D.R., Cunnick, C.C., 1978. A new medium forthe axenic cultivation of Entamoeba histolytica and other Ent-amoeba. Transactions of the Royal Society of Tropical Medicineand Hygiene 72, 431–432.

Leippe, M., Sebastian, E., Schoenberger, O.L., Horstmann, R.D.,Muller-Eberhard, H.J., 1991. Pore-forming peptide of pathogenicEntamoeba histolytica. Proceedings of the National Academy ofSciences USA 88, 7659–7663.

Leon, G., Fiori, C., Das, P., Moreno, M.A., Tovar, R., Sanchez-Salas,J.L., Munoz, M.L., 1997. Electron probe analysis and biochemicalcharacterization of electron-dense granules secreted by Entamoebahistolytica. Molecular and Biochemical Parasitology 85, 233–242.

Liang, P., Pardee, A.B., 1992. DiVerential display of eukaryotic messen-ger RNA by means of the polymerase chain reaction. Science 257,967–971.

Liang, P., Averboukh, L., Pardee, A.B., 1993. Distribution and cloningof eukaryotic mRNAs by means of diVerential display: reWnementsand optimization. Nucleic Acids Research 21, 3269–3275.

McCoy, J.J., Mann, B.J., Petri Jr., W.A., 1994. Adherence and cytotox-icity of Entamoeba histolytica or how lectins let parasites stickaround. Infection and Immunity 62, 3045–3050.

Munoz, M.L., Calderon, J., Rojkind, M., 1982. The collagenase of Ent-amoeba histolytica. Journal of Experimental Medicine 155, 42–51.

Munoz, M.L., RojKind, M., Calderon, J., Tanimoto, M., Arias-Negr-ete, S., Martinez-Palomo, A., 1984. Entamoeba histolytica: collage-nolytic activity and virulence. Journal of Protozoology 31, 468–470.

Nickel, R., Ott, C., Dandekar, T., Leippe, M., 1999. Pore-forming pep-tides of Entamoeba dispar. Similarity and divergence to amoebap-ores in structure, expression, and activity. European Journal ofBiochemistry 265, 1002–1007.

Park, S.J., Li, S.M., Lee, J., Yong, T.S., 2001. DiVerential gene expres-sion by iron-limitation in Entamoeba histolytica. Molecular andBiochemical Parasitology 114, 257–260.

Perez, E., Munoz, M.L., Ortega, A., 1996. Entamoeba histolytica:involvement of pp125FAK in collagen-induced signal transduction.Experimental Parasitology 82, 164–170.

Perez, E., Munoz, M.L., Ortega, A., 1998. Entamoeba histolytica: colla-gen-induced AP-1 DNA binding activity. FEMS Microbiology Let-ters 159, 187–192.

Perreault, N., Herring-Gillam, F.E., Desloges, N., Belanger, I., Pageot,L.P., Beaulieu, J.F., 1998. Epithelial vs mesenchymal contributionto the extracellular matrix in the human intestine. Biochemical Bio-physical Research Communications 248, 121–126.

Salazar, I., Ortega, A., Das, P., Sanchez-Salas, J.L., Munoz, M.L., 1997.DiVerential display of mRNAs from Entamoeba histolytica duringelectron dense granules secretion. Archives of Medical Research 28,S190–S192.

Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A LaboratoryManual, third ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY pp. 7.42–7.44.

Stanley, S.L., Reed, S.L., 2001. Microbes and microbial toxins: para-digms for microbial mucosal interactions VI. Entamoeba histoly-tica: parasite–host interactions. American Journal of PhysiologyGastrointestinal Liver Physiology 280, 1049–1054.

Sturtevant, J., 2000. Applications of diVerential-display reverse tran-scription-PCR to molecular pathogenesis and medical mycology.Clinical Microbiology Reviews 13, 408–427.

Willhoeft, U., Campos-Gongora, E., Touzni, S., Bruchhaus, I., Tannich,E., 2001. Introns of Entamoeba histolytica and Entamoeba dispar.Protist 152, 149–156.

World Health Organization, 1998. The World Health Report 1998.Life in the 21st Century: A Vision for All. World Health Organiza-tion, Geneva, Switzerland.