Engineering!aNi(II)-independentNikR!to!determine!the!role!of!the! … · 2015-08-31 · ! ! !!1!...

i

Engineering a Ni(II)-‐independent NikR to determine the role of the α3-‐helix in the mechanism of Ni(II)-‐activated DNA binding

by

Mauli Thakkar

A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Chemistry

University of Toronto

© Copyright by Mauli Thakkar 2015

ii

ii

Engineering a Ni(II)-‐independent NikR to determine the role of the α3-‐

helix in the mechanism of Ni(II)-‐activated DNA binding

Mauli Thakkar

Master of Science

Graduate Department of Chemistry University of Toronto

2015

Abstract

Intracellular nickel concentration in Escherichia coli is controlled by a transcription

factor called NikR, which represses the nikABCDE operon, encoding a nickel specific

transporter. The crystal structure of NikR-‐DNA complex reveals that nickel binding in the

metal-‐binding domain (MBD) stabilize α3-‐helix that could promote DNA binding. To

provide biochemical evidence for the role of the stabilized α3-‐helix in the proposed

mechanism, the goal of this study was to engineer a NikR mutant that is able to bind to the

nik promoter in the absence of nickel. To achieve this goal, two cysteine residues were

introduced at positions 70 and 77 in the MBD of NikR, and several crosslinkers were used

to organize the α3-‐helical region. The presented data demonstrate that the crosslinked

variants were incapable of binding DNA, suggesting that either the α3-‐helix was not

sufficiently stabilized or that the stabilized α3-‐helix alone is not sufficient to activate DNA

binding.

iii

iii

Acknowledgements No thesis is solely the work of one person, and it is a pleasure to thank the many people who

made this thesis possible.

First and foremost, I acknowledge with immense gratitude, my sincere obligation to my

supervisor, Prof. Deborah Zamble, for her kind help, excellent guidance, stimulating

motivation, infinite patience, and for her confidence in me throughout this study. I could

not have imagined having a better advisor and mentor for my graduate studies. Thank you

for providing me an opportunity to study under your supervision. It was truly an honor.

I am very much grateful to Prof. Jumi Shin, for her insightful comments and advice in

writing of this thesis. Thank you kindly.

I sincerely thank Dr. Matthew Forbes, for the genuine interest in the progress of my work

and for the delightful encouragement and generous assistance provided by him.

My appreciation also extends to my seniors and fellow laboratory colleagues. Your

mentoring, stimulating debates, wholehearted co-‐operation and help during the course of

my work have been especially valuable. Thank you so much.

Above ground, I am indebted to my mommy and daddy for their profound love and

boundless support in whatever I pursue. You always allowed me to be as ambitious as I

wanted and never let me stray from my goals. Your value to me only grows with age and I

do not think words are powerful enough to express my gratitude to you.

Lastly, I register my heartfelt tribute to my bestie, Chintan. Thank you for always standing

by my side and supporting me. But even more than that, thank you for trusting and

believing in me, even when I couldn’t. I could not have done this without you!

Mom, Dad, and Chintan

I love you three immensely, and with my warmest affection, I dedicate this thesis to you.

iv

iv

Table of Contents

Abstract ii

Acknowledgements iii

Table of Contents iv

List of Abbreviations v

List of Tables vi

List of Figures vii

1. Introduction 1

1.1 Role and Regulation of Nickel in Biological Systems 1

1.2 Metal Regulatory Protein, NikR 1

1.3 Escherichia coli NikR 1

1.4 Nickel Induced DNA binding by NikR 4

1.5 Purpose of Study 4

1.6 Selection of Residues to be Introduced 6

1.7 Selection of Mutation Site 6

1.8 Selection of Crosslinkers 7

2. Experimental 9

2.1 Materials 9

2.2 Methods 9

3. Results 17

3.1 Characterization of the Nickel-‐Binding Abilities of the NikR Mutants 17

3.2 Characterization of the Secondary Structure of the NikR Mutants 22

3.3 Trypsin and Glu-‐C Protease Digestion 25

3.4 The DNA-‐Binding Activities of the NikR Mutants in vitro 25

4. Discussion 27

5. Conclusion and Future Work 32

6. References 33

7. Appendix 37

v

v

List of Abbreviations

BSBCA: 3,3‘-‐bis(sulfo)-‐4,4‘-‐bis(chloroacetamido)azobenzene

BMH: bis(maleimido)-‐hexane

BMOE: bis(maleimido)-‐ethane

CD: circular dichroism

DBD: DNA-‐binding domain

DTNB: 5,5'-‐dithiobis-‐(2-‐nitrobenzoic acid)

DTT: dithiothreitol

E. coli: Escherichia coli

EDTA: ethylenediaminetetraacetic acid

EMSA: electrophoretic mobility shift assay

FPLC: fast protein liquid chromatography

IGEPAL: octylphenoxypolyethoxyethanol

IPTG: isopropyl-‐β-‐D-‐thiogalactopyranoside

LB: lysogeny broth

MutNikR: Mutant (R70C/ H77C) NikR

MBD: metal-‐binding domain

MRE: mean residue ellipticity

NTA: nitrilotriacetic acid

PAR: 4-‐(2-‐pyridylazo)resorcinol

PDB: protein data bank

PCR: polymerase chain reaction

RHH: ribbon-‐helix-‐helix

SDS PAGE: sodium dodecyl sulfate polyacrylamide gel electrophoresis

TB: tris-‐borate

TCEP: tris(2-‐carboxyethyl)phosphine

Tris: tris(hydroxymethyl)aminomethane

vi

vi

List of Tables

Table 2-‐1. PCR primers 11

Table 2-‐2. Calculated and observed molecular weights of WT NikR and MutNikR

Proteins 12

Table 2-‐3. Relevant crosslinker physical data 15

Table 3-‐1. Comparing mean residue ellipticity (MRE) ratio (between 208 nm and 220 nm)

of NikR proteins 23

vii

vii

List of Figures

Figure 1-‐1. Function of E. coli NikR 2

Figure 1-‐2. Ribbon diagram of the apo-‐NikR tetramer colored by polypeptide chain 3

Figure 1-‐3. Structure of E. coli NikR in complex with DNA 3

Figure 1-‐4. Proposed mechanism of the nickel-‐selective activation of E. coli NikR 5

Figure 1-‐5. Structure of E. coli NikR showing positions of residues selected for

mutation in the α3 sequence 6

Figure 1-‐6. Chemical structure of the azobenzene crosslinker, 3,3‘-‐bis(sulfo)-‐4,4‘-‐

bis(chloroacetamido)azobenzene (BSBCA) 8

Figure 1-‐7. Model of a crosslinked R70C/H77C MutNikR 8

Figure 3-‐1. Nickel titration and difference spectrum of WT NikR 18

Figure 3-‐2. Nickel titration and difference spectrum of MutNikR 20

Figure 3-‐3. Nickel titration of BMOE-‐crosslinked and BMH-‐crosslinked MutNikR 21

Figure 3-‐4. Circular dichroism spectra of WT NikR and MutNikR proteins 23

Figure 3-‐5. Thermal denaturation of apo-‐MutNikR monitored by circular dichroism

spectroscopy 24

Figure 3-‐6. in vitro DNA-‐binding activities of WT NikR and MutNikR in excess nickel 26

Figure 3-‐7. in vitro DNA-‐binding activities of WT NikR and MutNikR in the

absence of nickel 26

Figure 4-‐1. A model showing orientation of α3-‐helix and α4-‐helix in the presence of

nickel 30

Figure 7-‐1. Mass spectrum of WT NikR and MutNikR 37

Figure 7-‐2. Mass spectrum of MutNikR protein crosslinked with the azobenzene

crosslinker (BSBCA) 38

Figure 7-‐3. Mass spectrum of MutNikR protein crosslinked with the sulfhydryl

crosslinkers 39

1

1. Introduction

1.1 Role and Regulation of Nickel in Biological Systems

Nickel is an essential trace element required by many bacteria, fungi, and plants for a

variety of biological processes.1-‐4 The chemical properties of nickel provide activities for

important bacterial enzymes, making it indispensible for their survival.5-‐7 Despite being a

vital nutritional requirement, excess nickel can replace cognate metals in iron and zinc

enzymes, induce allosteric inhibition of enzymes or can activate indirect oxidative stress,

making it toxic.8,9 To avoid deleterious buildup of nickel, organisms have developed

intricate mechanisms that tightly regulate nickel concentrations in the cell.7,10,11 One of the

mechanisms involves metal-‐responsive transcription factors that regulate genes encoding

the metal importing proteins in response to direct metal binding.12 A well-‐studied example

of such a nickel-‐responsive metalloregulator is NikR.13-‐15

1.2 Metal Regulatory Protein, NikR

A nickel-‐responsive repressor protein, NikR regulates metal homeostasis at the

transcriptional level.16,17 In E. coli, higher intracellular nickel concentrations deactivate

nickel import through Ni2+-‐NikR mediated repression of the nikABCDE operon, encoding a

nickel-‐specific ATP-‐binding cassette membrane transporter (Figure 1-‐1).15-‐17 NikR is a

member of the ribbon-‐helix-‐helix (RHH) family of DNA-‐binding proteins, which has an N-‐

terminal DNA-‐binding domain (DBD) and a C-‐terminal metal-‐binding domain (MBD).18 The

protein is a functional tetramer, consisting of four central C-‐terminal MBD in the core

connected to two flanking RHH DBDs through a flexible linker (Figure 1-‐2).19-‐21

1.3 Escherichia coli NikR

E. coli NikR can bind one Ni(II) per monomer with KD = 0.9 pM19,22 in its high-‐

affinity site and additional Ni(II) with a KD ≈ 30 nM in its low-‐affinity site.23 The two sites

allow EcNikR to bind to the palindromic operator sequence (GTATGA-‐N16-‐TCATAC) in the

nikABCDE promoter (Pnik) with two different affinities. When the high-‐affinity site is

2

occupied by Ni(II), EcNikR can bind the nik promoter with KD ~ 5 nM19,23,24 and this

complex tightens to KD ~ 20 pM upon binding of additional Ni(II) in its low-‐affinity site.23,24

In the high-‐affinity site of EcNikR, the nickel is coordinated in a square planar geometry

with His87, His89 and Cys95 from one monomer, and His76’ from an adjacent monomer

(Figure 1-‐3).7,20,21,25 The low-‐affinity site is less well defined, but it is believed to include

His48 and His110 and nearby carboxylate ligands, located between the MBD and DBD.26

The importance of low-‐affinity site is not clear, and this study will focus on the activity of

the high-‐affinity site.

Figure 1-‐1. Function of E. coli NikR. The nickel-‐binding protein NikA binds Ni2+ in the periplasm and transfers it to the permease components, NikB & NikC. The ATP-‐binding components NikD & NikE hydrolyze ATP to provide energy for the transport process of Ni(II) across the inner membrane. When nickel is available in excess, nickel-‐bound NikR represses the transcription of the nikABCDE and of its own gene, which is downstream of the nik operon. The periplasmic nickel-‐binding protein (NikA) and the gene are in blue, the transmembrane domains of the ABC transporter and genes encoding them are in red, the cytoplasmic ATP-‐binding proteins and genes are in green, the NikR regulatory protein and gene are in yellow and nickel ions are in orange.27 This figure is adapted from reference #27.

Transcription

3

Figure 1-‐2. Ribbon diagram of the apo-‐NikR tetramer colored by polypeptide chain (PDB 1Q5V). Domains are labeled as either ribbon-‐helix-‐helix (RHH) domain (DNA-‐binding domain) or Ni(II)-‐regulatory domain (metal-‐binding domain).20 The region encoding α3-‐helix is not resolved in three out of four monomers (dashed circles). The image was generated using Chimera.

Figure 1-‐3. Structure of E. coli NikR in complex with DNA (PDB 2HZV). The tetrameric NikR binds four Ni(II) ions in a square planar geometry with Cys95, His87, His89 from one monomer and His76’ from an adjacent monomer. Upon Ni(II) binding, organization of the α3-‐helix allows for non-‐specific DNA contacts to be made, thereby localizing the protein to the DNA.7 Nickel and potassium are shown in yellow and orange spheres, respectively. The images were generated using Chimera.

α3

Ribbon-‐helix-‐helix domain

Ribbon-‐helix-‐helix domain

N-‐terminal DNA-‐binding domain

N-‐terminal DNA-‐binding domain

C-‐terminal metal-‐binding domain

α3

Ni(II)-‐regulatory domain

4

1.4 Nickel Induced DNA binding by NikR

The specific details of the mechanism of nickel-‐activated DNA binding by NikR are

not clear. However, the crystal structure of EcNikR in the apo-‐ and holo-‐forms (high-‐

affinity site occupied) demonstrate that nickel binding induces organization of the

previously unstructured α3-‐helix, increasing the α-‐helical content.19-‐21 Ordering of the α3

helices upon nickel binding is also supported by circular dichroism (CD) experiments that

show an increase in the α-‐helical content of NikR upon binding of stoichiometric amounts

of nickel.19,22,28 The formation of this helix is proposed to allow several non-‐specific

protein contacts between K64/R65 residues in the metal-‐binding domain and the DNA,

thereby localizing the protein to DNA where the protein can undergo a one-‐dimensional

search for the nik promoter.21,29,30 The binding of potassium ions at the site between the

MBDs and DBDs helps to stabilize the “down-‐cis” conformation and is critical for Ni(II)-‐

responsive DNA binding.31,32 Once the “down-‐cis” conformation is achieved, NikR then

makes specific DNA contacts that induce tighter DNA binding, repressing transcription of

the nikABCDE operon.

1.5 Purpose of Study

Although the crystal structures of NikR support a role for the α3-‐helix in the

mechanism of nickel-‐activated DNA binding, no direct biochemical evidence is available.

Residues in the MBD are protected from protease digestion in the presence of nickel and

the α-‐helicity of NikR increases upon nickel binding (revealed by CD), but these

experiments do not necessarily prove the importance of the stabilized α3-‐helix in metal-‐

mediated DNA binding.19,22,33 The aim of this study was to understand the role of the α3-‐

helix in nickel-‐responsive DNA binding by engineering a variant of EcNikR that is capable

of Ni(II)-‐independent DNA binding. To achieve this, a stable helix was synthesized via

chemical crosslinking where two amino acids in the helix were linked by a molecule with

appropriate end-‐to end distances to trap the protein in the ‘active conformation’. Once the

helix was stabilized through the crosslinker, the properties of holo-‐WT NikR and the apo-‐

crosslinked mutant were compared, with a focus on DNA-‐binding properties. If the

5

assumption that stabilization of the α3-‐helix induces NikR to bind the nik promoter is

correct, then the DNA-‐binding properties of WT NikR in the presence of nickel and

crosslinked mutant NikR in the absence of nickel were expected to be nearly the same

(Figure 1-‐4).

Figure 1-‐4. Proposed mechanism of the nickel-‐selective activation of E. coli NikR. Apo-‐NikR (PDB 1Q5V) binds stoichiometric amount of nickel (green spheres with white border), which stabilizes the α3-‐helix. This allows Ni(II)-‐NikR to localize onto the DNA through non-‐specific electrostatic interactions (PDB 2HZV). Upon binding of potassium ions (purple spheres), the “down-‐cis” conformation of DNA-‐binding domains locks NikR onto DNA, making specific contacts, allowing NikR to then repress transcription of nikABCDE operon. 14 The circled regions show the α3-‐helix that is disordered in the absence of nickel, but completely ordered in the presence of nickel. The image was generated using Chimera.

α3

4 Ni2+ DNA

K+ ions

Apo-‐NikR

Ni2+-‐NikR

Ni2+-‐NikR + DNA + K+

6

1.6 Selection of Residues to be Introduced

The thiol group of cysteine is amenable for site-‐directed crosslinking because it is

nucleophilic and can readily react with a variety of electrophiles. WT NikR contains two

cysteines at positions 95 and 128; however, neither is located in the α3 sequence (residues

63-‐79). To stabilize the α3-‐helical region by crosslinking, a mutant NikR was developed by

introducing two cysteine residues in the MBD by mutagenesis (performed previously by

Johanna Helmstadter).

1.7 Selection of Mutation Site

In mutant NikR protein, two cysteines were introduced at positions 70 and 77

(R70C/ H77C) in the α3-‐helix (Figure 1-‐5). These residues were chosen because they are

solvent exposed and should easily react with the crosslinker, even when the protein is fully

folded. Also, these mutated residues have no known functional or structural role, so we

predicted that the characteristics and overall folding of the mutant protein would be

unaffected. Moreover, these residues represent positions i and i+7, which are amenable to

crosslinking for the stabilization of the α3-‐helix.34

Figure 1-‐5. Structure of E. coli NikR showing positions of residues selected for mutation in the α3 sequence (PDB 1Q5V). The residues R70 and H77 in the MBD are present on the surface and introduced cysteines in these positions would easily react with the crosslinker. In this figure, only a part of the NikR protein is shown for clarity.

7

1.8 Selection of Crosslinkers

Azobenzene based crosslinkers have been previously used to control the structure

and function of α-‐helical containing proteins.34 Azobenzene and its derivatives exist in two

conformations (cis and trans) and can reversibly convert between forms upon absorption

of light of ~340 nm (exact wavelength depending on side groups of the linker).34 The trans

conformation of azobenzene is more stable and dominates in the dark at equilibrium, and

the cis isomer can be produced by irradiation with light.34 This enables azobenzenes to be

used as a ‘photoswitch’ that can undergo reversible photochemistry, such that many

rounds of switching between active/inactive states in biological systems can be achieved.34

The first crosslinker selected for crosslinking mutant NikR in this study is 3,3‘-‐bis(sulfo)-‐

4,4‘-‐bis(chloroacetamido)azobenzene (BSBCA), as shown in Figure 1-‐6. The cis

conformation of this crosslinker (obtained upon irradiation of 370 nm light) is

hypothesized to stabilize the α3-‐helix when attached to two cysteine residues with an i

and i+7 spacing.34 Modelling with the holo-‐NikR crystal structure suggested that an

azobenzene crosslinker introduced at R70C/H77C would be small enough not to interfere

with DNA binding (Figure 1-‐7). The expectation was to observe light-‐dependent reversible

DNA binding in the crosslinked mutant NikR without nickel. DNA binding would therefore

be much more effective in the light state versus the dark state, which should show very

weak or unobservable binding.

Other sulfhydryl-‐to-‐sulfhydryl crosslinkers with different arm lengths were also selected

to see whether irreversible stabilization of the α3 sequence attained the same desired DNA

binding in the absence of nickel.

8

Figure 1-‐6. Chemical structure of the azobenzene crosslinker, 3,3‘-‐bis(sulfo)-‐4,4‘-‐bis(chloroacetamido)azobenzene (BSBCA). Upon irradiating the trans isomer (dark state) with 370 nm UV light, the conformation of the linker is reversibly changed to the cis state. Once the light is removed, the cis isomer switches back to its relaxed form, trans state.34

Figure 1-‐7. Model of a crosslinked R70C/H77C MutNikR. Only one attached crosslinker is modeled here, but in practice all four monomer of the functional tetramer are expected to possess a crosslinker. The model is prepared by M. D. Jones.

9

2. Experimental

2.1 Materials

All chemicals were analytical or molecular biology grade and purchased from Sigma

Aldrich, except where noted. All enzymes, primers, and sequencing grade proteases were

purchased from New England Biolabs, Integrated DNA Technologies and Roche Chemicals,

respectively. Dr. P. Chivers (Department of Chemistry and Biochemistry, Durham, UK) and

Dr. G. A. Woolley (Department of Organic and Biological Chemistry, University of Toronto,

ON.) generously donated the plasmids (pNIK103 and pPC163)24 and an azobenzene

crosslinker (3,3‘-‐bis(sulfo)-‐4,4‘-‐bis(chloroacetamido)azobenzene (BSBCA) respectively.34

Sulfhydryl crosslinkers were purchased from VWR International. All samples and solutions

were prepared using 18.2 ΜΩ-‐cm resistance (Millipore) water, and the pH of all buffers

was adjusted using either HCl or NaOH at room temperature. Electronic absorption

measurements were conducted on an Agilent 8453 spectrophotometer with a 1-‐cm-‐

pathlength cuvette.

2.2 Methods

Vector Construction

The R70C/H77C NikR (mutant) plasmid was previously constructed by Johanna

Helmstadter using the primers listed in Table 2-‐1 from the pNIK103 plasmid by Phusion

PCR (Thermo Fisher Scientific). DNA sequencing (ACGT, Toronto, Ontario) was used to

confirm the accuracy of the mutagenesis using T7 promoter and terminator primers.

Protein expression and purification

For expression of wild type (WT) and mutant NikR, the plasmids were transformed

into BL21 (DE3)* E. coli cells (Invitrogen) by heat shock. Overnight cultures were grown

and 25 mL was used to inoculate 1.5 L of lysogeny broth (LB) medium supplemented with

10

100 μg/mL ampicillin. The cells were grown aerobically at 37 °C until the OD600 reached

0.6 -‐ 0.8, at which point they were induced with 330 μM isopropyl β-‐D-‐1-‐

thiogalactopyranoside (IPTG). After shaking at 37 °C for an additional 3 h, the cells were

harvested by centrifugation and resuspended in 30 mL of 20 mM

Tris(hydroxymethyl)aminomethane (Tris), pH 7.5, and 100 mM KCl. For a single protein

purification preparation, a total of 3 L of cell culture was used. All subsequent steps were

performed at 4 °C or on ice. The resuspended cells were lysed by sonication. The lysate

was centrifuged at 18 000 x g for 45 min and the supernatant was retained. NiSO4 (10 mM

stock solution in H2O) was added to the supernatant to a final concentration of 50 μM

followed by the addition of imidazole (pH 7.5) to a final concentration of 10 mM. The

supernantant was loaded onto a Ni(II) – nitrilotriacetic acid (NTA) column (Qiagen) that

had been pre-‐equilibrated with 10 volumes of Equilibration buffer (100 mM potassium

phosphate, 500 mM NaCl and 10 mM imidazole, pH 8). Two milliliters of Ni(II) – NTA resin

was used per liter of initial cell culture. After loading, the column was washed with 5

volumes of equilibration buffer, and bound protein was eluted with 2 column volumes of

Elution buffer (100 mM potassium phosphate, 10 mM Tris and 250 mM imidazole, pH 7.6).

Ethylenediaminetetraacetic acid (EDTA) (0.5 M stock, pH 8) was added to the eluate to a

final concentration of 2 mM for the preparation of apo-‐protein. The solution was dialyzed

against 20 mM Tris, pH 7.6, 1 mM dithiothreitol (DTT) and 2 mM EDTA (in case of apo-‐

preparation) for at least 5 h. The dialyzed protein solution was loaded onto a fast protein

liquid chromatography (FPLC) UnoQ (BioRad) anion exchange column, initially

equilibrated in 20 mM Tris, pH 7.6 and eluted with a linear NaCl gradient (NikR eluted

near 350 mM NaCl). While purifying MutNikR, 10 mM TCEP, pH 7.5, was added to the

lysate before sonication, 5 mM DTT to the dialysis buffer, and 10 mM TCEP, pH 7.5, to the

FPLC buffers to prevent cysteine residues from being oxidized.

The fractions from the NaCl gradient were analyzed by 12.5 % SDS-‐PAGE, and those

containing the protein of interest were pooled. Following concentration of the pooled

fractions to 2 mL using Amicon Ultra 3K MWCO centrifuge concentrators (Millipore), the

protein concentrations were calculated by using the calculated extinction coefficient of

4470 M-‐1 cm-‐1 for both WT and mutant NikR at 280 nm in protein buffer (20 mM Tris, 100

11

mM KCl, pH 7.6).35,36 A sample of each protein was sent for electrospray ionization mass

spectrometry (AIMS; Department of Chemistry, University of Toronto) to confirm the

molecular mass of the protein. The determined molecular weights of the WT and the

mutant were 15093.0 and 15006.5 Da, which correspond to their calculated molecular

masses of 15093.7 and 15006.7 Da respectively (Table 2-‐2; Figure 7-‐1). All proteins were

>90% pure as estimated by Coomassie-‐stained SDS-‐PAGE.

Table 2-‐1. PCR primers.

Primers

R70C/H77C NikR

Forward: 5'-‐/5Phosa/GAGACAATGCAGCTGGCTAAGTCGCG -‐3' Reverse: 5'-‐/5Phosa/CACCCAGCATTGTCACCACGACCTCTCCG -‐3’

100-‐bp DNA Probe

Forward: 5'-‐CGACTGCCCATCTATTGATCCAGAACAGG-‐3' Reverse: 5'-‐GGTAACCCCAATGGATTAAAATAGATGGCG-‐3'

171-‐bp DNA Probe

Forward: 5' -‐CGACAGTGTGCAATCGGCCGATTCAGTTAAC-‐3' Reverse: 5' -‐GAATCCGTAATCATTGTCGACAGCATGGTAACCC-‐3'

a5Phos indicates that the primer was phosphorylated at the 5' end.

The absence of any bound metal in apo-‐NikR was confirmed by a 4-‐(2-‐

pyridylazo)resorcinol (PAR) assay in which the protein was denatured with 4 M

guanidinium hydrochloride (GuHCl) and 50 μM PAR was added to the sample.37 The

absorbance at 500 nm, corresponding to the formation of a 2:1 PAR-‐Me(II) complex, was

monitored and compared to a standard curve prepared with 50 μM PAR in 4 M GuHCl and

known metal concentrations. The free thiol content of the proteins was quantified via

reaction of the proteins with 5,5'-‐dithio-‐bis(2-‐nitrobenzoic acid) (DTNB) in the presence

of 6 M GuHCl, and 1 mM EDTA. β-‐mercaptoethanol was used as a standard, and the

absorbance of the 5-‐mercapto-‐2-‐nitrobenzoic acid product was measured at 412 nm to

confirm the existence >90 % of the reduced form of the protein. The oxidation state of the

proteins was also monitored with N-‐ethyl-‐maleimide (NEM) assay where the cysteines

present in NikR were observed to be reduced (data not shown).38 If a higher level of

oxidation was measured, the protein was treated with 1 mM DTT for 24 h at 4 °C. The DTT

12

was removed by passing the protein over a PD-‐10 desalting column equilibrated with

protein buffer (20 mM Tris, 100 mM KCl, pH 7.6).

Table 2-‐2. Calculated and observed molecular weights of WT NikR and MutNikR proteins.

Calculated Mass (Da)

Observed Mass (Da)

WT NikR

15093.7

15093.0

R70C/H77C (Mutant) NikR

15006.7

15006.5

Mutant NikR-‐CR-‐BSBCAa

15459.7

15458.5

Mutant NikR-‐CR-‐BMOE

15226.7

15226.5

Mutant NikR-‐CR-‐BMH

15282.8

15283 a-‐CR-‐ indicates crosslinking of mutant NikR with the specified crosslinker. Information about the crosslinkers is presented in Table 2-‐3.

Nickel Titrations

A sample of 10 μM apo WT or mutant NikR was prepared in protein buffer (20 mM

Tris, 100 mM KCl, pH 7.6) supplemented with 10 mM glycine, pH 7.6. Separate aliquots of

apo-‐NikR were incubated with increasing amounts of NiSO4. After the addition of nickel,

the samples were allowed to equilibrate for at least 3 h at room temperature or overnight

at 4 °C. Nickel binding was monitored at 302 nm, with a background correction at 600 nm.

The extinction coefficients of the protein-‐nickel complexes were determined by plotting

the absorbance versus nickel concentrations, fitting the data into a straight line assuming

quantitative nickel binding.19,22

Circular Dichroism Spectroscopy

WT and mutant NikR samples were prepared for CD spectroscopy by buffer

exchanging the protein into 100 mM phosphate buffer, pH 7.6, using a PD-‐10 column. The

samples were then diluted to a final concentration of approximately 20-‐50 μM. For

samples containing nickel, 0.7 equivalents of NiSO4 was added to the diluted samples and

13

they were allowed to equilibrate overnight at 4 °C. All samples were analyzed on an Olis

RSM 1000 spectropolarimeter with a capped 1 mm pathlength cuvette in order to

minimize exposure to the air. Spectra were collected at 1 nm intervals over a spectral

range of 190-‐260 nm with an integration time of 2 sec. The final spectra obtained are

averages of three scans. The observed ellipticity was converted into mean residue

ellipticity ([θ]mre) (deg cm2 dmol-‐1) using the equation39 [θ]mre = [(MM/N-‐1) X θ]/ (c X l X

10)39, where MM is the molecular mass of the protein in Da, N is the number of amino acid

residues, θ is the measured ellipticity (degrees), c is the total protein concentration in

g/mL, and l is the cell path length.

Thermal denaturation samples were also prepared as described above. Spectra were

collected at 1 nm intervals over a spectral range of 190-‐260 nm with an integration time of

2 sec as the temperature was increased from 5 °C to 85 °C in 5 °C increments, with 1 min

equilibration time between temperature increases. The signal at 220 nm was used to

analyze the data and the observed ellipticity was converted into mean residue ellipticity as

described above and plotted versus temperature in °C.

Crosslinking Mutant NikR with an Azobenzene Crosslinker

A 200 – 350 μM solution of apo mutant NikR was incubated with 0 -‐ 0.75

equivalents of NiSO4 in 20 mM Tris, 10 mM glycine, pH 7.6, and four equivalents of tris(2-‐

carboxyethyl)phosphine (TCEP) for 30 min at room temperature. After the incubation

period, four equivalents of the 3,3‘-‐bis(sulfo)-‐4,4‘-‐bis(chloroacetamido)azobenzene

(BSBCA, Table 2-‐3) crosslinker (calculated as four times the concentration of the protein)

was added to the reaction mixture, and the sample was incubated at 42-‐47 °C for 18 h in

the presence or absence of 370 nm blue LED light. A sample of protein was sent for

electrospray ionization mass spectrometry (AIMS; Department of Chemistry, University of

Toronto) to confirm the molecular mass of the crosslinked protein. With 60% yield in this

reaction, the determined molecular weight of the crosslinked mutant protein was 15458.5

Da, which correspond to its calculated molecular mass of 15459 Da (for a single

modification) (Table 2-‐2; Figure 7-‐2).

14

Crosslinking Mutant NikR with Sulfhydryl Crosslinkers

A 100 μM solution of apo mutant NikR in 20 mM Tris, pH 7.6 was incubated with

7.5 mM EDTA, pH 7.6, and 3.25 equivalents of sulfhydryl crosslinker dissolved in DMSO

(Table 2-‐3) for 1 h at room temperature. A sample of protein was sent for electrospray

ionization mass spectrometry (AIMS; Department of Chemistry, University of Toronto) to

confirm the molecular masses of the crosslinked proteins. With >95% yield of the reaction,

the determined molecular weight of the crosslinked mutant proteins corresponded to

their calculated molecular masses, which correlated to a single modification (Table 2-‐2;

Figure 7-‐3).

Protease Digestion Experiments

A 30 -‐ 70 μM solution of apo-‐WT NikR was incubated with 0.8 equivalents of NiSO4

in 10 mM (4-‐(2-‐hydroxyethyl)-‐1-‐piperazineethanesulfonic acid) (HEPES), 100 mM KCl, pH

7.6 (treated with Chelex-‐100), for 1 h at room temperature. After an aliquot was removed

from the mixture to obtain a time-‐point for analysis at 0 h, trypsin (0.3 μM) or Glu-‐C (10

μM) was added and the reaction was left to proceed for 24 h at 37 °C. At 6 h and 24 h, 15

μL aliquots were removed, added to 4X SDS-‐PAGE loading buffer and stored at -‐20 °C. For

digestions with apo-‐ and crosslinked NikR, the same protocols were followed as described

above, except that instead of metal, 5 mM EDTA, pH 7.6 was added. Aliquots were

subjected to SDS-‐PAGE on 15%, 1.5 mm polyacrylamide Tris-‐Tricine (0.1% w/v SDS, 0.1 M

Tris, 0.1 M Tricine) gels and then stained with Coomassie Blue. Peptide fragments were

analyzed by electrospray ionization mass spectrometry (AIMS; Department of Chemistry,

University of Toronto) and fragments were identified by using the program MS-‐Digest.40

Electrophoretic Mobility Shift Assays (EMSAs)

The 100-‐bp DNA probe containing the nik promoter was PCR amplified from the

pPC163 plasmid using the primers listed in Table 2.1. The DNA probe was 5' end labeled at

both ends with γ-‐32P-‐ATP (Perkin Elmer) using T4 polynucleotide kinase and incubation

for 1 h 20 min at 37 °C followed by 30 min at 65 °C. Unincorporated nucleotides were

removed with a G-‐25 microspin column (GE Healthcare). The amount of label incorporated

15

was determined using a Packard Tri-‐Carb 2900TR Liquid Scintillation Counter (LSC). The

radiolabeled DNA (10,000 counts per minute (cpm)) was incubated with increasing

concentrations of apo-‐ and holo-‐NikR (the latter being protein loaded with stoichiometric

nickel) at room temperature for 1 h in the presence of binding buffer containing 20 mM

Tris, pH 7.5, 100 mM KCl, 3 mM MgCl2, 0.1% (v/v) octylphenoxypolyethoxyethanol

(IGEPAL), 5% glycerol, 0.1 mg/mL bovine serum albumin, and 0.1 mg/mL herring sperm

DNA (Promega). The reactions were resolved on a 6% native Tris-‐Borate (TB) (300 mM

borate and 75 mM Tris-‐HCl, pH 7.5) polyacrylamide gel containing either 35 μM NiSO4 or 1

mM EDTA for 3 hours at 350 V and 4°C after pre-‐running the gel for 25 min in TB running

buffer (300 mM borate and 75 mM Tris-‐HCl, pH 7.5, with either 35 μM NiSO4 or 1 mM

EDTA). The gel was vacuum-‐dried for 1 h and exposed overnight to a phosphor screen,

scanned with Pharos FXTM Plus Molecular Imager (BioRad) and analyzed with Quantity

One software.30

Table 2-‐3. Relevant crosslinker physical data.

Name of

Crosslinker

Type of

Crosslinker

Structure of Crosslinker

Molecular Weight (Da)

Mass added to mutant

(R70C/H77C) NikR (Da)

BSBCA 3,3‘-‐bis(sulfo)-‐

4,4‘-‐bis(chloroaceta-‐mido)azobenzene

Azobenzene

523.33

452.3a trans (dark)

cis (light)

λ = 370 nm Δ

31 Å

18 Å

16

aUpon reaction with the thiol groups of the cysteine side chains, the two chloride ions of BSBCA crosslinker are displaced giving the mass difference of 71 Da.

BMOE,

bis(maleimido)-‐ethane

Sulfhydryl

220.18

220.05

BMB 1,4-‐

bis(maleimido)-‐butane

Sulfhydryl

248.23

248.08

BMH

bis(maleimido)-‐hexane

Sulfhydryl

276.29

276.11

8 Å

10.9 Å

13 Å

17

3. Results

3.1 Characterization of the Nickel-‐Binding Abilities of the NikR Mutants

Due to the proposed role of NikR in the metal-‐regulatory pathway, whether the

protein could bind nickel was of utmost importance. After purification of apo-‐WT NikR and

apo-‐mutant NikR, their nickel-‐binding abilities were compared to learn if the mutant

protein (MutNikR) behaved similar to the WT NikR. Previous experiments have

demonstrated that upon incubation of WT NikR with stoichiometric amounts of nickel, an

intense electronic absorption band is observed at 302 nm.19,22 This absorption is

attributed to a Cys−S-‐ à Ni(II) ligand-‐to-‐metal charge transfer (LMCT).19,22,41 A plot of

absorbance at 302 nm versus nickel concentration yields a straight line with an extinction

coefficient of 7.2 x 103 M-‐1 cm-‐1.19,22,41 If the nickel-‐binding abilities of the MutNikR are not

compromised, then its nickel-‐binding plot would yield a similar extinction coefficient.

Upon titration of 10 μM apo-‐WT NikR with increasing amounts of nickel, a linear increase

in the 302 nm signal was observed with up to 0.8 equivalents of Ni(II), as seen in Figure 3-‐

1 (A). The linear portion of the titration yielded an extinction coefficient of (7 ± 2) x 103 M-‐

1 cm-‐1 after three independent replicates, in agreement with the literature values.22 The

difference spectrum obtained by subtracting the signal of apo-‐WT NikR from that of WT

NikR loaded with increasing amounts of Ni(II), shows this increase in charge-‐transfer band

is centered at 302 nm (Figure 3-‐1 (B)).

In previous experiments, the yield of the crosslinking reaction of purified apo-‐MutNikR

upon incubation with BSBCA was low (~50%) (data not shown; performed by Johanna

Helmstadter). Hence, holo-‐MutNikR was purified to check whether the presence of nickel

during the purification increases the subsequent yield of crosslinked protein. It was

hypothesized that the presence of nickel would rearrange the nickel-‐binding residues in

the MBD of MutNikR in square planar geometry, causing the protein to fold similarly to WT

NikR. This in turn would allow residues 70 and 77 to be on the surface in a pre-‐organized

18

α-‐helix, and with greater accessibility of the nucleophilic cysteine thiol groups, producing a

higher yield of crosslinked MutNikR.

Figure 3-‐1. Nickel titration and difference spectra of WT NikR. (A) Upon addition of increasing concentrations of NiSO4 to 10 μM apo-‐WT NikR, an overall increase in absorbance is observed at 302 nm. After 0.8 equivalents of nickel, the signal begins to saturate. The linear region of the titration curve yields an extinction coefficient of (7 ± 2) x 103 M-‐1 cm-‐1, an average from three separate experiments. (B) The difference spectra were generated by subtracting the signal of apo-‐WT NikR from that of WT NikR loaded with increasing concentrations of Ni(II). An intense band centered at 302 nm is attributed to a Cys−S-‐ à Ni(II) ligand-‐to-‐metal charge transfer (LMCT).42

0

0.01

0.02

0.03

0.04

0.05

0.06

0.07

0.08

0 0.2 0.4 0.6 0.8 1 1.2

Absorbance at 302 nm

Nickel Equivalents A

-‐0.01

0

0.01

0.02

0.03

0.04

0.05

0.06

250 260 270 280 290 300 310 320 330 340 350


Wavelength (nm)

APO

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8 B

[Ni2+]

19

After purification, holo-‐MutNikR was calculated to contain 0.35 equivalents of metal

(analyzed using PAR assay; data not shown). The nickel-‐binding ability of this initial holo-‐

MutNikR (containing 0.35 equivalent of metal) was analyzed by titrating 10 μM protein

with increasing amounts of Ni(II). A linear increase in the 302 nm signal was observed up

to 0.4 equivalent of added Ni(II), as seen in Figure 3-‐2 (A). The linear portion of the

titration yielded an extinction coefficient of (6 ± 2) x 103 M-‐1 cm-‐1 (Figure 3-‐2 (B)). The

difference spectra, obtained by subtracting the signal of initial holo-‐MutNikR containing

0.35 equivalent of metal from that of the MutNikR loaded with increasing amounts of

Ni(II), also showed an increase in the charge-‐transfer band centered at 302 nm (Figure 3-‐2

(B)).

PAR assays demonstrated that holo-‐purified MutNikR could bind ~0.65 equivalent of

Ni(II) (data not shown), suggesting that the nickel-‐binding ability of the MutNikR was not

compromised by introduced mutations. Upon crosslinking holo-‐MutNikR containing 0.35

equivalent of metal with BSBCA, the yield was increased from 50% to 65% compared to

apo-‐MutNikR, but ceased to increase greater than that (as measured by ESI-‐MS analysis).

Nickel titrations of 10 μM BMOE-‐ and BMH-‐crosslinked apo-‐MutNikR were also performed

with increasing amounts of nickel to validate whether the attachment of crosslinkers

resulted in re-‐stabilized or slightly improved nickel-‐binding ability of apo-‐MutNikR.

However, no change was evident in the electronic absorption spectrum (Figure 3-‐3)

suggesting that the Ni(II)-‐coordination sphere was not restored and/or was further

perturbed by the chemical crosslinking. This lack of nickel binding was not due to cysteine

oxidation, which was confirmed by analysis with DTNB (data not shown). No nickel

titration was performed with BSBCA-‐crosslinked MutNikR.

20

Figure 3-‐2. Nickel titration and difference spectra of MutNikR. (A) Upon addition of increasing concentrations of NiSO4 to 10 μM holo-‐MutNikR containing 0.35 equivalent of metal, an overall increase in absorbance is noted at 302 nm up to 0.4 equivalents of added nickel. The linear region of the titration curve yields an extinction coefficient of (6 ± 2) x 103 M-‐1 cm-‐1. (B) The difference spectra were generated by subtracting the signal of initial holo-‐MutNikR (containing 0.35 equivalent of metal) from that of MutNikR loaded with increasing concentrations of Ni(II). An intense band centered at 302 nm is attributed to a Cys−S-‐ à Ni(II) ligand-‐to-‐metal charge transfer (LMCT).42

0

0.005

0.01

0.015

0.02

0.025

0.03

0.035

0.04

0.045

0 0.2 0.4 0.6 0.8 1 1.2


Nickel Equivalents

A

-‐0.005

0

0.005

0.01

0.015

0.02

0.025

0.03

250 260 270 280 290 300 310 320 330 340 350


Wavelength (nm)

Apo

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1

0.1 B

[Ni2+]

21

Figure 3-‐3. Nickel titration of BMOE-‐crosslinked and BMH-‐crosslinked MutNikR. Upon addition of increasing concentrations of NiSO4 to 10 μM apo-‐BMOE crosslinked MutNikR (A) and 10 μM apo-‐BMH crosslinked MutNikR (B), no increase in absorbance is noted at 302 nm.

0

0.01

0.02

0.03

0.04

0.05

0.06

0.07

0 0.2 0.4 0.6 0.8 1 1.2


Nickel Equivalents A

0

0.005

0.01

0.015

0.02

0.025

0.03

0.035

0.04

0.045

0 0.2 0.4 0.6 0.8 1 1.2


Nickel Equivalents

B

22

3.2 Characterization of the Secondary Structure of the NikR Mutants

To relate the compromised nickel-‐binding ability of non-‐crosslinked and

crosslinked MutNikR with any differences present in the secondary structure, the α-‐helical

content of NikR proteins was compared using circular dichroism spectroscopy.

It was previously reported that a decrease in the mean residue ellipticity (MRE) of holo-‐

WT NikR suggested an increase in α-‐helical content compared to apo-‐WT NikR (Figure 3-‐

4).19 Similarly, if the presence of nickel or the crosslinkers stabilized the α3-‐helix, an

increase in α-‐helical content of MutNikR should be observed. Compared to the CD

spectrum of apo-‐WT NikR, apo-‐MutNikR showed an increased MRE, suggesting a decrease

in the α-‐helical content of the protein (Figure 3-‐4). Also, neither of holo-‐MutNikR, BMH-‐

MutNikR or BMOE-‐MutNikR showed a decreased MRE (corresponding to an increase in the

α-‐helical content of the protein) compared to apo-‐MutNikR, suggesting similar α-‐helix

contents of those proteins. Since it was unclear what the MRE readings of crosslinked-‐

MutNikR proteins represented in Figure 3-‐4, and the fact that MRE is highly sensitive to

protein concentration, MRE at 208 nm and 220 nm were compared (Table 3-‐1). The ratio

of 208 nm and 220 nm should help identify α-‐helicity independent of the magnitude of

MRE.

The MRE ratio of 208 nm and 220 nm shows a small change between apo-‐WT and holo-‐WT

NikR, suggesting very minute change in the α-‐helical content of the two proteins (Table 3-‐

1). The MRE ratio between 208 nm and 220 nm of WT NikR revealed that addition of

nickel lead to an increased signal at 220 nm compared to 208 nm, and a similar trend was

seen between apo-‐/ holo-‐MutNikR and apo-‐/ crosslinked-‐MutNikR proteins. The smaller

ratios of holo-‐MutNikR and crosslinked-‐MutNikR proteins may suggest a slight increase in

the α-‐helicity upon addition of nickel and chemical treatment, respectively (Table 3-‐1).

BSBCA-‐MutNikR in the dark state showed decreased MRE in the CD spectrum (Figure 3-‐4)

and an increased MRE ratio between 208 nm and 220 nm (Table 3-‐1) compared to the

apo-‐MutNikR. Furthermore, the reading did not appear to change substantially upon

23

irradiation with 370 nm UV-‐light. This suggested similar α-‐helix content of BSBCA-‐

MutNikR in the dark and light state.

Figure 3-‐4. Circular dichroism spectra of WT NikR and MutNikR proteins. The CD spectrum of apo-‐WT NikR displays an overall shape indicative of a mixed α/β protein. Upon addition of Ni(II), the intensity of the spectrum increases, sugesting an increase in the α-‐helical content. Compared to apo-‐MutNik, holo-‐MutNikR and BMH-‐MutNikR show decreased α-‐helical content and BMOE-‐MutNikR shows a similar overall secondary structure compared to that of MutNikR. In contrast, BSBCA-‐MutNik in the dark state shows an increased α-‐helical content compared to MutNikR. However, the light induced state of this protein shows no change in the overall secondary structure.

Table 3-‐1. Comparing mean residue ellipticity (MRE) ratio (between 208 nm and 220 nm) of NikR proteins.

MRE at 208 nm

MRE at 220 nm

MRE (208 nm/ 220 nm)

Apo-‐WT NikR -‐10249 -‐10046 1.02 Holo-‐WT NikR -‐10345 -‐11595 0.89 Apo-‐MutNikR -‐5507 -‐8137 0.68 Holo-‐MutNikR -‐3512 -‐7537 0.47 BMH-‐MutNikR -‐3798 -‐6961 0.55 BMOE-‐MutNikR -‐4768 -‐8146 0.59

BSBCA-‐MutNikR (dark) -‐9179 -‐9906 0.93 BSBCA-‐MutNikR (light) -‐8948 -‐9540 0.94

-‐14000

-‐12000

-‐10000

-‐8000

-‐6000

-‐4000

-‐2000

0

2000

4000

6000

190 200 210 220 230 240 250 260

[θ] m

re (d

eg cm

2 dmol-‐1)

Wavelength (nm)

WT Apo

WT Holo

Mut Apo

Mut Holo

Mut BMH

Mut BMOE

Mut BSBCA Dark

Mut BSBCA Light

24

To further elucidate the impact of the introduced mutations at positions 70 and 77,

thermal melting of MutNikR protein was monitored by circular dichroism spectroscopy

(Figure 3-‐5). Compared to the apo-‐WT NikR that melts at 50 °C22, apo-‐MutNikR was

observed to be stable up to 80 °C (Figure 3-‐5 (B)), hinting a much different conformation

of the protein, which sustains its stability at higher temperatures (Figure 3-‐4; Table 3-‐1).

Figure 3-‐5. Thermal denaturation of apo-‐MutNikR monitored by circular dichroism spectroscopy. The denaturation of 88 μM apo-‐MutNikR was monitored from 10 °C to 85 °C. (A) represents the raw data, and (B) shows MRE at 220 nm with respect to temperature.

-‐8000

-‐3000

2000

7000

200 210 220 230 240 250 260

Mean Residue Ellipticity

Wavelength (nm)

10°C 15°C 20°C 25°C 30°C 35°C 40°C 45°C 50°C 55°C 60°C 65°C 70°C 75°C 80°C 85°C

0

1000

2000

3000

4000

5000

6000

7000

10 20 30 40 50 60 70 80 90 Mean Residue Ellipticity at 220 nm

Temperature (°C) B

A

25

3.3 Trypsin and Glu-‐C Protease Digestion

In order to establish the position of the crosslinked regions within the MutNikR,

protease digestion of NikR followed by ESI mass spectrometry was utilized in an attempt

to identify the linked peptide fragments of NikR. The endopeptidases Trypsin and GluC

were selected as they were previously shown to produce reasonably sized NikR peptide

fragments, which should be readily detectable in the MS.33 However, self-‐digestion of these

serine proteases in the reaction mixture did not allow the detection of the linked peptide

fragments in the ESI spectra due to incomplete digestion of the proteins (data not shown).

3.4 The DNA-‐Binding Activities of the NikR Mutants in vitro

Despite the lack of evidence from protease digestion that the crosslinkers were

linked at two cysteines introduced in the metal-‐binding region, the MS results suggested

that a significant portion of the protein was crosslinked, so they could yield some

information about our hypothesis. In that respect, electrophoretic mobility shift assays

(EMSAs) were used to probe the interaction between MutNikR proteins and the promoter

sequence.

In the presence of excess amounts of nickel, WT NikR was able to bind to the 100-‐bp DNA

probe; however, non-‐crosslinked MutNikR, BMH-‐MutNikR, BMOE-‐MutNikR and BSBCA-‐

MutNikR (dark/light) were unable to bind to the DNA probe (Figure 3-‐6). The observation

that MutNikR did not shift the DNA in the presence of nickel suggests that the mutations

have altered the structure and thus activity of the protein.

In the absence of nickel, neither WT NikR (as expected) nor any of the mutant NikR

proteins (crosslinked and non crosslinked) produced an observable shift (Figure 3-‐7). This

suggested that the α-‐helical region of the MutNikR was not stabilized by crosslinkers as

expected.

26

Figure 3-‐6. in vitro DNA-‐binding activities of WT NikR and MutNikR in excess nickel. In the presence of excess nickel (35 μM), WT NikR binds to the 100-‐bp nik promoter sequence and the NikR-‐DNA complex shifts upwards (A (WT)). However, no shift is observed for mutant and crosslinked MutNikR in presence of nickel (A (BSBCA-‐Mut (dark), Mut, BSBCA-‐Mut (light) and B (BMH-‐Mut and BMOE-‐Mut)). (-‐) indicates free DNA probe and Mut refers to non-‐crosslinked MutNikR protein.

Figure 3-‐7. in vitro DNA-‐binding activities of WT NikR and MutNikR in the absence of nickel. In the absence of nickel (1 mM EDTA, pH 7.5, 3 mM MgSO4)41, WT NikR does not bind to the 100-‐bp nik promoter sequence (as expected), and the NikR-‐DNA complex does not shift upwards (A (WT)). No shift is observed for non-‐crosslinked and crosslinked MutNikR in absence of nickel (A (BSBCA-‐Mut (light), Mut, BSBCA-‐Mut (dark) and B (BMH-‐Mut and BMOE-‐Mut)). (-‐) indicates free DNA probe and Mut refers to non-‐crosslinked MutNikR.

A

B

[NikR]

[NikR]

A

B

27

4. Discussion

A role of the α3-‐helix in Ni(II)-‐responsive DNA binding by NikR has been suggested

by multiple experiments, including crystallography,20,21 protease digestion studies,33 and

observed changes in the circular dichroism spectrum,19,22 but no study has investigated

the role of this α-‐helix directly. In this work, an attempt was made to create a NikR-‐variant

capable of Ni(II)-‐independent DNA binding by introducing cysteine residues in the metal-‐

binding domain at positions 70 and 77 (positions i and i+7)43 and chemically crosslink

them to stabilize the α3-‐helix.44,45 The goal was to stabilize the helix independent of metal

binding and study the impact of stabilized α3-‐helix in the regulatory process of NikR.

R70C/H77C MutNikR was found to be air-‐sensitive and highly susceptible to oxidation,

mainly due to the presence of two extra cysteines relative to the WT NikR. To avoid

unwanted oxidation, 10 mM TCEP was added to the cells before sonication, 5 mM DTT in

the dialysis buffer, and 10 mM TCEP in the FPLC buffers.

WT NikR nickel titrations demonstrated that the nickel-‐binding ability of MutNikR was not

compromised (Figure 3-‐2). However, CD spectroscopy revealed a decreased MRE ratio of

208 nm and 220 nm (corresponding to an increased signal at 220 nm than at 208 nm;

Table 3-‐1) suggesting an increased α3-‐helicity of apo-‐MutNikR (compared to apo-‐WT-‐

NikR). Circular dichroism showed that apo-‐MutNikR was more thermally stable than apo-‐

WT NikR (Figure 3-‐5). Furthermore, MutNikR did not exhibit DNA binding to the 100-‐bp

nik promoter sequence in the presence of nickel. These results suggest that MutNikR has a

conformational state different from WT NikR that also makes it more thermally stable

(Figure 3-‐5).22

Cysteine residues were introduced at position 70 and 77. These residues were thought to

be accessible to react with crosslinkers in the fully folded state, since they appear to be

solvent exposed in the crystal structure. No functional or structural roles of these residues

were previously identified, so the characteristics and overall folding of the mutant protein

was expected to be similar to the wild type, allowing the mutant protein to behave similar

28

to WT NikR. However, unlike the to holo-‐WT NikR properties, holo-‐MutNikR did not bind

to the 100-‐bp nik promoter sequence in the presence of nickel. This could be due to the

mutation at position 77, as the side chain of H77 in the α3-‐helix is in close proximity (6 Å)

to D114 of the α4-‐helix in the crystal structure (Figure 4-‐1). It is possible that the lone pair

of electrons present on the nitrogen of the H77 side chain forms a hydrogen bond with the

carboxyl of D114, stabilizing the structure. The introduction of cysteine at position 77

would disrupt this hydrogen bond, disturbing the stability of the quaternary structure and

preventing holo-‐MutNikR from binding to the nik promoter sequence.

Figure 4-‐1. A model showing orientation of α3-‐helix and α4-‐helix in the presence of nickel (PDB 2HZV). It is likely for residue H77 of the α3-‐helix (pink) of the NikR protein (originally at 6 Å) to move closer due to rotation of the β-‐carbon of the side chains in the 3-‐dimensional space to D114 of α4-‐helix (blue) to form hydrogen bond with each other upon nickel binding. This may be required to stabilize the overall structure of NikR allowing it to bind to the nik promoter sequence. The bond distance between H77 and D114 is shown in yellow. The image was generated using Chimera.

The role of Cys70 is thought to be minimal, since there is no possibility of hydrogen-‐bond

formation in that part of the α3-‐helix. Previously, engineered NikR variants, S69C (where

two NikR monomers were linked by disulfide bonds), S73A and S73A/T74A NikR

exhibited DNA-‐binding activity in the presence of nickel (performed by Dr. Andrew Sydor

and Robin Liu, respectively), suggesting that the stability of this portion of the α3-‐helix is

D114 H77

29

not disrupted with the introduced cysteine/alanine mutations. Also, the above three

variants were also observed to be incapable of Ni(II)-‐independent DNA binding,

suggesting that this starting region of the α3-‐helix may not play a significant role in the

regulatory function of NikR.

Although MutNikR did not show similar MRE and DNA binding to the nik promoter

sequence (relative to WT NikR), crosslinking experiments were continued, because it is

possible that activity could become restored through conformational changes induced by

crosslinking and stabilization of the α3-‐helix.

Challenges were faced while crosslinking holo-‐MutNikR with BSBCA. In the first three

attempts, the yield of the reaction did not exceed 50%. Since it was necessary for at least

three of the four monomers in the functional NikR tetramer to have a crosslinker in the α3-‐

helix in order to elucidate the role of attached crosslinker, the concentration of BSBCA was

increased from four equivalents to six-‐eight equivalents (relative to MutNiKR) to obtain a

yield of at least 80%. With 6X concentration of BSBCA, no difference in yield was observed

compared previous attempts with 4X BSBCA concentration (Figure 7-‐2 (B)). Upon

increasing the concentration of BSBCA to 8X, the majority of the protein (~80%) was

crosslinked (Figure 7-‐2 (C)). However, the protein sample also contained components

other than the non-‐crosslinked MutNikR and BSBCA-‐MutNikR, which could not be

identified because the differences in the masses did not correspond to the molecular

weight of the crosslinker (Figure 7-‐2 (C)).

In order to limit the linking of BSBCA to one unit per MutNikR monomer, another

crosslinking reaction was attempted with 4X BSBCA relative to MutNikR, but this time in

the presence of UV light. These conditions allowed us to test the possibility that

positioning of BSBCA in the cis state could enhance the rate of the reaction of the second

cysteine, due to proximity of the electrophilic group of BSBCA, giving a better yield.

However, no difference in the yield was observed by crosslinking MutNikR in the presence

of UV light. The reaction was carried out in 20 mM Tris at pH 7.5, and in 0.1 M potassium

phosphate at pH 7.5 to test the effects of buffer, but no change in yield was observed.

Despite fresh batches of MutNikR and BSBCA being used, the highest yield obtained for

30

this reaction was 60%. Also, to compare whether nickel-‐binding affected crosslinking of

MutNikR, a reaction was set up with apo-‐MutNikR and 4X BSBCA. The final yield of the

reaction was 50%, revealing no difference between crosslinking of apo-‐ and holo-‐MutNikR.

In contrast, the control crosslinking reactions attempted with non-‐switchable sulfhydryl

crosslinkers (BMH and BMOE) gave the yield greater than 95% (Figure 7-‐3).

Nickel titrations showed that neither BMH-‐crosslinked MutNikR nor BMOE-‐crosslinked

MutNikR bound nickel. It may be possible that these crosslinking reagents of shorter

length (BMOE and BMH) pucker a region of metal-‐binding domain, altering the structure

in a way that would prevent the metal-‐binding residues from binding metal. The small

differences in the MRE ratios between 208 nm and 220 nm for apo-‐MutNikR versus BMH-‐

MutNikR and BMOE-‐MutNikR may be due to this structural perturbation. This distortion,

caused by introduction of the crosslinkers, could also explain the inability of BMH-‐

MutNikR and BMOE-‐MutNikR to bind to the nik promoter sequence.

Although the CD spectra showed an increase in the α3-‐helicity in BSBCA-‐MutNikR (in the

dark state) compared to apo-‐MutNikR (Figure 3-‐4), it did not produce DNA binding to the

nik promoter. This suggests that despite the gain of α-‐helicity due to a flexible/long linker,

it is likely that this flexibility of BSBCA would not have allowed the protein to hold one

state for a longer period of time in the aqueous solution, hindering its DNA binding to the

nik sequence. Based on the circular dichroism spectrum, an increase (for BSBCA-‐MutNikR)

or almost similar (for holo-‐, BMH-‐ and BMOE-‐MutNikR) in α-‐helical content was observed

for MutNikR proteins (Figure 3-‐4); however, it is unclear if this is due to stabilization of

the α3-‐helix in particular. Overall, the collected data show that the DNA-‐binding activity of

NikR is very sensitive to structural changes, and even small changes alter the activity of

the protein.

Despite the model showing no interference between crosslinked mutant protein and DNA

as shown in Figure 1-‐7, it may be possible that the hydrophobic crosslinkers are hindering

the protein to move in close proximity to the DNA, preventing formation of necessary non-‐

31

specific contacts30. The space containing water molecules may also be pushing away the

hydrophobic crosslinkers, further spacing out the barely formed protein-‐DNA complex.

It is also possible that folding of the α3-‐helix is not sufficient to activate DNA binding. This

suggests that there are additional interactions within the protein induced by Ni(II) binding

that extend beyond those of the α3-‐helix and without nickel, these interactions would be

absent. So, even in the presence of a crosslinker, if this region of the protein were unable to

make those specific needed contacts, it would not show expected binding to the nik

promoter sequence, and requires further research to determine the role of the α3-‐helix in

NikR Ni(II)-‐induced DNA binding.

32

5. Conclusion and Future Work

In this study, a double cysteine mutation (R70C/ H77C) of NikR was crosslinked

with various crosslinkers and studied. The crosslinked MutNikR did not exhibit nickel

binding, CD spectra or DNA-‐binding to the nik promoter similar to WT NikR. The data

presented here demonstrate that this engineered MutNikR variant in crosslinked/non-‐

crosslinked form is incapable of Ni(II)-‐independent DNA binding. The reasons for this lack

of function are unclear, and a clear link between stabilization of the α3-‐helix upon Ni(II)

binding and DNA binding cannot be established. It could be that the secondary structure

required for the activity of NikR was not maintained in the mutant, or that other needed

specific contacts (yet unknown) were not made. Hence, to elucidate the details of the

proposed NikR – DNA binding event, alternative avenues are required.

This may include working with only the MBD (residues 49-‐133), incorporating cysteine

residues at positions 70 and 77 followed by crosslinking and analysis using protease

digestion/ESI-‐MS.33 Since the region of the attached crosslinkers was not assigned,

protease digests should be repeated with other proteases to collect the peptide fragment

of interest. It is possible that H77 and D114 form a hydrogen bond that stabilizes the NikR

structure, such that it can perform regulatory function. This hypothesis could also be

tested by mutating D114 to alanine, and comparing this mutant protein’s nickel-‐binding

and DNA-‐binding activity with WT NikR.

33

6. References (1) Eitinger, T.; Mandrand-‐Berthelot, M. A. Nickel transport systems in

microorganisms. Arch Microbiol 2000, 173, 1-‐9.

(2) Mulrooney, S. B.; Hausinger, R. P. Nickel uptake and utilization by

microorganisms. Fems Microbiol Rev 2003, 27, 239-‐261.

(3) Küpper, H.; Kroneck, P. M. H. Nickel in the Environment and Its Role in the

Metabolism of Plants and Cyanobacteria. Met Ions Life Sci 2007, 2, 31-‐62.

(4) Ragsdale, S. W. Nickel-‐based Enzyme Systems. J Biol Chem 2009, 284, 18571-‐

18575.

(5) Maroney, M. J. Structure/function relationships in nickel

metallobiochemistry. Curr Opin Chem Biol 1999, 3, 188-‐199.

(6) Bleackley, M. R.; MacGillivray, R. T. A. Transition metal homeostasis: from

yeast to human disease. Biometals 2011, 24, 785-‐809.

(7) Sydor, A. M.; Zamble, D. B. Nickel metallomics: general themes guiding nickel

homeostasis. Met Ions Life Sci 2013, 12, 375-‐416.

(8) Chen, H. B.; Giri, N. C.; Zhang, R. H.; Yamane, K.; Zhang, Y.; Maroney, M.; Costa,

M. Nickel Ions Inhibit Histone Demethylase JMJD1A and DNA Repair Enzyme ABH2 by

Replacing the Ferrous Iron in the Catalytic Centers. J Biol Chem 2010, 285, 7374-‐7383.

(9) Macomber, L.; Hausinger, R. P. Mechanisms of nickel toxicity in

microorganisms. Metallomics 2011, 3, 1153-‐1162.

(10) Maier, R. J.; Benoit, S. L.; Seshadri, S. Nickel-‐binding and accessory proteins

facilitating Ni-‐enzyme maturation in Helicobacter pylori. Biometals 2007, 20, 655-‐664.

(11) Li, Y. J.; Zamble, D. B. Nickel Homeostasis and Nickel Regulation: An

Overview. Chem Rev 2009, 109, 4617-‐4643.

(12) Giedroc, D. P.; Arunkumar, A. I. Metal sensor proteins: nature's

metalloregulated allosteric switches. Dalton Trans 2007, 3107-‐3120.

(13) Dosanjh, N. S.; Michel, S. L. Microbial nickel metalloregulation: NikRs for

nickel ions. Curr Opin Chem Biol 2006, 10, 123-‐130.

(14) Wang, S. C.; Dias, A. V.; Zamble, D. B. The "metallo-‐specific" response of

proteins: a perspective based on the Escherichia coli transcriptional regulator NikR. Dalton

Trans 2009, 2459-‐2466.

34

(15) Iwig, J. S.; Chivers, P. T. Coordinating intracellular nickel-‐metal-‐site

structure-‐function relationships and the NikR and RcnR repressors. Nat Prod Rep 2010,

27, 658-‐667.

(16) De Pina, K.; Desjardin, V.; Mandrand-‐Berthelot, M. A.; Giordano, G.; Wu, L. F.

Isolation and characterization of the nikR gene encoding a nickel-‐responsive regulator in

Escherichia coli. J Bacteriol 1999, 181, 670-‐674.

(17) Navarro, C.; Wu, L. F.; Mandrandberthelot, M. A. The Nik Operon of

Escherichia-‐Coli Encodes a Periplasmic Binding-‐Protein-‐Dependent Transport-‐System for

Nickel. Mol Microbiol 1993, 9, 1181-‐1191.

(18) Chivers, P. T.; Sauer, R. T. NikR is a ribbon-‐helix-‐helix DNA-‐binding protein.

Protein Sci 1999, 8, 2494-‐2500.

(19) Chivers, P. T.; Sauer, R. T. NikR repressor: High-‐affinity nickel binding to the

C-‐terminal domain regulates binding to operator DNA. Chem Biol 2002, 9, 1141-‐1148.

(20) Schreiter, E. R.; Sintchak, M. D.; Guo, Y.; Chivers, P. T.; Sauer, R. T.; Drennan,

C. L. Crystal structure of the nickel-‐responsive transcription factor NikR. Nat Struct Biol

2003, 10, 794-‐799.

(21) Schreiter, E. R.; Wang, S. C.; Zamble, D. B.; Drennan, C. L. NikR-‐operator

complex structure and the mechanism of repressor activation by metal ions. Proc Natl

Acad Sci 2006, 103, 13676-‐13681.

(22) Wang, S. C.; Dias, A. V.; Bloom, S. L.; Zamble, D. B. Selectivity of metal binding

and metal-‐induced stability of Escherichia coli NikR. Biochemistry 2004, 43, 10018-‐10028.

(23) Bloom, S. L.; Zamble, D. B. Metal-‐selective DNA-‐binding response of

Escherichia coli NikR. Biochemistry 2004, 43, 10029-‐10038.

(24) Chivers, P. T.; Sauer, R. T. Regulation of high affinity nickel uptake in

bacteria. Ni2+-‐Dependent interaction of NikR with wild-‐type and mutant operator sites. J

Biol Chem 2000, 275, 19735-‐19741.

(25) Carrington, P. E.; Chivers, P. T.; Al-‐Mjeni, F.; Sauer, R. T.; Maroney, M. J. Nickel

coordination is regulated by the DNA-‐bound state of NikR. Nature Struct. Biol. 2003, 10,

126-‐130.

35

(26) Wang, S. C.; Li, Y.; Ho, M.; Bernal, M. E.; Sydor, A. M.; Kagzi, W. R.; Zamble, D.

B. The response of Escherichia coli NikR to nickel: a second nickel-‐binding site.

Biochemistry 2010, 49, 6635-‐6645.

(27) Phillips, C. M.; Drennan, C. L. Nickel Regulatory Transcription Factor, NikR.

In Handbook of Metalloproteins (Messerschmidt, A., Ed) John Wiley & Sons, Ltd., New York

2008.

(28) Phillips, C. M.; Schreiter, E. R.; Guo, Y.; Wang, S. C.; Zamble, D. B.; Drennan, C.

L. Structural basis of the metal specificity for nickel regulatory protein NikR. Biochemistry

2008, 47, 1938-‐1946.

(29) Phillips, C. M.; Schreiter, E. R.; Stultz, C. M.; Drennan, C. L. Structural basis of

low-‐affinity nickel binding to the nickel-‐responsive transcription factor NikR from

Escherichia coli. Biochemistry 2010, 49, 7830-‐7838.

(30) Krecisz, S.; Jones, M. D.; Zamble, D. B. Nonspecific interactions between

Escherichia coli NikR and DNA are critical for nickel-‐activated DNA binding. Biochemistry

2012, 51, 7873-‐7879.

(31) Phillips, C. M.; Nerenberg, P. S.; Drennan, C. L.; Stultz, C. M. Physical Basis of

Metal-‐Binding Specificity in Escherichia coli NikR. J Am Chem Soc 2009, 131, 10220-‐10228.

(32) Wang, S. C.; Li, Y. J.; Robinson, C. V.; Zamble, D. B. Potassium Is Critical for the

Ni(II)-‐Responsive DNA-‐Binding Activity of Escherichia coli NikR. J Am Chem Soc 2010, 132,

1506-‐1507.

(33) Dias, A. V.; Zamble, D. B. Protease digestion analysis of Escherichia coli NikR:

evidence for conformational stabilization with Ni(II). J Biol Inorg Chem 2005, 10, 605-‐612.

(34) Beharry, A. A.; Woolley, G. A. Azobenzene photoswitches for biomolecules.

Chem Soc Rev 2011, 40, 4422-‐4437.

(35) Edelhoch, H. Spectroscopic Determination of Tryptophan and Tyrosine in

Proteins. Biochemistry 1967, 6, 1948-‐1954.

(36) Pace, C. N.; Vajdos, F.; Fee, L.; Grimsley, G.; Gray, T. How to Measure and

Predict the Molar Absorption-‐Coefficient of a Protein. Protein Sci 1995, 4, 2411-‐2423.

(37) Hunt, J. B.; Neece, S. H.; Ginsburg, A. The Use of 4-‐(2-‐Pyridylazo)Resorcinol in

Studies of Zinc Release from Escherichia-‐Coli Aspartate Transcarbamoylase. Anal Biochem

1985, 146, 150-‐157.

36

(38) Kaluarachchi, H.; Sutherland, D. E.; Young, A.; Pickering, I. J.; Stillman, M. J.;

Zamble, D. B. The Ni(II)-‐binding properties of the metallochaperone SlyD. J Am Chem Soc

2009, 131, 18489-‐18500.

(39) Kelly, S. M.; Jess, T. J.; Price, N. C. How to study proteins by circular

dichroism. Biochim Biophys Acta 2005, 1751, 119-‐139.

(40) http://prospector.ucsf.edu/prospector/cgi-‐bin/msform.cgi?form=msdigest.

(41) Jones, M. D.; Ademi, I.; Yin, X.; Gong, Y.; Zamble, D. B. Nickel-‐responsive

regulation of two novel Helicobacter pylori NikR-‐targeted genes. Metallomics 2014.

(42) Lever, A. B. P.: Inorganic electronic spectroscopy; 2nd ed.; Elsevier:

Amsterdam ; New York, 1984.

(43) Burns, D. C.; Zhang, F.; Woolley, G. A. Synthesis of 3,3'-‐bis(sulfonato)-‐4,4'-‐

bis(chloroacetamido)azobenzene and cysteine cross-‐linking for photo-‐control of protein

conformation and activity. Nat Protoc 2007, 2, 251-‐258.

(44) Jo, H.; Meinhardt, N.; Wu, Y.; Kulkarni, S.; Hu, X.; Low, K. E.; Davies, P. L.;

DeGrado, W. F.; Greenbaum, D. C. Development of alpha-‐helical calpain probes by

mimicking a natural protein-‐protein interaction. J Am Chem Soc 2012, 134, 17704-‐17713.

(45) Zhang, F. Z.; Zarrine-‐Afsar, A.; Al-‐Abdul-‐Wahid, M. S.; Prosser, R. S.; Davidson,

A. R.; Woolley, G. A. Structure-‐Based Approach to the Photocontrol of Protein Folding. J Am

Chem Soc 2009, 131, 2283-‐2289.

37

7. Appendix

Figure 7-‐1. Mass spectrum of WT NikR and MutNikR. The calculated mass of WT NikR (A) and MutNikR (B) is 15093.7 Da and 15006.7 Da, respectively.

Mass reconstruction of +TOF MS: 1.534 to 1.750 min from 131119_2718.wiff Max. 863.1 cps.

1.47e4 1.48e4 1.49e4 1.50e4 1.51e4 1.52e4 1.53e4 1.54e4Mass, amu

0

50

100

150

200

250

300

350

400

450

500

550

600

650

700

750

800

850

Inten

sity,

cps

15093.0

Sample Name: N/A AIMS - U of TESI - QStar XL

Acq. Date: N/AAcq. Time: N/A

Acq. File: Mass reconstruction of +TOF MS: 1.534 to 1.750 min from 131119_2718.wiff Polarity/Scan Type: N/AMass reconstruction of +TOF MS: 1.484 to 1.667 min from 131119_2717.wiff Max. 312.6 cps.

1.44e4 1.45e4 1.46e4 1.47e4 1.48e4 1.49e4 1.50e4 1.51e4 1.52e4 1.53e4 1.54e4 1.55e4 1.56e4Mass, amu

0

20

40

60

80

100

120

140

160

180

200

220

240

260

280

300

313

Inten

sity,

cps

15006.0

Sample Name: N/A AIMS - U of TESI - QStar XL

Acq. Date: N/AAcq. Time: N/A

Acq. File: Mass reconstruction of +TOF MS: 1.484 to 1.667 min from 131119_2717.wiff Polarity/Scan Type: N/A

A

B

15093.0

15006.5

Mass (amu)

Intensity (cps) à

38

Figure 7-‐2. Mass spectrum of MutNikR protein crosslinked with the azobenzene crosslinker (BSBCA). (A), (B) and (C) represent the reaction carried out at 4X, 6X and 8X concentration of BSBCA with respect to MutNikR, respectively. The calculated mass of BSBCA-‐MutNikR is 15458.5 Da.

C

A

B

C

15459.4

15005.4

15708.5

15006.5

15458.5

15458.5

15005.4 16574.0

Mass (amu)

Intensity (cps) à

39

Figure 7-‐3. Mass spectrum of MutNikR protein crosslinked with the sulfhydryl crosslinkers. The calculated mass of BMOE-‐MutNikR (A) and BMH-‐MutNikR (B) is 15226.5 Da and 15283 Da, respectively.

ESI Mass Spectrum

Comment ESI+, de-salt, 100x dilutionDA Method AIMS_Protein.m Instrument Agilent 6538 Q-TOF Acq Date, Time 11/7/2014 11:11:52 AMSample Name PBS-3X BMOE Data File 141107_3057.d Acq Method AIMS_Default.m

1 of 1

ESI Mass Spectrum

Comment ESI+ Desalt 100 x dilnDA Method AIMS_Protein.m Instrument Agilent 6538 Q-TOF Acq Date, Time 11/24/2014 10:08:02 AMSample Name 3.25XBMH-in Tris Data File 141124_3348R.d Acq Method AIMS_Default.m

1 of 1

15226.5

15004.4

15282.5

Mass (amu)

Intensity (cps) à

Engineering!aNi(II)-independentNikR!to!determine!the!role!of!the! … · 2015-08-31 · ! ! !!1!...

Documents

Transcript of Engineering!aNi(II)-independentNikR!to!determine!the!role!of!the! … · 2015-08-31 · ! ! !!1!...