EMD-5127 – PDB 3IYDThree-dimensional EM structure of

an intact activator-dependent transcription initiation complex

EMD-5127 – PDB 3IYDThree-dimensional EM structure of

an intact activator-dependent transcription initiation complex

Hudson, B.P., Quispe, J., Lara-Gonzalez, S., Berman, H.M., Arnold, E., Ebright, R.H.,

Lawson, C.L. (2009)

Proc. National Acad. Sci. USA 106, 19830-19835

Funding:NIH GM021589

Catherine Lawson, PIHelen Berman, co-PI

Brian BenoffJens BirktoftBrian Hudson **Samuel Lara-GonzalezAndrew NapoliRamya RaoKaitlyn Turo

http://roma.rutgers.edu

Collaborators

RutgersRichard EbrightEddy Arnold

ScrippsJoel QuispeBridget CarragherClint Potter

Acknowledgements Acknowledgements Acknowledgements Acknowledgements

3 components:Activator (50 kDa)

RNA polymerase (300 kDa)Promoter DNA (~100 base pairs)

Total: ~ 500 kDa

Bacterial Transcription ActivationBacterial Transcription Activation

Sample ReconstitutionSample ReconstitutionCAP (-61.5)

+1

CGCAATAAATGTGATCTAGATCACATTTTAGGCAAAAAAGGCTTTACACTTTATGCTTCCGGCTCGT TGTGAGCGGATAACAAGGCGTTATTTACACTAGATCTAGTGTAAAATCCGTTTTTTCCGAAATGTGAAATACGAAGGCCGAGCA ACACTCGCCTATTGTTC

-35 -10 ATAATCGCACCTTA

ATAATCACACCTTA

EM SpecimenEM Specimen

• Carbon sandwich stain technique

Sample

Uranyl Formate Stain

Carbon Film

Carbon Film

Grid

Ohi et al, Biol. Proced. Online (2004), 6, 23-34.

EM ReconstructionEM Reconstruction

• EMAN projection matching

• thermophilic RNAP starting model yielded density for E. coli-specific insertions at expected positions

First refinement cycleFirst refinement cycleprojections

averages

projections

averages

Particles (~17000 total)Particles (~17000 total)

Final refinement cycleFinal refinement cycle

Resolution EstimationResolution Estimation

“Class I” Map + Interpretation“Class I” Map + Interpretation

EMDB IDEMD-5127

PDB ID3iyd

T. thermophilus RNAP holoenzyme from Mukhopadhyay et al., 2008 (PDBid 3DXJ).

CAP + CTD + DNAfrom Benoff et al., 2002 (PDBid 1LB2),

CTD + 70 region 4 + DNA from Lara et al, manuscript in preparation

DNA positions -23 to +20 from Lawson et al., 2004.

E. coli subunit N-terminal domain dimer from Zhang & Darst, 1998 (PDBid 1BDF).

E. coli 70 regions 1.2 to 2 from Malhotra et al., 1996 (PDBid 1SIG).

E. coli ’GNCD from Chlenov et al., 2005 (PDBid 2AUK).

Initial Model FittingInitial Model Fitting

Coordinate Model GenerationCoordinate Model Generation• Rigid body fitting, multiple models (Chimera)

• DNA helical path adjusted around -35 element (3DNA)

• Unified RNAP homology model created (Modeller)

• Domain-wise fitting (Yup.scx, improved overall map-model correlation coefficient from 0.77 to 0.85)

• Geometry regularization (phenix.pdbtools)

Coordinate Model QualityCoordinate Model Quality

Phenix.pdbtools geometry regularization:

• No close contacts• RMSD bonds 0.005 Å• RMSD angles 0.8 degrees• Unrealistic phi-psi angles:

500/4000 residues (12%)

“the value of such a reconstruction is … in having a model for E. coli RNAP (which contains significant differences from the thermophilic enzymes) and in providing a framework for testing positions/interactions involving parts of the complex that have not been available previously. “

Reviewer CommentReviewer Comment

component Avg. map value at fitted atoms

EOTEST mapsShift (Å)

EOTEST mapsRotation(°)

CAP dimer 3.3 1.4 2.9

Tth RNAP 6.0 0.1 0.3

RNAP α2NTD dimer

7.0 0.2 2.8

RNAP σ70 region 1.2-2

5.8 0.9 6.7

RNAP β’ GNCD 3.3 n.a. n.a.

Fitting StatisticsFitting Statistics

Euler Frequency Distribution Euler Frequency Distribution