Encode Sequence

download Encode Sequence

of 233

  • date post

    24-Oct-2014
  • Category

    Documents

  • view

    551
  • download

    2

Embed Size (px)

Transcript of Encode Sequence

1.

What is the amino acid sequence encoded by the DNA sequence? The DNA sequence given is: GCATGCTGCGAAACTTTGGCTGA The 3-letter codons are: ATG CTG CGA AAC TTT GGC TGA The amino acid sequence is: Met Leu Arg Asn Phe Gly Stop

2.

What does a missense mutation look like? Here's one example: GCATGGTGCGAAACTTTGGCTGA The 3-letter codons are: ATG GTG CGA AAC TTT GGC TGA The amino acid sequence is: Met Val Arg Asn Phe Gly Stop

3.

What does a nonsense mutation look like? Here's one example: GCATGCTGTGAAACTTTGGCTGA The 3-letter codons are: ATG CTG TGA AAC TTT GGC TGA The amino acid sequence is: Met Leu Stop

4.

You can make more than one frameshift mutation. What do they look like? How do they change the amino acid sequence? Here are some examples of different frameshift mutations. Insertion: GCATGCTGATCGAAACTTTGGCTGA The 3-letter codons are: ATG CTGATC GAA ACT TTG GCT GA The amino acid sequence is: Met Leu Ile Glu Thr Leu Ala Deletion: GCATGCT-CGAAACTTTGGCTGA The 3-letter codons are: ATG CTC GAA ACT TTG GCT GA The amino acid sequence is: Met Leu Glu Thr Leu Ala Insertion: GCATGCTGAAAGATAGTTGTCGAAACTTTGGCTGA The 3-letter codons are: ATG CTG AAA GAT AGT TGT CGA AAC TTT GGC TGA The amino acid sequence is: Met Leu Lys Asp Ser Cys Arg Asn Phe Gly Deletion: GCATGCTGCG-----TTGGCTGA The 3-letter codons are:ATG CTG CGT TGG CTG The amino acid sequence is: Met Leu Arg Trp Leu

5.

Notice how a single amino acid can be encoded by a number of different codons. What are some examples of silent mutations in the DNA sequence? Here's one example: GCATGCTGCGTAACTTTGGCTGA The 3-letter codons are: ATG CTG CGT AAC TTT GGC TGA The amino acid sequence is: Met Leu Arg Asn Phe Gly Stop

A silent mutation changes a nucleotide without changing the codon. For many amino acids the third nucleotide of the codon can be variable. For example, CCT, CCC, CCA and CCG all code for Proline. However, for some amino acids, both the first and the third nucleotide of the codon can vary. For example, CTT, CTC, CTA, TTA, CTG, AND TTG all code for Leucine.

Multiple Choice Questions 1. Which of the following is not known to be involved in initiation by eukaryotic RNA polymerase II? A) DNA helicase activity B) DNA polymerase activity C) Formation of an open complex D) Protein binding to specific DNA sequences E) Protein phosphorylation 2. Processing of a primary mRNA transcript in a eukaryotic cell does not normally involve: A) attachment of a long poly(A) sequence at the 3' end. B) conversion of normal bases to modified bases, such as inosine and pseudouridine. C) excision of intervening sequences (introns). D) joining of exons. E) methylation of one or more guanine nucleotides at the 5' end. 3. The 5'-terminal cap structure of eukaryotic mRNAs is a(n): A) 7-methylcytosine joined to the mRNA via a 2',3'-cyclic linkage. B) 7C) 7D) N 6 E) O .

6 4. The excision (splicing) of many group I introns requires, in addition to the primary transcript RNA: A) a cytosine nucleoside or nucleotide and a protein enzyme. B) a guanine nucleoside or nucleotide (only). C) a protein enzyme only. D) a small nuclear RNA and a protein enzyme. E) ATP, NAD, and a protein enzyme. 5. A branched (lariat) structure is formed during: A) attachment of a 5' cap to mRNA. B) attachment of poly(A) tails to mRNA. C) processing of preribosomal RNA. D) splicing of all classes of introns. E) splicing of group II introns. 6. Splicing of introns in nuclear mRNA primary transcripts requires: A) a guanine nucleoside or nucleotide. B) endoribonucleases. C) polynucleotide phosphorylase. D) RNA polymerase II. 992(4) 2011 2 E) small nuclear ribonucleoproteins (snurps). 7. Which one of the following is not true of the mRNA for ovalbumin? A) Exons are used for polypeptide synthesis. B) Introns are complementary to their adjacent exons and will form hybrids with them.

C) The mature mRNA is substantially shorter than the corresponding region on the DNA. D) The mRNA is originally synthesized in the nucleus, but ends up in the cytoplasm. E) The splicing that yields a mature mRNA occurs at very specific sites in the RNA primary transcript. 8. Differential RNA processing may result in: A) a shift in the ratio of mRNA produced from two adjacent genes. B) attachment of the poly(A) tail to the 5' end of an mRNA. C) inversion of certain exons in the final mRNA. D) the production of the same protein from two different genes. E) the production of two distinct proteins from a single gene. 9. Which of these polymerases does not require a template? A) RNA pol I B) RNA pol II C) Reverse transcriptase D) Polyadenylate polymerase E) RNA replicase 10. RNA polymerase: A) binds tightly to a region of DNA thousands of base pairs away from the DNA to be transcribed. B) can synthesize RNA chains de novo (without a primer). ch acts as a proofreading ribonuclease. D) separates DNA strands throughout a long region of DNA (up to thousands of base pairs), then copies one of them.

11. Which of the following statements about E. coli RNA polymerase (core enzyme) is false?

initiation begins. B) The core enzyme contains several different subunits. .

E) The RNA product is complementary to the DNA template. 992(4) 2011 3 12. RNA polymerase from E. coli (core enzyme alone) has all of the following properties except that it: A) can extend an RNA chain and initiate a new chain. B) is required for the synthesis of mRNA, rRNA, and tRNA in E. coli. C) produces an RNA polymer that begins with a 5'-triphosphate. D) recognizes specific start signals in DNA. E) requires all four ribonucleoside triphosphates and a DNA template. Short Answer Questions 13. Write the sequence of the messenger RNA molecule synthesized from a DNA template strand having the sequence: (5')ATCGTACCGTTA(3') Ans: (3')UAGCAUGGCAAU(5'). Also acceptable is (5')UAACGGUACGAU(3'). 14. For each of the following statements, indicate with a P if the statement applies only to prokaryotes, an E if the statement applies only to eukaryotes, and an E and a P if the statement applies to both eukaryotes and prokaryotes. A.___ RNA synthesis is blocked by actinomycin D.

B. ___ A single RNA polymerase transcribes genes that encode mRNAs, tRNAs, and rRNA. C. ___ Transcription of mRNA is bloc -amanitin.

initiated. E. ___ The 5' end of the mature mRNA begins with a triphosphate.

Ans: E and P; P; E; P; P; P 15. Indicate whether each of the following statements about eukaryotic cells is true (T) or false (F). A. ___ They have three distinct RNA polymerases. B. ___ Their mRNAs are generally synthesized by RNA polymerase I. C. ___ RNA polymerase III synthesizes only rRNAs. D. ___ The 5S rRNA is synthesized by RNA polymerase I E. ___ Their RNA polymerases initiate transcription at specific promoter sites on the DNA Ans: T; F; F; F; T 16. Name four general types of postsynthetic processing reactions that are observed in RNA. Briefly (one sentence or less) point out an example of each type. In your example, identify the type of RNA molecule involved (tRNA, mRNA, rRNA, etc.), the type of processing involved, and whether the example is characteristic of eukaryotes or 992(4) 2011 4 prokaryotes, or both. Do not describe specific genes, sequences, complicated structures, or enzymes. 17. What is a telomere? Describe the key features of its structure. What is unusual about

the structure and/or mechanism of action of telomerase? 18. List one basic property that distinguishes RNA polymerases from DNA polymerases, and list one basic property they share.BIOCHEMISTRY TEST You have 546 questions in this exam. 1. Increasing the concentration of dGTP directly causes ribonucleotide reductase to A. increase the rate of production of dGDP. B. increase the rate of production of dADP. C. decrease the rate of production of rCDP. D. decrease the rate of production of dADP. E. increase the rate of production of dTTP. Show answer Correct Answer: B Feedback A: Has no direct effect (Increased dGTP increases dATP production, which eventually would decrease RNR activity overall, but dGTP has no immediate effect on the enzyme except to increase dADP formation)

Feedback C: Has no direct effect (Increased dGTP increases dATP production, which eventually would decrease RNR activity overall, but dGTP has no immediate effect on the enzyme except to increase dADP formation) Feedback D: This rate increases Feedback E: Has no direct effect (Increased dGTP increases dATP production, which eventually would decrease RNR activity overall, but dGTP has no immediate effect on the enzyme except to increase dADP formation) 2. Glycogen phosphorylase is activated most directly by A. epinephrine. B. phosphorylase kinase. C. phosphorylase phosphatase. D. cAMP. E. glucagon. Show answer Correct Answer: B Feedback A: See B Feedback B: glucagon or epinephrine ---> increased cAMP ---> active PKA ---> active phosphorylase kinase ---> active glycogen phosporylase Feedback C: See B Feedback D: See B Feedback E: See B

3. Which of the following cofactors is most directly concerned with a CO2 fixation reaction? A. biotin B. vitamin D C. coenzyme A D. thiamine pyrophosphate E. lipoic acid Show answer Correct Answer: A Feedback A: Biotin is a carrier of activated CO2 and is a component of acetyl carboxylase, propionyl CoA carboxylase, and pyruvate carboxylase. Feedback B: Feedback C: Feedback D: Feedback E: 4. Which statement about reactions catalyzed by transaminases (aminotransferases) is false? A. The equilibrium constant is close to 1. B. The reaction involves a Schiff base intermediate. C. Pyridoxal phosphate is covalently bound to the enzyme protein through the epsilon amino group of a lysine residue. D. The reactions are important for the biosynthesis of non-essential amino acids. E. Ammonia is liberated. Show answer Correct Answer: E Feedback A: Aminotransferases can participate in